Mechanism of cigarette smoke condensate-induced acute

Available online http://respiratory-research.com/content/3/1/22

Respiratory Research Vol 3 No 1http://respiratory-research.com/content/3/1/22 Hellermannet al.Research articleMechanism of cigarette smoke condensate-induced acute inflammatory response in human bronchial epithelial cellsGary R Hellermann, Szilvia B Nagy, Xiaoyuan Kong, Richard F Lockey and Shyam S Mohapatra

Division of Allergy and Immunology and the Joy McCann Culverhouse Airway Disease Center, Department of Internal Medicine, University of South Florida College of Medicine and VA Hospital, Tampa, Florida, 33612, USA

Correspondence: Shyam S Mohapatra - [email protected]

AbstractBackground: To demonstrate the involvement of tobacco smoking in the pathophysiology of lungdisease, the responses of pulmonary epithelial cells to cigarette smoke condensate (CSC) — theparticulate fraction of tobacco smoke — were examined.Methods: The human alveolar epithelial cell line A549 and normal human bronchial epithelial cells(NHBEs) were exposed to 0.4 µg/ml CSC, a concentration that resulted in >90% cell survival and<5% apoptosis. Changes in gene expression and signaling responses were determined by RT-PCR,western blotting and immunocytofluorescence.Results: NHBEs exposed to CSC showed increased expression of the inflammatory mediators sICAM-1, IL-1β, IL-8 and GM-CSF, as determined by RT-PCR. CSC-induced IL-1β expression was reducedby PD98059, a blocker of mitogen-actived protein kinase (MAPK) kinase (MEK), and by PDTC, a NFκBinhibitor. Analysis of intracellular signaling pathways, using antibodies specific for phosphorylatedMAPKs (extracellular signal-regulated kinase [ERK]-1/2), demonstrated an increased level ofphosphorylated ERK1/2 with increasing CSC concentration. Nuclear localization of phosphorylatedERK1/2 was seen within 30 min of CSC exposure and was inhibited by PD98059. Increasedphosphorylation and nuclear translocation of IκB was also seen after CSC exposure. A549 cellstransfected with a luciferase reporter plasmid containing a NFκB-inducible promoter sequence andexposed to CSC (0.4 µg/ml) or TNF-α (50 ng/ml) had an increased reporter activity of approximately2-fold for CSC and 3.5-fold for TNF-α relative to untreated controls.Conclusion: The acute phase response of NHBEs to cigarette smoke involves activation of both MAPKand NFκB.

Keywords: bronchial, cigarette, MAPK, NF-kappaB, signal transduction

IntroductionThe association of inhaled particulate pollution and ciga-rette smoking with pulmonary disease, such as chronic ob-structive pulmonary disease, is well documented [1], butthe specific early responses of lung epithelial cells to toxicsubstances in particulates — that predispose the cells todisease — have not been elucidated. Cigarette smoke hasalso been considered a major player in the pathogenesis ofasthma and as a trigger for acute symptoms [2]. Exposureto cigarette smoke activates an inflammatory cascade inthe airway epithelium resulting in the production of a

number of potent cytokines and chemokines, with accom-panying damage to the lung epithelium, increased permea-bility, and recruitment of macrophages and neutrophils tothe airway [3]. Even brief exposure to cigarette smoke hasbeen shown to increase expression of IL-8 in primary cul-tures of human bronchial epithelial cells (HBEs) in the pres-ence of dust mite allergen [4]. Increased release of thechemokine IL-8 has also been shown for cultured HBEs ex-posed to cigarette smoke extract (CSE) [5,6] and diesel ex-haust particles [7]. However, the precise molecular events

Received: 6 December 2001

Revisions requested: 12 February 2002

Revisions received: 11 April 2002

Accepted: 8 May 2002

Published: 10 July 2002

Respir Res 2002, 3:22

© 2002 Hellerman et al., licensee BioMed Central Ltd

(Print ISSN 1465-9921; Online ISSN 1465-993X)

Page 1 of 8(page number not for citation purposes)

Respiratory Research Vol 3 No 1 Hellermann et al.

that bring about these intracellular changes and acute in-flammation in lung epithelial cells are not well understood.

Upregulation of cytokine gene expression in epithelial cellshas been linked to activation of specific signaling path-ways. Involvement of the mitogen-activated protein kinase(MAPK) pathway, extracellular signal-regulated protein ki-nase (ERK)-1/2 (p44/p42), in cytokine regulation has beendemonstrated in HBEs exposed to diesel exhaust particles[7] but not to cigarette smoke. NFκB is a ubiquitous tran-scription factor involved in regulating inflammatory re-sponses, and its targets include several of the genesencoding cytokines and chemokines. The activation ofNFκB by oxidative stress, inflammatory cytokines such asIL-1β and by TNF-α has been studied in depth [8], butmuch less is known about the effects of cigarette smoke onNFκB activation.

The purpose of this study was to gain insight into the mech-anism of inflammation induced by cigarette smoke, specifi-cally the acute response to smoke. The human alveolarepithelial cell line A549 and normal human bronchial epi-thelial cells (NHBEs) were exposed to the particulate frac-tion of cigarette smoke (cigarette smoke condensate;CSC) and examined for the production of proinflammatorycytokines and activation of MAPK and NFκB. The resultsdemonstrate that the acute phase response of pulmonaryepithelial cells to cigarette smoke involves activation ofERK1/2 and NFκB

Materials and methodsReagentsRPMI 1640, penicillin, streptomycin, fungizone, andtrypsin/EDTA were obtained from Cellgro (Herndon, VA,USA). Fetal bovine serum was from Atlanta Biochemicals(Atlanta, GA, USA). The culture medium (BEGM), growthfactors, trypsin, trypsin neutralizing solution, and Hanks'balanced salt solution for growing and treating primary hu-man epithelial cells were purchased from Clonetics (SanDiego, CA, USA. CSC was purchased from Murty Pharma-ceuticals (Lexington, KY, USA) and was prepared using aPhipps-Bird 20-channel smoking machine designed forFTC testing. The particulate matter from Kentucky standardcigarettes (1R3F; University of Kentucky, KY, USA) wascollected on Cambridge glass fibre filters and the amountobtained determined by weight increase of the filter. CSCwas prepared by dissolving the collected smoke particu-lates in dimethyl sulfoxide (DMSO) to yield a 4% solution(w/v). The average yield of CSC was 26.1 mg/cigarette.The CSC was diluted into DMSO and aliquots were kept at-80°C. Oligonucleotide primers for PCR were synthesizedby Operon Technologies (Alameda, CA, USA). Taqpolymerase, deoxynucleotide triphosphates and Taq bufferwere from Promega (Madison, WI, USA). Anti-ERK1/2(p44/p42) polyclonal antibody, anti-phosphorylated ERK1/

2 polyclonal antibody, and horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG were purchased from NewEngland Biolabs (Beverly, MA, USA). Anti-phosphorylatedIκB-α polyclonal antibody, IκB monoclonal antibody andchemiluminescent detection reagents were from Cell Sign-aling Technology (Beverly, MA, USA).

Cell cultureThe human alveolar epithelial cell line A549 (ATCC, Rock-ville, MD, USA) was grown in RPMI plus 10% fetal bovineserum, 100 U/ml penicillin, 100 U/ml streptomycin, and250 ng/ml amphotericin-B in an atmosphere of 5% carbondioxide and 95% air at 37°C. Primary cultures of NHBEs(Clonetics, San Diego, CA, USA) were obtained at secondpassage and cultured according to the manufacturer's in-structions using the media and growth factors suppliedwith the cells. The cells were seeded into 12-well cultureplates at 105 cells per well and used between passagesthree and seven.

Exposure of epithelial cells to cigarette smoke conden-sateCultures of A549 cells or NHBEs were grown to 50–75%confluence, then incubated with serum-deficient media for4 hours before exposure to CSC. Treatment with CSC, ata final concentration of 0.4 µg/ml in 0.5% DMSO, was car-ried out in modified Eagle's medium (MEM) containing Ear-le's salts at 37°C for 30 min to 5 hours. Control cells weretreated with the same concentration of DMSO withoutCSC. For CSC dose-response experiments, cells were in-cubated for 30 min at 37°C with concentrations of CSCranging from 0.004 to 20 µg/ml in 0.5% DMSO. Cell viabil-ity after CSC treatment was determined using the trypanblue dye exclusion test and was compared to viability of un-treated control cells.

TUNEL assayThe induction of apoptosis was determined by means ofthe TUNEL (deoxynucleotidyl transferase-mediated dUTPnick end labeling) assay using a kit supplied by Promega(Madison, WI, USA). Cultures of A549 cells or NHBEswere grown on 8-well slides and treated with CSC as de-scribed above, fixed with 4% paraformaldehyde for 15 minat room temperature, then examined by fluorescent micros-copy. Nuclei were counterstained by the addition of 4',6-di-amidino-2-phenylindole dihydrochloride (DAPI; MolecularProbes, Eugene, OR, USA) to the mounting medium. Thepercentage of apoptotic cells was determined by countinggreen fluorescent nuclei relative to the total number ofDAPI-positive nuclei.

Reverse-transcriptase PCRA549 cells or NHBEs were grown to approximately 75%confluence in 12-well plates, treated with various concen-trations of CSC in 0.5% DMSO, and total RNA was isolat-



ed using RNeasy method (Qiagen, Valencia, CA, USA).RNA (1 µg) was converted to cDNA in a 50 µl reaction con-taining 1 U of avian myeloblastosis virus reverse tran-scriptase (New England Biolabs, Beverly, MA, USA), 1 mMdNTP's, and 10 µg/ml random hexamer primers in 1× re-verse transcriptase buffer at 42°C for 50 min; the reactionwas terminated by heating to 90°C for 10 min. The result-ing cDNA was used as template for PCR amplification us-ing the primer pairs (Operon Technologies, Alameda, CA,USA) listed in Table 1. As a loading control parallel PCR re-actions were carried out using a primer pair for humanGAPDH (see Table 1). PCR products were separated onagarose gels, the ethidium bromide-stained bands weredigitally photographed using a ChemImager 4400 (AlphaInotech, San Leandro, CA, USA) and scanned using theAphaEase version 5.5 densitometry program. The experi-mental values were normalized to the corresponding GAP-DH value and expressed as relative intensity.

Western blotting and immunocytochemistryA549 cells or NHBEs were treated with CSC as describedabove and whole-cell protein extracts were prepared byscraping cells into lysis buffer containing 20 mM Tris-HCl(pH 8.0), 1 mM EDTA, 1 mM sodium orthovanadate, 1 mMsodium fluoride, 1 µg/ml each of leupeptin and pepstatin,and 1 µM PMSF. Cell lysis was achieved by sonicating thesuspension on ice with three 10-second bursts at a powersetting of 2 mW (Sonic Dismembrator, Fisher ScientificCo., Atlanta, GA, USA). Lysates were clarified by centrifu-gation at 10,000 × g for 30 min at 4°C and the protein con-centration of the whole-cell extracts was determined by thebicinchoninic protein assay (Pierce Biochemical Co., Rock-ford, IL, USA). Aliquots of 10 µg of protein were separatedby SDS-PAGE and electroblotted to nitrocellulose. The fil-ters were blocked with 2% nonfat dry milk in 10 mM Tris-HCl (pH 8.0), 0.15 M sodium chloride, 0.2% Tween-20(TBST) then incubated with primary antibody (1:1000 dilu-tion) for 2 hours at room temperature. After washing in Tris-

buffered saline with tween 20 (TBST), blots were incubat-ed for one hour at room temperature with HRP-conjugatedsecondary antibody, washed again and detected by chemi-luminescence. The protein bands were quantified by densi-tometry as described above. For immunocytochemistry,NHBEs grown on 8-well chamber slides were exposed toCSC at a concentration of 0.4 µg/ml for 30 min. Cells werefixed with 4% paraformaldehyde, blocked with BSA, immu-nostained using anti-phosphorylated ERK1/2, and visual-ized using HRP-conjugated secondary antibody andbisbenzamidine substrate.

Transfection with NFκB-luciferase reporter constructs and assay for gene expressionA549 cells were grown to 50–80% confluence on 12-wellplates and transfected with the Mercury pathway profilingsystem vector, pNFκB-TA-Luc (Clontech, Palo Alto, CA,USA), using lipofectamine (Gibco/BRL, Rockville, MD,USA) and used according to the manufacturer's recom-mendations. Cells were transfected using lipofectaminefrom Bibco/BRL (Rockville, MD). The plasmid, pVAX-LacZ,(Clontech, Palo Alto, CA, USA) was used as transfectioncontrol.

DNA/lipofectamine complexes were allowed to form for 30min at room temperature in RPMI (without antibiotics) con-taining 1 µg of reporter plasmid, 20 ng of pVAX-LacZ formonitoring transfection efficiency, and 10 µg of lipo-fectamine. Cells were transfected for 18 h. Prior to CSCchallenge, the transfected cells were preincubated for 4hours in minimal Eagle's medium with Earle's salts to re-move serum factors. Assays were done in triplicate andconsisted of untreated controls, treatment with 50 ng/mlTNF-α and treatment with 0.4 µg/ml CSC. After treat-ments, the cells were lysed by addition of cell lysis buffer assupplied in the luciferase assay kit from Clontech, scrapedfrom the wells and centrifuged 1 min at 12,000 × g. Aliq-uots of 20 µl of each lysate were transferred to flat-bot-tomed, white microtiter plates (Dynex, Chantilly, VA, USA)and read on a Dynex MLX plate reader in flash mode. Thetransfection efficiency was normalized by determining β-ga-lactosidase activity in the lysates from the cotransfectedpLacZ plasmid.

Statistical AnalysisAll values are expressed as mean ± standard error of themean (SEM). Comparisons of experimental values forCSC-treated cells to untreated controls were done by anal-ysis of variance (ANOVA). Probability values of < 0.05were considered significant.

Table 1

Primer pairs used for PCR of cDNA from CSC-treated NHBEs and A549 cells

Name Forward primer sequence (5'→3')

Reverse primer sequence (5'→3')

SICAM-1 Atggctcccagcagcccc cacctggcagcgtagggtIl-1b Gacctggacctctgccctctg aggtattttgtcattactttcRANTES tgaaggtctccgcggcacgcct ctagctcatctccaaagagttgIL-6 Aactccttctccacaagcg tggactgcaggaactccttIL-8 Atttctgcagctctgtgtaa tcctgtggcatccacgaaactGM-CSF Atgtggctgcagagcctgc tcactcctggactggctccGAPDH atggggaaggtgaaggtcgga gagatgatgacccttttggc



ResultsEffects of cigarette smoke condensate on cell viability and apoptosisTo determine the effects of CSC on cell viability, A549 cellsand NHBEs were exposed to increasing concentrations ofCSC for 30 min then examined using the trypan blue dye-exclusion test (Fig. 1A). Maximum toxicity for A549 at thehighest concentration of CSC (20 µg/ml) was 15%. At low-er CSC concentrations (<0.1 µg/ml), survival was greaterthan 90% for both A549 cells and NHBEs. Induction of ap-optosis by CSC was determined in A549 cells and NHBEsby using the TUNEL assay and confirmed by DNA fragmen-tation analysis (data not shown). NHBEs showed 5 to 10%apoptosis at moderate doses of CSC; A549 cells showedless than 5% apoptosis (Fig. 1B). However, with increasingconcentration of CSC, NHBEs showed as high as 20% ap-optosis, while A549 cells remained unchanged.

Changes in expression of specific cytokines and chem-okines after exposure to cigarette smoke condensateTo characterize the response of epithelial cells to CSC wedetermined the changes in message levels for a group ofcytokines, chemokines and cell-adhesion molecules. TotalRNA isolated from NHBEs following exposure to CSC wassubjected to RT-PCR, and the results are shown in Fig. 2.

IL-1β was induced to a level 9.5 times that of untreatedcontrols, while the expression of IL-8 and GM-CSF was in-creased 2.7-fold and 2.2-fold, respectively. Expression ofthe adhesion molecule ICAM-1 was found to be approxi-mately 1.6 times the level of control. IL-6 and the chemok-ine RANTES were elevated slightly (Fig. 2). This pattern ofenhancement of proinflammatory mediator expression im-plies that specific effector compounds are present in CSC.

Involvement of the MAPK pathway in response to ciga-rette smoke condensateTo examine if CSC-upregulation of cytokine production in-volves activation of MAPKs we examined CSC-treated NH-BEs for specific phosphorylated species. Fig. 3A showsthe results of a western blot of whole-cell extracts from NH-BEs exposed to increasing concentrations of CSC andprobed for phosphorylated ERK1/2, the activated form ofERK1/2. Band densities on the film were measured and theprotein loading variations were adjusted by normalizing tothe levels of non-phosphorylated ERK1/2. The level ofERK1/2 phosphorylation increased rapidly with increasingexposure to CSC, to a maximum of nearly twice the control.To confirm the results of immunoblot detection of phospho-rylated ERK1/2, NHBEs were exposed to 0.4 µg/ml CSCfor 30 min, then fixed and stained for phosphorylated

Figure 1

Effect of CSC on viability and apoptosis in A549 cells and NHBEs. Cells were grown to about 70% confluence in 12-well plates (Panel A, viability)or 8-well chamber slides (Panel B, apoptosis). Cells were exposed to the indicated concentration of CSC for 30 min then rinsed with PBS and proc-essed for each assay. Viability was determined by trypan blue vital staining and expressed as percent of total cells. Apoptosis was measured by flu-orescent TUNEL assay and is expressed as the percent of cells exhibiting apoptosis relative to the total number of cells. The values are the mean ±SEM for n = 3. (--�-- A549; --Њ-- NHBE) CSC = cigarette smoke condensate; NBHE = normal human bronchial epithelial cell; PBS = phosphate-buffered saline; SEM = standard error of the mean; TUNEL = deoxynucleotidyl transferase-mediated dUTP nick end labeling



ERK1/2. Exposure to CSC caused a marked increase innuclear staining of cells with phosphorylated ERK1/2 anti-bodies (Fig 3B). This nuclear localization and phosphorylat-ed ERK1/2 staining was largely blocked by pretreating withthe MEK inhibitor PD98059. The CSC-induced increase inIL-1β expression was also reduced by treatment of the cellswith PD98059 or the NFκB inhibitor, PDTC (Fig. 3C).These results suggest that CSC activates ERK1/2 in thesecells within 30 min.

Cigarette smoke condensate treatment induces rapid ac-tivation of the NFκB pathwayTo determine whether upregulation of cytokine productionby CSC involved activation of NFκB, we examined CSC-treated epithelial cells for phosphorylation of the inhibitor ofNFκB (IκB). NHBEs were treated with increasing concen-trations of CSC and whole-cell extracts were immunoblot-ted for phosphorylated IκB. Activation of NFκB involves theincreased phosphorylation and proteolytic degradation ofIκB. Treatment of cells with increasing concentrations ofCSC resulted in an initial rise in phosphorylated IκB levelsfollowed by a decrease (Fig. 4A). Protein bands were quan-titated by densitometry on the film and the phosphorylatedIκB densities were normalized to the levels of IκB. NHBEsexposed to CSC also showed an increase in nuclear stain-ing of phosphorylated IκB as detected by immunocyto-chemical staining using an antibody to phosphorylated IκB(Fig. 4B).

Effect of cigarette smoke condensate on transcriptional activation of luciferase reporter constructCSC appears to activate NFκB, which should result in tran-scriptional activation of NFκB-inducible genes. Therefore,A549 cells were transfected with a luciferase reporter plas-mid containing a promoter sequence that bound NFκB andluciferase activity was measured after challenge with CSC.Treatment with 0.4 µg/ml CSC for 30 min resulted in sig-nificant enhancement of luciferase reporter expressioncompared to control (Fig. 4C), indicating activation ofNFκB. TNF-α used as a positive control also activated luci-ferase gene expression with the same plasmid system. Ex-posure of cells transfected with the reporter plasmid toincreasing doses of CSC showed NFκB expression peak-ing at a CSC concentration between 1 and 4 µg/ml (Fig.4D).

DiscussionThe complex changes in lung function, morphology, andgene expression caused by compounds in cigarette smokeinvolve a combination of direct and indirect effects on cells,but principally center around an increase in airway inflam-mation as a result of cigarette smoking. The results of ourstudies demonstrate that the mechanism underlying theseacute inflammatory events involves activation of specificsignaling pathways such as MAPK (ERK1/2) and NFκB,leading to the release of proinflammatory cytokines.

One of the important observations of this study is the effectof CSC on NHBEs. Even at a concentration of 0.4 µg/ml,which does not induce significant changes in the viability ofthese cells, CSC induced increases in expression of sever-al cytokines at the mRNA level. IL-1β, which was signifi-cantly upregulated in NHBEs following CSC exposure, hasbeen shown to be important for activation of IL-8 [6] andICAM-1 [4]. This is also consistent with the report that ep-ithelial cells regulate inflammatory events by secreting cy-tokines and chemokines such as IL-1β, IL-8, GM-CSF,TNF-α, and sICAM-1 [2]. These paracrine effectors canthen produce further primary local inflammation or amplifythe effects of previously activated macrophages, eosi-nophils, mast cells, or lymphocytes. A notable finding fromour study is that exposure of NHBEs to CSC elicits the syn-thesis and release of a pattern of mediators similar to thatseen in A549 cells in response to CSC. These results implythat neoplastic cells and normal cells respond to CSC in asimilar manner.

Cigarette smoke has been shown by others to induce asynthesis of glutathione and gamma-glutamylcysteine thatwas associated with transcription factor AP-1 or an AP-1-like response element [9]. Although MAPKs and NFκBhave been implicated in the upregulation of proinflammato-ry cytokines, the role of these pathways in normal humanpulmonary epithelial cells in response to CSC has not been

Figure 2

Effect of CSC treatment on proinflammatory gene expression. NHBEswere exposed to CSC at a concentration of 0.4 µg/ml for 30 min at37°C. Total RNA was isolated and specific gene expression measuredby RT-PCR assay. Target gene expression levels were normalized tothe level of GAPDH expression in each reaction and expressed as foldchange relative to control. The values are means ± SEM for n = 3. Sig-nificant differences at P < 0.05 are indicated by *. CSC = cigarettesmoke condensate; NBHE = normal human bronchial epithelial cell;RT-PCR = reverse transcriptase-polymerase chain reaction; SEM =standard error of the mean



investigated. The results of our study implicate the ERK1/2(p42/44) MAPK pathway as a key element in this inflamma-tory response, an association that has not heretofore beenreported in normal human pulmonary epithelial cells. A sig-nificant finding of this study is that MAPKs such as ERK1/2 (p44/p42) are consistently activated in NHBEs. Howev-er, upon exposure to CSC, the magnitude of phosphoryla-tion increases. The finding that IL-1β expression and MAPKactivation are concomitantly increased by CSC exposureand inhibited by PD98059 is consistent with the report thatMAPKs activate expression of IL-1β genes [10]. Althoughthe control of cytokine expression was not investigated,ERK1/2 has been reported to upregulate IL-8, TNFα, andsICAM-1 expression [11–13]. Interestingly, phosphoryla-tion of p38 MAPK could not be detected in these cells (da-ta not shown). Activation of p38 has been reported inepithelial cells in conjunction with CSC-induced stress re-sponse [14]. The activation of ERK1/2 appears to be CSC-

specific as it was not phosphorylated by respiratory syncy-tial virus infection (San Juan and Mohapatra, unpublisheddata) Thus, activation of different MAPKs appears to bespecific to cell lines and environmental stimuli.

Another major finding of our studies is that CSC inducesactivation of NFκB, a central mediator of proinflammatoryresponses, which is activated under oxidative stress andupon injury to cells [15]. The reporter gene analysis indi-cates the potential for CSC exposure to activate any genehaving NFκB binding sites. This is consistent with results ofTransFacT analysis of promoter elements of IL-1, IL-8, IL-6,and ICAM-1, all of which possess NFκB binding sites intheir promoters (data not shown). While our results demon-strate that the acute response to CSC involves a concom-itant activation of the MAPK and NFκB pathways, thephysiological mechanism remains to be elucidated. Severalstudies have pointed to reactive oxygen species as the me-

Figure 3

CSC-induced phosphorylation of ERK1/2 and IL-1β expression. (A) CSC induces ERK1/2 phosphorylation. NHBEs were incubated with the indi-cated concentrations of CSC for 30 min at 37°C. Whole-cell protein extracts were prepared from cell lysates, aliquots of 10 µg of protein were sep-arated by SDS-PAGE, transferred to nitrocellulose and probed with an antibody to phosphorylated ERK1/2. Blots were then stripped and reprobedfor ERK1/2. The band intensities were determined by densitometry and the fold-change relative to control was plotted as means ± SEM. (B) Nuclearlocalization of phosphorylated ERK1/2 in NHBEs. Cells were incubated with 0.4 µg/ml CSC for 30 min at 37°C, then fixed with paraformaldehydeand probed with antibody to phosphorylated ERK1/2. Visualization was achieved by incubating the cells with HRP-conjugated secondary antibodyand bisbenzamidine substrate. Cells were treated with vehicle alone (Control), with CSC (CSC), or with CSC and the MEK inhibitor, PD98059 (20µM) (CSC + PD98059). (C) Inhibition of ERK1/2 or IκB phosphorylation attenuates IL-1β expression in A549. Cells were treated with 50 µg/mlPD98059 or 1 mM pyrrolidine dithiocarbamate (PDTC) for 30 min then exposed to 0.4 µg/ml CSC for 60 min. RT-PCR was performed on RNAextracted from these cells using IL-1β-specific primers. Band densities were normalized to GAPDH levels, expressed as fold change relative tountreated controls, and plotted as mean ± SEM for n = 3. The * indicates significance at P < 0.05. CSC = cigarette smoke condensate; ERK =extracellular signal-regulated kinase; IκB = inhibitor of NFκB; MEK = MAPK kinase; NBHE = normal human bronchial epithelial cell.



diator of NFκB activation [15], and metal contaminants inresidual oil fly ash have been suggested as participating inthe generation of reactive oxygen intermediates and activa-tion of NFκB in human airway epithelial cells [16]. There isevidence that heavy metals such as cadmium, nickel, andchromium activate MAPKs in the HBE cell line BEAS-2B

[8] and that metals in the air pollutant, residual oil fly ash,can induce expression of IL-6 and IL-8 in NHBEs [17].However, the role of metals in CSC-induced acute inflam-matory responses remains to be elucidated.

Figure 4

Phosphorylation of IκB and expression of NFκB-luciferase reporter gene in cells exposed to CSC. (A) CSC exposure results in phosphorylation ofIκB in NHBEs. Cells were grown to approximately 80% confluency then treated with the indicated concentrations of CSC for 30 min at 37°C.Whole-cell protein extracts were prepared and 10 µg aliquots were separated by SDS-PAGE, blotted and probed with an antibody to phosphor-ylated IκB. The blot was then stripped and reprobed for IκB. The band intensities for phosphorylated IκB were determined by densitometric scan-ning and normalized to the levels of IκB in each lane. Values are means ± SEM for n = 3. (B) CSC-induced immunofluorescent staining forphosphorylated IκB in NHBEs. Cells were treated with vehicle (Control) or 0.04 µg/ml CSC (CSC) for 30 min at 37°C. Cells were fixed with para-formaldehyde and probed with antibody to phosphorylated IκB. (C) and (D) Effect of CSC on expression of an NFκB-regulated luciferase reportergene in A549 cells. Cells were transfected with a plasmid containing an NFκB binding site upstream of a luciferase reporter sequence. The trans-fected cells were exposed to 0.4 µg/ml CSC for 30 min at 37°C (C) or increasing doses of CSC (D) and lysates were assayed for luciferase activityusing a luminometer. Differences in transfection efficiency were normalized by cotransfection with a LacZ-containing plasmid. The treatments wereperformed in triplicate and expressed as mean ± SEM for n = 3. CSC = cigarette smoke condensate; IκB = inhibitor of NFκB; SEM = standard errorof the mean; NFκB = nuclear factor-kappa B; NHBE = normal human bronchial epithelial cell.



ConclusionIn essence, these results demonstrate that NHBEs re-spond to moderate doses of CSC by activating both theERK1/2 and the NFκB pathways, and by upregulating theexpression of several genes encoding proinflammatory mol-ecules.

AbbreviationsBSA = Bovine serum albumin; CSC = cigarette smoke condensate; ERK = extracellular signal-regulated kinase; GM-CSF = granulocyte-macrophage colony-stimulating factor; HBE = human bronchial epithe-lial cell; IL = interleukin; IκB = inhibitor of NFκB; MAPK = mitogen-acti-vated protein kinase; MEK-1 = MAPK kinase; NFκB = nuclear factor-kappa B; NHBE = normal human bronchial epithelial cell; PBS = phos-phate-buffered saline; PDTC = pyrrolidine dithiocarbamate; RT-PCR = reverse transcriptase-polymerase chain reaction; sICAM = soluble inter-cellular adhesion molecule; TNF = tumour necrosis factor; TUNEL = de-oxynucleotidyl transferase-mediated dUTP nick end labeling

AcknowledgementsThis study was supported by grants from the VA Merit Review Award and the American Heart Association, Florida Affiliate award and the gen-erous support from the Joy McCann Culverhouse endowment to the Di-vision of Allergy and Immunology.

References1. Office of Environmental Health Hazard Assessment:: Health Ef-

fects of Exposure to Environmental Tobacco Smoke. CaliforniaEnvironmental Protection Agency 1997

2. Floreani AA, Rennard SI: The role of cigarette smoke in thepathogenesis of asthma and as a trigger for acute symptoms.Curr Opin Pulm Med 1999, 5:38-46

3. Adler KB, Fischer BM, Wright DT, Cohen LA, Becker S: Interac-tions between respiratory epithelial cells and cytokines: rela-tionships to lung inflammation. Ann NY Acad Sci 1994,725:128-145

4. Rusznak C, Sapsford RJ, Devalia JL, Shah SS, Hewitt EL, LamontAG, Davies RJ, Lozewicz S: Interaction of cigarette smoke andhouse dust mite allergens on inflammatory mediator releasefrom primary cultures of human bronchial epithelial cells. ClinExp Allergy 2001, 31:226-38

5. Mio T, Romberger DJ, Thompson AB, Robbins RA, Heires A, Ren-nard SI: Cigarette smoke induces interleukin-8 release fromhuman bronchial epithelial cells. Am J Respir Crit Care Med1997, 155:1770-6

6. Nakamura H, Yoshimura K, Jaffe HA, Crystal RG: Interleukin-8gene expression in human bronchial epithelial cells. J BiolChem 1991, 266:19611-7

7. Kawasaki S, Takizawa H, Takami K, Desaki M, Okazaki H, KasamaT, Kobayashi K, Yamamoto K, Nakahara K, Tanaka M, Sagai M,Ohtoshi T: Benzene-extracted components are important forthe major activity of diesel exhaust particles: effect on inter-leukin-8 gene expression in human bronchial epithelial cells.Am J Respir Cell Mol Biol 2001, 24:419-26

8. Ghosh S: Regulation of inducible gene expression by the tran-scription factor NFκB. Immunol Rev 1999, 19:183-189

9. Rahman I, Smith CA, Lawson MF, Harrison DJ, MacNee W: Induc-tion of gamma-glutamylcysteine synthetase by cigarettesmoke is associated with AP-1 in human alveolar epithelialcells. FEBS Lett 1996, 396:21-5

10. Eberhardt W, Huwiler A, Beck KF, Walpen S, Pfeilschifter J: Am-plification of IL-1 beta-induced matrix metalloproteinase-9 ex-pression by superoxide in rat glomerular mesangial cells ismediated by increased activities of NF-kappa B and activatingprotein-1 and involves activation of the mitogen-activated pro-tein kinase pathways. J Immunol 2000, 165:5788-97

11. Wang H, Ye Y, Zhu M, Cho C: Increased interleukin-8 expres-sion by cigarette smoke extract in endothelial cells. EnvironToxicol Pharmacol 2000, 9:19-23

12. Means TK, Pavlovich RP, Roca D, Vermeulen MW, Fenton MJ: Ac-tivation of TNF-alpha transcription utilizes distinct MAP kinasepathways in different macrophage populations. J Leukoc Biol2000, 67:885-93

13. Modur V, Zimmerman GA, Prescott SM, McIntyre TM: Endothelialcell inflammatory responses to tumor necrosis factor alpha.Ceramide-dependent and -independent mitogen-activatedprotein kinase cascades. J Biol Chem 1996, 271:13094-102

14. Mochida-Nishimura K, Surewicz K, Cross JV, Hejal R, TempletonD, Rich EA, Toossi Z: Differential activation of MAP kinase sig-naling pathways and nuclear factor-kappaB in bronchoalveo-lar cells of smokers and nonsmokers. Mol Med 2001, 7:177-85

15. Bowie A, O'Neill LA: Oxidative stress and nuclear factor-kap-paB activation: a reassessment of the evidence in the light ofrecent discoveries. Biochem Pharmacol 2000, 59:13-23

16. Quay JL, Reed W, Samet J, Devlin RB: Air pollution particles in-duce IL-6 gene expression in human airway epithelial cells viaNF-kappaB activation. Am J Respir Cell Mol Biol 1998, 19:98-106

17. Carter JD, Ghio AJ, Samet JM, Devlin RB: Cytokine production byhuman airway epithelial cells after exposure to an air pollutionparticle is metal-dependent. Toxicol Appl Pharmacol 1997,146:180-8


http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=10813248




























































Documents

Mechanism of cigarette smoke condensate-induced acute