LQB490 Molecular Pathology Practical Manual

.

.

Name:

Student number:

LQB490 Molecular Pathology

Practical Manual Semester 2

2021

Unit Coordinator: Daniel Wallace [email protected]

School of Biomedical Sciences

mailto:[email protected]

LQB490 – Cytogenetic & Molecular Pathology

1

Contents

Week Activities Page

8 Molecular Pathology: Hereditary Haemochromatosis Case Study 2

9 Genomic DNA extraction, quantification and quality analysis 8

10 Genotyping by real-time PCR, RFLP analysis and PCR setup for DNA sequencing

18

11 Analysis of real-time PCR results, gel of PCR, purification of PCR product and setup of BigDye® terminator reaction for Sanger sequencing

34

12 Clean up of BigDye® terminator reaction for Sanger sequencing 52

13 Analysis of patient sequence data and Hereditary Haemochromatosis case study review

55

• Molecular Pathology practical classes from Week 9 to 13 will be held in GP Q801 on Tuesdays at 9:00 and 12:30.

• Please check which classes you are enrolled in.


2

Name: ______________________________________ Student no: ___________________

BACKGROUND

Hereditary haemochromatosis (HH) is an iron overload disorder. It is one of the most

common hereditary diseases and predominantly affects people of Northern European

descent with a frequency in Australia of 1 in every 200 individuals with a carrier frequency

of between 1 in 9. It is less common in other populations. HH is an autosomal recessive

disorder of iron metabolism, characterised by increased iron absorption and deposition in

the liver, pancreas, heart, joints and pituitary gland. Symptoms of HH usually appear

between the ages 30 and 60 years.

The liver is the primary site for the storage of excess iron and is usually the first organ to be

affected. If treated early, complications improve in most patients after iron depletion. The

removal of blood by phlebotomy (also known as venesection) is the standard treatment to

remove excess iron and many patients are regular blood donors (treating themselves while

helping out others at the same time). Without treatment, the disease ultimately may lead to

severe fatigue, arthritis, cirrhosis, diabetes mellitus, hyperpigmentation of the skin,

hypopituitarism, hypogonadism, cardiomyopathy, primary liver cancer, or an increased risk

of certain bacterial infections. In severe cases, death may occur from cirrhosis, primary liver

cancer, diabetes, or cardiomyopathy.

If you are interested in learning more about the disease you can visit the Haemochromatosis

Australia website: https://haemochromatosis.org.au/

LQB490: Molecular Pathology - Hereditary

Haemochromatosis Case Study

https://haemochromatosis.org.au/


3

Which gene is involved in HH & what is the function of the ‘normal’ protein?

The HFE gene (Haemochromatosis Fe (iron)) is located on human chromosome 6 at 6p22.2,

approximately 3.8 megabases telomeric from HLA-A, and covers approximately 8 kilobases.

The HFE protein is a 343 residue type I transmembrane protein that associates with the HLA

class I light chain beta2-microglobulin. The HFE protein product binds to the transferrin

receptor on the surface of liver cells. Here it is involved in intracellular signalling - sensing

the levels of iron in the blood and regulating the production of a small peptide hormone

called hepcidin. Hepcidin then regulates the amount of iron being absorbed from the small

intestine and the amount of iron being recycled in the body. Patients with HH do not

produce enough hepcidin and this results in hyperabsorption of iron and gradual

accumulation of excess iron in the body organs, eventually causing tissue damage and the

associated clinical complications. In effect, a non-functional HFE protein in HH patients

causes their body to think that it is iron deficient when it is not and iron absorption is

inappropriately switched on.

Which mutations are associated with HH?

There are many allelic variants of the HFE gene that have been reported. Two of these

variants – p.C282Y and p.H63D are relatively common in European populations and are

significantly associated with HH.

• The p.C282Y mutation results from a guanine-to-adenine (G-to-A) transition at

nucleotide 845 of the HFE gene coding region. This missense mutation results in the

substitution of a cysteine with a tyrosine at amino acid position 282 of the protein

product. The Human Genome Variation Society (HGVS) nomenclature for this mutation

is c.845G>A (p.Cys282Tyr or p.C282Y). The p.C282Y mutation alters the HFE protein


4

structure and beta2-microglobulin association, disrupting its transport to and

presentation on the cell surface, preventing it from functioning normally.

• The p.H63D mutation results from a guanine-to-cytosine (G-to-C) transversion at

nucleotide 187 of the HFE gene coding region, causing the substitution of histidine with

aspartic acid at amino acid position 63 of the HFE protein. The HGVS nomenclature for

this mutation is c.187C>G (p.His63Asp or p.H63D). The p.H63D mutation does not

appear to prevent beta2-microglobulin association or cell surface expression, and the

protein still retains much of its functionality. As a consequence p.H63D is considered a

milder mutation than p.C282Y with a much lower penetrance. It is more prevalent than

p.C282Y in the general population but the more penetrant p.C282Y mutation is more

commonly found in HH patients. In some situations HH patients can be heterozygous for

both p.C282Y and p.H63D (known as compound heterozygosity). These cases usually

have a mild HH phenotype.

HFE genotypes: prevalence in Australia & development of HH.

Table 1: Frequencies of HFE genotypes in the Australian Population

HFE genotype Frequency

No HFE gene mutation found 2/3

Homozygous (p.C282Y) 1/200

Compound heterozygous (p.C282Y/p.H63D) 1/45

Heterozygous (p.C282Y) 1/9

Heterozygous (p.H63D) 1/4

Homozygous (p.H63D) 1/40


5

Not all persons with the homozygous p.C282Y genotype will develop HH; an estimated 40–

70% will develop clinical evidence of iron overload. Females are less likely to develop clinical

symptoms due to menstrual blood loss throughout their reproductive years. Of those

Australians who do have HH however, >95% have the homozygous p.C282Y genotype.

The risk of p.C282Y and p.H63D heterozygotes or p.H63D homozygotes developing HH is

very low; there is no need for iron status levels to be monitored in these individuals unless

they are abnormal or symptoms are present. About 1% of people with the compound

heterozygote (p.C282Y/p.H63D) genotype develop HH. In these individuals iron status

should be monitored every 2-5 yrs.

Who should be tested for HH?

HH is an autosomal recessive inheritable

disease with potentially significant health

consequences. Apart from ‘novel’ cases

(patients) with a symptomatic clinical

history, relatives of patients with

diagnosed HH should also be tested. This

is particularly important in the case of

brothers and sisters (siblings), as they

stand at least a 1 in 4 chance of being

affected.

The MBS (medical benefits scheme) covers HFE gene testing for patients with:

• Raised serum ferritin or transferrin saturation levels on more than one occasion, or

• A 1st degree relative diagnosed with HH

Early detection and treatment will prevent

virtually all the complications of the

disease.

H = haemochromatosis gene

n = normal ‘healthy’ gene


6

CASE STUDY OVERVIEW

In this project, which will span the second half of semester, the class will test four patients

for genetic abnormalities (mutations) in the Haemochromatosis gene, specifically the two

main ones associated with HH, p.C282Y and p.H63D. The clinical histories of the four

patients are provided below. As part of this project you will receive first-hand experience

with state of the art ‘real world’ clinical molecular pathology techniques and equipment.

At the end of this case study you should be able to demonstrate evidence of

• Familiarisation with the practical techniques used in clinical molecular pathology to

investigate potential genetic abnormalities.

• Understanding of the theory behind the molecular analytical processes used to

investigate clinical genetic abnormalities.

• Understanding of the basis of HH, the different genotypes associated with it and the

implications for patients and relatives with the different HFE genotypes.

Patient Clinical Histories

Patient 1 (P1)

A 54-year-old man presented to a GP with acute worsening of joint pain involving the hands

and wrists. A careful history revealed an approximately 20-year period of mild, yet slowly

progressive, multiple joint arthralgias, most notably in the fingers of both hands and in the

wrists, knees, and shoulders. The patient reported that he had previously received

intermittent treatment with over-the-counter analgesics for what he was told was “arthritis

of old age”. He also reported a history of abdominal pain and severe fatigue over the

previous 5 to 10 years. Radiographic studies and a full laboratory work up was requested.

Laboratory findings indicated elevated liver enzymes and a very high serum ferritin level

(3250 μg/L RI: 30-400) with an elevated transferrin saturation (95% RI: 15-50). The elevated

ferritin and transferrin saturation were confirmed on repeat testing one month later. The

possibility that haemochromatosis was behind his arthritis and his other symptoms was

suspected by his clinician and HFE genotyping was requested.

Patient 2 (P2)

A 36-year-old female presented to her local GP. She informed that her mother, 58, had just

been diagnosed with hereditary haemochromatosis (p.C282Y homozygote). Her previous

medical and obstetric histories were unremarkable. Full blood examination, liver function

tests and iron study results were all normal. HFE genotyping was requested due to a first

degree relative being diagnosed with HH.


7

Patient 3 (P3)

A male patient aged 35 years during a routine check-up was found to have abnormal liver

function tests: ALT (175 U/L RI:<35) and AST (69 U/L RI:<35), together with a mildly elevated

serum ferritin (454 μg/L RI: 50-400). Serum iron, TIBC and transferrin saturation were

normal. The family history was negative for haemochromatosis. The patient did not drink

alcohol but was overweight with a BMI of 32. Full blood examination was normal and viral

markers for hepatitis B and C were negative. Repeat iron studies and liver enzymes were

performed twice over the next six months with similar findings. The possibility of iron

overload was raised and genotyping for mutations in the HFE gene was requested.

Patient 4 (P4)

A male patient aged 68 years was found to have an elevated serum ferritin (725 μg/L RI: 30-

400) and transferrin saturation (71% RI: 15-50) at a routine health check up with his GP.

Repeat measures 1 month later were similar. He no longer drank alcohol but reported

being a heavy drinker when younger. He also had type 2 diabetes that was well controlled

with medication and diet. Otherwise, he was in good health. His elevated serum ferritin

and transferrin saturation on 2 occasions prompted the possibility of haemochromatosis

and HFE genotyping was requested by his GP.

Stages of the Case study

The key stages of the case study are outlined below:

1. Extraction of genomic DNA. Quantity and quality analysis (Week 9)

2. Real Time PCR analysis of the patient samples to look for the presence of the 2 common

mutations associated with HH (HFE - p.C282Y and p.H63D) (Weeks 10-11)

3. PCR amplification of the regions of the HFE gene surrounding the p.C282Y and p.H63D

mutations from patient DNA samples to prepare for DNA sequencing (Weeks 10-11)

4. DNA sequencing of PCR amplified HFE - p.C282Y and p.H63D regions to confirm patient

results from Real Time PCR (Weeks 11-12)

5. Analysis of DNA sequencing results and review of the case study – what is the outcome

of the genetic testing for Patients 1-4 and the implications of any findings for the

patients and their families. (Week 13)

In the lectures you will be provided with the foundational knowledge for all these molecular

techniques and processes.

QUT acknowledges the support of our industry colleagues at Sullivan Nicolaides Pathology (SNP) here in Brisbane who have kindly provided extracted human DNA and some of the clinical protocols that you will use in this case study.

LQB490 – Cytogenetic & Molecular Pathology – Week 9

8

Name: ______________________________________ Student no: ___________________ LEARNING OUTCOMES: By the end of the session, you should be able to:

• Perform a genomic DNA extraction

• Estimate the quality and concentration of extracted gDNA

HEALTH & SAFETY FIRST – GOOD LABORATORY PRACTICE • You will be working with chemicals and pipettes, and must wear lab coats, gloves and

safety glasses (PPE) at all times.

• Buffer G1 and Wash Buffer GW1 contain guanidine hydrochloride, a chaotropic salt,

which is a potent irritant. Harmful when in skin contact, inhaled or ingested.

• Biological material (Sheep blood) is to be handled in this practical. Plastic protective

gowns will be supplied and must be worn when working with blood.

• Human extracted DNA will be used in this practical. Please use PPE at all times.

• Safety lids must always be in place when operating centrifuges. Ensure gowns are well

away before fastening lid.

• Heating blocks at high temperatures (70°C) can cause burns, be careful when

transferring tubes to and from the heating block. Seek assistance from a demonstrator

if you have difficulty removing tubes.

To circumvent Health and Safety and ethical concerns regarding the handling of human

blood, the genomic DNA extraction from blood and subsequent DNA analysis for quality and

quantity will be conducted using sheep’s blood. The process is the same as that used for

human blood so you will still experience and appreciate all aspects of this clinical procedure.

For setting up PCRs and for all subsequent analyses, DNA extracted from human samples

will be used. This DNA has kindly been provided by industry colleagues at Sullivan Nicolaides

Pathology (SNP) here in Brisbane.

LQB490 Practical Week 9: Genomic DNA

extraction, quantification and quality

analysis


9

Part 1: Extraction of Genomic DNA from Sheep’s Blood DNA extraction from cells is a fundamental step in many molecular pathology assays and is the first step in a clinical diagnostics lab towards testing for hereditary genetic disease. Blood is the preferred source of DNA because

• obtaining blood is less invasive than obtaining tissue samples

• large quantities can be obtained

• blood replenishes itself

• blood is a suitable sample type for many testing procedures Commercially available kits are used by most scientists to extract human DNA for greater consistency and efficiency. In this practical you will use “Isolate II: genomic DNA kit”, a commercial kit manufactured by BIOLINE. In the gDNA extraction you will perform today there are five stages:

1. Cell lysis and protein removal: The rupture of cell membranes using detergents to dissolve the phospholipid bilayer of the plasma membrane and nuclear membrane. This releases DNA and other organic molecules into the solution.

2. Precipitation of DNA 3. Binding of DNA to a silica column 4. Purification/washing of column-bound DNA 5. Elution of ‘pure’ DNA

Note: For this assay students will work INDEPENDENTLY & will each require:

• 200 µL of sheep blood in a 1.5 mL microfuge tube

• Proteinase K solution

• Lysis Buffer (G3)

• 100% Ethanol

• Wash Buffer 1 (GW1) - contains guanidine hydrochloride and isopropanol

• Wash Buffer 2 (GW2) - contains ethanol

• Elution Buffer (G) - preheated to 70°C

• 1 x spin column

• 2 x 2 mL microfuge collection tubes

• 1 x 1.5 mL microfuge collection tube

• Barrier tips (these contain a filter in the tip to prevent aerosols and contamination of the pipette barrel)

• A microfuge tube rack

• p20, p200 and p1000 Micropipettes

• A vortex mixer

• A 70oC heating block

• A Microcentrifuge


10

WARNING: Biological material, chaotropic salts, high temperature heating block

Method:

Extraction of Genomic DNA (gDNA) from Sheep’s Blood Step Procedure Notes

1 Collect one tube containing 200 µL of blood. Label your tubes clearly with your first name and surname initial using a permanent marker pen.

2 Add 25 µL of Proteinase K solution using barrier tips.

Barrier tips are used in all processes pre-PCR in diagnostic labs. Barrier tips contain a filter in the tip to prevent aerosols and contamination of the pipette barrel with nucleic acids.

3 Add 200 µL of Lysis Buffer G3, cap and vortex vigorously for 10-20 sec.

Thorough vortexing at this step is essential for the complete lysis of cells and extraction of high quality DNA.

4 Incubate samples at 70°C for 15 min. Vortex the samples briefly every 5 min.

Be careful when using the heat block due to high temperature.

5 Add 210 µL of 100% ethanol, vortex and pulse spin in the microcentrifuge.

A pulse spin is a brief centrifugation of only 10-20 sec that collects stray droplets back into the main bulk of liquid in the bottom of the tube.

6 Carefully pipette all the liquid from step 5 into a “spin column” seated in a 2 mL collection tube and positioned in a rack.

Ensure you don’t wet the rim of the spin column.


11

7 Cap the spin column.

8 Centrifuge for 1 min at maximum speed. After centrifugation, check that all the liquid has passed through the column. Centrifuge again if necessary.

KEEP your SPIN COLUMN, but DISCARD the COLLECTION TUBE with the filtered blood solution.

9 Place the spin column in a clean 2 mL collection tube.

10 Carefully open spin column and add 500 µL of Wash Buffer GW1.

Do not wet the rim of the column. Be sure to check that you are using the right wash buffer.

11 Centrifuge for 1 min at maximum speed and discard “flow through” into the waste beaker.

“Flow through” is the liquid that passes through the silica membrane from the column into the collection tube during centrifugation.

12 Place the spin column in the same 2 mL collection tube.

13 Carefully open the spin column and add 600 µL of Wash Buffer GW2.

Be sure to check that you are using the right wash buffer.

14 Centrifuge for 1min at maximum speed and discard “flow through” into the waste beaker.

15 Place the spin column in the same 2 mL collection tube.

16 Centrifuge for 1 min at maximum speed to remove residual ethanol contained in GW2 and discard tube and “flow through” into the waste beaker.

Ethanol inhibits PCR and interferes with gel electrophoresis of samples.

17 Now place the spin column in a fresh 1.5 mL microcentrifuge tube.

Label the microfuge tube with your first name and surname initial.

18 Carefully open the spin column and add 100 µL of Elution Buffer G (pre-incubated at 70oC) directly onto the silica membrane.

Do not allow the tip to touch the membrane.

19 Incubate for 3 min at room temp (RT).

20 Centrifuge for 1 min at maximum speed. Discard the spin column.

Your collection tube will have an open lid when centrifuging in this step. You will have to arrange the tubes in the centrifuge so that the open lid trails behind the tube when spinning. Check with a demonstrator if unsure. KEEP THE COLLECTION TUBE. It contains your extracted DNA.

You now have extracted genomic DNA from Sheep’s blood and will proceed to Part 2 of today’s practical: Quantification and Quality Analysis of DNA.


12

The genomic DNA extraction you performed is broken into 5 stages. Which steps in your procedure align with each stage?

1. Cell lysis: 2. DNA precipitation: 3. DNA binding to column: 4. DNA purification/washing (can also be thought of as removal of

other impurities): 5. DNA elution:

1. Why are we lysing the cells?

2. Why is proteinase K used and why is it important to use it?

3. What is a spin column and why is it used in the gDNA extraction?


13

Part 2: DNA Quantification and Quality Analysis. Once DNA has been extracted it can be necessary to ascertain the quantity or concentration of DNA extracted and the purity and integrity of the DNA before proceeding with further analysis. There are different methods that can be used for this and in this practical you will use spectrophotometry to determine concentration and purity and agarose gel electrophoresis to assess DNA integrity. In a clinical laboratory quality would be assessed using electrophoresis if/when a new extraction method was being introduced. Once a method has been validated however, this step may well be omitted as the extraction methods are optimised to be very reliable and reproducible, and produce pure DNA; extraction is often done by automated systems which further improves their reproducibility. With large numbers of samples being processed daily in a pathology lab, time saving (without compromising quality), can decrease turnaround time. Spectrophotometry Nucleic acids absorb UV light at 260 nm and proteins absorb UV light at 280 nm. The concentration of DNA can be estimated from its absorbance at 260 nm and the purity of the extracted DNA by the ratio of absorbance at 260 nm to absorbance at 280 nm (ie an indication of how much protein is contaminating the sample). One of the limitations of spectrophotometry is that both RNA and DNA absorb at 260 nm. In this practical you will use the Nanodrop Lite to determine the concentration and purity of your DNA. The Nanodrop Lite is a small scale spectrophotometer that allows you to measure DNA concentration using only 2 µL of your sample. Electrophoresis The purity and integrity of DNA also can be analysed by electrophoresis on an agarose gel. Genomic DNA (gDNA) (fluorescently labelled) appears as a single, strong, high molecular weight band. Contaminating low molecular weight DNA and RNA will appear as separate bands and degraded DNA will appear as band smearing. When running DNA samples on a gel, a fluorescently labelled DNA molecular weight marker (MWM) is run alongside. This MWM contains DNA fragments of known size and amounts, allowing you to compare your bands to the MWM and determine both size (which will identify your gDNA) and concentration of DNA. This method of determining DNA concentration is less sensitive since it involves estimating “by-eye”, however it does allow you to distinguish gDNA from other contaminating DNA or RNA and assess the integrity of the DNA. Other methods There are other methods including picogreen and Qubit methods which can detect small changes in DNA concentration (ie are sensitive) and are able to distinguish between different nucleic acid types. Reagents are used that produce fluorescence when they interact specifically with a particular nucleic acid type. These methods can overcome some of the limitations of the gel-based and spectrophotometry methods and are discussed in your lectures.


14

Part 2a: Quantification & Analysis of DNA using the Nanodrop Lite

Note: Students will work independently and will require: • Your extracted gDNA

• a p20 micropipette and micropipette tips

• a Nanodrop Lite spectrophotometer

• Elution buffer (to use as a reagent blank) Method:

Quantifying and Analysing DNA quality using the Nanodrop Lite Step Procedure Notes

1 Select DNA from the Home Screen and choose dsDNA (double stranded DNA) on the next screen.

The spectrophotometer will already be set for you to read double-stranded DNA (dsDNA) at a wavelength of 260 nm.

2 Raise the arm of the NanoDrop Lite spectrophotometer.

3 Pipette 2 µL of Elution buffer (reagent blank) onto the lower pedestal.

4 Lower the arm and press Blank. 5 When the measurement is complete, raise

the arm and wipe the upper and lower pedestals with a lint free tissue (Kimwipe).

6 You will be prompted to repeat the Blank. Repeat steps 2 – 5.

7 Pipette 2 µL of your gDNA sample onto the lower pedestal.

8 Lower the arm and press Measure.

9 When the measurement is complete, record the following measurements: a) Absorbance at 260 nm (A260): ...............

b) A260/A280 ratio: ...............

c) DNA concentration (ng/µL): ...............

10 Raise the arm and wipe with a kimwipe tissue to remove your sample from both the upper and lower pedestals.

11 Lower the arm to close the instrument.

You now know the concentration of your sheep blood gDNA and will use this to determine how much of your sample to load onto an agarose gel to check the integrity of the sample. The amount of gDNA and the DNA Marker should be similar, so the intensity of their fluorescence following staining can be compared. Proceed to Part 2b.


15

Part 2b: Analysis of DNA by Electrophoresis on a 1.2% Agarose Gel

Note: Each student will load their own set of samples onto the gel; three students per gel • 1 x Pre-made 1.2% agarose E-Gel™ (containing SYBR Safe nucleic acid stain)

• 1 x E-Gel™ Simple Runner Electrophoresis Device Each student will require:

• TriTrack 6 X DNA loading dye (contains glycerol and dyes: xylene cyanol, bromophenol blue and Orange G)

• Your extracted gDNA

• 1 x 1.5 mL microfuge tubes

• p20 and p200 micropipettes

• barrier tips • 1 x 10 µL aliquot of DNA molecular weight “marker” (premeasured)

• dH2O

• A microcentrifuge Method:

Analysis of DNA by Electrophoresis on a 1.2% Agarose Gel Step Procedure Notes

1 Calculate the volume of your gDNA sample that corresponds to approx. 200 ng: 200 ng = approx. …… µL

……….ng/µL

e.g. If your gDNA concentration from part 2a is 33.2ng/µL then you will need: 200 ng = approx. 6 µL of your 33.2 ng/µL sample

2 Based on your calculations, complete the pipetting schedule below for gDNA and H2O. Tubes 1 and 2 will both contain approximately 600 ng DNA.

Tube 1 2

Sample 1 kb ladder MW Marker (µL)

Sheep gDNA (µL)

MWM DNA (60 ng/μL) 10 0

gDNA 0

6X loading dye 4 4

H2O 10

TOTAL VOLUME (μL) 24 24

3 Make up tubes 1 and 2 in microfuge tubes as per the table.

Label the tubes 1 and 2 with your initials before you add reagents.

4 Mix tubes by gently pipetting up and down in a pipette tip 3-4 times. Pulse spin.

Tip: use a p20 micropipette (set to 10µL) and try to minimise bubbles. Use a separate tip for each tube.


16

5 Remove your E-Gel from its package, gently remove the comb and insert into the E-Gel™ Simple Runner Electrophoresis Device

Start from the right edge of the E-Gel and press down to insert.

6 Load 20 µl of each sample into the wells of your E-Gel as indicated in the table below. Each student will need to load 2 samples of water (w) on either side of their samples to make sure that all wells are full before running the gel. Begin with the two water (w) samples, followed by the DNA marker (tube 1) and then your sheep gDNA (tube 2).

Lane 1 2 3 4 5 6 7 8 9 10 11 12

Student Student 1 samples Student 2 samples Student 3 samples

Sample w 1 2 w W 1 2 w w 1 2 w

7 Once fully loaded (all wells need to contain either 20 µl of sample or 20 µl of water), start the electrophoresis process by simply pressing the “15 min” button. Your samples will run for 15 minutes. During the run your DNA samples will migrate through the gel matrix and separate according to size.

8 Once your gel has finished running it will be visualised under UV light and photographed using a GELDOC camera. The demonstrators will help photograph your gels for you.

Attach the photograph to this prac document and label it according to guidelines provided in the LQB490 Practical guidelines document.


17

1. Describe what you see in your gDNA lane

• Number of bands and clarity and relative intensity of the bands (you may like to use a + to ++++ scale for this).

2. Label the gDNA band on your picture. How do you know this is the gDNA

band?

3. How does the purity of your DNA seen from the gel correlate with the

A260/A280 ratio derived using the Nanodrop Lite?

Attach your gel photograph below.

• Label the anode and cathode ends.

• Using the MWM ladder estimate the sizes of your gDNA bands and include on the picture next to each band.

1 kb DNA Ladder visualized by ethidium bromide staining on a 0.8% TAE agarose gel. Mass values are for 0.5 µg/lane.


18

1. Name: ______________________________________ Student no: ___________________ LEARNING OUTCOMES: By the end of the session, you should be able to:

• Understand the theory and processes of Real Time PCR and and how to set one up

• Understand the processes of RFLP analysis and interpret results

• Set up a PCR for subsequent sequencing analysis

• Prepare an agarose gel

HEALTH & SAFETY FIRST – GOOD LABORATORY PRACTICE

• You will be working with chemicals and pipettes, and must wear lab coats, gloves and safety glasses

(PPE) at all times.


• Safety lids must always be in place when operating centrifuges.

INTRODUCTION: In Week 9 you extracted DNA and assessed the quality of the DNA using spectrophotometry and agarose gel electrophoresis (AGE). Sheep’s blood was used for this due to the H&S concerns about using human blood, however, the procedures were exactly the same as those used for human blood. This week you will use DNA extracted from one of our four case study patient blood samples to determine whether the HFE p.C282Y or p.H63D mutations are present. There are a number of methods that can be used for detecting mutations including Restriction Fragment Length Polymorphism (RFLP) analysis, Real-Time PCR or DNA sequencing. Today you will setup a real-time PCR for both the p.C282Y and p.H63D mutations (Part 1), you will interpret the results of RFLP analysis for p.C282Y (Part 2) and you will setup a PCR for subsequent DNA sequencing in the Week 11 practical (Part 3). For this practical, and from here on in the practical classes, you will be testing the extracted DNA of the four patients whose clinical histories are given in the Case Study introduction. It is your job to test their samples to determine whether their clinical histories correlate with the presence of mutations in the HFE gene – the gene responsible for hereditary haemochromatosis (HH).

LQB490 Practical Week 10: Genotyping by

real-time PCR, RFLP analysis and PCR setup

for DNA sequencing


19

The first stage of this molecular process is the gDNA extraction and this has been carried out for us at the SNP laboratory in Brisbane. Now the DNA will be interrogated for the presence of the p.C282Y and p.H63D mutations using Real-Time PCR.

Part 1: Real-Time PCR for interrogation of p.C282Y & p.H63D mutations in the HFE gene Real-Time PCR For this part of the practical, you will be exposed to Real-Time PCR, a more recent, effective, robust and quicker methodology than the more ‘old-fashioned’ and time-consuming PCR-RFLP (Part 2). If you took LQB280 Genes, Genomes and Genetics you would have done an RFLP to detect the sickle cell mutation in the HBB gene. RFLP involves multiple steps including PCR, validity gel, RE digest with the final genotype determined by analysing banding patterns on an agarose or polyacrylamide gel. Real-Time PCR is a type of PCR that allows the detection and quantification of the target sequence as the PCR progresses (hence the term ‘real-time’). Apart from using similar cycling conditions (denaturation, annealing and extension) to conventional PCR, this highly sensitive and specific PCR uses fluorescence-based chemistries (SYBR-Green or TaqMan) to monitor, in real time, the amplification of new copies of a DNA target into millions of identical copies. The incorporation of these chemistries into the existing PCR technology allows accurate and reliable quantification of the initial amount of DNA or RNA, without the need for additional time-consuming processes, such as the separation of DNA fragments using electrophoretic methods. This advantage and the high sensitivity, specificity and efficiency of real time PCR has led to its use in a myriad of different applications that can be classified into quantitative and end-point assays. In the quantitative assays, real-time PCR uses either relative or absolute methods for the quantification of mRNA or microbial RNA and DNA. In addition, real-time PCR is used in end-point assays that allow the detection and genotyping of mutations (genetic variants) from one individual up to a large population. This application is allelic discrimination Real-Time PCR. In this practical, you will be using an end-point assay for the genotyping of the four Case Study patients for the p.C282Y and p.H63D mutations using TaqMan chemistry. TaqMan technology uses a set of primers flanking the region of interest and a dye-labelled DNA probe (TaqMan or hydrolysis probe) that is specific to the sequence flanked by the primers and which includes the site of the mutation to be investigated. This technology relies on two principles:

1. the Fluorescence Resonance Energy Transfer (FRET) between a fluorogenic reporter dye located at the 5’ end and the quencher molecule at the 3’ end of the DNA probe and

2. the 5’ – 3’ exonuclease activity of the Taq DNA polymerase, which cleaves the DNA probe, releasing the reporter and allowing the detection of the fluorescence signal shed by the reporter upon its release from the probe.


20

In end-point assays, two TaqMan probes designed to be specific to each allele of the target mutation (ie. normal or mutation- containing alleles) are labelled with specific fluorogenic dyes, VIC or FAM that fluoresce at different wavelengths. For the genotyping of the p.C282Y and the p.H63D mutations in your four patients, two different real-time PCRs will be performed on each patient’s DNA, one assay for the p.C282Y mutation and one assay for the p.H63D mutation. In these assays, VIC-labelled TaqMan probes have been designed to detect specifically the wild-type (normal) alleles and FAM-labelled TaqMan probes to detect the mutant p.C282Y and p.H63D alleles. For the detection of the genotypes for each mutation:

• individuals homozygous for the p.C282Y wild-type (normal) allele will only have amplification plots for the probes labelled with VIC; whereas, individuals homozygous for the p.C282Y mutant allele will only exhibit amplification plots for the FAM-labelled probes.

• individuals homozygous for the p.H63D wild-type (normal) allele will only have amplification plots for the probes labelled with VIC; whereas, individuals homozygous for the p.H63D mutant allele will only exhibit amplification plots for the FAM-labelled probes.

• Individuals heterozygous (ie. one wild type and one mutant allele) will have amplification plots for both VIC and FAM-labelled probes.

In this real-time PCR two sections of the HFE gene will be amplified (in two separate reactions) – one containing the position of the p.C282Y mutation in exon 4 and one containing the position of the p.H63D mutation in exon 2. The size of the sections being amplified are 106 bp for p.C282Y and 93 bp for p.H63D. The following page shows the positions of the p.C282Y and p.H63D mutations and the primer and probe sequences used to target them by Taqman allelic discrimination PCR.

Normal Allele:

VIC Mutant Allele:

FAM


21

HFE gene: p.C282Y mutation section amplified by Real Time PCR (5’ to 3’ strand shown)

6601 gataagcagc caatggatgc caaggagttc gaacctaaag acgtattgcc caatggggat

6661 gggacctacc agggctggat aaccttggct gtaccccctg gggaagagca gagatatacg

6721 tgccaggtgg agcacccagg cctggatcag cccctcattg tgatctgggg tatgtgactg

6781 atgagagcca ggagctgaga aaatctattg ggggttgaga ggagtgcctg aggaggtaat

Forward p.C282Y Real Time PCR Primer binding site – (Primer Sequence 5’ GGC TGG AT A

ACC TTG GCT GTA C 3’

Reverse p.C282Y Real Time PCR Primer binding site – (Primer sequence 5’ GTC ACA TAC CCC

AGA TCA CAA TGA G 3’ (reverse complement of gene sequence)

Probe binding site –

Normal Allele Probe sequence: 5’ VIC – AGA GAT ATA CGT GCC AGG 3’

Mutant Allele Probe sequence: 5’FAM – CAG AGA TAT ACG TAC CAG GTG 3’

g – p.C282Y point of mutation; G in normal, A in mutant (HGVS notation: c.845G>A).

HFE gene: p.H63D mutation section amplified by Real Time PCR (5’ to 3’ strand shown)

4681 ggtgcctcag agcaggacct tggtctttcc ttgtttgaag ctttgggcta cgtggatgac

4741 cagctgttcg tgttctatga tcatgagagt cgccgtgtgg agccccgaac tccatgggtt

4801 tccagtagaa tttcaagcca gatgtggctg cagctgagtc agagtctgaa agggtgggat

Forward p.H63D Real Time PCR Primer binding site – (Primer sequence 5’GAT GAC CAG CTG

TTC GTG TTC 3’) Reverse p.H63D Real Time PCR Primer binding site – (Primer sequence 5’CCA CAT CTG GCT TGA AAT TCT ACT G 3’) - reverse complement of gene sequence displayed

Probe binding site

Normal Allele Probe sequence: 5’VIC - CGA CTC TCA TGA TCA TA 3’

Mutant Allele Probe sequence: 5’FAM – CGA CTC TCA TCA TCA TA 3’

NB both p.H63D probes are the reverse complement of gene sequence displayed

c – p.H63D point of mutation; C in normal, G in mutant (HGVS notation: c.187C>G).


22

This week there are two sets of primers and probes; one set interrogates the p.C282Y locus and the other set tests the p.H63D locus. It is important that you match the probes and primers correctly (eg. p.C282Y primers must be matched with p.C282Y probe in a single reaction). Each student will set up 3 reactions each:

A. A negative template control (in each pair, one student will do a negative control containing the p.C282Y primer/probe set and the other student’s negative control will contain the p.H63D primer/probe set - decide which you will do between you).

B. This reaction contains your patient DNA, probes and primers for the p.H63D mutation

C. This reaction contains your patient DNA, probes and primers for the p.C282Y mutation

Note: Students will work independently Materials:

• 1 x patient sample of gDNA (you will be allocated one of the four patients)

• 1 tube of 2x LC480 Probes Master (contains usual components required for PCR reaction except for probes/primers)

• PCR grade dH2O

• RT - C282Y Primer Mix

• HFE282- Probe Mix

• RT - H63D Primer Mix

• HFE63- Probe Mix

• 0.2 mL PCR tubes (strip of 4 x white tubes with separate clear lids)

• Rack to hold your 0.2 mL PCR tubes

• p20 barrier micropipette tips

• p20 micropipettes Method:

Set up p.C282Y and p.H63D targeted Real Time PCR Step Procedure Notes

1 In pairs, decide who will do a negative control (NTC) for p.H63D and who will do a negative control for p.C282Y

2 Complete the table below and then label 3 of the 0.2 mL PCR tubes (in strip) clearly on the SIDE ONLY with the tube ID letter (A-C) and your initials. (Note: DO NOT write on the reaction tube LIDS as this will interfere with the detection of the fluorescence)

Tube/Reaction ID

A B C

Reaction Type NTC p.H63D p.C282Y

Probe & Primer Mix

...….. p.H63D p.C282Y

Template type dH2O Patient ….

DNA Patient ….

DNA


23

3 Complete the following Real-Time Reaction Pipetting Schedule (use C1V1 =C2V2):

Reagent [Stock soln] [Final soln]

Vol (µL) per reaction tube

1 dH2O 1

2 LC480 Probes Master 9

3 RT – Primer Mix 20μM 4μM .....

4 HFE – Probe Mix 6μM 1.2 μM …...

5 *Template (see table step 2)

2

Total volume 20

Be sure to use a new tip for each reagent

4 Into each labelled reaction tube (A-C, set up in step 2), pipette the volumes of reagents 1-4 in the order they appear in the table above. Mix using a pipette.

Make sure you use the correct combination of probes and primers as specified in Step 2. Use a new pipette tip for each addition.

5 *Add 2 µL of the correct template to each of your reactions – see table in Step 2. Insert the lids onto the strip tubes. Pipette or flick mix to combine.

Again - use a new pipette tip for each addition.

6 Put your reaction tubes into the racks on the front bench. Complete the table provided by including your initials, loci (p.H63D or p.C282Y) for your NTC and tube ID (A, B, C) against the position in which your reaction tubes are placed. They will be run in the Light Cycler Real-Time PCR machine by the technical scientists to cycle according to the schedule below:

Thermocycling Profile

Step Description Analysis Mode Target (°C)

Hold Time Number of cycles

Ramp Rate °C/s

Pre-incubation None 95 10min 1 X 4.4

Amplification Quantification 95 10 sec 50 X 4.4

60 20 sec 2.2

Cool None 50 10 sec 1 X 1.5

You will be able to watch the progress of your run during the remainder of the practical. After the run has completed results will be saved and you will analyse them in the Week 11 practical.

Once you have completed your Real Time PCR set up, proceed to Part 2.


24

1. Why are both probes and primers needed in TaqMan Real Time PCR? 2. What might happen if you mixed up the probes and primers, eg used

primers for p.C282Y and probes for p.H63D? 3. What are the sizes of the probes (in bases) for p.C282Y and p.H63D? 4. What are the primer sizes (in bases)? 5. What is the reporter dye for the ‘normal’ p.C282Y probe? For the

‘mutant’ p.C282Y probe? What about for p.H63D? 6. What happens at 95°C in the thermocycler? 7. What happens at 60°C in the thermocycler?


25

Rsa I

5’- G T A C -3’ 3’- C A T G -5’

Part 2: RFLP analysis for p.C282Y mutation Restriction enzymes recognise and cut double stranded DNA (dsDNA) at a specific point in a particular sequence called a restriction site, which is usually about 4-8 bp in length. Different restriction enzymes target different sequences. As well as targeting different sites, restriction enzymes work optimally under specific salt, pH and temperature conditions. Buffers are used to achieve the required salt and pH conditions. If you previously took LQB280 Genes, Genomes and Genetics you would have performed Restriction Fragment Length Polymorphism (RFLP) analysis to detect the sickle cell mutation in the HBB gene. The point mutation c.20A>T (p.E7V) destroys a recognition site for the restriction enzyme Bsu36I. When digested with Bsu36I your PCR amplicon was either cut if it was wild-type or uncut if it contained the c.20A>T mutation. This led to different and characteristic banding patterns on an agarose gel depending on the genotype of your sample: wild-type – 2 bands, homozygous c.20A>T – 1 band and heterozygous – 3 bands. You will not be performing an RFLP for the HFE mutations p.C282Y or p.H63D in the four case study patients partly because a similar method was done in first year but also because RFLP is no longer a common methodology for mutation detection in molecular pathology laboratories. Most genetic variants are now detected by real-time PCR, other advanced PCR techniques or by DNA sequencing. However, in this part of the practical you will be interpreting the RFLP patterns characteristic for the HFE mutation p.C282Y. The HFE-p.C282Y RFLP initially targets a 390 bp section of the HFE gene. The region of DNA targeted by this PCR includes the position of the p.C282Y mutation - the most common mutation responsible for hereditary haemochromatosis (HH). Sequences containing the p.C282Y mutation have an additional restriction site recognised by the restriction enzyme RsaI (compared to ‘normal’ ie no mutation). Therefore, when your patient’s PCR amplicon is treated with RsaI, different sized fragments result depending on the presence of normal sequence or sequence containing the p.C282Y mutation. The sequence on the following page shows the primer sequences used to amplify the p.C282Y mutation region and the positions of RsaI restriction sites. RsaI has a 4 base recognition sequence (GTAC) and cuts this sequence in the middle to produce ‘blunt-ended’ fragments as shown below:


26

HFE gene: p.C282Y mutation section amplified by PCR (5’ to 3’ strand shown)

6421 gaagtgaaag ttccagtctt cctggcaagg gtaaacagat cccctctcct catccttcct

6481 ctttcctgtc aagtgcctcc tttggtgaag gtgacacatc atgtgacctc ttcagtgacc

6541 actctacggt gtcgggcctt gaactactac ccccagaaca tcaccatgaa gtggctgaag



6721 tGccaggtgg agcacccagg cctggatcag cccctcattg tgatctggggtatgtgactg

6781 atgagagcca ggagctgaga aaatctattg ggggttgaga ggagtgcctg aggaggtaat

Forward p.C282Y Primer binding site – Primer Sequence 5’ TGGCAAGGGTAAACAGATCC 3’

Reverse p.C282Y Primer binding site – Primer sequence 5’ CTCAGGCACTCCTCTCAACC 3’

(reverse complement of gene sequence)

RsaI restriction site – GTAC (NB second restriction site only occurs in mutant – second G is

an A in the p.C282Y mutation containing allele)

G – p.C282Y point of mutation G in normal, A in mutant (HGVS notation: c.845G>A)


27

How many fragments does the restriction digest produce if the gene has the p.C282Y mutation? Now many if the gene is ‘normal’? Why? What size bands would you expect to see on a gel for the following genotypes:

Normal (no mutations)

Homozygous p.C282Y

Heterozygous p.C282Y Using the gel diagram below mark the positions of the bands you would expect to see after RsaI digestion of the p.C282Y mutation targeted PCR for individuals who are homozygous normal (wild-type), homozygous for p.C282Y and heterozygous for p.C282Y.


28

Part 3: PCR setup for DNA sequencing In the first step of the DNA sequencing process you will be setting up PCRs that target the regions containing the p.C282Y and p.H63D mutations. These are conventional PCRs. Using 2 pairs of primers you will target the regions containing the p.C282Y and p.H63D mutation sites and amplify them exponentially to make enough DNA to use as a template in DNA sequencing reactions in the Week 11 practical.

This week you will be amplifying your patient’s DNA using primers that recognise sequences within the HFE gene that flank the regions that include the positions of the p.C282Y and p.H63D mutations. Because the 2 mutation sites are in different exons, several kilobases apart they need to be targeted in 2 separate PCRs – see below diagram that shows the exonic structure of the HFE gene (coding regions are in red), the positions of the 2 mutations and the positions of the corresponding PCR amplicons.

The PCR process


29

For the p.C282Y targeted PCR you will use the forward and reverse primers indicated on the DNA sequence in Part 2. This should result in the amplification of a 390 bp section of your patient’s DNA that contains the site of the p.C282Y mutation. p.C282Y Forward Primer Sequence: 5’-TGGCAAGGGTAAACAGATCC-3’ p.C282Y Reverse Primer Sequence: 5’-CTCAGGCACTCCTCTCAACC-3’ For the p.H63D targeted PCR you will use the forward and reverse primers indicated in the below sequence that should result in the amplification of a 208 bp section of your patient’s DNA that contains the site of the p.H63D mutation.

HFE gene: p.H63D mutation section amplified by PCR (5’ to 3’ strand shown)

4621 acatggttaa ggcctgttgc tctgtctcca ggttcacact ctctgcacta cctcttcatg


4741 cagctgttcg tgttctatga tCatgagagt cgccgtgtgg agccccgaac tccatgggtt

4801 tccagtagaa tttcaagcca gatgtggctg cagctgagtc agagtctgaa agggtgggat

4861 cacatgttca ctgttgactt ctggactatt atggaaaatc acaaccacag caagggtatg

Forward p.H63D Primer binding site – 5’ ACATGGTTAAGGCCTGTTGC 3’

Reverse p.H63D Primer binding site – 5’ GCCACATCTGGCTTGAAATT 3’

(reverse complement of gene sequence)

C – p.H63D point of mutation; C in normal, G in mutant (HGVS notation: c.187C>G).

Materials

Note: Students will work in pairs to make the master mixes but will independently set up their own reactions. Each student will require:

• 1 x patient sample of extracted gDNA (the same patient you were allocated in Part 1)

• PCR grade dH2O

• Forward Primer (for p.C282Y or p.H63D)

• Reverse Primer (for p.C282Y or p.H63D)

• 10 x PCR buffer

• dNTPs mix

• Taq DNA polymerase

• 1 x 1.5 mL microfuge tube

• 3 x 0.2 mL PCR tubes

• Rack to hold your 0.2 mL PCR tubes

• p20 and p200 barrier micropipette tips (these contain a filter in the tip to prevent aerosols)



30

Method

Set up p.C282Y and p.H63D targeted PCRs Step Procedure Notes

1 In pairs, you will each prepare a master mix for either the p.C282Y targeted PCR or the p.H63D targeted PCR and share the master mixes between you so that each student does PCRs for both mutations on their patient sample. If you prepared the p.C282Y master mix you will set up the negative control (NTC) for p.C282Y and if you prepared the p.H63D master mix you will set up the NTC for p.H63D.

2 Complete the following pipetting schedule for your PCR ‘master mix’ set –up (check it with a demonstrator). Circle which master mix you prepared:

p.H63D p.C282Y

A master mix consists of the components common to all PCRs. They are pipetted into one tube and then dispensed into the individual reactions. The use of master mixes minimises pipetting error by reducing the number of pipetting steps, increasing the volumes pipetted, and ensures the ratio of reagents is equal in all reactions.

Master Mix Pipetting Schedule

Order of addition

Reagent [Stock soln] [Final soln]

Vol (µL) per 1 reaction

Vol (µL) per 3.5 reactions

1

dH2O 28

2

dNTPs 2.5 mM 0.25 mM 5

3

PCR buffer 10 x 1 x 5

4 Forward primer

5 µM 0.4 µM 4

5 Reverse primer

5 µM 0.4 µM 4

6

Taq DNA pol 1 U/µL 2 U 2

Total volume 48 168

Be sure to use a new tip for each reagent

3 Into a 1.5 mL tube, pipette the volumes of reagents in the most right-hand column in the order they appear in your table (1-6). Mix by pipette and pulse spin to collect contents to the bottom of the tube.

Use a different barrier tip for each addition. To mix, use a p200 micropipette (set to 100 µL) and barrier tip. Why do you set the volume to much less than the total volume in your tube? Make sure you balance the centrifuge!


31

4 Complete the table below and then label 3 x 0.2 mL PCR tubes clearly on the lid and side with the tube ID number (1-3) and your initials. Eg. 1 - DW.

Tube/Reaction ID

1 2 3

Reaction Type NTC p.H63D p.C282Y

PCR master mix

...….. p.H63D p.C282Y

Template type dH2O Patient ….

DNA Patient ….

DNA

Tube 1 will either contain the p.H63D or p.C282Y master mix. Tubes 2 and 3 will contain your patient DNA sample.

5 Add reagents to PCR tubes in the order given below from top to bottom, ie. master mix to all tubes, then dH2O to tube 1, etc.

PCR Tube Pipetting Schedule

Tube 1 2 3

PCR Reaction:

NTC P1, P2, P3 or P4

(patient) P1, P2, P3 or P4

(patient)

Master mix

Volume

………

48 µL

p.H63D

48 µL

p.C282Y

48 µL

dH2O

2 µL - -

Patient DNA template

- 2 µL 2 µL

• close your tube after each addition

• Use a new tip for each addition


32

6 Put your reaction tubes in the PCR machine. They will be run by the technical scientists to cycle according to the schedule below:

PCR Cycling Schedule

Step Description Temperature (°C)

Time Number of cycles

Initial Denaturation

95 5 min 1 X

Denaturation 94 30 sec 30 X Annealing 63 30 sec

Final Extension 72 30 sec

Extension 72 7 min 1 X

Hold 14 ∞

Your PCR samples will be stored at -20°C until Week 11, when you will analyse the results of your PCR, purify the DNA and set up DNA sequencing reactions.

1. For your experiment today you made up 3 reactions, why do you make up volumes equivalent to 3.5 reactions in your master mix?

2. There are 5 components to the master mix (other than water). What do

each of them do in the PCR? 3. What is the purpose of the negative control (NTC - no template control)?


33

What is happening in each of the steps of the PCR cycle? i) Denaturation ii) Annealing iii) Extension

Why is the order of these steps important?


34


• Analyse amplification plots from Real Time PCR reactions

• Synthesise data from a number of amplification plots to determine genotypes at

different loci and draw conclusions about the likelihood of HH in the 4 Case Study

patients

• Clean up a PCR for sequencing using a kit-based method

• Set-up a Sanger sequencing reaction using BigDye® Terminator and understand the

principles involved in sequencing


• You will be working with chemicals and pipettes, and must wear lab coats, gloves and

safety glasses (PPE) at all times.



INTRODUCTION: In the last practical you set up real time PCRs to determine the HFE p.C282Y and p.H63D genotypes in one of 4 Case Study patient samples. Part 1 of today’s practical will deal with the analysis of these results and determine the genotypes of all 4 patients at the p.C282Y and p.H63D loci. DNA sequencing is another method that can be used to determine genotypes, for both known mutations and unknown mutations. In the Week 10 practical you set up PCRs to amplify the regions surrounding the p.C282Y and p.H63D mutation sites in the HFE gene. The purpose of this PCR was to generate enough DNA template to use in a Sanger DNA

LQB490 Practical Week 11: Analysis of real-

time PCR results, gel of PCR, purification of

PCR product and setup of BigDye®

terminator reaction for Sanger sequencing


35

sequencing reaction. We will be sequencing the regions surrounding the p.C282Y and p.H63D mutation sites to confirm the results obtained using real time PCR. Sometimes, other sequence variants can interfere with the real time PCR process. For example, a rare mutation in HFE called p.S65C is physically close to the site of the p.H63D mutation and can cause misleading real time PCR results when present. Hence diagnostic pathology laboratories will sometimes confirm unusual real time PCR genotype results using a DNA sequencing method. Before we can start the DNA sequencing reactions, we first need to confirm that the PCRs that you ran in Week 10 worked to amplify the regions surrounding the p.C282Y and p.H63D mutation sites. To do this you will electrophorese you PCRs using a 1.5% agarose gel and check for the correct size bands (Part 2). Once your PCRs are validated you then need to purify the PCR amplicons (Part 3a) and measure their concentrations (Part 3b). Once this is done you can then proceed to sequence the purified PCR amplicons by setting up BigDye® Terminator Sanger DNA sequencing reactions (Part 4). This week’s practical has 4 parts to it: Part 1: Analysing Week 10 Real Time PCR results Part 2: Agarose gel electrophoresis to validate PCRs Part 3: Clean-up/purification of PCR amplicon Part 4: Set up of BigDye® Terminator reaction for Sanger DNA Sequencing.

Part 1: Workshop: Analysing Week 10 Real Time PCR results For the genotyping of the p.C282Y and p.H63D mutations in the four patients, two different real time PCRs were set up on each patient’s DNA, one assay for each of the p.C282Y and p.H63D mutations. In these assays, VIC-labelled TaqMan probes are designed to detect specifically the wild-type allele of both mutations and FAM-labelled TaqMan probes to detect the mutant alleles. In addition you set up No Template Controls (NTC) for each of the mutations, containing appropriate primers and probes for each mutation.

For the detection of the genotypes for each mutation:

• individuals homozygous for the wild-type (normal) allele will only have amplification plots for the probes labelled with VIC

• individuals homozygous for the mutation will only exhibit amplification plots for the FAM-labelled probes

• Individuals heterozygous (ie one wild type and one mutant allele) will have amplification plots for both VIC and FAM-labelled probes.

Normal Allele:

VIC Mutant Allele:

FAM


36

Activity: You will review the results of your Real Time PCR amplification plots for each patient. As a class, you will be shown how to analyse the plots in general terms and then will analyse your own plots and those for all four patients with the support of fellow students and staff. You will need to bring printed copies of your four amplification plots that will be available for you in the U drive\StudentShare folder. Or alternatively you can view them using the laptops in the lab. The plots are for the No Template Control (A), p.H63D targeted Real Time PCR for your patient (B), p.C282Y targeted Real Time PCR for your patient (C) and a final plot which has combined all your amplification curves (ABC). Please be sure you know which plot is which, based on the table of reaction details provided for each class. These tables of reaction details will be provided in a separate file. Please complete the table below from your own data for the patient you analysed. The remainder of the table can be completed in discussion with your peers or class discussion. For the genotype column: HED stands for heterozygous mutation detected, HOD stands for homozygous mutation detected and NMD stands for no mutation detected

Sample

p.C282Y p.H63D

VIC Curve ( ✓ or X )

FAM Curve ( ✓ or X )

Genotype HED, HOD, NMD

VIC Curve (✓ or X )

FAM Curve (✓ or X)

Genotype HED, HOD, NMD

Patient 1

Patient 2

Patient 3

Patient 4

NTC


37

Part 2: Agarose gel electrophoresis to validate PCR for DNA sequencing As a quality control measure, you need to check that your PCR has worked correctly. You included a negative control (NTC) PCR tube to help you determine whether (or not) you can rely on your results. If the experiment has failed, controls can give you some direction to begin investigating and fixing the possible cause of the failure. AGE is used to assess the validity of your PCR process; it is important to know that you have amplified the right amplicon from the right template – otherwise our downstream applications may be futile. The number and size of bands generated from your control and patient samples will be used to assess the validity of the PCR: 1. Negative template control (NTC) should not contain any amplicon

• Amplicon present (ie band/s on gel) indicates cross contamination and/or contamination of one or more reagents with the template

- this is an invalid assay (ie you cannot rely on the amplicon generated in your patient samples as being the target of interest)

• No amplicon present validates the assay, provided that your patient DNA in tubes 2 and 3 has amplified and has the correct size bands

2. Patient sample amplified using PCR primers targeting the region surrounding the p.H63D

mutation site. Should produce an amplicon of 236 bp in size 3. Patient sample amplified using PCR primers targeting the region surrounding the

p.C282Y mutation site. Should produce an amplicon of 390 bp in size

Note: Each student will load their own set of samples onto the gel; two students per gel Materials:

• 1 x 1.5% Agarose gel (containing Red Safe nucleic acid stain)

• 1 x electrophoresis kit containing o 1 x power pack and cord o 1 x gel tank and lid o 300mL 1 x TBE (Tris Borate EDTA) Buffer

• Your PCR samples (NTC and 2x patient PCR products)

• 3 x 1.5 mL tubes

• 6X tri-track loading dye

• 10 µL pre-measured DNA molecular weight marker (50 bp ladder)


38

Method:

WARNING: High voltage, Red Safe intercalates with DNA (no long term studies completed)

Analysis of PCR products by Electrophoresis on a 1.5% Agarose Gel.

Step Procedure Notes

1 Collect your 3 x PCR samples and 1 x aliquot of DNA Molecular Weight Marker (50 bp ladder)

Label all tubes as per table below with tube number (A-D) and your initials.

2 Make up tubes A-D as per the pipetting schedule below. Include your patient sample number (P1, P2, P3 or P4) in columns C and D in the table. All volumes are in μL

Tube

A B C D

Sample MW marker (50 bp ladder)

PCR tube 1 NTC

PCR tube 2 Patient ….

p.H63D

PCR tube 3 Patient …. p.C282Y

MWM DNA (50 ng/μL) 10 0 0 0

NTC PCR product 0 10 0 0

Patient … p.H63D PCR product

0 0 10 0

Patient … p.C282Y PCR product

0 0 0 10

6X loading dye 2 2 2 2

TOTAL VOLUME (μL) 12 12 12 12

NTC – No (or negative) template control

3 Flick mix samples or mix them gently by pipetting and then pulse spin.

4 Set up your agarose gel in the gel tank and submerge it in running buffer. Load 10 μL of each sample into the wells as indicated in the table below.

Lane 1

Lane 2

Lane 3

Lane 4

Lane 5

Lane 6

Lane 7

Lane 8

Student 1 samples Student 2 samples

MWM NTC Patient …

p.H63D

Patient …

p.C282Y

MWM NTC Patient …

p.H63D

Patient …

p.C282Y

http://www.google.com.au/url?sa=i&rct=j&q=&esrc=s&frm=1&source=images&cd=&cad=rja&uact=8&docid=8DGb5DYA-9OnBM&tbnid=JPy0DmfslYZjmM:&ved=0CAUQjRw&url=http://www.sigmaaldrich.com/technical-documents/articles/biology/extract-n-amp-seed-pcr-kits.html&ei=7L32U_zAIM2yuASS7oGQDw&bvm=bv.73373277,d.aWw&psig=AFQjCNELjBGebMgghnJaLd6ZBR2BpUKkVQ&ust=1408765566897177


39

5 Place the lid on your tank, attach the electrodes to the power pack. Set the voltage to 100V, run time to 30 mins and press start (the button with the “running man”).

6 Once your gel has finished running it will be visualised under UV light and photographed using a GELDOC camera. Attach the photograph to this prac document below to label and analyse.

During the electrophoresis of your PCR products, return to PART 1 of the practical: Analysing Week 10 Real Time PCR results. RESULTS: 1. Attach the photograph of your gel and label the anode and cathode ends and what is in

each lane (you may decide to use a key for this and simply number the lanes). Remember to include the patient number (ie whether you had P1, P2, P3 or P4).

PCR Tube 1 NTC PCR Tube 2 Patient …. p.H63D

PCR Tube 3 Patient …. p.C282Y

Number of bands

Size of bands

50 bp DNA Ladder (NEB)50 bp ladder)


40

1. What can you conclude about the validity of the PCR process? Explain why.

2. Were the size/s of the DNA fragment/s as you would expect for the

amplification of the p.H63D section of the HFE gene? Why or why not?

3. Were the size/s of the DNA fragment/s as you would expect for the

amplification of the p.C282Y section of the HFE gene? Why or why not?


41

Part 3a: Clean-up/purification of PCR amplicon to prepare for BigDye® Terminator Reaction (for Sanger Sequencing) To help ensure an accurate, clear result when sequencing amplified DNA, it is necessary to first purify or ‘clean up’ the PCR amplicon to remove unincorporated dNTPs, primers, polymerase and salts that might affect the sequencing reactions. For this clean up, you will use silica-based spin columns that are similar to the ones you used for your DNA extractions in Week 9. The p.H63D and p.C282Y PCR amplicons you produced in Week 10 and analysed in Part 2 will be used for the clean-up process.

NOTE: Each student will purify two (2) PCRs. Materials:

• Your patient p.H63D and p.C282Y PCR products from Week 10

• Buffer PB (1)

• Buffer PE (2)

• Buffer EB (3)

• 2 x QIAquick spin columns

• 2 x 2 mL collection tubes

• 2 x 1.5 mL microfuge tubes without lids


• Barrier tips


• Microcentrifuge Method:

Clean up PCR reaction Step Procedure Notes

1 Label 2 x 1.5 mL tubes with your initials and either p.H63D or p.C282Y

Also label 2 x spin columns, 2 x 1.5mL microfuge tubes and 2 x 1.5 mL microfuge tubes without lids with the same information. These will be used later in the process.

2 Transfer 20µL of your patient PCRs into the labelled 1.5 mL tubes

3 Add 5 volumes of BUFFER PB (1) to each tube containing your PCR amplicons

You are adding buffer at a ratio of 1 volume of PCR to 5 volumes of Buffer PB (1:5), also known as a 1 in 6 (1/6) dilution of PCR product.

4 Load all of the combined buffer/PCR reactions from step 3 onto your labelled spin columns seated in 2 mL collection tubes

Take note of tubes –use a 2 mL round bottomed tube not the 1.5 mL conical based tubes that you labelled in step 1.

5 Centrifuge at maximum speed for 45 sec Be sure to balance your 2 tubes in the centrifuge each time you spin.


42

6 Discard flow through into waste beaker

7 Re-seat the spin columns in the same collection tubes and then add 750 μL of BUFFER PE (2)

8 Centrifuge at maximum speed for 45 sec

9 Discard flow through

10 Re-seat the spin columns in the same collection tubes again and centrifuge at maximum speed for 1 min to remove any residual ethanol from Buffer PE

11 Discard flow through and collection tubes

12 Transfer your spin columns to the clean 1.5 mL microfuge tubes without lids that you labelled in the ‘Notes’ section of step 1

13 Load 50 μL of BUFFER EB (3) to the centre of the spin column membrane

Take care not to touch the membrane with the pipette tip

14 Centrifuge at maximum speed for 1 min to elute the DNA from the columns

15 Remove and discard spin column Keep the 1.5 mL tube contents.

16 Transfer the contents of the 1.5 mL tubes into the remaining clean, fully labelled 1.5 mL tube. Close and KEEP; place on ice.

This contains your purified PCR amplicon.

You now have purified your p.H63D and p.C282Y PCR amplicons from your patient sample. The next step is to measure their concentrations. Proceed to Part 3b.

Part 3b: Use Nanodrop Lite to determine the concentration of purified PCR amplicons Having the correct template quantity is critical for successful sequencing. Too much or too little template can adversely affect your Big Dye Terminator reaction (for Sanger Sequencing). If the template is a 100-200bp PCR product, 1-3ng of template is recommended (different quantities are specified for templates of other types and sizes). According to the BigDye® Terminator Reaction kit manufacturer (Applied Biosystems), the preferred method of DNA quantification is by gel electrophoresis with a DNA mass ladder standard. However, due to time constraints, today you will quantify your template using the Nanodrop Lite.

Why is it necessary to remove unincorporated dNTPs, primers, polymerase and salts from your PCR amplicon?


43

Note: Students will work independently. Materials:

• Your purified PCR amplicons from part 3a

• p20 micropipette & barrier tips

• Nanodrop Lite spectrophotometer

• Buffer EB (3) (to use as a reagent blank)

Method:

Quantifying purified PCR product using the Nanodrop Lite Step Procedure Notes

1 Select DNA from the Home Screen and choose dsDNA (double stranded DNA) on next screen.

The spectrophotometer will be set to read double-stranded DNA (dsDNA) at 260 nm but it is good practice to check the settings.

2 Raise the arm of the NanoDrop Lite.

3 Pipette 2 µL of Buffer EB (3) (reagent blank) onto the lower pedestal.

4 Lower the arm and press Blank.

5 When the measurement is complete, raise the arm and wipe the upper and lower pedestals with a lint free tissue (Kimwipe).

6 You will be prompted to repeat the Blank. Repeat steps 2 – 5.

7 Pipette 2 µL of your purified p.H63D PCR amplicon onto the lower pedestal.

8 Lower the arm and press Measure.

9 When the measurement is complete, record the following measurements in the table on the next page (step 13): d) Absorbance at 260 nm (A260): e) A260/A280 ratio: f) DNA concentration (ng/µL):

10 Raise the arm and wipe with a kimwipe tissue to remove your sample from both the upper and lower pedestals.

11 Repeat steps 7 to 10 for your purified p.C282Y PCR amplicon

12 Lower the arm to close the instrument.


44

13 Record the Nanodrop Lite readings for your purified PCR amplicons in the table below:

Purified PCR Patient ….

p.H63D

Purified PCR Patient …. p.C282Y

Absorbance at 260 nm (A260)

A260/A280 ratio

DNA concentration (ng/µL)

* Volume required for 3 ng (to be used in Part 4)

* Calculate the volume of purified PCR amplicon that contains 3 ng of DNA. You will be using this amount in the sequencing reactions in Part 4.

Proceed to Part 4 to sequence the purified PCR amplicons

Part 4: Set up Big Dye Terminator Reaction for Sanger DNA Sequencing For this part of the practical, all students will sequence both the p.H63D and p.C282Y regions of the HFE gene from the patient they have been testing throughout this case study using the PCR amplicons prepared in Week 10, validated and purified in Parts 2 and 3 today. Sequencing reactions are slightly different from PCR applications in that each reaction only contains 1 primer. Consequently, each sequencing reaction results in multiple copies of single stranded DNA products that incorporate Big Dye chain terminators (fluorescently labelled ddNTPs) at different points. Hence, only one strand of the double stranded DNA sequence will be amplified in your reaction. Unlike PCR, sequencing reactions do not exponentially amplify the target DNA, hence, to successfully sequence a DNA target you require a much larger amount of starting template DNA in the reaction. We are using purified PCR amplicons as the templates in our sequencing reactions – these represent large numbers of copies of the target DNA amplified from the 4 patients. We are sequencing the forward strand of DNA only. To sequence the reverse strand, you would set up another reaction with a primer that binds the opposite strand of the DNA. This is generally only required for longer sequences (>800 bp) to ensure quality sequencing of both ends (the quality of sequencing read generally drops off above 800 bp). Your sequence is less than 400bp, so one-directional sequencing should be sufficient.


45

For the p.H63D sequencing reaction you will be using the forward primer that was used in the original PCR as the sequencing primer (see below diagram). This primer is located 121 bases upstream (5’) of the p.H63D mutation site.

HFE gene: p.H63D mutation section amplified by Sequencing PCR (5’ to 3’ strand shown)

4621 acatggttaa ggcctgttgc tctgtctcca ggttcacact ctctgcacta cctcttcatg


4741 cagctgttcg tgttctatga tcatgagagt cgccgtgtgg agccccgaac tccatgggtt

4801 tccagtagaa tttcaagcca gatgtggc

Forward p.H63D Sequencing Primer binding site –

5’ ACATGGTTAAGGCCTGTTGC 3’ c – p.H63D point of mutation; C in normal, G in mutant (HGVS notation: c.187C>G).

For the p.C282Y sequencing reaction you will be using a different sequencing primer that is located closer to the mutation site than the forward primer used in the original PCR (see below diagram). This primer is located 79 bases upstream (5’) of the p.C282Y mutation site.

HFE gene: p.C282Y mutation section amplified by Sequencing PCR (5’ to 3’ strand shown)

6443 tggcaagg gtaaacagat cccctctcct catccttcct

6481 ctttcctgtc aagtgcctcc tttggtgaag gtgacacatc atgtgacctc ttcagtgacc

6541 actctacggt gtcgggcctt gaactactac ccccagaaca tcaccatgaa gtggctgaag



6721 tgccaggtgg agcacccagg cctggatcag cccctcattg tgatctggggtatgtgactg

6781 atgagagcca ggagctgaga aaatctattg ggggttgaga ggagtgcctg ag

Forward p.C282Y Sequencing Primer binding site –

5’ CAAGGAGTTCGAACCTAAAGACG 3’ g – p.C282Y point of mutation; G in normal, A in mutant (HGVS notation: c.845G>A).

Materials:

• dH2O

• Purified patient p.H63D and p.C282Y PCR amplicons (PCR template in step 2 below)

• BigDye® Terminator Ready Reaction Mix (BDT-RRM)

• Sequencing Buffer – a buffer with optimal salt concentrations for efficient reaction (exact composition is proprietary knowledge)

• FORWARD p.H63D Sequencing Primer

• FORWARD p.C282Y Sequencing Primer

• 2 x 0.2 mL PCR tubes

• p20 barrier tips

• p20 micropipette


46

Method:

Set up Big Dye Terminator Reactions Step Procedure Notes

1 Label 2 x 0.2 mL tubes clearly on the side and lid with your initials, patient number and mutation.

For example: DW-P1-H63D DW-P1-C282Y

2 Complete the pipetting schedule in the following table.

*The p.H63D and p.C282Y PCR templates are your purified PCR amplicons from Part 3. Use the volume required for 3 ng that you calculated in Part 3b. Adjust the volume of dH2O to

achieve a final volume of 20 μL. Be sure to use a new tip for each addition.

All volumes are in µL

Reagent Final Amount/ Concentration

Volume in p.H63D Reaction

tube

Volume in p.C282Y Reaction

tube

dH2O ….

….

Sequencing buffer 1 x 3.5 3.5

p.H63D sequencing primer (0.8 μM)

3.2 pmol 4

p.C282Y sequencing primer (0.8 μM)

3.2 pmol 4

BigDye® Terminator (BDT-RRM)

1/8 x 1 1

*p.H63D PCR Template

3 ng ….

*p.C282Y PCR Template

3 ng ….

TOTAL VOLUME (μL) 20 20

3 Add reagents to the tube in the order listed in your pipetting schedule in step 2.

NOTE: Demonstrators will dispense the Big Dye Terminator.

4 Pipette or flick mix to combine and then pulse spin.

5 Put your reaction tube in the PCR machine. They will be cycled according to the schedule below.

PCR Cycling Schedule

Step Description Temperature (°C)

Time Number of cycles

Initial Denaturation

96 1 min 1 X

Denaturation 96 10 sec 30 X Annealing 50 5 sec

Extension 60 4 min

Hold 4 Hold 1 X


47

You will now have two sequencing reactions that contains single stranded DNA molecules of various sizes tagged with BigDye® Terminator. They will be cleaned up using EDTA/ethanol precipitation and centrifugation by the technical staff. This process removes unincorporated dye and other reaction components prior to sequencing. After clean-up your sequencing reactions will be run on an Applied Biosystems 3500 Genetic Analyser. This machine will separate the DNA fragments by capillary electrophoresis and detect their fluorescence using a laser and detector. See the appendix on the next page for more details about Sanger sequencing and how it works.

1. What do you think are the key components in the BigDye® Terminator Ready Reaction Mix (BDT-RRM)?

2. What happens during the annealing phase? 3. What happens during the extension phase


48

Appendix – Sanger – Cycle Sequencing & Detection The following information is taken from the Life Technologies/Applied Biosystems pages: www.lifetechnologies.com/au/en/home/life-science/sequencing/sanger-sequencing/sanger-dna-sequencing.html www.lifetechnologies.com/au/en/home/life-science/sequencing/sanger-sequencing/sanger_sequencing_method.html www.appliedbiosystems.com/absite/us/en/home/applications-technologies/dna-sequencing-fragment-analysis/overview-of-dna-sequencing/sequencing-chemistries.html

Workflow Diagram

Sanger Sequencing Method

During Sanger sequencing, DNA polymerases copy single-stranded DNA templates by adding nucleotides to a growing chain (extension product). Chain elongation occurs at the 3' end of a primer, an oligonucleotide that anneals to the template. The deoxynucleotides added to the extension product are selected by base-pair matching to the template. The extension product grows by the formation of a phosphodiester bridge between the 3'-hydroxyl group on the primer and the 5'-phosphate group of the incoming deoxynucleotide (Watson et al. 1987). Growth occurs in the 5' -> 3' direction (Figure 1). DNA polymerases can also incorporate analogues of nucleotide bases. The dideoxy method of DNA sequencing developed by Sanger et al. in 1977 takes advantage of this characteristic by using 2',3'-dideoxynucleotides as substrates. When dideoxynucleotides are incorporated at the 3' end of the growing chain, chain elongation is terminated selectively at A, C, G, or T. This is because once the dideoxynucleotide is incorporated, the chain lacks a 3'-hydroxyl group so further elongation of the chain is prevented. Cycle sequencing is a simple method in which successive rounds of denaturation, annealing, and extension in a thermal cycler result in linear amplification of extension products (Figure 1). The products are then injected into a capillary.

http://www.lifetechnologies.com/au/en/home/life-science/sequencing/sanger-sequencing/sanger-dna-sequencing.html

http://www.lifetechnologies.com/au/en/home/life-science/sequencing/sanger-sequencing/sanger_sequencing_method.html

http://www.appliedbiosystems.com/absite/us/en/home/applications-technologies/dna-sequencing-fragment-analysis/overview-of-dna-sequencing/sequencing-chemistries.html

http://www.appliedbiosystems.com/absite/us/en/home/applications-technologies/dna-sequencing-fragment-analysis/overview-of-dna-sequencing/sequencing-chemistries.html


49

Figure 1: Cycle sequencing

Fluorescent DNA sequencing can also be performed using a chemistry in which the dyes are attached to the ddNTPs, thereby requiring only one reaction tube per sample. DNA template, unlabeled primer, buffer, the four dNTPs, the four fluorescently labeled ddNTPs, and AmpliTaq® DNA Polymerase are added to the reaction tube. Fluorescent fragments are generated by incorporation of dye-labeled ddNTPs. Each different ddNTP (ddATP, ddCTP, ddGTP, or ddTTP) will carry a different colour of dye. All terminated fragments (those ending with a ddNTP), therefore, contain a dye at their 3’ end (Figure 2).

Figure 2 Fluorescent cycle sequencing

Sanger sequencing by capillary electrophoresis is the gold-standard DNA sequencing technique that is used in a number of experimental workflows in life sciences laboratories. During capillary electrophoresis, the products of the cycle sequencing reaction are injected electrokinetically into capillaries filled with polymer. High voltage is applied so that the negatively-charged DNA fragments move through the polymer in the capillaries toward the positive electrode (Figure 3). Capillary electrophoresis can resolve DNA molecules that differ in molecular weight by only one nucleotide. Figure 3: Fluorescently labeled DNA fragments move through a capillary.


50

Shortly before reaching the positive electrode, the fluorescently-labeled DNA fragments, separated by size, move through the path of a laser beam. The laser beam causes the dyes on the fragments to fluoresce. An optical detection device on Applied Biosystems® genetic analyzers detects the fluorescence signal (Figure 4).

Figure 4: DNA fragments pass through a laser beam and optical detector. The data collection software converts the fluorescence signal to digital data, and records the data in a *.ab1 file. Because each dye emits light at a different wavelength when excited by the laser, all four colours, and therefore, all four bases, can be detected and distinguished in one capillary injection (Figure 5).

Figure 5: Different dyes allow detection of four bases in a single capillary.


51

The 3500 Genetic Analyser


52


• Clean up BigDye® Terminator reactions for Sanger sequencing, understand the

processes involved in the clean up and be able to draw parallels with this and

previous clean up procedures for other molecular processes

• Understand the process of Sanger DNA sequencing


• You will be working with chemicals and pipettes, and must wear lab coats, gloves and safety glasses

(PPE) at all times.


INTRODUCTION: In previous practicals (Weeks 10-11), you analysed four patient samples for the presence of the HFE mutations p.C282Y and p.H63D using real-time PCR. In week 11 you analysed the real-time PCR results and worked out the genotypes of the four patients at these two mutation sites. You also set up Sanger DNA sequencing reactions to confirm the presence of these mutations using a different method. DNA sequencing has the advantage of allowing us to read the individual bases of DNA, something that is not possible using real-time PCR or conventional PCR alone. In today’s practical you will finish off the last step in the DNA sequencing process before it gets analysed by the DNA sequencer instrument. This week’s practical has 1 part to it: Part 1: Clean-up/purification of BigDye® Terminator reactions for Sanger sequencing.

LQB490 Practical Week 12: Clean-up of

BigDye® terminator reaction for Sanger

sequencing


53

Part 1: Clean-up of BigDye® Terminator Reaction for Sanger Sequencing To help ensure an accurate, clear result when sequencing, it is necessary to first purify or ‘clean-up’ the BigDye® Terminator reaction. In week 11, you cleaned up your PCR amplicons to prepare them for inclusion into the BigDye® Terminator sequencing reactions. Why do you think you now need to clean-up the BigDye® reaction? For this clean up, you will use solutions of EDTA (Ethylenediaminetetraacetic acid) and Ethanol.

NOTE: Each student will clean-up (2) BigDye® Terminator reactions. Materials:

• Your 2 BigDye® Terminator reactions from week 11

• 125 mM EDTA, pH 8.0

• 100% Ethanol

• 80% Ethanol


• Barrier tips

• p20, p200 and p1000 micropipettes

• Microcentrifuge

Method:

Clean up BigDye® Terminator reaction Step Procedure Notes

1 Label 2 x 1.5 mL tubes with your initials, patient and mutation locus

Eg DFW P2 H63D and DFW P2 C282Y

2 Add 5 µL of 125 mM EDTA, pH 8.0 into the two 1.5 mL tubes

3 Pipette all 20 µL of your p.H63D sequencing reaction into one tube and your p.C282Y sequencing reaction into the other tube

4 Vortex to mix and pulse spin

5 Add 60µL of 100% Ethanol to each tube

6 Vortex to mix and pulse spin

7 Incubate at room temperature for 15 min

8 Centrifuge at maximum speed for 20 min

Make sure you position the hinge to the outside of the rotor so that you know where the DNA pellet is! If you position your tube correctly, your pellet will end up as shown in the diagram below. This is critical since it will be virtually impossible to actually see the pellet.

Pellet


54

Why do you think it is necessary to clean-up your BigDye® Terminator reaction?

9 Gently remove as much of the solution as possible with a p200 pipette

Insert tip at the front of the tube (opposite the hinge) to avoid touching or removing your pellet. 10 Pulse spin and carefully remove any residual

liquid

11 Add 250 µL of 80% Ethanol

12 Centrifuge at maximum speed for 5 min

13 Gently remove as much of the solution as possible with a p200 pipette

Tip: set the p200 to 125 µL and remove liquid in two stages.

14 Pulse spin and carefully remove any residual liquid.

15 Air dry the pellets on the bench at room temperature for 20 min

Leave the tube in a rack on the bench with the cap open

You have now cleaned your BigDye Terminator reactions. They will be sent to the Genomics Laboratory to be sequenced on the Applied Biosystems 3500 Genetic Analyser (Refer back to Week 11 practical document).


55


• Analyse sequence data using Bioedit software

• Determine genotype from sequence data

• Understand the concept of penetrance and how it applies to the genotypes for hereditary haemochromatosis (HH)

• Be able to make conclusions about the likelihood of hereditary haemochromatosis for each of the three study patients and implications for other family members

INTRODUCTION: In the Week 11 practical, you analysed real time PCR results to assess the presence of both the p.C282Y and p.H63D mutations in your four case study patients. The p.C282Y mutation in the HFE gene is the most common cause of HH. The p.H63D mutation is a more common genetic variant than p.C282Y but is less commonly seen in pathology practice because most HH patients are homozygous for p.C282Y. p.H63D is a milder mutation with lower penetrance than p.C282Y but is also implicated in HH and it is important to look for the presence of this mutation also, particularly with patients that do not show homozygosity for p.C282Y but have presented with a clinical history that might indicate HH. The real time PCR results allowed you to determine the genotypes for all four case study patients at both the p.C282Y and p.H63D loci. In Week 10 you set up PCRs to target the regions containing the p.C282Y and p.H63D mutations and the resultant amplicons were purified and used as template in DNA sequencing reactions in Week 11. These reactions were cleaned up in Week 12 ready for input into the capillary electrophoresis-based Genetic Analyser. These sequencing reactions were used to confirm your real-time PCR results and to give you experience in the Sanger method of DNA sequencing. Occasionally rare mutations other than p.C282Y and p.H63D can be implicated in HH. An example is p.S65C which is located close to the site of the p.H63D mutation. The p.S65C variant is also a mild mutation, similar in penetrance to p.H63D, and its presence can lead to unusual results when using the p.H63D real-time PCR assay. Hence some diagnostic pathology labs will use a DNA sequencing method to check any unusual real-time PCR results. DNA sequencing has the advantage of allowing you to determine the exact base composition of your target DNA molecule. It enables you to discover new sequence variants/mutations, even ones that no one has identified before.

LQB490 Practical Week 13: Analysis of

patient sequence data and Hereditary

Haemochromatosis case study review


56

This week you will analyse the sequence data obtained from the Genetic Analyser for each of the four patients; you will look at the actual sequence of the section of the HFE gene where the mutations are located. You will compare the sequence data to reference sequence data from individuals with the ‘normal’ (NMD) allele and those with the p.H63D and p.C282Y mutations, both homozygous (HOD) and heterozygous (HED). To do this sequence analysis you will be using Bioedit, a freely available software package.

This week’s practical has two parts to it: Part 1: Analysing Patient sequence data Part 2: Review of the case study

Part 1: Analysing Sequence data In this part of the practical, you will work in groups to analyse data for each of the four patients using Bioedit. A selection of sequencing reactions from each patient and for both mutations were run on the Genetic Analyzer after the practicals in Week 12. You will be able to assess the quality of the sequencing output as well as determine genotype from the data for all four patients.

Sequence analysis workflow and additional notes 1. p.H63D sequence analysis.

• By following the Bioedit procedures in Parts A and B of this practical document, look at the sequences for quality, then align all your sequences against the reference sequences.

• Once you have aligned your sequences with the reference sequences, you will find the region of the p.H63D mutation at between 40 and 60 bases, depending on your sequence. Determine the genotype for each of the four patients.

• The sequence of the DNA around the p.H63D mutation site is GATCATG. When the mutation is present you have a base substitution. Which base is substituted for the C in the mutant genotype?

2. p.C282Y Sequence analysis

Repeat the above procedure for the sequences targeting the p.C282Y mutation.

• The sequence of the DNA around the p.C282Y mutation site is CGTGCCA. When the mutation is present you have a base substitution. Which base is substituted for the G in the mutant genotype?

3. Poor Sequence examples The folder “Poor sequence examples” includes sequences that could be better! These provide good information to allow troubleshooting to improve the quality of subsequent sequencing.

• Open these files and have a look at the sequences. Describe any differences you note compared to the quality of the sequences you have been looking at. What do you think could have been the cause and have you any suggestions for improving the quality of repeat sequence analysis?


57

Notes to assist in sequence interpretation

• Occasionally an additional base is inserted in a sequence, a misread in analysis. If this is the case, once the sequences are aligned, a space or dash will be seen in the reference sequences and other sequences that do not have this extra base. This is to ensure that the rest of the sequence is correctly aligned (pretty clever!).

• The 4 bases you are familiar with are A, T, G and C. You may see other ‘letters’ in your sequence data. These are inserted in the sequence when the analyser cannot determine whether it should be one or another base. What sort of zygosity do you think this might represent if a mutation is present?

o M = A or C o R = A or G o Y = C or T o K = G or T o S = G or C o W = A or T


58

BioEdit is a biological sequence alignment editor written for Windows 95/98/NT/2000/XP/7.

An intuitive multiple document interface with convenient features makes alignment and

manipulation of sequences relatively easy on your desktop computer. Several sequence

manipulation and analysis options and links to external analysis programs facilitate a

working environment which allows you to view and manipulate sequences with simple point-

and-click operations

From the website: http://www.mbio.ncsu.edu/bioedit/bioedit.html

A. Analyse p.H63D and p.C282Y targeted sequences

• Access Bioedit from the U drive folder: U:\Health\Student Data\Biomedical Sciences\Bioedit\BioEditSetup.exe

• Install the program: (Press next 3 times and then Install)

• Open BioEdit from All Programs.

• Go to File > Open

http://www.mbio.ncsu.edu/bioedit/bioedit.html


59

• Open your class folder (2021_AM or 2021_PM) from the U drive folder: U:\Health\Student Data\Biomedical Sciences\Bioedit\. Make sure ‘File of type:’ is set to ‘All Files (*.*)’.

• There are a selection of files from your class that correspond to each patient (P1 to P4) and mutation (p.H63D and p.C282Y) combination. Initially open one that corresponds to your patient and the p.H63D mutation. This will bring up a coloured sequence chromatogram and a text file.

• Check your peak resolution, peak height, and spacing.

• Repeat steps 4 to 7, this time looking at your patient and the p.C282Y targeted sequence.


60

B. Compare your sequence against the reference sequences (NMD, HOD, HED) 1. Go to File > Open

1. It is of paramount importance that patients results obtained in the pathology laboratory are valid, meeting quality criteria, before release to requesting doctors. Did your sequencing reaction yield ‘good’ sequencing data? Comment on the appearance of your sequence data, and whether it would be used to determine patient results in the ‘real world’. If not, what do you think is the problem or cause of the unclear sequence?


61

2. Open the alignment file (H63D alignment.gb) in folder: p.H63D ref sequences

• This will bring up a file containing three reference sequences in text format that were derived from individuals known to be NMD, HOD or HED for the p.H63D mutation.


62

3. Import a sequence that corresponds to your patient and the p.H63D mutation into the

alignment file:

• Go to File>Import>Sequence alignment file

• Select your class folder:


63

• Select the file you want to analyse. The sequence will appear underneath the three reference sequences:

4. Go to: Accessory application tab and find ClustalW Multiple alignment


64

5. Click Run ClustalW

6. Click OK:


65

7. A multiple sequence alignment is produced (all four sequences are compared and

aligned by nucleotide position):

8. Identify the presence of any mismatches between your sequence and the reference sequences.

• Some of the buttons above the sequence will shade the alignment in different ways – these features can make it easier to identify sequence variations.

• Determine the genotype for the p.H63D loci of your patient. You can capture your sequence data in a screen shot to attach to your prac document.

• Sometimes you will also see other differences between your sequence of interest and the reference sequences. These can be due to the software incorrectly calling the sequence and it is best to check these anomalies by reviewing the peak pattern in the chromatogram to determine whether they are ‘real’ changes.


66

9. Repeat steps 1 to 8, this time looking at the p.C282Y reference sequences and p.C282Y targeted sequences.

10. Once you have looked at your patient for both the p.H63D and p.C282Y sequences you can have a go with some of the other patients.

From the sequence data – what were the genotypes for p.H63D and p.C282Y for the three patients?

Genotype: HED, HOD, NMD Did the results confirm real time PCR results? Y or N p.H63D p.C282Y

Patient 1

Patient 2

Patient 3

Patient 4

Did the results allow you to confirm the real time PCR results? If not, why?


67

Part 2: Review of Case Study This will be a student discussion (small groups and then feedback to class) about: 1. The molecular workflow:

• what the purpose of each stage was and

• what the results of each process told you about the four patients 2. The outcomes for each of Patients 1, 2, 3 and 4:

• The genotypes for each

• penetrance – likelihood of HH

• Family and patient implications

For this exercise to be beneficial to your learning, you will need to be familiar with the practical case study workflow, what the processes involved, the reasons for undertaking them and the outcomes of each. You will also need to be up to speed on the background information provided to you in the case study introduction document and the presentation on Hereditary Haemochromatosis.

Discussion topics 1. Extraction of genomic DNA – why did you do this?

– What happens in this process? – What methods did you use to analyse the quantity and quality of DNA? – How is this relevant to the patient downstream applications?

2. Real Time PCR – why did you do this? – What happens in this process? – What reactions did you set up? Controls – what and why? – What did it tell you about patients 1-4?

3. Sequencing – why did you do this? – What happens in this process? – Stages of the process and why? – What did it tell you about Patients 1-4?

4. Patient 1 5. Patient 2 6. Patient 3 7. Patient 4 For all patients (topics 4, 5, 6 and 7)

• Does it appear the patients have developed HH? (Clinical history) • What is the likelihood of developing HH with this genotype (penetrance)? • How frequently should these patients be monitored? How often and for what? • Can we determine anything about the parentage of the patients? • What is the likelihood that siblings and offspring of the patient will have

genotypes associated with HH? • Would you recommend testing of family members? Who and why?


68

Documents

LQB490 Molecular Pathology Practical Manual