34
Animal Breeding & Genomics Centre Animal Breeding & Genomics Centre Nutrigenomics in poultry nutrition International Symposium – Nutrition and gut health to manage today’s challenges in poultry production. Wageningen, The Netherlands, Wednesday, 3 June 2009 Mari Smits

Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

  • Upload
    dangthu

  • View
    229

  • Download
    3

Embed Size (px)

Citation preview

Page 1: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Animal Breeding & Genomics Centre

Nutrigenomics in poultry nutritionInternational Symposium – Nutrition and gut health to manage today’s challenges in poultry production. Wageningen, The Netherlands, Wednesday, 3 June 2009

Mari Smits

Page 2: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Overview

IntroductionGenomicsNutrigenomicsExample 1 – 3Conclusions

Page 3: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Nutrition and performance traits

Variation in genome (DNA)

Variation innutrition

Variation in performance traits

Page 4: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

CostsReturnsDeveloping improved animal feeds (knowledge based)

Breeding animals with the most profitable genes

Making the profitable genes to work harder and better

Knowledge profits

Page 5: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

NutrigenomicsGenomics

NutritionPerformance

Nutrigenomics

Page 6: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

DNA is the carrier of all genetic informationDNA

RNA

Protein

Metabolites

Structure

Transport

Communication

Regulation

Page 7: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Genomics: analysis of all genes instead of one

DNA sequence

SequencingSequencing MetabolomicsMetabolomicsMicroarraysMicroarrays

Gene activity Proteins

ProteomicsProteomics

Metabolites

Applications

BioinformaticsBioinformatics

Knowledge

Page 8: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

DNA structure and variation

AGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGCCTTTAAAAGGCT

GCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATAGAAACTGGGC

CAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGCCTTTAA

AAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATAGAAA

TGGGCCAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGC

TTTAAAAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATA

GAAACTGGGCCAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRC

GCGCCTTTAAAAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGG

CCAATAGAAACTGGGCCAATAGA

AGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGCCTTTAAAAGGCT

GCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATAGAAACTGGGC

CAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGCCTTTAA

AAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATAGAAA

TGGGCCAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRCGCGC

TTTAAAAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGGCCAATA

GAAACTGGGCCAATAGAAGCTGGGCCAATAGACAGCGATAGATTGACCAAAGTRC

GCGCCTTTGAAAGGCTGCTTAGCATGTAGATTGACCAAATAGATTGACCACTGGG

CCAATAGAAACTGGGCCAATAGA

Effect on trait?

Page 9: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Genome sequence Gallus gallus

WASHUC2 is an assembly of the

Chicken, Red Jungle Fowl

Statistics

Assembly: WASHUC2, May 2006

Genebuild: Ensembl, Aug 2006

Database version: 48.2f

Known genes: 4,782

Projected genes: 7,432

Novel genes: 4,522

Pseudogenes: 96

RNA genes: 655

Genscan gene predictions: 40,505

Gene exons: 182,183

Gene transcripts: 22,291

SNPs: 3,202,570

Base Pairs*: 1,050,947,331

http://www.ensembl.org/Gallus_gallus/index.htmlWe know all the genes and proteins including their structures

Page 10: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Transcriptomics, proteomics: analysis of all mRNA, proteins, . .

DNA sequence

SequencingSequencing MetabolomicsMetabolomicsMicroarraysMicroarrays

Gene activity Proteins

ProteomicsProteomics

Metabolites

Applications

BioinformaticsBioinformatics

Knowledge

Page 11: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Measuring gene activity

B > A

A > B

A = B

A BDiet A Diet B

Page 12: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Protein profiling – snapshot of “all proteins” in sample

Page 13: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Functional genomics research

treatment

endpoint

functional genomic studies

Understanding biological processes leading to endpoint

Tools to measure, monitor, modulate, develop

endpoint

Page 14: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

NutrigenomicsNutrigenomics is the study of molecular relationships between nutrition and the response of genes.

The aim of nutrigenomics is to extrapolate how nutrition-induced gene expression changes affect performance traits.

Nutrigenomics focuses on the effect of nutrients on the genome, transcriptome, proteome, and metabolome.

By determining the mechanism of the effects of nutrients or the effects of a nutritional regime, Nutrigenomics tries to define the relationship between these specific nutrients or specific nutrient regimes (diets) and performance traits.

Nutrigenomics is a new science, still in its infancy but is expanding rapidly

Page 15: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Nutrigenomics

Page 16: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Nutrigenomics studies - trends

Host Microbes

Food/Feed

Gastrointestinal

track

Imm

une awareness

and competence

Energy partioningand m

etabolism

Gastrointestinalfunctioning

Healthy populations

Healthy organism(human and animal)

Page 17: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Bioinformatics

Microarrays

Proteomics

Storage, management,integration, interpretation

Genomics

Genetics

Physiology

data

data

data

datadata

data

Metabolomics

Comparative genomics:

Transfer of knowledge from one species to another

Page 18: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Genetic Regulation of Feed Intake and Energy Balance in Poultry

A better understanding of the genes associated with controlling feed intake and energy balance and how their expression is regulated by nutritional and hormonal stimuli will offer new insights into current poultry nutrition, breeding and management practices.

Page 19: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Example 1

Effect of an oil byproduct from conjugated linoleic acid (CLA) purification on CLA accumulation and lipogenic gene expression in broilers

J.H. Kim et al.

J. Agric. Food Chem. 2009, 57, 2397–2404 2397

Page 20: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Example 1Research question

Can CLB induce CLA accumulation in muscle without inducing ligogenesis in liver

2% CLA (conjugated linoleic acid)2% CLB (CLA byproduct)2% SAF (safflower oil)2% CON (soybean oil)

456 1-day-old male broiler chicks 4 weeks experimental feeding

No alteration in performance among the test groups.CLA accumulation efficiency in the breast muscle did not differ significantly between the CLA- and CBP-fed groups

Measured in liver gene activity for:sterol regulatory element binding protein 1 (SREBP1)fatty acid synthase (FAS)acetyl coenzyme A carboxylase (ACC)malic enzyme (ME)

Page 21: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Example 1

SREBP1

ACC

FAS

ME

Conclusion: CBP could be an efficient dietary source that promotes CLA accumulation in broiler muscle without inducing lipogenesis in the liver

Page 22: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Example 2 (ASG experiment)

2 groups of 25 animals Group 1: diet AGroup 2: diet BAnalysis of gene activity in jejunum5 pools of 5 animals20K arrayEach pool tested twice

Page 23: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Significant up-regulated genes in diet B compared to diet A

No. Fold up (2log) Homology1 2.26 Hemoglobin-α-chain2 2.21 ch CCLi103 2.19 ENSGALT00000026140.14 2.07 chemokine ah2215 2.07 Genome Hit Contig 1336.16 1.97 NDR-2 (human) weakly similar7 1.96 Early response to neural induction8 1.92 Nuclear receptor (NroB2), weakly similar9 1.89 Insulin-induced gene 1 (Insig-1)10 1.85 Immunoglobulin Heavy Chain11 1.84 F-Box/LRR repeat protein 3A12 1.83 Cytochrome P45013 1.81 Hepatocyte growth factor like protein (HGFL)14 1.80 Thrombospondin receptor (CD#36)15 1.76 ENSGALT00000016755.1

Example 2 (ASG experiment)

Page 24: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Significant down-regulated genes in diet B compared to diet A

No. Fold up (2log) Homology1 3.45 Genome Hit Contig 41.1792 3.22 Squalene mono-oxygenase3 2.49 Aceteacetyl-CoA-synthase4 2.42 isopentyl-diphosphate-deltaisomerase 25 2.37 C4 methyl sterol oxidase6 2.36 B – G protein precursor/MHC 3-G antigen7 2.29 Hypothetical Protein8 2.25 Hydroxysteroid (17 beta) dehydroxygenase9 1.96 ENSGALT00000011147.110 1.84 ENSGALT00000013304.111 1.80 ENSGALT00000011832.112 1.73 ENSGALT00000022866.113 1.72 Genome Hit Contig 190.2614 1.72 α2-macroglobulin precursor α215 1.69 soluble carrier family 1

Example 2 (ASG experiment)

Page 25: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Example 2: conclusions, biological interpretationDiets A and B affect gene expression patterns in jejunum

Diet B downregulates cholesterol biosynthesis pathway throughInsig-1↑ (B): “inhibiting” of SREBP1CD36 ↑(B) = receptor for LDL cholesterol uptake macrophages

Some genes involved in immune functions are regulatedB-G precursor protein ↓ (B)= MHC complexchemokine ah221 ↑ (B)= T-cel chemotaxis

SREBPInsig-1

SREBP+

Page 26: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Example 3Maternal diet influences gene expression in intestine of offspring in chicken (Gallus gallus)

Rebel et al. 2006

Influences eggs yolk composition

Hatchability

Mortality offspring

Villus length in intestine

Susceptibility for MAS

Circulating lymphocytes

Mother diet influences intestinal development

Mother diet:

Hypothesis:

Page 27: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Example 3Maternal diet influences gene expression in intestine of offspring in chicken (Gallus gallus)

Week 18-30 high/low feedmix

Week 29: collection of fertilized eggs

Offspring reared under same conditions

Day 3, 14, 15 intestinal sections taken

RNA pools (5 animals per group)

Measure gene actiivity

Immunohistochemistry

Exp approach:

Page 28: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Example 3Maternal diet influences gene expression in intestine of offspring in chicken (Gallus gallus)

Composition of breeder feed

0.25 mg/kg0.125 mg/kgSelenium

15 mg/kg7.5 mg/kgCopper

70 mg/kg40 mg/kgZinc

16 mg/kg8 mg/kgVitamin B2

6 mg/kg3 mg/kgVitamin B1

100 mg/kgNot addedVitamin C

200 IU10 IUVitamin E

3000 IU2500 IUVitamin D

15,000 IU7500 IUVitamin A

High feed mixLow feed mix weight of broilers

0

200

400

600

800

1000

1200

1400

1600

1800

3 7 14 21 32

time in days

wei

ght i

n gr

ams

broilers of breeders lowbroilers of breeders high

Weight of broilers

Page 29: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Example 3Maternal diet influences gene expression in intestine of offspring in chicken (Gallus gallus)

In the intestines of the offspring, 11 genes were found to be differentially expressed at day 3 and 11 after hatch.

Genes higher expressed in the “high mix” mothers are involved in epithelial turnover and maturation.

Page 30: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Maternal diet influences gene expression . . . . . . . and cell proliferation patterns

In all three areas investigated, the decrease in number of proliferating cells from day 3 to day 14 is less in the offspring of the “ high mix” group.

Conclusion: mother diet influences intestinal development in offspring

Page 31: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Maternal diet influences gene expression . .and host respons to MAS

Experimental MAS challenge

Mother feed high and offspring regularMother feed regular and offspring regular

Offspring inoculated with MAS or Saline at day 1 of ageSampling 1,3,7,14, 21 days pi

MAS: Flattened crypt epithelium,

cystic crypt, villus atrophy

Nprmal

Time PI Lesions Low mix High mix cystic crypt + ++ Day 3 villus atrophy 0 +++ Pmn inf ++ +++++ cystic crypt +++++ +++ Day 7 villus atrophy +++ +++ Pmn inf ++++ +++ cystic crypt ++++ ++ Day 14 villus atrophy ++ +++ Pmn inf ++ +++ cystic crypt ++ 0 Day21 villus atrophy + + Pmn inf + 0

Page 32: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Effect of an oil byproduct from conjugated linoleic acid (CLA) purification on CLA accumulation and lipogenic gene expression in broilers.Effects of 1alpha-hydroxycholecalciferol on growth performance, parameters of tibia and plasma, meat quality, and type IIb sodium phosphate cotransporter gene expression of one- to twenty-one-day-old broilers.Short term changes in the expression of lipogenic genes in broilers (Gallus gallus).Dietary supplementation of glycine modulates inflammatory response indicators in broiler chickensEffects of source and level of magnesium on catalase activity and its gene expression in livers of broiler chickensEffects of daidzein on messenger ribonucleic acid expression of gonadotropin receptors in chicken ovarian follicles.Expression of the chicken peroxisome proliferator-activated receptor-gamma gene is influenced by aging, nutrition, and agonist administration.An examination of the role of feeding regimens in regulating metabolism during the broiler breeder grower period. 1. Hepatic lipid metabolism. Effect of early feed restriction on myofibre types and expression of growth-related genes in the gastrocnemius muscle of crossbred broiler chickensEffect of diet containing phytate and phytase on the activity and mRNA expression of carbohydrase and transporter in chickens.Effects of dehydroepiandrosterone (DHEA) on hepatic lipid metabolism parameters and lipogenic gene mRNA expression in broiler chickensDietary nitrogen intake regulates hepatic malic enzyme messenger ribonucleic acid expressionEffect of manganese supplementation and source on carcass traits, meat quality, and lipid oxidation in broilers

Examples of recent nutrigenomic studies in poultry

Page 33: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Conclusions

Nutrigenomics approaches become more important in animal nutrition research

Nutrigenomics approaches provide deeper insight into the relationships between nutrition and the response of genes

Nutrigenomics approaches provide deeper insight into the mechanisms how nutrition-induced gene expression changes affect performance traits

Nutrigenomics tools can be used to measure the physiological effects of specific nutrients or specific nutrient regimes

In the future, knowledge obtained by nutrigenomics approaches may be applied to specifically modulate performance traits by nutrition

In the future knowledge obtained by nutrigenomics approaches may be applied to develop new (more knowledge based) animal feeds / nutrient regimes

Page 34: Mari Smits Animal Breeding & Genomics Centre - eliasnutri · PDF fileAnimal Breeding & Genomics Centre Nutrition and performance traits Variation in genome (DNA) Variation in nutrition

Animal Breeding & Genomics Centre

Animal Breeding & Genomics Centre

Thanks for your attention