Loop-Mediated Isothermal Amplification Integratedon Microfluidic Chips for Point-of-Care QuantitativeDetection of Pathogens

Xueen Fang,†,‡ Yingyi Liu,‡ Jilie Kong,*,† and Xingyu Jiang*,‡

Department of Chemistry and Institutes of Biomedical Sciences, Fudan University, Shanghai 200433, P.R. China, andCAS Key Lab for Biological Effects of Nanomaterials and Nanosafety, National Center for Nanoscience andTechnology, Beijing 100190, P.R. China

This work shows that loop-mediated isothermal amplifica-tion (LAMP) of nucleic acid can be integrated in an eight-channel microfluidic chip for readout either by the nakedeye (as a result of the insoluble byproduct pyrophosphategenerating during LAMP amplification) or via absorbancemeasured by an optic sensor; we call this system micro-LAMP (µLAMP). It is capable of analyzing target nucleicacids quantitatively with high sensitivity and specificity.The assay is straightforward in manipulation. It requiresa sample volume of 0.4 µL and is complete within 1 h.The sensitivity of the assay is comparable to standardmethods, where 10 fg of DNA sample could be detectedunder isothermal conditions (63 °C). A real time quan-titative µLAMP assay using absorbance detection is pos-sible by integration of optical fibers within the chip.

Pseudorabies virus (PRV) is the main pathogen of pseudora-bies, which would infect pigs with high mortality. Effective PRVdetection is very important in the surveillance and control of theacute infectious disease. Traditional methods for PRV detectionincludes virus isolation, immunohistological assays, and variouspolymerase chain reactions (PCRs), which either consume unac-ceptably long time or demand sophisticated instruments forroutine and large-scale assays or point-of-care detection.

Loop-mediated isothermal amplification (LAMP) is a methodfor the amplification of nucleic acids, which amplifies DNA/RNAunder isothermal conditions (60-65 °C) with high specificity andsensitivity using a set of six specially designed primers and a BstDNA polymerase.1 Without the need to accurately toggle thereaction mixture between different temperatures normally re-quired for PCR, LAMP is a powerful tool for nucleic acidamplification and it has already been used widely in pathogendetection, such as human immunodeficiency virus (HIV),2 severeacute respiratory syndrome coronavirus (SARS-CoV),3 hepatitis

B virus (HBV),4 H5 avian influenza virus,5 and so forth. AlthoughLAMP is more convenient and effective than technologies basedon pathogen isolation, immunoassays, and PCRs, most of themethods for monitoring the process of LAMP are performed inmacroscale tubes, often requiring at least tens to hundreds ofmicroliters of solutions in polypropylene tubes, which severelylimits the throughput/miniaturization of LAMP and the incorpora-tion of LAMP into automated and integrated diagnostic systems.

Recent developments in microfluidics technology have enabledapplications related to lab-on-a-chip or micrototal analysis systems.They allow the manipulation of small volumes of liquids inmicrofabricated channels and in some cases microchannels toperform all analytical steps including sample pretreatment, reac-tion, separation, and detection on a small chip in an effective andautomatic format.6-8 Microfluidics has been applied in manybiological assays, such as electrophoresis,9 immunoassays,10-14

nucleic acid amplification analysis,15-17 cell manipulations18-21 and

* To whom correspondence should be addressed. E-mail: xingyujiang@nanoctr.cn (X.J.); jlkong@fudan.edu.cn (J.K.).

† Fudan University.‡ National Center for Nanoscience and Technology.

(1) Notomi, T.; Okayama, H.; Masubuchi, H. Nucleic Acids Res. 2000, 28, E63.(2) Curtis, K. A.; Rudolph, D. L.; Owen, S. M. J. Virol. Methods 2008, 151,

264–270.(3) Hong, T. C.; Mai, Q. L.; Cuong, D. V. J. Clin. Microbiol. 2004, 4, 1956–

1961.

(4) Cai, T.; Lou, G. Q.; Yang, J.; Xu, D.; Meng, Z. H. J. Clin.Virol. 2008, 41,270–276.

(5) Imai, M.; Ninomiya, A.; Minekawa, H.; Notomi, T.; Ishizaki, T.; Tashiro,M.; Odagiri, T. Vaccine 2006, 24, 6679–6682.

(6) Zheng, B.; Ismagilov, R. F. Angew. Chem., Int. Ed. 2005, 44, 2520–2523.(7) Whitesides, G. M. Nature 2006, 442, 368–373.(8) Wang, J. B.; Zhou, Y.; Qiu, H. W.; Huang, H.; Sun, C. H.; Xi, J. Z.; Huang,

Y. Y. Lab Chip 2009, 9, 1831–1835.(9) Manz, A.; Harrison, D. J.; Verpoorte, E. M. J.; Fettinger, J. C.; Paulus, A.;

Ludi, H.; Wider, H. M. J. Chromatogr. 1992, 593, 253–258.(10) Jiang, X. Y.; Ng, J. M. K.; Stroock, A. D.; Dertinger, S. K. W.; Whitesides,

G. M. J. Am. Chem. Soc. 2003, 125, 5294–5295.(11) Yang, D. Y.; Niu, X.; Liu, Y. Y.; Wang, Y.; Gu, X.; Song, L. S.; Zhao, R.; Ma,

L. Y.; Shao, Y. M.; Jiang, X. Y. Adv. Mater. 2008, 20, 4770–4775.(12) Liu, Y. Y.; Yang, D. Y.; Yu, T.; Jiang, X. Y. Electrophoresis 2009, 30, 3269–

3275.(13) Shi, M. H.; Peng, Y. Y.; Zhou, J.; Liu, B. H.; Huang, Y. P.; Kong, J. L. Biosens.

Bioelectron. 2007, 22, 2841–2847.(14) Chen, H.; Jiang, C. M.; Yu, C.; Zhang, S.; Liu, B. H.; Kong, J. L. Biosens.

Bioelectron. 2009, 24, 3399–3411.(15) Northrup, M. A.; Ching, M. T.; White, R. M.; Watson, R. T. Proc. Tranducers

1993, 924–926.(16) Schaerli, Y.; Wootton, R. C.; Robinson, T.; Stein, V.; Dunsby, C.; Neil,

M. A. A.; French, P. M. W.; deMello, A. J.; Abell, C.; Hollfelder, F. Anal.Chem. 2009, 81, 302–306.

(17) Huang, Y. Y.; Castrataro, P.; Lee, C. C.; Quake, S. R. Lab Chip 2007, 7,24–26.

(18) Sun, Y.; Liu, Y. Y.; Qu, W. S.; Jiang, X. Y. Anal. Chim. Acta 2009, 650,98–105.

(19) Chen, Z. L.; Li, Y.; Liu, W. W.; Zhang, D. Z.; Zhao, Y. Y.; Yuan, B.; Jiang,X. Y. Angew. Chem., Int. Ed. 2009, 48, 8303–8305.

(20) Chen, Z.; Xie, S. B.; Shen, L.; Du, Y.; He, S. I.; Li, Q.; Liang, Z. W.; Meng,X.; Li, B.; Xu, X. D.; Ma, H. W.; Huang, Y. Y.; Shao, Y. H. Analyst 2008,133, 1221–1228.

Anal. Chem. 2010, 82, 3002–3006

10.1021/ac1000652 2010 American Chemical Society3002 Analytical Chemistry, Vol. 82, No. 7, April 1, 2010Published on Web 03/10/2010

so forth. Among these assays, nucleic acid amplification-basedmicrofluidics is an active research area. Combination of LAMPand microfluidic technology will miniaturize the LAMP detectionsystem and facilitate the realization of point-of-care (POC) patho-gen detection.

In this study, we integrate the LAMP on a microfluidic chip,which we call microLAMP (µLAMP) to quantitatively detect targetnucleic acids with high sensitivity, specificity, and rapidity. Thisdevice potentially enables LAMP assays to be highly portable foron-site analysis.

MATERIALS AND METHODSMaterials. Pseudorabies virus (PRV) derived from cell culture

was provided by the Shanghai Entry-Exit Inspection and Quar-antine Bureau (SHCIQ). Total PRV genomic DNA used as thepositive model was extracted using the QlAamp DNA Blood MiniKit (Qiagen GmbH, Germany). This virus was used as the modelfor the development of the µLAMP assay for the following reasons:(1) as a real world virus, this model is more complex andchallenging than a synthetic sequence of nucleic acids and (2)the surveillance of PRV is particularly important in countries (e.g.,China) where pork is the predominant source of meat.

Microfluidic Chip Design and Fabrication. A poly(dimeth-ylsiloxane) (PDMS) master with positive surface patterns wasmolded against a 60 mm × 60 mm poly(methyl methacrylate)(PMMA) glass fabricated by mechanical microfabrication. ThePDMS replica was produced by soft lithography as the following:19 The PDMS precursor mixture prepared at a weight ratio ofbase to curing agent of 10:1 was poured carefully on the master,placed under vacuum for ∼0.5 h to rid the bubbles, and cured at80 °C for 2 h. The cured PDMS replica was gently peeled off themaster, and the conically shaped inlet/outlet was drilled manuallyusing a knife. (This kind of inlet/outlet was necessary for the con-venient and accurate addition of the DNA sample and at the sametime making the capillary force available to transport the LAMPreaction mixture into microchannel.) Finally, the replica wasirreversibly sealed with a microscope glass slide by an O2 plasmato form a leak-proof µLAMP microchannel. The final dimensionof the microchannel is 1 mm × 0.8 mm × 0.6 mm with a volumeof ∼5 µL.

Setup for Real-Time Quantitative Analysis. A detectionlength of 1.2 mm was used in the real-time turbidity absorbancedetection system while the volume of the microchannel remainedto be 5 µL. The optical detection unit including optical fibers (FU-76F, Keyence Corporation, Osaka, Japan) and digital fiber opticsensor (FS-V31M, Keyence Corporation, Osaka) were applied inour system. The fiber optic sensor employs a high-intensity redlight-emitting diode (LED) light at 640 nm and a phototransistor.The launching and collecting optical fibers with a 265 µm diametercore and 400 µm diameter cladding were inserted carefully intothe fiber channels that oppose each other. The reduction of opticaldensity was used to indicate the turbidity generation of the LAMPreaction:22,23

optical density ) ln(I0/I1) = turbidity

where I0 is the intensity of incident light and I1 is the intensityof transmitted light. Serial dilutions (10-fold) of PRV DNAranging from 105 to 10 fg/µL were used as templates to evaluatethe dynamics of LAMP amplification in microfluidic chips andestablish standard curves for quantitative analysis.

LAMP Amplification. The LAMP reaction was performedaccording to our previous work with minor modification.24 Thewhole volume of the system was 5 µL, which contained 1×ThermoPol buffer (New England Biolabs Inc.), 8.0 mM MgSO4,0.8 M betaine (Sigma, Germany), 1.0 mM dNTPs (Invitrogen),0.2 µM each of the outer primer (F3, CGCCTTCCTGCAC-TACG; B3, AGCGGGCCGTTGAAGA), 1.6 µM each of innerprimer (FIP, AGAGGTGCACGGGGTAGAGCGGGCACGGT-GTCCATC AA; BIP, GGACGTCAACCGGCTCGTGG CGCGGG-TACACAAACTCCT), and 0.8 µM each of loop primer (LF,ACGCGCCACGCCTCGTGC; LB, CGACCCCTTCAACG CCAA),0.32 U/µL of Bst polymerase (large fragment; New EnglandBiolabs Inc.) with 0.4 µL of nucleic acid sample as a template.The amplification was performed at 63 °C in a laboratory waterbath for 1 h. The detection result was determined directly bythe naked eye or a fiber optic sensor according to the turbidityof the solution during LAMP amplification, which was thenconfirmed by agarose gel electrophoresis and restrictiondigestion with the Hinc II enzyme.

Integrated Microfluidic LAMP Chip Operation. A samplecontaining 0.4 µL of nucleic acid was first introduced via the inlet.A reaction mixture for LAMP (prepared manually according tothe system above) of 4.6 µL was drawn slowly into the micro-channel by capillary force. The inlet and outlet were tightly sealedby uncured PDMS to form an integral microchamber for LAMPreaction. The whole microfluidic chip was incubated at 63 °C for1 h using a water bath. The final results were analyzed by thenaked eye or optical absorbance and confirmed by agarose gelelectrophoresis. The presence of 0.1% Triton X-100 in the reactionmixture and the hydrophilicity of the PDMS replica (as a resultof O2 plasma treatment) could help completely fill the micro-chamber without trapped air.25

RESULTS AND DISCUSSIONFabrication of Microchips for µLAMP. We constructed a

PDMS-glass hybrid microfluidic chip with eight 5 µL microchan-nels (Figure 1). The microfluidic chip is easy to fabricate withoutusing any precise valves or pumps. The LAMP reaction andreadout could be simultaneously performed on the microchip. Weprevented typical problems associated with the failure of DNAamplification in microchannels, such as bubble generation, reagentevaporation, cross contamination, by completely filling and sealingthe microchamber with uncured PDMS in the conically shapedinlet/outlet while taking care to prevent entrapped gas. Thismethod precludes any of the frequently encountered problemsreported by researchers designing nucleic amplification micro-channels.26 These advantages of µLAMP are most likely due to(21) Gomez-Sjoberg, R.; Leyrat, A. A.; Pirone, D. M.; Chen, C. S.; Quake, S. R.

Anal. Chem. 2007, 79, 8557–8563.(22) Mori, Y.; Kitao, M.; Tomita, N.; Notomi, T. J. Biochem. Biophys. Methods

2004, 59, 145–157.(23) Lee, S. Y.; Huang, J. G.; Chuang, T. L.; Sheu, J. C.; Chuan, Y. K.; Holl, M.;

Meldrum, D. R.; Lee, C. N.; Lin, C. W. Sens. Actuators, B 2008, 133, 493–501.

(24) Fang, X. E.; Xiong, W.; Li, J.; Chen, Q. J. Virol. Methods 2008, 151, 35–39.(25) Ramalingam, N.; San, T. C.; Kai, T. J.; Mak, M. Y. M.; Gong, H. Q.

Microfluid. Nanofluid. 2009, 7, 325–336.(26) Shin, Y. S.; Cho, K.; Lim, S. H.; Chung, S.; Park, S. J.; Chung, C.; Han,

D. C.; Chang, J. K. J. Micromech. Microeng. 2003, 13, 768–774.

3003Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

the fact that µLAMP does not require changes in temperature, aprotocol that may bring about problems such as bubble generationin PDMS. In this respect, µLAMP is particularly compatible withPDMS.

As an isothermal DNA amplification device, our µLAMP chipdid not require a precise thermal cycling module. A water bathor heat block alone was sufficient for performing the µLAMP,which would be more acceptable in resource-poor settings.

Sensitivity and Specificity of the µLAMP. During LAMPamplification, a large amount of byproduct, a white precipitate ofmagnesium pyrophosphate, appears, leading to a turbid reactionmixture, which could be directly observed by the naked eye.27 Weincorporated this visual detection method in the µLAMP system.Such visual detection often suffers from low sensitivity in microchan-nels because of the short optical length. Lee et al. demonstrated thenecessity of at least a volume of 25 µL in the microchamber for theturbidity detection. Zhang et al. presented a 10 µL volume LAMPmicrochamber for visual determination.28 In our system, we designedan optical length of 800 µm for turbidity detection of µLAMP whilethe reaction volume was reduced to 5 µL. The sensitivity of theµLAMP was evaluated by the naked eye visual analysis and standardagarose gel electrophoresis using a series of PRV DNA dilutions(10-2 to 10-8) as templates (original concentration of DNA samplewas 10 ng/µL). We observed that the detection limit of the assaywas 10 fg of DNA, 100-1000-fold more sensitive than the standardPCRs for PRV detection (Figure 2).24 The high sensitivity of oursystem was possibly attributable to the merits of Bst polymerase andloop-mediated mechanism of the amplification.1 Otherwise, theturbidity in the microchannels did not decrease simultaneously withreduction of the initial DNA copies, which made the naked eyedetection more powerful and effective (Figure 2A).

To demonstrate the specificity of µLAMP, we applied a Hinc IIrestriction enzyme digestion assay.24 Products of a band of predict-able size of ∼108 bp were resolved on the gel after the Hinc IIenzyme digestion assay, demonstrating that the target region of thenucleic acid was amplified specifically (Figure 3B, lane 2). To validatethe specificity of µLAMP for PRV, we used viruses not targeted bythe LAMP primers, namely, foot-and-mouth disease virus (FMDV),transmissible gastroenteritis of swine virus (TGEV), and porcineparvovirus (PPV) as control experiments. The result shows thatµLAMP is highly specific and does not bring about cross-reactionfrom nontargeted viruses (Figure 3A). Moreover, the specificity ofLAMP can be confirmed by the ladderlike pattern observed in gelelectrophoresis (Figure 3B, lane 1).1,27

Because of the very weak turbid signal of LAMP in thetraditional PCR tube, many groups have developed other detectionmethods in recent years, such as various DNA staining methods,fluorescent LAMP primers,30 fluorescent metal indicators,31 andso forth. These methods typically rely on either complex equip-ment or sophisticated chemical synthesis. We can, however, easilyobserve the turbidity in the microchamber with the naked eyealone, which makes µLAMP suitable for integration into complexsystems designed to be in a lab-on-a-chip format without havingto resort to bulky equipments required in many complex methods.We ascribe the strong turbid signal in the microchamber to itslarger depth-to-width ratio (DWR of the microchamber in ourµLAMP and a typical PCR tube was 1.33 and 1.00, respectively).

In a word, the µLAMP established in our study using the directnaked eye detection was highly sensitive, specific, and could be(27) Mori, Y.; Nagamine, K.; Tomita, N.; Notomi, T. Biochem. Biophys. Res.

Commun. 2001, 289, 150–154.(28) Hataoka, Y.; Zhang, L. H.; Mori, Y.; Tomita, N.; Notomi, T.; Baba, Y. Anal.

Chem. 2004, 76, 3689–3693.(29) Vanoirschot, J. T. J. Clin. Microbiol. 1991, 5–9.

(30) Mori, Y.; Hirano, T.; Notomi, T. BMC Biotechnol. 2006, 6, 3.(31) Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Nat. Protoc. 2008, 3, 877–

882.

Figure 1. Eight-channel PDMS-glass hybrid microfluidic chip for LAMP: (A) photograph and (B) schematic drawing of an eight-channelPDMS-glass hybrid microfluidic chip.

Figure 2. Sensitivity of the µLAMP: (A) direct naked eye detection.Channels 1-5 show the white precipitate (channels appear white),while channels 6-8 do not (channels appear dark). (B) Sensitivity ofthe LAMP determined by standard agarose gel electrophoresis. (1-7)DNA sample located at 10-2 (105 fg/µL), 10-3 (104 fg/µL), . . . 0.10-7

(0.1 fg/µL) dilutions, respectively, and (8) negative control.

Figure 3. The specificity of the µLAMP: (A) specificity of the µLAMPdetermined by nontargetted viruses; (1-5) PRV, FMDV, TGEV, PPV,and negative control, respectively. (B) The specific amplificationconfirmed by the Hinc II enzyme; (M) DL2000 DNA marker, (1)ladderlike bands of µLAMP, (2) product of a band of predictable sizeof ∼108 bp determined by the Hinc II assay, (3) negative control.

3004 Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

conducted together with the amplification in one step withoutusing any detection reagents or equipment. The notable meritsof the µLAMP were compared with other methods, includingpolymerase chain reaction (PCR), enzyme-linked immunosorbantassay (ELISA), and direct virus isolation assay, which weredemonstrated in Table 1. We believe that this method has greatpotential for developing point-of-care devices.

µLAMP for Quantitative Analysis. To further show thatµLAMP can be easily expanded for more sophisticated assays,we demonstrate that the µLAMP system could also be appliedfor the quantitative analysis via measuring the absorbance of thereaction mixture. Absorbance assay is a flexible and robusttechnology commonly used in microfluidic chips.32 Because ofthe generation of turbidity in LAMP reaction, we performed theturbidity absorbance detection by integrating optical fibers in themicrofluidic chip to realize real-time monitoring of the LAMPprocess and its quantitative analysis. We applied a single channeloptical detection module with a 1.2 mm detection length to developthe quantitative µLAMP (Figure 4).

We obtained values of threshold time (Tt, defined as thereaction time necessary for samples to reach sufficiently positivesignals above the baseline during real-time amplification) ofµLAMP by measuring absorbance. LAMPs from different initialconcentrations of DNA template had different values of Tt, whichcan be related to the initial DNA concentration. Tt could beobtained by monitoring absorbance, which changes in real timeas a result of the accumulation of precipitates.22 We used serialdilutions (10-fold) of DNA templates from 105 to 10 fg/µL togenerate standard dynamic curves by the optical µLAMP chipsystem and corresponding Tt values (Figure 5 A). The log linearregression plot between template concentration and Tt shows acorrelation coefficient of 0.9894, making the fiber optical µLAMPchip useful for quantitative DNA analysis (Figure 5 B).

From the results shown in Figure 5, The LAMP amplificationfrom the lowest sample concentration (10 fg/µL DNA) initiated apositive response at 46 min and then proceeded rapidly at anapproximate exponential rate, reaching a maximum at 50 min.Experiments with high initial DNA concentrations exhibited fastpositive responses in reaching the maximum. All curves decreasedslightly after the maximum time. We attribute this observation tothe following reasons: (1) precipitation and aggregation ofmagnesium pyrophosphate and (2) adsorption of pyrophosphateson the microchannel surface. This decay in turbidity absorbancedoes not affect the accuracy of the quantitative analysis becauseof the prominence of the emergence of the Tt.

Compared with other known methods for detecting viruses,µLAMP is relatively fast, and virus isolation33 and immunohisto-logical methods34 for detecting PRV are both time-consuming,requiring at least 2-3 days, while PCR assays also required 2-3h to finish the amplification.35-37 By contrast, in our system,LAMPs from detectable DNA samples could all be accomplishedwithin 60 min (with higher concentrations of samples requiringeven less time, see Figure 5. This time was comparably shortamong various methods. The whole diagnostic process from thesample arrival to the final result readout could be accomplishedwithin less than 2 h.

Although fluctuations could not be avoided between runs inthis homemade single channel optical detection system, theemergence of new technologies, such as integrated opticalwaveguides in microfluidics or optofluidics, may bring us the hope

(32) Myers, F. B.; Lee, L. P. Lab Chip 2008, 8, 2015–2031.(33) Pensaert, M. B.; Kluge, J. P. In Virus Infections of Porcines; Pensaert, M. B.,

Ed.; Elsevier: Amsterdam, The Netherlands, 1989; pp 39-65.(34) Ducatelle, R.; Coussement, W.; Hoorens, J. Res. Vet. Sci. 1982, 32, 294–

302.(35) Osorio, F. A. In First International Symposium on the Eradication of

Pseudorabies Aujeszky’s Disease Virus; Morrison, R. B., Ed.; Elsevier: SaintPaul, MN 1991; pp 17-32.

(36) Balasch, M. J.; Segale, P. J. Vet. Microbiol. 1998, 60, 99–106.(37) Lee, C. S.; Moon, H. J.; Yang, J. S. J. Virol. Methods 2007, 139, 39–43.

Table 1. Merits of µLAMP Compared with OtherTechniques

methods sensitivity specificity sample time equipmentµLAMP 10 fg/µL high 0.4 µL 0.5-1 h water bathPCR24 103 fg/µL high 2 µL 1.5-2 h thermocyclerELISA29 ∼103 fg/µL low 2 µL 2-3 h ELISA readerneutralization29,32,33 low high ∼50 µL 3 days biosafety lab

Figure 4. Photograph (A) and schematic illustration (B) of thequantitative analysis unit.

Figure 5. Results from the optical absorbance assay: dynamiccurves (A) and standard curve (B) of the real-time absorbancedetection of the LAMP chip.

3005Analytical Chemistry, Vol. 82, No. 7, April 1, 2010

in realizing multichannel detection, which may achieve increas-ingly accurate real-time quantitative analysis in one experiment.38,39

The combination of the turbidity-based readout of LAMP and theoptical fiber incorporation in the microfluidic chip would be anattractive area and bring us a fascinating future to achieve a POCquantitative nucleic acid analytical device which could be used tosurvey and combat epidemics, such as SARS, tuberculosis, orinfluenza A (H1N1) and so forth.

CONCLUSIONSIn this study, we integrated an isothermal DNA amplification,

LAMP, on a microfluidic chip and fabricated a multichannelmicrofluidic system for parallel detection of pathogens. Thereadout could either be a naked-eye determination or a compactreal-time absorbance detection device. The µLAMP presented hereallows the direct analysis of a sample of 0.4 µL of interested DNAin less than 1 h with a detection limit of 10 fg/µL.

The combination of LAMP and microfluidics will performdiagnostics in a parallel, multiple, high-throughput, and integratedformat. The technology presented here will eventually facilitatethe realization of POC devices that can be used anywhere, byanyone to assay for agents that are associated with epidemics.

ACKNOWLEDGMENTWe are grateful for the kind help from the colleagues in our

groups, particularly Wanshun Ma for his help in chip fabricationand Wenying Pan, Bo Yuan, and Yi Zhang for their assistance inimage illustration. We thank Dr. Hui Chen for her helpful advicein the manuscript revision. We acknowledge the National ScienceFoundation of China (2Grants 0945001, 20890020, 20890022,2009ZX10605, and 90813032), the Human Frontier Science Pro-gram, the Chinese Academy of Sciences (Grant KJCX2-YW-M15),and the Ministry of Science & Technology (Grants 2007CB714502,2009CB930001, and 2009ZX10004-505) for financial support.

Received for review January 9, 2010. Accepted March 3,2010.

AC1000652

(38) Balslev, S.; Jorgensen, A. M.; Bilenberg, B.; Mogensen, K. B.; Snakenborg,D.; Geschke, O.; Kutter, J. P.; Kristensen, A. Lab Chip 2006, 6, 213–217.

(39) Keea, J. S.; Poenarb, D. P.; Neuzil, P.; Yobas, L. Sens. Actuators, B 2008,134, 532–538.

3006 Analytical Chemistry, Vol. 82, No. 7, April 1, 2010