Materials and Methods Genetic Mapping Population and Plant … · 2019. 2. 11. · 1 Materials and Methods Genetic Mapping Population and Plant Material Rice (Oryza sativa L.) recombinant

1

Materials and Methods

Genetic Mapping Population and Plant Material

Rice (Oryza sativa L.) recombinant inbred lines (RILs) were developed by crossing

indica variety ‘Teqing’ with temperate japonica variety ‘02428’, followed by more

than six rounds of self-pollination (1). The near-isogenic line was isolated from a

BC5F2 backcross population in the ‘Teqing’ background. The indica rice cultivar

‘Teqing’ and the japonica rice cultivar ‘Nipponbare’ and ‘Zhonghua 11’ were used

for genetic transformation. A set of 101 O. sativa and 21 O. rufipogon accessions

collected worldwide were used for the HAN1 haplotyping by Sanger sequencing (2, SI

Appendix, Tab. S5-6). In addition, 572 rice accessions with genomic sequence

information generated by next generation sequencing were analyzed for nucleotide

diversity and used in a selective sweep analysis. Some accessions with known

geographic information were mapped. Information for each accession is provided in

SI Appendix, Tab. S7. Raw sequence data have been deposited in the Genome

Sequence Archive in BIG Data Center, Beijing Institute of Genomics, Chinese

Academy of Sciences, under accession numbers CRA000778, CRA000779 and

CRA000995 and are publicly accessible (http://bigd.big.ac.cn/gsa).

Evaluation of Phenotypes

To test chilling tolerance of rice, 7-day-old seedlings of the RILs and the ‘Teqing’

transgenic lines were cold-treated at 10oC for 4-6 days, while the ‘Nipponbare’ or

‘Zhonghua 11’ and their derived transgenic lines were treated at 4oC for 4-6 days in a

growth chamber (Percival Scientific, Perry, IA). After the plants had recovered at

28oC/25

oC day/night cycles for 3–7 days, the survival rates were determined based on

the percentage of surviving seedlings (3). To test freezing tolerance of Arabidopsis,

12-day-old soil-grown plants of wild type (Col-0), mutant cyp94b3, and

complementary line carrying 35S::HAN1 in the mutant, were freeze-treated at -10°C

for 1.5 h. After freezing treatment, plants were incubated at 4°C in the darkness for 10

h and then transferred to light at 22°C. Survival rates of the seedlings were scored

www.pnas.org/cgi/doi/10.1073/pnas.1819769116

2

visually after 7 d (4). At least three independent experiments were carried out. A total

of 30-50 healthy plants were cold treated in each treatment. The significant

differences between genotypes were analyzed using ANOVA or Student’s t-test.

To evaluate yield-related traits, each line was planted in the experimental fields in

Changsha (28°11’N, 112°58’E) or Sanya (18°09′N, 109°48′E) both in China, and

cultivated following standard agricultural management practices for rice (5). There

were ten plants for each line, and significant differences between genotypes were

analyzed with Student’s t-test.

QTL Analysis and Fine Mapping

Linkage maps were constructed with MAPMAKER/EXP 3.0 software (6). Putative

QTLs were determined using interval mapping in Windows QTL Cartographer 2.5

software (7). LOD thresholds were based on 1,000-iteration permutation tests

(P=0.05). The additive and dominant effects, as well as phenotypic variances (R2)

explained by each QTL, were estimated from the peak LOD score. The 95%

confidence interval for each QTL was determined by the left and right points having a

LOD value of 2 points below the peak point (8). Thirteen extremely cold-sensitive

RILs with <5% survival rate and 10 extremely cold-tolerant RILs with survival

rate >85% were genotyped using the newly developed markers around the primary

HAN1 mapping interval, and HAN1 was fine-mapped to an 871-kb interval.

To fine-map the interval containing HAN1, we genotyped a total of 3,000 BC5F2

individuals derived from BC5F1 plants that were heterozygous at the 871-kb region

but homozygous at another QTL on chromosome 4. A total of 11 recombinants were

isolated for further phenotyping. Based on the differences in chilling tolerance in the

B5CF2 plants, we localized HAN1 to a 59-kb genomic interval between marker loci

R11ID1693 and R11ID1699.

Plasmid Construction and Plant Transformation

Fragments of HAN1 were amplified from genomic DNA of ‘Teqing’ and ‘02428’ for

vector construction. Each DNA fragment was cloned into the binary vectors based on

3

homologous recombination technology using the ClonExpress Entry One Step

Cloning Kit (Vazyme, Nanjing, China). The recipient vectors were pTCK303 for

overexpression of HAN1 (pUbiquitin::HAN1Teqing

, and pUbiquitin::HAN102428

),

pBWA(V)HVE for estrogen-inducible expression of HAN1 (pER8::HAN1Teqing

,

pER8::HAN102428

), pCAMBIA1300 for the complementation assay

(pHAN1Teqing

::HAN102428

, pHAN102428

::HAN102428

), and pCAMBIA1301 for activity

analysis of the HAN1 promoter regions (pHAN1Teqing

::GUS, pHAN102428

::GUS),

respectively. To generate the CRISPR/Cas9 knockout lines, the Cas9 gene was driven

by the promoter of CaMV35S, while the 20 bases upstream of the protospacer

adjacent motifs (PAM) were selected as candidate target sequences and driven by the

promoter of OsU3 in the binary vector of BGK03. The target regions in the genome of

the transgenic plants were then sequenced using the PCR products (9). To obtain the

lines with a deletion of the MYB cis-element in the promoter of HAN1(han1ΔMYB

), the

24-bp long fragment containing the MYB cis-element was deleted by Cas9 protein

recognizing and digesting its two flanking PAM motifs in the genetic background of

temperate japonica rice cultivar ‘Zhonghua 11’. All plasmid vectors were introduced

into Agrobacterium tumefaciens strain EHA105 followed by Agrobacterium-mediated

transformation of rice cultivars ‘Teqing’, ‘Nipponbare’, or ‘Zhonghua 11’. For

complementation of the Arabidopsis mutant cyp94b3, the full-length coding region of

HAN102428

was cloned into the plant binary vector pBWA(V)HS to generate

35S::HAN1, which was then used to transform the Arabidopsis mutant cyp94b3 by

Agrobacterium-mediated transformation. With the exception of T0 transgenic plants of

pUbiquitin::HAN1Teqing

and pUbiquitin::HAN102428

, all other homozygous T3 seedling

were phenotyped. The total number of independent transgenic lines are as followed:

18 of pUbiquitin::HAN1Teqing

, 15 of pUbiquitin::HAN1

02428, 11 of pER8::HAN1

02428,

12 of pER8::HANTeqing

, seven of pHAN1Teqing

::GUS, six of pHAN102428

::GUS, four of

pHAN1Teqing

::HAN102428

, five of pHAN102428

::HAN102428

, three of 35S::HAN1/cyp94b3,

two of han1 and one han1ΔMYB

respectively.

4

Transient expression in plant protoplasts

The firefly luciferase (LUC) was fused to the promoters of HAN1 with ‘Teqing’ or

‘02428’ genotypes, and also to a mutated promoter of HAN1 with only one base

change from A to G at the -1543(G-A) site on the base of ‘02428’ type. Subsequently,

two parental types, pHAN1Teqing

::LUC and pHAN102428

::LUC, and the mutated type,

pHAN102428m

::LUC, were introduced into Arabidopsis protoplasts by PEG-mediated

transformation. The 35S::GUS plasmid was used as an internal transformation control

to provide an estimate of the transient expression level. Ratios of LUC to GUS

activity were used to define relative promoter activity. Three to five biological

replicates, each with ten technical replicates, were assayed for each construct. The

methodological details are described in Zhang et al. (10).

Subcellular Localization and GUS staining of HAN1

The vectors 35S::HAN1-GFP, 35S::GFP, and the endoplasmic reticulum (ER) marker

35S::HDEL-RFP, were introduced into rice protoplast cells by PEG-mediated

transformation or into leaves of N. benthamiana by agro-infiltration. Green and red

fluorescence signals were observed with a laser confocal microscope (Olympus

FV1000). GFP was excited with a 488nm laser, and RFP was excited with a 543nm

laser. The emission spectra were collected at 500-550 nm for GFP, and 565-653 nm

for RFP.

GUS staining of young seedlings and mature transgenic plants harboring the

pHAN1::GUS construct was performed as previously described (11).

In silico Microarray Expression Data Analysis

Expression profile data of HAN1 at all growth stages were retrieved from CREP

(http://crep.ncpgr.cn) (12).

Quantitative RT-PCR Analysis

Total RNA was extracted from plant tissues using TRIZOL reagent (Sangon, Shanghai,

China) and was reverse transcribed into cDNA using the M-MLV Reverse

5

Transcriptase kit (Promega, Madison, WI, USA). Quantitative RT-PCR (qPCR) was

performed using SYBR I Premix ExTaq (Takara Bio, Kusatsu, Shiga, Japan). The

gene expression levels in three biological replicates were calculated using the ∆∆Ct

method. Student’s t-test was used to determine whether there were significant

differences between samples.

Oxidase Activity Assay

Using an in vitro enzyme assay in yeast heterologous expression system, CYP94B3,

the HAN1-orthologous protein in Arabidopsis, has been shown to act as an oxidase

that metabolizes JA-Ile, the biologically active form of JA, to 12OHJA-ILE, an

inactive form (13). To confirm HAN1 oxidase activity, the ORFs of HAN1Teqing

,

HAN102428

, and CYP94B3 were amplified from the genomic DNA of rice cultivars

‘Teqing’ and ‘02428’, and Arabidopsis ecotype Colombia (Col-0), and subsequently

cloned individually into the yeast expression vector pYES2/NTC. The resulting

vectors, pGAL1::HAN1Teqing

, pGAL1::HAN102428

, and pGAL1::CYP94B3 (positive

control), plus the empty vector (negative control), were transformed into the INVSc1

strain of S. cerevisiae. The microsomal proteins isolated from these yeast cells under

galactose inducible expression were incubated with the JA-Ile substrate in the reaction

mixture at 37oC for 1 hour. The resulting mixture was directly analyzed for the

presence of 12OH-JA-Ile by LC-MS/MS. For details of the methods used, refer to

Koo et al. (13).

Measuring Endogenous JA-Ile Levels

Quantification of endogenous JA-Ile was performed as described by Koo et al. (13).

Briefly, 7-day old seedlings of the NILs with genotypes HAN1Teqing/Teqing

and

HAN102428/02428

were treated at 8oC in a Percival growth chamber. Fresh leaves were

harvested after 0, 3, and 24 hours of cold treatment, and ~1 g samples were used for

the measurements, with three biological replicates.

Haplotype Analysis and Phylogenetic Analysis of HAN1

Haplotype analysis was performed on the genomic sequences including the HAN1

6

promoter and coding regions from 101 O. sativa and 22 O. rufipogon accessions.

HAN1 was amplified by PCR, and the resulting DNA fragments were subjected to

Sanger sequencing. A neighbor-joining tree based on the HAN1 nucleotide sequences

from the rice varieties was constructed using MEGA 5.0 (14). Nucleotide diversity of

HAN1 in the different groups was calculated using DnaSP 5.10 (15). A phylogenetic

network was constructed using the median-joining model implemented in network

version 4.6 (16).

The sequences of the 1.0-Mb regions flanking HAN1 from 572 rice cultivars were

retrieved from sequence dataset (http://bigd.big.ac.cn/gsa. Accession numbers:

CRA000778, CRA000779 and CRA000995). Possible artificial selection on HAN1

was evaluated between two populations cultivated in either typical temperate climate

regions at high latitudes (>40oN) or in subtropical and tropical climate regions at

lower latitudes (<40oN) using ‘vcftools’ with 10k sliding windows and 5k step (17).

The likelihood-based selective sweep detection was calculated by ‘SweeD’ with a 2kb

grid size (18). Windowed nucleotide diversity and selection likelihood in the region

ranging from 16.5 Mb to 17.5 Mb on chromosome11 were plotted using the R

package ‘ggplot2’ (19).

Oligonucleotide Primers

The sequences of primers used for QTL mapping, gene cloning, expression analysis,

and vector construction are listed in SI Appendix, Tab. S8.

References

1. Mao DH, Liu TM, Xu CG, Li XH, Xing YZ (2011) Epistasis and complementary

gene action adequately account for the genetic bases of transgressive segregation of

kilo-grain weight in rice. Euphytica 180: 261-271.

2. Garris AJ, Tai TH, Coburn J, Kresovich S, McCouch S (2005) Genetic structure

and diversity in Oryza sativa L. Genetics 169:1631–1638.

3. Mao D, Yu L, Chen D, Li L, Zhu Y, Xiao Y, Zhang D, Chen C (2015) Multiple cold

7

resistance loci confer the high cold tolerance adaptation of Dongxiang wild rice

(Oryza rufipogon) to its high-latitude habitat. Theor Appl Genet 128(7):1359-1371.

4. Hu Y, Jiang L, Wang F, Yu D (2013) Jasmonate regulates the inducer of CBF

EXPRESSION-C-REPEAT BINDING FACTOR/DRE BINDING FACTOR1 cascade

and freezing tolerance in Arabidopsis. Plant Cell 25(8):2907-2924.

5. Xing Y, Tan Y, Xu C, Hua J, Sun X (2001) Mapping quantitative trait loci for grain

appearance traits of rice using a recombinant inbred line population. Acta Bot Sin

43:840-845.

6. Stephen EL, Lincoln SE, Lander ES (1990) Constructing genetic maps with

MAPMAKER: a tutorial and reference manual. A Whitehead Institute for Biomedical

Research, Cambridge, USA.

7. Wang S, Basten C, and Zeng ZB (2006) Windows QTL Cartographer 2.5.

Department of Statistics, North Carolina State University, Raleigh, NC.

8. Van Ooijen JW, Boer MP, Jansen RC, Maliepaard C (2002) MapQTL 4.0, software

for the calculation of QTL positions on genetic maps. Plant Research International,

Wageningen, the Netherlands.

9. Lu Y, Ye X, Guo R, Huang J, Wang W, Tang J, Tan L, Zhu JK, Chu C, Qian Y

(2017) Genome-wide targeted mutagenesis in rice using the CRISPR/Cas9 system.

Mol Plant 10(9):1242-1245.

10. Zhang Z, Li J, Pan Y, Li J, Zhou L, Shi H, Zeng Y, Guo H, Yang S, Zheng W, Yu J,

Sun X, Li G, Ding Y, Ma L, Shen S, Dai L, Zhang H, Yang S, Guo Y, Li Z (2017)

Natural variation in CTB4a enhances rice adaptation to cold habitats. Nat Commun

8:14788.

11. Liu W, Zhang D, Tang M, Li D, Zhu Y, Zhu L, Chen C (2013) THIS1 is a putative

lipase that regulates tillering, plant height, and spikelet fertility in rice. J Exp Bot.

64(14):4389-4402.

12. Wang L, Xie W, Chen Y, Tang W, Yang J, Ye R, Liu L, Lin Y, Xu C, Xiao J, Zhang

8

Q (2010) A dynamic gene expression atlas covering the entire life cycle of rice. Plant

J 61(5):752-766.

13. Koo AJ, Cooke TF, Howe GA (2011) Cytochrome P450 CYP94B3 mediates

catabolism and inactivation of the plant hormone jasmonoyl-L-isoleucine. Proc Natl

Acad Sci USA 108(22):9298-9303.

14. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4, molecular evolutionary

genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599.

15. Librado P, Rozas J (2009) DnaSP v5: a software for comprehensive analysis of

DNA polymorphism data. Bioinformatics 25(11):1451-1452.

16. Bandelt HJ, Forster P, RolA (1999) Median-joining networks for inferring

intraspecific phylogenies. Mol Biol Evol 16(1):37-48.

17. Danecek P, Auton A, Abecasis G, Albers CA, Banks E, DePristo M, Handsaker R,

Lunter G, Marth G, Sherry S, McVean G, Durbin Rd (2011) The variant call format

and VCFtools. Bioinformatics 27: 2156–2158.

18. Nielsen R, Williamson S, Kim Y, Hubisz MJ, Clark AG, Bustamante C (2005)

Genomic scans for selective sweeps using SNP data. Genome Res 15(11):1566-1575.

19. Ginestet C. ggplot2: Elegant Graphics for Data Analysis (2011) Journal of the

Royal Statistical Society 174(1):245–246.

9

Supplementary Figure 1 QTL mapping for chilling tolerance at the seedling stage in

the population derived from a cross between the two cultivars ‘Teqing’ and‘02428’.

A) Performance of the parental rice cultivars ‘Teqing’ and ‘02428’ after 4, 6, 8, and 10

days of chilling stress treatment. B) The survival rate (%) of the parental rice cultivars

10

‘Teqing’ and ‘02428’ after 4, 6, 8, and 10 days of chilling stress treatment (Student’s

t-test, *P < 0.01, n = 3). C) Survival rate frequencies of the RILs after chilling stress

treatment. The results of three biological replications, I to III, are shown. D) Location

of the HAN1 QTL on the linkage map constructed in the ‘Teqing’/‘02428’ RIL

population (interval mapping in Windows QTL Cartographer 2.5 software). E)

Graphical genotyping of the HAN1 fine-mapping NIL involving the chilling tolerance

QTL on chromosomes (Chr.). Ovals indicate QTLs for chilling tolerance detected at

the seedling stage in the ‘Teqing’/‘02428’ RILs population; horizontal lines show the

molecular marker loci used for genotyping; the white, grey and green rectangles

represent homozygous ‘Teqing’, heterozygous, and homozygous ‘02428’ regions,

respectively. F) Chilling tolerance of three genotypes in the near isogenic line

background. Letters ‘a’ and ‘b’ indicate that there was a significant difference in

chilling tolerance among the genotypes using Student’s t-test with P < 0.05 (5

independent lines of T/T, 8 lines of T/0, and 3 lines of 0/0).

11

Supplementary Figure 2 The performance of HAN1-overexpressing transgenic rice

plants. A) Schematic diagram of the DNA constructs used for overexpression of

HAN1 in rice. B) Performance of the pUbi::HAN1 transgenic plants carrying the two

parental alleles at the seedling stage.

12

Supplementary Figure 3 The performance of HAN1 transgenic lines using the

estrogen inducible expression system. A) Diagram of the genetic constructs used for

estrogen-inducible expression of HAN1. B) Relative expression level of HAN1 in

HAN1 transgenic lines and wild type (Student’s t test, **

P < 0.01, NS

P > 0.05, n = 3). C)

Performance of HAN1 transgenic lines and wild type after chilling stress. D) Survival

of HAN1 transgenic lines and wild type after chilling treatment (Letters ‘a’ and ‘b’

indicate a significant difference in chilling tolerance among the genotypes by

Student’s t-test with P < 0.05 and n = 3).

13

Supplementary Figure 4 Subcellular localization of HAN1.

A-E) The subcellular localization of GFP from the empty vector (A-C), and the

subcellular co-localization of HAN1 and the endoplasmic reticulum marker HDEL via

transient expression in rice protoplasts (C-E). F-K) Subcellular localization of HAN1

and the ER marker protein HDEL via transient expression in cells of agro-infiltrated

tobacco leaves. I, J, and K are the enlarged insets in panels F, G, and H, respectively.

14

Supplementary Figure 5 Expression profiles of HAN1 in rice. Gene expression

profile data of HAN1 during the entire growth period was retrieved from CREP

(http://crep.ncpgr.cn.) and RiceGE (http://signal.salk.edu/cgi-bin/RiceGE). ZS97,

MH63 and IR64 are the rice cultivars used for gene expression analysis.

15

Supplementary Figure 6 GUS histochemical assays of HAN1 expression

The transgenic plants that carried the reporter gene GUS driven by the HAN1

promoter region from either ‘Teqing’ or ‘02428’ allele in the ‘Nipponbare’

background were histologically stained to analyze the expression pattern. A-K) GUS

staining of rice tissues under normal conditions: A young panicle, B glume, C glume

and stamen, D mature seed, E leaf sheath, F leaf, G stem, H root hair, I root, J radicle

and coleoptile, and K leaf sections stained for GUS expression before and after

chilling treatments.

16

Supplementary Figure 7 Analysis of HAN1oxidase activity .

The microsomal proteins isolated from these yeast cells expressing pGAL::CYP94B3,

pGAL::HAN1Teqing

, pGAL::HAN102428

, or empty vector under galactose inducible

expression were incubated with JA-Ile substrate in the reaction mixture at 37oC for 1

hour. A) LC-MS/MS analysis of substrate JA-Ile in the terminated reaction mixture. B)

LC-MS/MS analysis of 12OH-JA-Ile in the terminated reaction mixture.

pGAL::CYP94B3 and empty vector represented the positive and negative control,

respectively.

17

Supplementary Figure 8 Phylogenetic tree of the HAN1 gene in the five ecotypes

and O. rufipogon accessions based on Sanger sequencing data. Ind, Aus, Aro, Trj, Tej,

and Wild represent the five rice ecotypes, indica, aus, aromatic, tropical japonica, and

temperate japonica rice, and wild O. rufipogon rice, respectively.

18

Supplementary Figure 9 Haplotype network of HAN1 in 122 cultivated and wild rice

accessions. Circle size is proportional to the number of samples of a given haplotype.

Different colors represent different subgroups: orange for aus, yellow for indica, gray

for aromatic, light green for tropical, dark green for temperate japonica rice, and blue

for wild rice.

19

Supplementary Figure 10 Functional analysis of the putative MYB cis-element in

the promoter region of HAN1

A) DNA construct maps and relative expression levels of LUC under chilling

treatment (4oC) in Arabidopsis protoplasts driven by the promoters of pHAN1

02428,

pHAN1Teqing

, and pHAN102428m

. pHAN102428

and pHAN1Teqing

are the promoters from

the two parental lines. pHAN102428m

represents the mutant promoter with a single base

change from A to G at the MYB cis-element. Student’s t-test, **

P < 0.01, n = 5. B)

20

Partial DNA sequences from wild type and HAN1 knockout mutant han1ΔMYB

,

showing the specific mutations. MYB represents the MYB cis-element with base

sequence AACCA, and PAM represents protospacer adjacent motif (NGG) for

CRISPR/Cas9 DNA target cleavage. C) a 24-bp deletion was detected by molecular

marker. D) and E) Seedling performance of han1ΔMYB

and wild type in genetic

background of japonica rice cultivar ‘Zhonghua 11’ under control (D) or chilling

treatment (E). F) RT-qPCR expression analysis of han1ΔMYB

and wild type under

chilling stress (NT, normal temperature of 28oC for 24hr; CS, chilling stress of 4

oC for

24hr; Actin is reference gene, Student’s t-test, **P < 0.01, n = 3). G) Seedling survival

rate of han1ΔMYB

and wild type after chilling stress treatment (Student’s t-test,

*P<0.05, n = 3).

21

Supplementary Figure 11 Yield-related traits for HAN1 NILs, transgenic lines, and

knock-out lines grown under field conditions. A) han1 and WT, the CRISPR/Cas9

HAN1 knock-out line and the wild type ‘Nipponbare’; B) 290C and WT, the

pHAN102428

::HAN102428

transgenic line and the wild type ‘Teqing’; C) TT and OO, the

NILs with genotypes of HAN1Teqing/Teqing

or HAN102428/02428

. Student’s t-test, *P < 0.05,

**P < 0.01, and NS

P > 0.05 (n = 10).

22

Supplementary Table 1 QTL mapping of chilling tolerance at seedling stage in the

‘Teqing’/ ‘02428’ RIL population

Chr.a Interval

b LOD

c Add%

d Var%

e

4 RM518-RM261 5.2 -12.4 13.2

11 RM332-RM536 11.5 20.4 35.8

aChromosomes where QTLs were located;

bIntervals where QTLs were located;

cLOD

threshold was confirmed by 1000-iteration permutation test (P=0.05), and LOD

scores greater than the thresholds are shown in the table; dAdditive effect, where a

positive value means that the ‘02428’ allele increased chilling tolerance; ePercentage

of total phenotypic variance explained by QTLs;

23

Supplementary Table 2 Extremely sensitive or tolerant RILs for fine mapping of

HAN1 R

IL N

um

ber

a Marker genotype

b

Phen

oty

pe

c

RM

332

R11ID

443

R11ID

542

R11ID

722

R11ID

807

RM

536

RM

5857

RM

26652

R11ID

1646

R111ID

1693

RM

287

R11ID

1733

R11ID

1764

RM

229

155 T T T T T T T T T T T 0 0 0 ES

116 T T T T T T T T T T T T T 0 ES

186 0 T T T T T T T T T T T T T ES

57 0 0 T T T T T T T T T T T T ES

97 0 0 0 T T T T T T T T T T T ES

100 0 0 0 T T T T T T T T T T T ES

41 T 0 0 T T T T T T T T T T T ES

59 T T 0 0 T T T T T T T T T T ES

21 0 0 0 0 T T T T T T T T T T ES

93 0 0 0 0 T T T T T T T T T T ES

63 0 0 0 0 0 0 T T T T T T T T ES

145 T 0 0 0 0 0 0 T T T T T T T ES

101 0 0 0 0 0 0 0 0 0 T T T T T ES

89 T T T T T 0 0 0 0 0 0 0 0 0 ET

45 T T T 0 0 0 0 0 0 0 0 0 0 T ET

58 T 0 0 0 0 0 0 0 0 0 0 0 0 T ET

84 T 0 0 0 0 0 0 0 0 0 0 0 0 0 ET

67 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ET

71 0 0 0 0 0 0 0 0 0 0 0 0 0 T ET

103 0 0 0 0 0 0 0 0 0 0 0 0 0 T ET

123 0 0 0 0 0 0 0 0 0 0 0 T T T ET

131 T T T 0 0 0 0 0 0 0 0 0 0 0 ET

135 0 0 0 0 0 0 0 0 0 0 0 0 0 0 ET

a Number of each RIL;

b Marker genotype of each RIL, ‘T’ and ‘0’ mean ‘Teqing’/

‘Teqing’ or ‘02428’/‘02428’ genotype, respectively; c

Phenotype of each line, ES

and ET stand for extremely sensitive or tolerant to chilling stress (The survival rate:

ES < 5%, ET > 85%; three biological repeats for chilling tolerance phenotyping of

each line).

24

Supplementary Table 3 Recombinants from RIL and NIL populations for fine mapping of HAN1 R

ecom

bin

ant

s N

um

ber

s a

R11ID

1535 b

R11ID

1542

R11ID

1551

R11ID

1578

R11ID

1583

R11ID

1628

R11ID

1646

R11ID

1693

R11ID

1699

RM

287

R11ID

1733

R11ID

1740

R11ID

1748

R11ID

1762

R11ID

1764

SU

R%

c

SU

R%

(T/T

)d

SU

R%

(0/0

) e

P-V

alue

f

Ril101 0 0 0 0 0 0 0 T T T T T T T T 0.0±0.0

Ril123 0 0 0 0 0 0 0 0 0 0 T T T T T 87.1±0.6

Ril155 T T T T T T T T T T 0 0 0 0 0 2.4±4.1

Nil-c15 T T T T T T T T T T H H H H H 1.3±2.3 0.5±0.9 0.405

Nil-c23 T T T T T T T T T T H H H H H 22.0±11.4 17.2±16.7 0.644

Nil-m25 T T T T T T T T T T H H H H H 15.2±7.0 12.7±8.9 0.591

Nil-s13 T T H H H H H H H H H H H H H 0.3±0.8 7.8±6.1 0.026

Nil-m31 H H H H H H H H H H T T T T T 4.9±4.1 51.5±12.3 5E-04

Nil-s26 0 0 H H H H H H H H H H H H H 14.1±10.2 43.8±24.5 0.044

Nil-s54 0 0 H H H H H H H H H H H H H 30.5±4.0 56.2±12.3 3E-04

Nil-m10 0 0 0 0 H H H H H H H H H H H 7.6±6.6 39.5±18.4 0.042

Nil-c51 0 0 0 0 0 0 0 0 0 H H H H H H 37.4±8.7 24.1±2.1 0.135

Nil-c54 0 0 0 0 0 0 0 0 0 H H H H H H 26.6±14.5 42.1±25.9 0.169

Nil-c29 0 0 0 0 0 0 0 0 0 0 H H H H H 68.6±13.9 64.0±17.9 0.607 a Recombinants for fine mapping of HAN1 (‘Ril’ and ‘Nil’ were derived from RIL or NIL population, respectively);

b Marker genotype of each

recombinant group: ‘T’ , ‘0’ , and ‘H’ indicate the genotypes of ‘Teqing’/‘Teqing’, ‘02428’/‘02428’, or ‘Teqing’/‘02428’, respectively; c

Chilling

tolerance of recombinants from RIL population; d

and e Chilling tolerance of ‘Teqing’/‘Teqing’ or ‘02428’/‘02428’ progenies of NIL

recombinants based on the genotypes of markers in the ‘Teqing’/‘02428’ interval (n ≥ 3 for each genotype); f Student’s t-test between two

genotypes of the progenies.

25

Supplementary Table 4 Candidate genes in the HAN1 interval

Gene ID Annotation Orthologous genes Putative function Pub

LOC_Os11g29200 Protein transport protein - -

LOC_Os11g29210 Resistance-gene-interacting protein - -

LOC_Os11g29220 Hypothetical protein - -

LOC_Os11g29230 Pentatricopeptide repeat protein - -

LOC_Os11g29240 Expressed protein - -



LOC_Os11g29274 conserved hypothetical protein - -

LOC_Os11g29290 Cytochrome P450 CYP94B3 JA metabolism Koo et al., 2011


Supplementary Table 5 Background information of 101 rice cultivars for HAN1 sequencing

Accession namea IRGC

b Origin

c Group

d Hap

e Sur%

f Sur%

g Sur%

h

Norin 20 418 Japan Tej 1 100.0 - 80.0

Haginomae Mochi 2540 Japan Tej 1 100.0 87.5 -

Kotobuki Mochi 2545 Japan Trj 1 100.0 80.0 90.8

Mansaku 8191 Japan Tej 1 95.8 70.5 -

Baber 33984 India Tej 1 97.6 93.6 60.9

Aichi Asahi 40252 Japan Tej 1 - 94.4 -

26

Aedal 55441 Korea Tej 1 77.7 81.3 88.7

Beonjo 55457 Korea Tej 1 100.0 100.0 56.0

Chodongji 55471 South Korea Tej 1 97.8 95.8 67.8

Heukgyeong 55530 South Korea Tej 1 93.8 100.0 61.0

Baghlani

Nangarhar 58266 Afghanistan Tej 1 96.7 66.7 15.3

Luk Takhar 58286 Afghanistan Tej 1 100.0 100.0 86.2

Taibei309 - China Tej 1 97.1 87.2 98.4

2428 - China Tej 1 68.9 - -

Nipponbare - Japan Tej 1 94.2 90.0 97.2

Arias 43325

Indonesia(West

Java) Trj 2 27.5 48.9 12.3

Ta Hung Ku 1107 China Tej 3 95.6 94.4 51.3

Dourado Agulha 3297 Brazil Trj 3 100.0 - 11.1

Kinastano 3782 Philippines Trj 3 97.9 76.2 27.3

CAAWA/Fortuna

6-103-15 5441 Taiwan Trj 3 70.8 100.0 52.5

Davao 8244 Phillipines Trj 3 100.0 87.8 8.3

Hu Lo Tao 8264 China Tej 3 91.1 - 98.2

RT 1031-69 15092 Zaire Trj 3 100.0 95.8 22.0

27

IAC 25 19642 Brazil Trj 3 93.8 - 38.8

Binulawan 26872 Phillipines Ind 3 25.0 - 0.0

NPE 826 38694 Pakistan Aro 3 35.6 84.3 43.2

Gogo Lempuk 43394 Indonesia Trj 3 23.8 0.0 0.0

Canella De Ferro 50448 Brazil Trj 3 93.8 96.3 18.0

L-202 66292 USA Trj 3 65.3 100.0 80.9

N 12 6298 India Aro 4 38.4 92.7 -

Dom Sofid 12880 Iran Aro 4 0.0 42.5 15.3

Chahora 144 27869 Pakistan Trj 4 81.1 100.0 6.6

Rexoro 1715 USA Trj 5 66.4 68.8 -

Pankhari 203 5999 India Aro 5 2.4 47.2 -

JC101 9060 India Aro 5 0.0 20.5 -

Mehr 12883 Iran Aus 5 0.0 70.7 7.5

Darmali 27630 Nepal Tej 5 16.9 100.0 60.8

Phudugey 32399 Bhutan Aus 5 83.3 64.5 11.4

NPE 253 38690 Pakistan Tej 5 96.1 66.7 40.7

NPE 417 38692 Pakistan Trj 5 - 100.0 -

BJ 1 45195 India Aus 5 0.0 0.0 0.0

28

Lageado 50490 Brazil Ind 5 47.9 44.4 -

Ghati Kamma

Nangarhar 58278 Afghanistan Aus 5 0.0 12.5 0.0

Chhote Dhan 58930 Nepal Ind 5 0.0 0.0 -

Kasalath - India Aus 5 0.9 0.0 0.0

JC149 9070 India Aro 6 0.0 5.6 -

Taichung Native 1 105 Taiwan Ind 7 2.1 - 0.0

DA 7 5809 Bangladesh Ind 7 0.0 0.0 -


DA 5 5855 Bangladesh Ind 7 0.0 - -


CO 18 6331 India Ind 7 0.0 - -

Bhadoia 233 6541 Bangladesh Aus 7 0.0 0.0 -

Baguamon 14 6590 Bangladesh Ind 7 0.0 0.0 -

Kalukantha 7755 Sri Lanka Ind 7 0.0 4.2 -

MTU9 7919 India Ind 7 0.0 0.0 -

Pratao 7937 Brazil Ind 7 - - -

Peh-Kuh-Tsao-Tu 8237 Taiwan Ind 7 0.0 0.0 0.0

Pappaku 8268 Taiwan Ind 7 0.0 - 0.0

29

Pao-Tou-Hung 51400 China Ind 7 0.0 8.3 0.0

Chitraj (DA23) 6208 Bangladesh Ind 8 0.0 - -

Seratoes Hari 8260 Indonesia Ind 8 0.0 0.0 0.0

JC111 9062 India Aro 8 0.0 6.1 -

TKM6 237 India Ind 9 0.0 2.8 -

IRGA 409 77483 Brazil Ind 9 0.0 0.0 0.0

- - - Ind 9 0.6 33.3 3.7

Peh-Kuh 8238 Taiwan Ind 10 6.5 20.4 1.5

Ai-Chiao-Hong 51250 China Ind 10 0.0 0.0 0.0

XieqingzaoB - China Ind 10 0.0 - 0.0

I-Geo-Tze 120 Taiwan Ind 11 0.0 78.4 0.6

Teqing - China Ind 11 11.5 - 0.0

Makalioka-34 6087 Madagascar Ind 12 0.0 0.0 -

Mudgo 6663 India Ind 12 0.0 0.0 0.0

O-Lurn-Cheung 8179 Taiwan Ind 12 5.4 10.3 20.2

Shai-Kuh 8197 China Ind 12 68.1 85.6 0.0

Som Cau 70A 8227 Vietnam Tej 12 0.0 0.0 -

Hsia-Chioh-Keh-Tu 8240 Taiwan Ind 12 0.0 2.4 -

30

Shuang-Chiang 8242 Taiwan Ind 12 0.0 0.0 -

JC157 9179 India Aro 12 0.0 12.5 1.8

Chiem Chanh 10214 Vietnam Ind 12 6.3 87.5 2.5

Kalamkati 45975 India Aus 12 0.0 0.0 -

Guan-Yin-Tsan 51300 China Ind 12 6.3 0.0 0.0

Chau 56036 Vietnam Ind 13 0.0 0.0 -

JC1 9091 India Aro 14 0.0 0.0 -

FR13 A 6144 India Aus 15 0.0 - -

N 22 6264 India Trj 15 2.1 76.4 0.0

PTB9 6274 India Ind 15 0.0 4.4 -

T 1 6294 India Aus 15 0.0 24.4 1.9

Jhona 349 6307 India Aus 15 2.1 26.1 0.6

DZ78 8555 Bangladesh Aus 15 0.0 21.0 0.0

ARC 10177 12386 India Aus 15 - 0.0 -

ARC 10352 12440 India Aro 15 0.0 0.0 0.0

Miriti 25901 Bangladesh Trj 15 0.0 3.0 0.7

Black Gora (Ncs12) 40275 India Aus 15 0.0 2.8 0.0

Lal Aman 46202 India Ind 15 0.0 57.4 0.0

31

RTS4 8177 Vietnam Ind 16 0.0 0.0 -

RTS14 8178 Vietnam Ind 16 0.0 - 11.5

Padi Kasalle 8261 Indonesia Trj 16 0.0 - 18.7

Gundil Kuning 16428 Indonesia Trj 16 - - -

Sintane Diofor 5418 Burkina Fasao Ind 17 0.0 0.0 -

JC73-4 9115 India Aro 17 2.1 0.0 -

aName of cultivated rice accessions;

bNumber of each accession in the IRRI IRGC database;

dCountry of origin of each accession;

eSubgroup of

each accession according to Garris et al. (2005); f-h

Survival percent of seedling at chilling stresses of 10oC for 7 days, 8

oC for 6 days, and 4

oC for

4 days, respectively.

32

Supplementary Table 6 Origins of 21 wild rice accessions (O. rufipogon) used for

HAN1 sequencing

Accession number Country of origin

172 Malaysia

173 China

174 Thailand

176 Thailand

181 Laos

182 Myanmar

183 Papau New Guinea

188 Myanmar

189 India

190 Philippines

191 Taiwan

192 Bangladesh

211 Malaysia

212 Philippines

213 Cambodia

214 India

225 Malaysia

242 Papau New Guinea

243 Cambodia

DXWR China

CLWR China

33

Supplementary Table 7 Background information and classification of 572 rice accessions with resequencing genome data

Name of cultivars Subgroup Region of origin Latitude Longitude

9113 Indica II Hunan,China 28.2 112.9

H383 Indica_inter

H421 Indica_inter

H72 Indica_inter

Fu58 Indica_inter

Fu608 Indica_inter

Fu9811 Indica I

Jiazao66 Indica_inter Zhejiang,China 30.3 120.2

Yuenuo6hao Indica_inter Zhejiang,China 30.3 120.2

Zhongjiazao6hao Indica_inter Zhejiang,China 30.3 120.2

Zhongxiangzao4hao Indica_inter

Xqzb Indica I Anhui,China 31.8 117.2

Jin23b Indica I Hunan,China 28.2 112.9

Xieb Indica I

Fengyuanb Indica I Hunan,China 28.2 112.9

Ganxiangb Indica_inter Jiangxi,China 28.7 115.8

706b Indica_inter

Jiangxi1587 Indica II

V20b Indica I Hunan,China 28.2 112.9

Yevb Indica_inter

Peh-kuh-tsao-tu Indica_inter

Zx97b Indica I Zhejiang,China 30.3 120.2

Digu Indica I Fujian,China 26.1 119.3

Guangluai4hao Indica I Guangdong,China 23.1 113.3

34

Jinyou974 Indica_inter Hunan,China 28.2 112.9

Xiangzaoxian45hao Indica_inter Hunan,China 28.2 112.9

Zhenshan97b Indica_inter Zhejiang,China 30.3 120.2

Minghui63 Indica_inter Fujian,China 26.1 119.3

Lucaihao Indica I Fujian,China 26.1 119.3

75-79 Indica I

Minkezao77 Indica I

Guangluai15-1 Indica I Guangxi,China 22.8 108.4

Cuganshangzao Indica I

Xiujiangzao9hao Indica I Jiangxi,China 28.7 115.8

Suxian1hao Indica I

Zhenhong17 Indica I Fujian,China 26.1 119.3

Nt02 Indica I

Dongzao Indica I

Zhe733 Indica_inter Zhejiang,China 30.3 120.2

Zhe852 Indica I Zhejiang,China 30.3 120.2

Zaodongliu45 Indica I Zhejiang,China 30.3 120.2

Zaolian31 Indica I Zhejiang,China 30.3 120.2

S08-18 TEJ

Wenteqing Indica I

Liushiqing Indica I

Hongmeizao Indica I Guangdong,China 23.1 113.3

Jinke5hao Indica_inter

Gaoye50zao Indica I

Jxyzhongzao35 Indica_inter Zhejiang,China 30.3 120.2

Qiuzhi TEJ

35

Luzhouzaob Indica_inter Sichuan,China 30.6 104.1

Hang406b Indica I

406b Indica I

Ghatikammanangarhar Indica I

Qitouwang Indica I

Kezhongfu Indica I

Mangzhan Indica I

Sandongqi Indica I

Xiguzao Indica I

R894 Indica II Sichuan,China 30.6 104.1


Xiagu5hao Indica I

Dongshuizao Indica I

Aimeizao3 Indica_inter Guangdong,China 23.1 113.3

R301 Indica II Jiangxi,China 28.7 115.8

Rikutokemochi Japonica_Inter Japan 35.4 138.5

Nanjing11 Indica_inter Jiangsu,China 32.1 118.8

Zhenong9906 Indica_inter Zhejiang,China 30.3 120.2

Rts14 Indica I

O-lurn-cheung Indica I

Nj11 Indica_inter

Fushe31 Indica_inter Fujian,China 26.1 119.3

Guangchangai6hao Indica I Guangdong,China 23.1 113.3

Zhaiyeqing4hao Indica_inter Guangdong,China 23.1 113.3

Nantehao Indica I Jiangxi,China 28.7 115.8

Tuanhuangzhan Indica_inter Guangxi,China 22.8 108.4

36

Chaoyangzao18 Indica I Guangdong,China 23.1 113.3

Sanyazao Indica I

Guangchang13 Indica I Guangdong,China 23.1 113.3

Xiangfengb Indica_inter Jiangxi,China 28.7 115.8

Zaohuang Indica I

Zhefu7 Indica_inter Zhejiang,China 30.3 120.2

R286 Indica_inter Guangxi,China 22.8 108.4

Longge113 Indica I Fujian,China 26.1 119.3

Bashizaozhan Indica I

Hongliusi MIX

Fenggui1hao Indica_inter Guangdong,China 23.1 113.3

26-1 Indica I

Tiepizhong Indica I

Qiyuezao Indica I

Huaai35hao Indica I Hubei,China 30.6 114.3

Dular AUS India 28.4 77.1

Norin20 TEJ

Irri-24 Indica II Philippines 15.0 121.0

3207-998 Indica II

Irri-55 Indica II Philippines 15.0 121.0

R210 Indica II Hunan,China 28.2 112.9


R128 Indica II Hunan,China 28.2 112.9

Tr1988 Indica II

Aixiangzhan Indica II Guangdong,China 23.1 113.3

Aoqixinzhan Indica II Guangdong,China 23.1 113.3

37

Chengnuoruanzhan Indica II

Fengxinzhan Indica II Guangdong,China 23.1 113.3

Fengxiangsimiao2hao Indica II Guangdong,China 23.1 113.3

Gufengzhan Indica II Guangdong,China 23.1 113.3

Guangyan1hao Indica II Guangdong,China 23.1 113.3

Hangtezhan Indica II

Huahang3hao Indica II Guangdong,China 23.1 113.3

Huazhongzhan2hao Indica II

Huangguangzhan Indica II Guangdong,China 23.1 113.3

Huanghuazhan Indica II Guangdong,China 23.1 113.3

Huangruanxiangzhan Indica II

Jinhuaruanzhan Indica II

Kangwen5 Indica II

Liweizhan Indica II

Meixiangzhan2hao Indica II Guangdong,China 23.1 113.3

Meiyazhan Indica II Guangdong,China 23.1 113.3

Ningbo2 MIX

Pinghui141 Indica II Jiangxi,China 27.6 113.8

Shanqingzhan Indica II

Suixiangzhan Indica II

Tainongxin5 Indica II Taiwan 24.0 120.0

Texiansimiao Indica II Guangdong,China 23.1 113.3

Wushanxiuzhan Indica II Guangdong,China 23.1 113.3

Xianliangzhan Indica II

Xiangfu994 AUS Hunan,China 28.2 112.9

Xinhuangzhan（guangpu） Indica II Guangdong,China 23.1 113.3

38

Yuguangzhan Indica II

Yujingzhan Indica II Guangdong,China 23.1 113.3

Yushanfengzhan Indica II

Yushanlizhan Indica II

Yushansimiao Indica II

Yuefengsizhan Indica II Guangdong,China 23.1 113.3

Yuexinzhan2hao Indica II Guangdong,China 23.1 113.3

Zaohuazhan Indica II Guangdong,China 23.1 113.3

Zhongguangsimiao Indica II Guangdong,China 23.1 113.3

Zhongxiang1hao Indica II Zhejiang,China 30.3 120.2

Tq Indica II Guangdong,China 23.1 113.3

Huazhan Indica II Guangdong,China 23.1 113.3

Yuetaib Indica_inter Guangdong,China 23.1 113.3

Luxiang618b Indica_inter Sichuan,China 30.6 104.1

Yixiang1b Indica_inter Sichuan,China 30.6 104.1

Jiafuzhan Indica_inter Fujian,China 26.1 119.3

Ⅱ-32b Indica I Hunan,China 28.2 112.9

Xiangaib Indica_inter Jiangxi,China 27.6 113.8

Yuefengb Indica_inter Guangdong,China 23.1 113.3

Yuzhenxiang Indica_inter Hunan,China 28.2 112.9

Gumei4hao Indica_inter Sichuan,China 30.6 104.1

Mianhui3724 Indica II Sichuan,China 31.5 104.7



Luhui602 Indica II Sichuan,China 30.6 104.1

Chuanr527 Indica II

39

Shuhui166 Indica II Sichuan,China 30.6 104.1


Chuanhui687 Indica II Sichuan,China 30.6 104.1

Zhen084 Indica II

T136 MIX Jiangsu,China 32.4 119.4

R6547 Indica II Jiangsu,China 32.4 119.4

Zaoshur13 Indica II

Ranxuan6hao Indica II

Luobiao Indica_inter

Zhongjiangd208 Indica II

Yangdao6hao（youmang） Indica II Jiangsu,China 32.4 119.4

02428 Indica II Jiangsu,China 32.1 118.8

Guanghui998 Indica II Guangdong,China 23.1 113.3

Meitezhan Indica II

Wanxian98 Indica II Hubei,China 30.6 114.3

Ir64 Indica II Philippines 15.0 121.0

Yuer9113 Indica II Hunan,China 28.2 112.9

Liufengxiangzhan Indica_inter Guangxi,China 22.8 108.4

Guihongyihao Indica II Guangxi,China 22.8 108.4

Yesizhan Indica II Guangdong,China 23.1 113.3

Xinxiangzhan Indica_inter Guangxi,China 22.8 108.4

Minghui77 Indica II Fujian,China 26.1 119.3

Jusuidao Indica_inter

Gui99 Indica II Guangxi,China 22.8 108.4

Miyang46 Indica II South Korea 37.3 126.6

R725 Indica II

40

Rb207 Indica_inter Hunan,China 28.2 112.9

R299 Indica_inter Sichuan,China 30.6 104.1

Xiangwannuoyihao Indica II Hunan,China 28.2 112.9

Yuetaisimiao Indica II Guangdong,China 23.1 113.3

Huangsizhan Indica II Guangdong,China 23.1 113.3

Nongxiang26 Indica II Hunan,China 28.2 112.9

Nongxiang28 Indica II Hunan,China 28.2 112.9

Ii-32b Indica I Hunan,China 28.2 112.9

Taichungnative1 Indica I Taiwan 24.2 120.7

I-geo-tze Indica I

T1 AUS

Jhona349 AUS Pakistan 33.4 73.1

Peh-kuh Indica I

Seratoeshari Indica_inter

Dz78 AUS

Chiemchanh Indica_inter

Arc10177 AUS


Blackgora(Ncs12) AUS Philippines 15.0 121.0

Bj1 AUS Philippines 15.0 121.0

Lalaman MIX Bangladesh 23.7 90.4

Ai-chiao-hong Indica I

Guan-yin-tsan Indica I

Pao-tou-hung Indica I

9311 Indica II Jiangsu,China 32.1 118.8

C418 MIX

41

Mh63 Indica II Fujian,China 26.1 119.3

Kasalath AUS Japan 35.4 138.5

Irbb56 Indica II

Teqing Indica II Philippines 15.0 121.0

Irat109 TRJ Brazil

Huakexianluo Indica I

Xu213 Indica II

Jinghong1hao Indica I

9487 Indica_inter

Mianxing4hao Indica II

Xiaoyeqing Indica_inter

Wuqizhan Indica_inter

Shixieai Indica_inter

Nanzhuai2hao Indica_inter Guangdong,China 23.1 113.3

Chuanzaozhong Indica I

Wuxiangxian107 Indica_inter

Nannongxian2hao Indica_inter Jiangsu,China 32.1 118.8

Jinxuan2hao Indica_inter

Jiqing Indica_inter Guangxi,China 22.8 108.4

Longtepu Indica_inter Guangxi,China 22.8 108.4

Huazhan Indica_inter

Wunong7hao Indica_inter


Xingningzhan Indica I

Nanjing2157 Indica II

78xuan15 Indica_inter

42

Teqing2hao Indica II Guangdong,China 23.1 113.3

Zhend-1 Indica_inter Fujian,China 26.1 119.3

Heiyenuo Indica_inter

Nannong4028 Indica II

Longyang2hao Indica_inter

Datouzhan Indica I

Jianzao Indica I

Yinfeng Indica I Guangxi,China 22.8 108.4

Xiangsimiao2 Indica II Guangdong,China 23.1 113.3


Xinqingai Indica I Guangdong,China 23.1 113.3

Guichao2hao Indica_inter Guangdong,China 23.1 113.3

Shuangzhuzhan Indica_inter Guangdong,China 23.1 113.3

Yigenmiao Indica I

2036-1 Indica_inter

Chaocong302 Indica_inter

Bairizao Indica I

Ailun Indica_inter

Heijiazhan Indica I

Shuangchao7 Indica_inter Guangdong,China 23.1 113.3

88272 Indica_inter

525 Indica_inter Hubei,China 30.6 114.3

9522 TEJ

Zhongyu1hao Indica_inter Zhejiang,China 30.3 120.2

Qinghuafugui Indica_inter

Jiangaizao Indica I

43

Gharib Japonica_Inter

Douradoprecoce TRJ Brazil

Yuelin1hao Indica II Guangdong,China 23.1 113.3

Zhongzu14 Indica II Zhejiang,China 30.3 120.2

Kibi TEJ

Xing1 Indica II

Changxianggu AUS

Yinjingsizhan Indica II Guangdong,China 23.1 113.3

Yuejingsimiao Indica II Guangdong,China 23.1 113.3

Yuezhenzhan Indica II Guangdong,China 23.1 113.3

93-11 Indica II Jiangsu,China 32.1 118.8

Minghui86 Indica II Fujian,China 26.1 119.3

Neihui99-14 Indica II Sichuan,China 29.6 105.1


R702 Indica_inter

R411 Indica II

Zhenzhunuo Indica II

R9368 Indica II

Yangdao6hao（wumang） Indica II Jiangsu,China 32.4 119.4

Yangdao8hao Indica II Jiangsu,China 32.4 119.4

Binulawan TRJ


Ir50 Indica II India 28.4 77.1

Nj16 Indica_inter

Yns Indica I

6406 Indica I

44

6302 Indica I

7900 Indica II

6730 TEJ

7975 Indica II

Zhenxian232 Indica_inter Jiangsu,China 32.1 118.8

Meigui1hao Indica_inter Guangxi,China 22.8 108.4

Gerdeh AUS Iran

Carolinagold Japonica_Inter

Shankiuju TEJ

Nhta10 TEJ

Shortgrain Indica_inter

Iguapecateto TRJ

Kaniranga Indica_inter

5814 Indica II

Minfeng3hao Indica_inter

Yangdao4hao Indica_inter Jiangsu,China 32.4 119.4

Haginomaemochi AUS

Kun-min-tsieh-hunan Indica_inter

Phudugey MIX Bhutan 27.3 90.3

Irga409 Indica_inter

Meilianzao Indica_inter

Pagaiyahan MIX


Irri-54 Indica II

Mudgo Indica_inter

Shai-kuh Indica_inter

45

Pappaku Indica_inter

Wanzhong80 Indica II Sichuan,China 28.1 114.4

Zacaodao Indica_inter

9311xuan Indica_inter Jiangsu,China 32.4 119.4

Changfeng108 TEJ Fujian,China 26.1 119.3

Kongyu131 TEJ Japan 35.4 138.5

Kendao12 TEJ Heilongjiang,China 45.7 126.7

Kendao17 TEJ Heilongjiang,China 45.7 126.7

Kenjiandao13hao TEJ Heilongjiang,China 45.7 126.7

Kenjiandao14hao TEJ Heilongjiang,China 45.7 126.7

Longjing20hao TEJ Heilongjiang,China 45.7 126.7



Jinxuan1hao TEJ

Suidao13 TEJ Heilongjiang,China 45.7 126.7

Longqingdao1hao TEJ Heilongjiang,China 45.7 126.7

Puyou52 TEJ Heilongjiang,China 45.7 126.7

Puxuan28 TEJ Heilongjiang,China 45.7 126.7

Caidao Japonica_Inter

Wuyoudao1hao TEJ Heilongjiang,China 45.7 126.7

Jite639 TEJ Jilin,China 43.8 125.3

Songjing2hao TEJ Heilongjiang,China 45.7 126.7

Songjing10hao TEJ Heilongjiang,China 45.7 126.7

Dongnong428 TEJ Heilongjiang,China 45.7 126.7

Dongnong429 TEJ Heilongjiang,China 45.7 126.7

Longdao7hao TEJ Heilongjiang,China 45.7 126.7

46

Mudanjiang31 TEJ Heilongjiang,China 45.7 126.7

Changbai12 TEJ Jilin,China 43.8 125.3

Jupei TEJ

Liaoxing16 TEJ Liaoling,China 41.7 123.4

Jijing86 TEJ Jilin,China 43.8 125.3

Jiudao62 TEJ Jilin,China 43.8 125.3

Nip TEJ Japan 35.4 138.5

Tiejing4hao TEJ Liaoling,China 41.7 123.4

Kaijing1hao TEJ Liaoling,China 41.7 123.4

Shendao2hao TEJ Liaoling,China 41.7 123.4

Zhonghua11 TEJ Beijing 39.5 116.4

7981 TEJ

Tahungku Japonica_Inter

Kiang-chou-chiu Indica I

Mansaku TEJ

Baber Japonica_Inter

Aedal TEJ

Baghlaninangarhar TEJ

Changlijing MIX

Songxiangzaojing TEJ Shanghai,China 31.2 121.5

Zhonghua11 TEJ Beijing 39.5 116.4

Songxiangzaojing TEJ Jilin,China 43.8 125.3

Daohuaxiang MIX Heilongjiang,China 45.7 126.7

Xintuanheigu Japonica_Inter Yunnan,China 24.9 102.8

Shennong9741（huashizao） TEJ Heilongjiang,China 45.7 126.7

Shennong9816 TEJ Heilongjiang,China 45.7 126.7

47

Tiejing10 TEJ Liaoling,China 41.7 123.4

C4115 MIX Liaoling,China 41.7 123.4

Lindao16 TEJ Shandong,China 36.5 116.7

Lindao17 TEJ Shandong,China 36.5 116.7

Suxiu10hao TEJ Zhejiang,China 30.3 120.2

Suxiu9hao TEJ Zhejiang,China 30.3 120.2

Heukgyeong TEJ

Luktakhar TEJ

Npe844 Japonica_Inter

Gogolempuk TRJ

Trembese TRJ

L-202 TRJ

Yunjing26 MIX Yunnan,China 24.9 102.8

Sanlicun Indica I Shandxi,China 37.9 112.5

Ribenqing TEJ Japan 35.4 138.5

Shendao5hao TEJ Liaoling,China 41.7 123.4

Shengdao15 TEJ Shandong,China 36.5 116.7

Shengdao16 TEJ Shandong,China 36.5 116.7

Shengxiang2572 TEJ Shandong,China 36.5 116.7

Xujing8hao TEJ

Xindao20hao TEJ

Zhongdao1hao TEJ Beijing 39.5 116.4

Xindao29 TEJ

Wuyun1111 TEJ Jiangsu,China 32.1 118.8

Zhen9424 TEJ Jiangsu,China 32.1 118.8

Zhendao681 TEJ Jiangsu,China 32.1 118.8

48

Zrja129(irat129) TRJ

Yueyinjing TEJ

Liaoxing17hao TEJ Liaoling,China 41.7 123.4

Shennongxiangnuo1hao TEJ Heilongjiang,China 45.7 126.7

Yangguang600 TEJ

Ning9213 TEJ

Lvyijing TEJ Anhui,China 31.8 117.2

Huai66 TEJ

Huaidao5hao TEJ Jiangsu,China 32.1 118.8

Taijing1002 TEJ Jiangsu,China 32.1 118.8

Yangjing4227 TEJ Jiangsu,China 32.4 119.4

Ning5055 TEJ

Wuyunjing8hao TEJ Jiangsu,China 32.1 118.8

Nanjing44 TEJ Jiangsu,China 32.1 118.8

Huajing6hao TEJ Jiangsu,China 32.1 118.8

Lianjing6hao TEJ Jiangsu,China 32.1 118.8

Ningjing5hao TEJ Jiangsu,China 32.1 118.8

Yanjing9029 TEJ Liaoling,China 41.7 123.4

Yanjing10hao TEJ Liaoling,China 41.7 123.4

Taijing2hao TEJ Jiangsu,China 32.1 118.8

Taijing3hao TEJ Jiangsu,China 32.1 118.8

Yangyujing2hao TEJ Jiangsu,China 32.1 118.8

Hanyou8hao TEJ Shanghai,China 31.2 121.5

Jc157 Indica_inter India 26.9 75.8

Cuba65 MIX

Arc10352 AUS

49

Lijiang Japonica_Inter

Darmali Indica II

Yelaikmeedon Indica II

Beonjo TEJ

Chodongji TEJ

Douradoagulha TRJ

Kinastano TRJ

Maintmolotsy1226 TRJ

Rt1031-69 TRJ

Iac25 TRJ Brazil

Miriti AUS

Arias Indica II

Yujing13 TEJ Yunnan,China 24.9 102.8

Zhanjing12hao TEJ Yunnan,China 24.9 102.8

Zhanjing9hao TEJ Yunnan,China 24.9 102.8

Jingnuo TEJ

Zaoshu123bing1-07 TEJ


C013 TEJ

Liuqianxin13 TEJ Jiangsu,China 32.1 118.8

Yangjing349 TEJ Jiangsu,China 32.4 119.4

Wuyujing3hao TEJ Jiangsu,China 32.1 118.8

Xiushui40 TEJ Zhejiang,China 30.3 120.2

Yuejin2hao TEJ

Changxiangjing11-2 TEJ

N12 AUS

50

Domsofid MIX

Mehr MIX

6733 TEJ

Hulotao TEJ

Aichiasahi TEJ Japan 35.4 138.5

Tp309 TEJ

Kotobukimochi TEJ Japan 35.4 138.5

Padikasalle TRJ

Lac23 MIX

Canelladeferro TRJ

Lemont Japonica_Inter United States

Chujing28 TEJ Yunnan,China 24.9 102.8

Jiahe218 TEJ




31 TEJ



Nongke TEJ

Xiushui620 Japonica_Inter Zhejiang,China 30.3 120.2

Changlijing MIX


Dank4 TEJ

Wuyujing10hao TEJ Jiangsu,China 32.1 118.8


51

Chunjiang03jing TEJ



Xianghu492 TEJ


R1120 TEJ

Jia64 TEJ Zhejiang,China 30.3 120.2

Changyou1hao TEJ

Yelicanghua TEJ Tianjing,China 39.5 116.4

Chishi TEJ Japan 35.4 138.5

Balsamo Indica_inter Philippines 15.0 121.0

Rexoro/red

rice//r252 TRJ United States

Arc10521 TRJ India 28.4 77.1

Kpbctocka

ABC6/10 MIX Bulgaria

Xinrong TEJ Japan 35.4 138.5

Earlykalpi TEJ

80a60yr7

1009-1-5 Japonica_Inter Australia -13.1 142.1

Elid TEJ

Secono

brazil TEJ Brazil

Cpslo17 MIX United States

Gasmal72-1 MIX Bangladesh 23.7 90.4

Wumangshuidao TEJ Shandxi,China 37.9 112.5

52

Kpbctocka

II15A Japonica_Inter Bulgaria

Jonazo TEJ South Korea 37.3 126.6

Allorio TEJ Portuguesa

80a90yr7

2078-25 TRJ Australia -13.1 142.1

Xihai63hao TEJ Japan 35.4 138.5

Irat8 TRJ Coate d'Ivoire

Taeguna TEJ South Korea 37.3 126.6

Bidong7hao/BL7 Japonica_Inter Japan 35.4 138.5

Dosan

zo37 TEJ South Korea 37.3 126.6

Chimao TEJ Japan 35.4 138.5

Damagum TEJ Indonesia -6.0 107.0

Yr196 Japonica_Inter Australia -13.1 142.1

Muando TEJ South Korea 37.3 126.6

Huanghai53 TEJ North Korea 40.0 127.0

Binbei545 Indica_inter Bulgaria

80a86yr7

2154-17 Indica_inter Australia -13.1 142.1

Kangcheong

do TEJ South Korea 37.3 126.6

Dongyu220 TEJ Japan 35.4 138.5

Καρα

δνηδ

ΝjiblΝ

TEJ soviet union

53

Nonglin22hao Japonica_Inter Japan 35.4 138.5

Dnt157 AUS Pakistan 33.4 73.1

Boegi

jmba TRJ Indonesia -6.0 107.0

Bj1 AUS Philippines 15.0 121.0

Ucp48 AUS India 28.4 77.1

Asdt Indica_inter India 28.4 77.1

Mudo MIX India 28.4 77.1

Jabonl AUS Bangladesh 23.7 90.4

Buluputih MIX Indonesia -6.0 107.0

Rathuheenati TRJ Sri Lanka 6.6 80.0

Shannuo TEJ Japan 35.4 138.5

Tuojiangnuo5hao TEJ Sichuan,China 30.6 104.1

Dj10 AUS Bangladesh 23.7 90.4

Pashui/PASHUI TEJ

Honduras TRJ United States

Asecellaroba TRJ Indonesia -6.0 107.0

Buyagaw TRJ Philippines 15.0 121.0

Gondomono TRJ Indonesia -6.0 107.0

Aselotang TRJ Indonesia -6.0 107.0

Jianada1hao Indica I

Wuxiunuo TEJ Jiangsu,China 32.1 118.8

Shanfunuo/nonglinnuo192hao TEJ Japan 35.4 138.5

Richuhunuo TEJ Japan 35.4 138.5

Te54 TEJ Japan 35.4 138.5

Aoyu247 TEJ Japan 35.4 138.5

54

Dongshouxi1 TEJ Japan 35.4 138.5

Fengguo32hao TEJ Japan 35.4 138.5

Pinxi147 TEJ Japan 35.4 138.5

Tongjiao17hao TEJ Jilin,China 43.8 125.3

Zhuang402 TEJ Japan 35.4 138.5

Fuxi3339 TEJ Japan 35.4 138.5

Yanan12hao TEJ North Korea 40.0 127.0

Teng842 TEJ Japan 35.4 138.5


Aoyum317 TEJ Japan 35.4 138.5


Qiuxi116 TEJ Japan 35.4 138.5

Zhongbu49 TEJ Japan 35.4 138.5


Yuxi105 TEJ Japan 35.4 138.5

Qiuxi TEJ Japan 35.4 138.5


Qiutian36 TEJ Japan 35.4 138.5


Huangkenuo（1） TEJ Japan 35.4 138.5

Zhixuan3hao Indica I Jiangsu,China 32.1 118.8

Huangjinguang/nonglin266hao TEJ Japan 35.4 138.5

Fengxu/nonglin260hao TEJ Japan 35.4 138.5

Yuzhan TEJ North Korea 40.0 127.0

74-24xuansan TEJ

Hugaiyi99 TEJ North Korea 40.0 127.0

55

Daoshanjin TEJ Japan 35.4 138.5

Shishi TEJ Japan 35.4 138.5

Fengtianzaosheng TEJ Japan 35.4 138.5

Qiutian39 TEJ Japan 35.4 138.5

72-125 TEJ


Shenli TEJ Japan 35.4 138.5

K3 TEJ Japan 35.4 138.5

Kebeijisiqi TEJ North Korea 40.0 127.0

Jianongnuo8 TEJ

Kunnong8hao TEJ Jiangsu,China 32.1 118.8

Yuhong3hao TEJ

Wucangjin TEJ Japan 35.4 138.5

Dadiannanhai19hao TEJ Japan 35.4 138.5

Supplementary Table 8 Primers used for mapping, vector construction and qRT-PCR

Primers' Name Forward primer Reverse primer Aims

HAN1-Seq1 gctatctcttgggctagatg Aagtagagttgtggagcagc Sequencing of HAN1

HAN1-Seq2 ctagctccagctccacttct Agcatctccgtgtaccagtc Sequencing of HAN1

HAN1-Seq3 cttcatcgtcctgtggatct Catgaggagccagaagaacc sequencing of HAN1

HAN1-Seq4 catggtgatcagcttcatca Ccttggatctatcaaggatc sequencing of HAN1

HAN1_OX ctagaggatccccgggtaccatg

atttgcttcatggcgtgg

Gatcggggaaattcgagctctt

aactactggtcaattcccc

Construct for overexpression

HAN1_EX cagtgaagacaatttgatgatttgc

ttcatggcgtg

Cagtgctcttcaactactggtca

attcccctc

Construct for inducible expression

56

HAN1_Cas9 cagtggtctcaggcgggcgttcta

ccgcaac

Cagtggtctcaaaacgttgcgg

tagaacgccc

Construct for CRISPR/Cas9 line

HAN1_SubL cagtgaagacaacaacatggcgt

ggttcgtcgcggc

cagtgaagacaatacaactact

ggtcaattcccctc

Construct for subcellular location

HAN1_Yst cagtgtggtggaattcaacacaat

gtctgcgtggttcgtcgcggcttg

cgaagggccctctagattaacta

ctggtcaattcccctcc

Construct for expression of HAN1 in Yeasts

CYP94B3_Yst cagtgtggtggaattcaacacaat

gtctgcatttcttctgagttttttgata

cgaagggccctctagattaaac

gttgttaaggatgtgac

Construct for expression of CYP94B3 in Yeasts

HAN1_Compl aaaggatccaagagtattcgtgta

catgggctta

tttgaattctttcagtaaatcggtg

aacatctct

Construct for complementation

HAN1_Prom1 tacgaattcgagctcggtaccggt

catatatcccagaactacag

ttaccctcagatctaccatgggct

tctcctctctctcgatccctc

Construct for promoter activity (GUS) of HAN1

HAN1_Prom2 acgacggccagtgccaagcttgg

tcatatatcccagaactacag

tgtttttggcgtcttccatgggaa

gcaaatcatgcttctcctct

Construct for promoter activity (LUC) of HAN1

GP2010-1955 ccttgtggtggtgatggtga gacgttgaagatgcccatgc Genotyping for CRISPR/Cas9 line, han1

TvexF gctcgactctaggatcttcg atctccgtgtaccagtccag Genotyping for pER8::HAN1 transgenic plants

Tv303F caggtcgactctagaggatc atctccgtgtaccagtccag Genotyping for 35S::HAN1 transgenic plants

Tv1300F ggcgattaagttgggtaacg agttcggtgttcagtcatcg Genotyping for pHAN1::HAN1 transgenic plants

Tv1301GusR ggcgattaagttgggtaacg tcatcatcatagacacacg Genotyping for pHAN1::GUS transgenic plants

001709F/R gttggtgagtttagggttag ctttccctacacaaaccctc Genotyping for the wild type of CYP94B3

001709F/pROK2LBa1 gttggtgagtttagggttag gttcacgtagtgggccatcg Genotyping for the mutant of CYP94B3

RM518 ctcttcactcactcaccatgg atccatctggagcaagcaac SSR marker (2034709bp)

RM261 ctacttctccccttgtgtcg tgtaccatcgccaaatctcc SSR marker (6578953bp)

RM332 gcgaaggcgaaggtgaag catgagtgatctcactcaccc SSR marker (2840213bp)

RM536 tctctcctcttgtttggctc acacaccaacacgaccacac SSR marker (8990534bp)

57

RM5857 acagcttgtctttatttcctg gatggtaatccaggttgttg SSR marker

RM26652 caatccattgctggttgatgc caagatctccaaggtgctgagg SSR marker

RM287 ttccctgttaagagagaaatc gtgtatttggtgaaagcaac SSR marker

RM229 cactcacacgaacgactgac cgcaggttcttgtgaaatgt SSR marker

R11ID443 ccctgcatcataagggactt cgcttatcttggcatgatcag InDel marker

R11ID542 ccctgcatcataagggactt cgcttatcttggcatgatcag InDel marker

R11ID722 ccagcagccacaatgctata gagagtatggtgtccattag InDel marker

R11ID807F aagcttctgttcacaagctc gaatgggtgctatcactcag InDel marker

R11ID1551 tgttatgccaccatctttgc gggagagaaacccttcatcc InDel marker

R11ID1646 ctcattatgactcaatgttcc tttatccgacgtatgatccac InDel marker

R111ID1677 ccttcaagacctgaattgtg actgtacacacctcacagac InDel marker

R11ID1693 ccattgtttcctgcactagtt gaggctttgttgatggtatac InDel marker

R11ID1699 tggttgctaacatggcctga tgtgagtgatgattggtgcc InDel marker

R11ID1711 agaggagacgaggagataag gcctcttaactaaccgtcag InDel marker

R11ID1733 ataccaacggttgatgtgatg cactagatcaaagaggcagc InDel marker

R11ID1764 tcagctaccattgcaagctg aactaccaacaagtcgcctc InDel marker

HAN1_qPCR cttgtggtggtgatggtgag gcatctccgtgtaccagtcc RT-qPCR

OsDREB1F aggacgccatcttcgacat gtcgagagatctcccaatcg RT-qPCR

OsDREB1G aacagtacggcagtggcagtc agatggcttcttcgtccatg RT-qPCR

OsDREB1I cccgtactacgaggtcatgg gctacctacggcaggatcac RT-qPCR

OsDREB1E gaattcgaaatgcaggggta ctcgcagtcgtagtcctcct RT-qPCR

OsDREB1C caaagcttatcagcagtagc ggttagtagcagaaagacttg RT-qPCR

OsDREB1D caacatggacttcgaccagc tagctccagagtgtgacgtc RT-qPCR

OsDREB1B gatggcgacgaagaagaaga gaacctgaacccgtcgtc RT-qPCR

OsDREB1H cttcatcgatcgacggaacg cgtagtacgtgtcgtagtcc RT-qPCR

58

OsDREB1A acctgtactacgcgagcttg tagtagctccagagtgggac RT-qPCR

Ubiquitin 5 accacttcgaccgccactact acgcctaagcctgctggtt RT-qPCR

Actin tggcatctctcagcacattcc tgcacaatggatgggtcaga RT-qPCR

GUS caagagtatcagtgtgcatgg cgaagttcatgccagtccag RT-qPCR

Documents

Materials and Methods Genetic Mapping Population and Plant … · 2019. 2. 11. · 1 Materials and Methods Genetic Mapping Population and Plant Material Rice (Oryza sativa L.) recombinant