1915

Abstract. – OBJECTIVE: miR-630 has been reported as a tumor suppressor or tumor pro-moter in various types of cancer. However, the effect of miR-630 in osteosarcoma (OS) has not been investigated. The purpose of this study was to investigate the expression patterns, clin-ical value, and functional role of miR-630 in OS.

PATIENTS AND METHODS: miR-630 levels in 147 paired OS tissues and corresponding nor-mal bone tissues were investigated by RT-PCR. The clinical data were interpreted by chi-square test, Kaplan-Meier analysis, univariate analy-sis, and multivariate analysis. The functional role of miR-630 was verified using cell experi-ments. The regulation of Proteasome 26S sub-unit ATPase 2 (PSMC2) by miR-630 was detected by Western blotting, dual luciferase reporter as-says and rescue experiments.

RESULTS: We found that miR-630 expression was decreased in OS tissues and cell lines. A low level of miR-630 was associated with advanced clinical stage and distant metastasis. Clinical as-say indicated that downregulation of miR-630 strongly correlated with poor prognosis and was an independent prognostic indicator for overall survival of OS patients. Functional investigation showed that miR-630 overexpression inhibited cell growth, colony formation, migration, inva-sion and EMT pathway, and promoted apoptosis in OS. Mechanistically, miR-630 was identified as direct targets of miR-630 and its overexpression significantly suppressed the levels of PSMC2. In addition, overexpression of PSMC2 recuperated the effects of miR-630 overexpression.

CONCLUSIONS: Our data indicated that miR-630 targets PSMC2 in OS and inhibited OS cell pro-liferation, which may offer a new mechanism un-derlying the development and progression of OS.

Key Words:miR-630, PSMC2, Osteosarcoma, Proliferation, Me-

tastasis, Prognosis.

Introduction

Osteosarcoma (OS) is the most common pri-mary malignant bone tumor, which is prevalent in teenagers and young adults1. The incidence of OS was the highest in people aged between 10 and 20 years old2. The major treatment for these OS adolescents is combined limb-salvage surgery and neo-adjuvant chemotherapy, which results in that the 5-year survival for OS patients has increased to 60-70%3,4. Unfortunately, the prog-nosis of some OS patients is extremely poor due to its metastatic disseminations, especially the lung5,6. To date, the mechanisms underlying OS carcinogenesis and progression remain poorly un-derstood. Therefore, the molecular pathogenesis of OS needs to be explored; such understanding may help explore novel biomarkers for develop-ing target therapy. MiRNAs are a class of small non-coding RNAs of 20-22 nucleotides that si-lence gene expression usually by interfering with mRNA stability or protein translation7. Growing studies show that miRNAs can be key players in diverse physiological and pathological processes, such as embryonic development, tumorigenesis, metastasis, metabolism and apoptosis8,9. Espe-cially, accumulating evidence has shown that miRNAs can act either as oncogenes or as tumor suppressors in tumors, including OS10,11. Recent-ly, there is also increasing evidence that miRNA expression profiles may be indicative of disease risk and burden12,13. Thus, dysregulation of miR-NAs has great potential to be used as novel clin-ical biomarkers for OS patients. Although more and more miRNAs have been identified, there are a large number of miRNAs which remain to be elucidated14. MiR-630, a newly identified miR-

European Review for Medical and Pharmacological Sciences 2019; 23: 1915-1925

G.-W. LI1, X. YAN2

1Department of Spine Surgery, the First Affiliated Hospital of Jinzhou Medical University, Jinzhou, Liaoning, China2Respiration Medicine, the First Affiliated Hospital of Jinzhou Medical University, Jinzhou, Liaoning, China

Corresponding Author: Xue Yan, MD; email: yx9971463@163.com

Lower miR-630 expression predicts poor prognosis of osteosarcoma and promotes cell proliferation, migration and invasion by targeting PSMC2

G.-W. Li, X. Yan

1916

NA and a tumor-related regulator, has been re-ported to be dysregulated in several tumors and play an important role in regulating tumor cells proliferation and metastasis15-17. However, to our best knowledge, the expression pattern, biologi-cal function and potential mechanism of miR-630 in OS progression have not been investigated. In this study, we discovered that miR-630 expression was significantly down-regulated in OS and asso-ciated with prognosis of OS patients. Then, it was observed that miR-630 functioned as a novel sup-pressor in tumor proliferation, metastasis and the EMT process in OS by targeting PSMC2, which has been confirmed to be a tumor promoter in several tumors, including OS.

Patients and Methods

Patients and Tissue SamplesSurgically resected OS tissue samples and

paired corresponding non-cancerous bone tissues were collected from 147 patients with primary OS at the First Affiliated Hospital of Jinzhou Medical University from February 2010 to March 2012. All participants enrolled in this study signed in-formed consents, which were reviewed and ap-proved by the Medical Ethics Committee of the First Affiliated Hospital of Jinzhou Medical Uni-versity. The patients’ clinical features were list-ed in Table II. The patients did not receive any perioperative radiotherapy or chemotherapy be-fore surgery. All clinical samples were immedi-ately frozen in liquid nitrogen and stored at -80°C for further experiments.

Cell Lines and Cell CultureHuman OS cell lines (Saos-2, U2OS, MG63 and

HOS) were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Xuhui, Shanghai, China). The osteoblast hFOB1.19 was purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). RPMI-1640 medium (BasalMedia Technologies, Pudong, Shanghai, China) was used to culture the cells. Be-sides, 10% fetal bovine serum (FBS, Life Technolo-gies, Carlsbad, CA, USA) as well as antibiotics (100 microg/mL streptomycin and 100 Ul/mL penicillin) were added into the cell culture medium and the cells were at 37˚C with 5% CO2.

Cell Transfection Cell transfection was conducted using Lipo-

fectamine 3000 reagent (Invitrogen Co., Carls-

bad, CA, USA) according to the manufacturer’s instructions. Briefly, the cells (1 × 105 cells per well) were seeded into 12-well plates (Excell Bio, Taicang, Jiangsu, China) and maintained until the cell confluence reached 70%. Then, appropriate concentration of miRNA mimic or plasmid was mixed with Lipofectamine 3000 reagent in the Opti-MEM (Invitrogen Co., Carlsbad, CA, USA). After 24 h incubation, the medium was changed and the cells were used for further experiments. The miRNA mimics (NC mimic or miR-630 mimic) were purchased from Generay Biotech Co., Ltd. (Songjiang, Shanghai, China). The PSMC2 overexpression plasmid, pcDNA3.1-PS-MC2 was constructed by Vigene Biosciences Co., Ltd. (Jinan, Shandong, China).

Reverse Transcription-Quantitative Polymerase Chain Reaction (qRT-PCR)

Total RNA was extracted from cultured cells or clinical samples using Total RNA Fast Extraction Kit (BioTeke, Haidian, Beijing, China) according to the manufacturer’s protocols, and the concen-tration was determined by a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Montchanin, DE, USA). The qRT-PCR assays were performed using an ABI7500 real-time PCR instrument (ABI Co., Oyster Bay, NY, USA). The mRNA detection was conducted by the use of FastKing One Step RT-PCR Master Mix Kit, which was purchased from TIANGEN Biotech-nology Co., Ltd. (Haidian, Beijing, China). Glyc-eraldehyde-3-phosphate dehydrogenase (GAP-DH) was used as internal reference for mRNA. The miRNA was isolated using miRNA Purifi-cation Kit (Qiagen, Hilden, Germany) and detect-ed by TransScript Green miRNA Two-Step qRT-PCR SuperMix Kit which was purchased from TRANSGEN Biotechnology Co., Ltd. (Haidian, Beijing, China). The relative expression was an-alyzed using 2−∆∆Ct method. All primer sequences were listed in Table I.

Western Blot AnalysisCells were collected and lysed using radio im-

munoprecipitation assay (RIPA) buffer (Beyo-time, Pudong, Shanghai, China) containing pro-tease inhibitor cocktail (TRANSGEN Biotech, Haidian, Beijing, China). A Bicinchoninic Acid (BCA) Protein Assay Kit (BioTeke, Haidian, Bei-jing, China) were then utilized to assess the pro-tein concentration. Subsequently, equal amount of proteins was loaded onto a 10% SDS-polyacryl-amide gel and transferred onto polyvinylidene

miR-630 targeting PSMC2 in osteosarcoma

1917

difluoride (PVDF) membranes (Millipore, Biller-ica, MA, USA) using a BioRad Bis-Tris Gel sys-tem (Bio-Rad, Richmond, CA, USA) at 300 mA. After the membranes were blocked by 5% non-fat milk, they were incubated overnight with the primary antibodies against vimentin, N-Cadher-in, PSMC2 and GAPDH, at 4°C, and subsequent incubation with secondary antibodies at room temperature for 1 h. Chemiluminesence West-ern blotting reagents (Cell Signaling Technol-ogy, Danvers, MA, USA) and ECL System (GE Healthcare, Madison, WI, USA) were applied to observe the protein bands. The optical density of the protein bands was assessed by ImageJ soft-ware (version 1.8.0; NIH, Bethesda, MD, USA).

Cell Viability AssaysCells at a density of 3000 cells per well were

seeded into 96-well plates (Excell Bio, Taicang, Jiangsu, China). At indicated time points at 37°C, Cell Count Kit-8 (CCK-8) assays were conducted by adding 10 μl CCK-8 reagent (Solarbio, Tong-zhou, Beijing, China) into each well. After cultur-ing for additional 1-2 h, the absorbance at a wave-length of 450 nm was determined by a microplate reader (BioTek Instruments, Bio-Tek, Winooski, VT, USA).

Colony Formation AssayMG63 or U2OS cells (500 cells per well) trans-

fected with indicated miRNA mimics or plasmids were seeded in 6-well plates at 37°C with 5% CO2. After culturing for two weeks, the cell colonies were fixed with ethanol and stained with 0.1% crystal violet (Sigma Aldrich, Pudong, Shang-hai, China). Colonies with over 50 cells were re-corded using an inverted microscope (Carl Zeiss, Oberkochen, Germany).

Apoptosis AssayCell apoptosis were evaluated by flow cy-

tometry. In short, the collected MG63 or U2OS cells were re-suspended in 400 μl binding buffer

and subsequently incubated with 5 μl Annexin V-FITC, and 5 μl propidium iodide (PI) using Annexin V-FITC Apoptosis Detection Kit which was purchased from KeyGEN Biotechnology Co., Ltd. (Nanjing, Jiangsu, China). FACS AriaIII sys-tem (BD Biosciences, San Jose, CA, USA) was then employed to analyze the cell apoptosis.

Wound Healing AssayThe cell migration was assessed by wound

healing assays. Briefly, cell suspensions (70 μl, 2×105 cells/ml) were seeded into each chamber of the culture insert in a 35 mm high culture µ-dish (Ibidi, Martinsried, Germany). After the cell at-tachment for 24 h, the culture inserts were gently removed using sterile tweezers. Then, the photo-graphs of wounded areas were taken by an invert-ed microscope (Carl Zeiss, Oberkochen, Germa-ny) at 0 h and 24 h.

Transwell Invasion AssayTo measure cell invasion ability, the transwell

chambers (8 μm pore size; BD Biosciences, Frank-lin Lakes, NJ, USA) were firstly pre-coated with 50 μl of Matrigel (200 mg/ml; BD Biosciences, Franklin Lakes, NJ, USA). Then, cells were col-lected by trypsin digestion and re-suspended in serum-free medium. Afterwards, the cell suspen-sions (200 µl; 2.5 × 105 cells per ml) were added into the top side of the chambers, while the lower chamber was supplemented with 500 μl medium containing 10% FBS. After culturing for 24 h, the cells on the bottom surface of the membrane were fixed with 4% formaldehyde (Meilun Biotechnol-ogy, Dalian, Liaoning, China), stained with 0.5% crystal violet (Sangong, Pudong, Shanghai, Chi-na) and counted using an inverted microscope (Carl Zeiss, Oberkochen, Germany).

Dual Luciferase Reporter AssaysSequences corresponding to the 3’-untrans-

lated region (UTR) of PSMC2 mRNA and con-taining the wild-type (PSMC2 WT) or mutat-

Table I. Primer sets used in the present study.

Gene names Primer sequences (5’-3’) miR-630: Forward GTCAGCGCAGTATTCTGTACmiR-630: Reverse GTGCAGGGTCCGAGGTPSMC2: Forward GAGCACTTACTCTAGGCAGATCAPSMC2: Reverse GTACACCTGGCAACCTGTAAAGGAPDH: Forward ACAACTTTGGTATCGTGGAAGGGAPDH: Reverse GCCATCACGCCACAGTTTC

G.-W. Li, X. Yan

1918

ed (PSMC2 MUT) miR-630 binding site were synthesized by Generay Biotechnology Co., Ltd. (Songjiang, Shanghai, China). The se-quences were sub-cloned into pGL3 Basic vec-tor (Promega, Madison, WI, USA) by IGE Bio-technology Co., Ltd. (Guangzhou, Guangdong, China). After MG63 and U2OS cells were seed-ed into 24-well plates for 48 h, NC mimics or miR-630 mimics were co-transfected with 10 μg PSMC2 WT plasmids or PSMC2 WT plasmids using Lipofectamine 3000 reagent (Invitrogen Co., Carlsbad, CA, USA) according to the man-ufacturer’s instructions. Dual luciferase reporter assays were then carried out using Dual-Glo Lu-ciferase Assay System (Promega, Madison, WI, USA) according to manufacturer’s protocols.

Statistical AnalysisAll the values in this study were shown as

mean ± the standard error of the mean (SEM). Ka-plan-Meier survival and log-rank test were used for survival analysis and comparison of differenc-es in overall survival. The variables were used in multivariate analysis on the basis of the Cox pro-portional hazards model. Statistical analyses were performed with the SPSS 20.0 statistics software (SPSS, Inc., Chicago, IL, USA). The differences were evaluated by one-way ANOVA or Student’s t-test. Tukey’s post hoc test was used to validate the ANOVA for comparing measurement data be-tween groups. The difference between the groups was considered significant and very significant when p < 0.05.

Table II. Correlation between miR-630 expression and different clinicopathological features in 147 osteosarcoma patients.

miR-630 expression NumberClinicopathological features of cases Low High p-value

Age NS < 20 years 71 31 40 ≥ 20 years 76 41 35 Gender NS Female 53 21 32 Male 94 51 43 Tumor size NS < 8 cm 96 42 54 ≥ 8 cm 51 30 21 Anatomic location NS Tibia/femur 78 37 41 Elsewhere 69 35 34 Clinical stage 0.010 IIA 93 38 55 IIB/III 54 34 20 Distant metastasis 0.006 Absent 94 42 52 Present 43 30 13

Table III. Univariate and multivariate analysis of clinicopathological factors for overall survival in 147 patients with CRC.

Univariate analysis Multivariate analysis

Risk factors HR 95% CI p HR 95% CI p Age 1.542 0.569-2.311 0.156 - - -Gender 1.781 0.844-2.432 0.177 - - -Tumor size 1.478 0.659-2.784 0.114 Anatomic location 1.548 0.894-2.327 0.138 - - -Clinical stage 3.427 1.569-4.982 0.013 2.785 1.236-3.416 0.025Distant metastasis 3.895 1.674-5.655 0.004 3.237 1.238-4.678 0.009miR-630 expression 4.216 1.477-6.556 0.001 3.679 1.215-5.235 0.003

miR-630 targeting PSMC2 in osteosarcoma

1919

Results

MiR-630 Expression was Downregulated in OS Patients and Associated with Poor Prognosis

In order to explore the possible role of miR-630 in OS, we firstly detected its expression in OS patients. As shown in Figure 1A, we found that the expres-sion levels of miR-630 was significantly down-reg-ulated in OS tissues compared to matched normal bone tissues (p < 0.01). Then, we also found that miR-630 expression in four OS cell lines (Saos-2, U2OS, MG63 and HOS) was reduced compared to a normal human osteoblast cell line (hFOB1.19) (Figure 1B). Our results indicated that miR-630 may play an important role in progression of OS.

Then, in order to further explore the clinical significance of miR-630 in OS patients, OS sam-ples were classified into low miR-630 expression group (n = 72) and the high miR-630 expression group (n = 75) according to the median miR-630 expression level of all OS samples. As shown in Table II, we found that low miR-630 expression was significantly associated with clinical stage (p = 0.010) and distant metastasis (p = 0.006). However, there were no significant correlations between miR-630 expression and other clini-copathological factors of patients. Moreover, Kaplan-Meier method and log-rank test were used to evaluate differences of overall survival between low expression group and high-expres-sion group. As shown in Figure 1C, a significant difference was found that OS patients with low miR-630 expression level had distinctly shorter overall survival than patients with high miR-630 expression level (p = 0.065). Of note, mul-

tivariate analysis revealed that miR-630 expres-sion level (HR = 3.679, 95% CI: 1.215-5.235, p = 0.003) was independently associated with the overall survival (Table III). Taken together, our findings suggested miR-630 as a potential bio-marker for OS patients.

Ectopic Expression of miR-630 Inhibited the Proliferation of OS Cells and Promoted Cell Apoptosis

Considering that miR-630 was downregulated in OS tissues and closely associated with favor-able prognosis, we next aimed to investigate the biological roles of miR-630 in OS. To achieve that, miR-630 mimics were transfected into OS cell lines, MG63 and U2OS, to enhance the expres-sion of miR-630. The results of qRT-PCR anal-ysis demonstrated that miR-630 was effectively improved in MG63 and U2OS cells after they were transfected with miR-630 mimics (Figure 2A). Thereafter, CCK-8 assays were performed to evaluate the cell proliferation, and the data in-dicated that miR-630 overexpression notably in-hibited the proliferative rates of MG63 and U2OS cells (Figure 2B and C). Similarly, colony forma-tion assays also confirmed the inhibitory effect of miR-630 on MG63 and U2OS cells (Figure 2D and E). We next investigated the effects of miR-630 on the apoptosis of OS cells by the use of flow cytometry analysis. It was demonstrated that the apoptotic rates were significantly lower in miR-630 overexpression MG63 and U2OS cells than in the control cells (Figure 2F and G). Collectively, these data confirmed that overexpression of miR-630 could significantly inhibit the proliferation of OS cells and accelerate the cell apoptosis.

Figure 1. Expression levels of miR-630 in OS tissues and cell lines, and its prognostic significance. (A) Difference in expres-sion levels of miR-630 between OS tissues and matched non-tumor bone tissues. The expression of miR-630 was normalized to GADPH. (B) The expression levels of miR-630 were measured in four OS cell lines and normal osteoblast hFOB1.19. (C) Kaplan-Meier curve showed that OS patients with low miR-630 expression had a poor overall survival compared to patient with high miR-630 expression. * p < 0.05, **p < 0.01.

G.-W. Li, X. Yan

1920

Overexpression of miR-630 Impaired the Migration and Invasion of OS Cells

To evaluate whether miR-630 contributed to the progression of OS, we next examined the ef-fects of miR-630 on the migratory and invasive behaviors of MG63 and U2OS cells using wound heling and transwell invasion assays. The results of wound healing assays revealed that the up-reg-ulation of miR-630 remarkably attenuated the migratory capacities of MG63 and U2OS cells (Figure 3A and B). In addition, transwell invasion assays clearly showed that transfection of miR-630 mimics dramatically impeded the invasive abilities of MG63 and U2OS cells (Figure 3C and D). Besides, the expressing levels of epithelial to mesenchymal (EMT) markers such as N-cadherin and vimentin in MG63 and U2OS cells were fur-ther examined by Western blot assays. According to the data, enhancing expression of miR-630 re-sulted in a marked decline of the protein levels

of N-cadherin and vimentin in MG63 and U2OS cells (Figure 3E and F). Overall, our data suggest-ed that overexpression of miR-630 suppressed the migration and invasion of OS cells.

PSMC2 was a Novel Direct Target of miR-630 in OS Cells

To further ascertain the molecular mechanisms by which miR-630 exerted its tumor-suppressing roles in OS, we next employed bioinformatics analysis to predict the potential target of miR-630 using “miRDB” (http://www.mirdb.org/). The results indicated that a putative binding site for miR-630 was identified in the 3’-UTR of PSMC2 (Figure 4A). To certify whether the 3’-UTR of PSMC2 could be directly targeted by miR-630, we next performed dual luciferase reporter as-says. The data revealed that when co-transfected with PSMC2 3’-UTR wild-type (PSMC2-WT) plasmid, miR-630 resulted in a remarkable de-

Figure 2. Ectopic expression of miR-630 inhibited OS cell proliferation and invasion. (A) Relative expression levels of miR-630 in MG63 and U2OS cells transfected with negative control miRNA mimic (NC mimic) or miR-630 mimic. (B and C) The proliferation rates of MG63 and U2OS cells aseessed by CCK-8 assays. (D and E) Representative images of the colony forma-tion assays and statistical analysis of MG63 and U2OS cell colony number. (F) Flow cytometry analysis detected the apoptotic rates of MG63 and U2OS cells transfected with NC mimic or miR-630 mimic. *p < 0.05, **p < 0.01.

miR-630 targeting PSMC2 in osteosarcoma

1921

crease in the luciferase activities of MG63 and U2OS cells, whereas the luciferase activities were unaffected when the cells were co-transfected with PSMC2 3’-UTR mutant (PSMC2-MUT) plasmid as well as miR-630 mimics (Figure 4B). Furthermore, the qRT-PCR assays suggested that the expression levels of PSMC2 were dramatical-ly decreased in MG63 and U2OS cells transfect-ed miR-630 mimics (Figure 4C). Analogously, ectopic expression of miR-630 significantly re-duced the protein levels of PSMC2 in MG63 and U2OS cells (Figure 4D). Taken together, our data demonstrated that PSMC2 was directly interacted with miR-630 in OS cells.

Alteration of PSMC2 Expression Abrogated the Inhibitory Effects of miR-630 on OS Cell Proliferation and Invasion

Given the low expression levels of miR-630 in OS cells, rescue experiments were carried out by

co-transfecting the miR-630 mimics with or with-out pcDNA3.1-PSMC2 plasmid followed by deter-mination of the cell proliferation and invasion (Fig-ure 5A). CCK-8 assays validated that transfection of miR-630 mimics alone notably inhibited cell growth, while reintroduction of pcDNA3.1-PSMC2 plasmid could effectively reverse the inhibitory ef-fects of miR-630 on the proliferation of MG63 and U2OS cells (Figure 5B). Similarly, cell colony for-mation assays revealed that, restored PSMC2 ex-pression markedly rescued the suppressive effects of miR-630 on the colony formation capabilities of MG63 and U2OS cells (Figure 5C and D). In addi-tion, transwell assays suggested that the invasive cells were significantly decreased after transfect-ing miR-630 mimic, while co-transfection of pcD-NA3.1-PSMC2 plasmid and miR-630 remarkably elevated the cell number of invaded MG63 and U2OS cells (Figure 5E). In summary, these results supported that PSMC2 was a downstream func-tional effector of miR-630 in OS cells.

Figure 3. The effects of miR-630 on the migration and invasion of MG63 and U2OS cells. (A and B) The wound healing assays showed that transfection of miR-630 mimic reduced the migratory abilities of MG63 and U2OS cells. (C and D) The invasive cell numbers of MG63 and U2OS cells transfected with miR-630 mimic were significantly decreased using transwell invasion assays. (E and F) N-cadherin and vimentin in MG63 and U2OS were evaluated by Western blot assays. * p < 0.05, **p < 0.01.

G.-W. Li, X. Yan

1922

Discussion

OS remains a great challenge for clinical treat-ments. The great majority of OS patients are rep-resented by high-grade tumors with advanced phenotypes at the time of diagnosis18,19. In clinical practice, evaluation of prognosis of OS patients is very important for decision of treatment meth-ods20. Although several clinical parameters and some genes biomarkers have been used to predict the prognosis of OS patients, these systems may not be sufficient to estimate patient prognosis21,22. Recently, some functional miRNAs become ideal candidates for this problem. In this study, our at-tention focused on miR-630. By RT-PCR, it was observed that miR-630 expression was signifi-cantly down-regulated in both OS tissues and cell lines. Furthermore, by analyzing clinical data, we found that low miR-630 expression was asso-

ciated with advanced clinical stage and positive distant metastasis, suggesting that it might be involved in the carcinogenesis of OS. Moreover, according to multivariate analysis, miR-630 was an independent prognostic marker for OS. These findings indicated that miR-630 plays a key role in OS progression and may be used as a novel biomarker for OS prognosis. MiR-630 has been reported as a potential tumor suppressor, which was identified as one of the miRNAs downreg-ulated in renal cell carcinoma23, nasopharyngeal carcinoma24, colorectal cancer25 and lung can-cer26. In addition, the oncogenic role of miR-630 was also reported in several tumors. For instance, overexpression of miR-630 inhibited lung cancer proliferation by targeting CDC727. In breast can-cer, it was reported that miR-630 functioned as a tumor suppressor by directly targeting BMI128. However, Zhang et al29 reported that miR-630

Figure 4. miR-630 directly targeted PSMC2. (A) Bioinformatics tool “miRBD” predicted that PSMC2 mRNA 3’-UTR har-bored the miR-630 binding site. (B) The luciferase activities of MG63 and U2OS cells were assessed by dual-luciferase re-porter assays. (C) qRT-PCR assays were applied to evaluate the effects of miR-630 on PSMC2 mRNA expression. (D and E) Western blot assays were applied to evaluate the effects of miR-630 on PSMC2 protein expression. * p < 0.05, **p < 0.01.

miR-630 targeting PSMC2 in osteosarcoma

1923

was highly expressed in epithelial ovarian can-cer and its overexpression promoted epithelial ovarian cancer cell proliferation and migration by targeting KLF6. These results revealed that miR-630 may play a different role according to the cell situation. In this work, we investigated the effects of miR-630 on cell proliferation, me-tastasis and invasion apoptosis. It was observed that overexpression of miR-630 significantly suppressed tumor growth, migration and inva-sion, and promoted apoptosis in OS. In addition, the results of Western blot indicated that forced miR-630 expression may suppress EMT path-

way. Taken together, our study, for the first time, showed that miR-630 acted as a tumor suppres-sor in progression of OS. Proteasome 26S subunit ATPase 2 (PSMC2), located in 7q22.1-q22.3 in the genome, is a pivotal member of the 19S reg-ulatory subunit of the 26S proteasome30. Recent-ly, more and more evidences show that PSMC2 acted as functional gene in regulating tumor pro-gression31,32. Of note, recently Song et al33 firstly reported that PSMC2 was highly expressed in OS and its knockdown could suppress OS cell prolif-eration and migration, and promoted apoptosis. However, the potential mechanism underling OS

Figure 5. Overexpression of PSMC2 abrogated the tumor suppressive roles of miR-630. (A) Relative mRNA expression levels of PSMC2 in MG63 and U2OS cells transfected with NC mimic, miR-630 mimic or co-transfected with miR-630 mimic and pcD-NA3.1-PSMC2 plasmid. (B) The proliferative rates of MG63 and U2OS cells determined by CCK-8 assays. (C and D) Cell colony formation assays evaluated the alteration of clongenic abilities of MG63 and U2OS cells. (E) Representative images of the tran-swell invasion assays and statistical analysis of MG63 and U2OS cell invasive number in different groups. *p < 0.05, **p < 0.01.

G.-W. Li, X. Yan

1924

progression remains largely unclear. In this re-port, by bioinformatics analysis, we found that we identified PSMC2 as a possible target of miR-630 among the regulated genes. Further, we used series of experiments to confirm whether PSMC2 was a direct negative target gene of miR-630 in OS. By a dual-luciferase reporter assay, miR-630 was demonstrated to bind directly to the 3’-UTR of PSMC2. Furthermore, we also found that overexpression of miR-630 significantly suppress the levels of PSMC2. In addition, we observed that PSMC2 re-expression attenuates miR-630 mediated inhibition of cell proliferation, colony formation, migration and invasion in OS cells. Taken together, our findings suggested that miR-630 may suppress OS progression by targeting PSMC2. On the other hand, other target mole-cules might help miR-630 to inhibit OS cell mi-gration and PSMC2 expression.

Conclusions

To our knowledge, we presented the first ev-idence that miR-630 expression was reduced in OS cell lines and its downregulation related to poor prognosis of OS patients. Functional assay indicated that miR-630 suppresses OS growth and metastasis, at least partially through targeting PSMC2. These findings provided novel insights into understanding the molecular pathogenesis of OS and suggests.

Conflict of InterestThe Authors declare that they have no conflict of interest.

References

1) Miller KD, Siegel rl, lin CC, Mariotto aB, KraMer Jl, rowlanD JH, Stein KD, alteri r, JeMal a. Cancer treatment and survivorship statistics, 2016. CA Cancer J Clin 2016; 66: 271-289.

2) Moore DD, luu HH. Osteosarcoma. Cancer Treat Res 2014; 162: 65-92.

3) Ferrari S, Serra M. An update on chemotherapy for osteosarcoma. Expert Opin Pharmacother 2015; 16: 2727-2736.

4) ViJayaMurugan n, BaKHSHi S. Review of manage-ment issues in relapsed osteosarcoma. Expert Rev Anticancer Ther 2014; 14: 151-161.

5) luetKe a, MeyerS Pa, lewiS i, JuergenS H. Osteosar-coma treatment - where do we stand? A state of

the art review. Cancer Treat Rev 2014; 40: 523-532.

6) naValKele P, JoneS SM, JoneS JK, Salazar JD, toy PC, iyer rV, Herrington B. Osteosarcoma tumor thrombus: a case report with a review of the liter-ature. Tex Heart Inst J 2013; 40: 75-78.

7) HaMMonD SM. An overview of microRNAs. Adv Drug Deliv Rev 2015; 87: 3-14.

8) BaK ro, MiKKelSen Jg. miRNA sponges: soaking up miRNAs for regulation of gene expression. Wiley Interdiscip Rev RNA 2014; 5: 317-333.

9) ToBa H, Cortez D, linDSey Ml, CHilton rJ. Applica-tions of miRNA technology for atherosclerosis. Curr Atheroscler Rep 2014; 16: 386.

10) Xu Sy, Xu PF, gao tt. MiR-372-3p inhibits the growth and metastasis of osteosarcoma cells by targeting FXYD6. Eur Rev Med Pharmacol Sci 2018; 22: 62-69.

11) ouyang l, liu P, yang S, ye S, Xu w, liu X. A three-plas-ma miRNA signature serves as novel biomarkers for osteosarcoma. Med Oncol 2013; 30: 340.

12) li z, rana tM. Therapeutic targeting of microR-NAs: current status and future challenges. Nat Rev Drug Discov 2014; 13: 622-638.

13) DalMay t. Mechanism of miRNA-mediated re-pression of mRNA translation. Essays Biochem 2013; 54: 29-38.

14) SingH tr, guPta a, SuraVaJHala P. Challenges in the miRNA research. Int J Bioinform Res Appl 2013; 9: 576-583.

15) zHou CX, wang Cl, yu al, wang Qy, zHan Mn, tang J, gong XF, yin QQ, He M, He Jr, CHen gQ, zHao Q. MiR-630 suppresses breast cancer pro-gression by targeting metadherin. Oncotarget 2016; 7: 1288-1299.

16) Cao JX, li Sy, an gS, Mao zB, Jia Ht, ni JH. E2F1-regulated DROSHA promotes miR-630 bio-synthesis in cisplatin-exposed cancer cells. Bio-chem Biophys Res Commun 2014; 450: 470-475.

17) zHang y, liu H, li w, yu J, li J, SHen z, ye g, Qi X, li g. CircRNA_100269 is downregulated in gastric can-cer and suppresses tumor cell growth by targeting miR-630. Aging (Albany NY) 2017; 9: 1585-1594.

18) Feng D, yang X, liu t, Xiao J, wu z, Huang Q, Ma J, Huang w, zHeng w, Cui z, Xu H, teng y. Os-teosarcoma of the spine: surgical treatment and outcomes. World J Surg Oncol 2013; 11: 89.

19) Meazza C, SCanagatta P. Metastatic osteosarco-ma: a challenging multidisciplinary treatment. Expert Rev Anticancer Ther 2016; 16: 543-556.

20) Hattinger CM, Fanelli M, taVanti e, Vella S, Ferrari S, PiCCi P, Serra M. Advances in emerging drugs for osteosarcoma. Expert Opin Emerg Drugs 2015; 20: 495-514.

21) li C, Cong y, liu X, zHou X, zHou g, lu M, SHi X, wu S. The progress of molecular diagnostics of osteosarcoma. Front Biosci (Landmark Ed) 2016; 21: 20-30.

22) ClarK JC, DaSS Cr, CHoong PF. A review of clin-ical and molecular prognostic factors in osteo-

miR-630 targeting PSMC2 in osteosarcoma

1925

sarcoma. J Cancer Res Clin Oncol 2008; 134: 281-297.

23) zHao JJ, CHen PJ, Duan rQ, li KJ, wang yz, li y. miR-630 functions as a tumor oncogene in renal cell carcinoma. Arch Med Sci 2016; 12: 473-478.

24) li X, lin y, yang X, wu X, He X. Long noncoding RNA H19 regulates EZH2 expression by interact-ing with miR-630 and promotes cell invasion in nasopharyngeal carcinoma. Biochem Biophys Res Commun 2016; 473: 913-919.

25) zHang y, yu J, liu H, Ma w, yan l, wang J, li g. Novel epigenetic CREB-miR-630 signaling axis regulates radiosensitivity in colorectal cancer. PLoS One 2015; 10: e0133870.

26) Song yF, Hong JF, liu Dl, lin Qa, lan XP, lai gX. miR-630 targets LMO3 to regulate cell growth and metastasis in lung cancer. Am J Transl Res 2015; 7: 1271-1279.

27) Cao JX, lu y, Qi JJ, an gS, Mao zB, Jia Ht, li Sy, ni JH. MiR-630 inhibits proliferation by targeting CDC7 kinase, but maintains the apoptotic bal-ance by targeting multiple modulators in human lung cancer A549 cells. Cell Death Dis 2014; 5: e1426.

28) gong XF, yu al, tang J, wang Cl, He Jr, CHen gQ, zHao Q, He M, zHou CX. MicroRNA-630 inhibits

breast cancer progression by directly targeting BMI1. Exp Cell Res 2018; 362: 378-385.

29) zHang S, zHang Jy, lu lJ, wang CH, wang lH. MiR-630 promotes epithelial ovarian cancer pro-liferation and invasion via targeting KLF6. Eur Rev Med Pharmacol Sci 2017; 21: 4542-4547.

30) wang X, Dong C, Sun l, zHu l, Sun C, Ma r, ning K, lu B, zHang J, Xu J. Quantitative proteomic analysis of age-related subventricular zone pro-teins associated with neurodegenerative dis-ease. Sci Rep 2016; 6: 37443.

31) DeSHPanDe r, aSieDu MK, KleBig M, Sutor S, KuzMin e, nelSon J, PiotrowSKi J, SHin SH, yoSHiDa M, CoS-tanzo M, Boone C, wigle Da, MyerS Cl. A compar-ative genomic approach for identifying synthetic lethal interactions in human cancer. Cancer Res 2013; 73: 6128-6136.

32) Cui F, wang y, wang J, wei K, Hu J, liu F, wang H, zHao X, zHang X, yang X. The up-regulation of pro-teasome subunits and lysosomal proteases in he-patocellular carcinomas of the HBx gene knockin transgenic mice. Proteomics 2006; 6: 498-504.

33) Song M, wang y, zHang z, wang S. PSMC2 is up-regulated in osteosarcoma and regulates os-teosarcoma cell proliferation, apoptosis and mi-gration. Oncotarget 2017; 8: 933-953.