MHC Class I Loss Is a Frequent Mechanism of Immune …clincancerres.aacrjournals.org/content/clincanres/20/23/6034.full.pdf · Trevor E. Angell1,2,3, Melissa G. Lechner2,4, Julie

Cancer Therapy: Preclinical

MHC Class I Loss Is a Frequent Mechanism of ImmuneEscape in Papillary Thyroid Cancer That Is Reversed byInterferon and Selumetinib Treatment In Vitro

Trevor E. Angell1,2,3, Melissa G. Lechner2,4, Julie K. Jang2, Jonathan S. LoPresti1, and Alan L. Epstein2

AbstractPurpose: To evaluate MHC class I expression on papillary thyroid cancer (PTC) and analyze changes in

MHC expression and associated immune activation with current and experimental treatments for thyroid

cancer using in vitro PTC cell lines.

Experimental Design: MHC class I expression and assessment of tumor-infiltrating leukocyte popula-

tions were evaluated by immunohistochemistry. PTC cell lines were analyzed for HLA-ABC expression by

flow cytometry following tyrosine kinase inhibitor, IFNa or IFNg , or radiation treatment. Functionalchanges in antigenicity were assessed by coculture of allogeneic donor peripheral blood leukocytes (PBL)

with pretreated or untreated PTC cell lines and measurement of T-cell activation and cytokine production.

Results: Both MHC class I and b2-microglobulin expression was reduced or absent in 76% of PTCspecimens and was associated with reduced tumor-infiltrating immune cells, including effector (CD3,CD8, CD16) and suppressor (FoxP3) populations. Treatment of PTC cell lines with the MEK1/2inhibitor selumetinib or IFN increased HLA-ABC expression. This phenotypic change was associated with

increased T-cell activation (%CD25 of CD3) and IL2 production by PBL cocultured with treated PTC celllines. Additive effects were seen with combination selumetinib and IFN treatment.

Conclusions:MHCclass I expression loss is frequent in humanPTC specimens and represents a significant

mechanism of immune escape. Increased antigenicity following selumetinib and IFN treatment warrants

further study for immunotherapy of progressive PTC. Clin Cancer Res; 20(23); 603444. 2014 AACR.

IntroductionPapillary thyroid cancer (PTC) comprises 85% to 90% of

all thyroid malignancies and its incidence has increased 3-fold over the past several decades. Despite an overall goodprognosis, 20% to 30% of patients with PTC have persis-tence or recurrence and 5% to 10% suffer progressive,treatment-refractory disease. For these patients, the adjunc-tive therapies currently available are often of limited benefit(14).

Immunotherapy is a potential new treatment strategy forpatients with recurrent or progressive PTC. In melanoma

and other solid malignancies, including lung, prostate, andrenal cell cancers, immunotherapy regimens such asCTLA-4and programmed death ligand 1 (PD-L1) blockade and IL2have produced remarkably durable tumor regressions inpatients with metastatic disease (57). Immunotherapyuses the ability of the bodys own immune cells to recognizeand eliminate malignant cells, taking advantage of theinherent specificity and systemic reach of the adaptiveimmune system. While the host immune system can rec-ognize and be activated to abnormal antigens present ontumors, neoplastic growths frequently evolve mechanismsto escape immune destruction (8, 9). Strategies of immuneescape include downregulation of antigen display, and theinduction of immune inhibition by tumor expression ofinhibitory molecules and the recruitment of suppressor cellpopulations (9). To eliminate cancer effectively, immuno-therapy regimens must reverse the tumor-driven immunedysfunction, restore antitumor immune responses, andinduce antigen-specific memory.

MHC class I molecules and their associated proteasomalmachinery play a key role in the presentation of peptides,including tumor-associated antigens, expressed on the sur-face of neoplasms. Expression of these cell antigens con-current with immune costimulatory signals indicating celldamage induces immune activation and cytotoxic killingof the abnormal cell (9). Downregulation of MHC class I

1Division of Endocrinology and Diabetes, Keck Medical Center, Universityof Southern California, Los Angeles, California. 2Department of Pathology,Keck Medical Center, University of Southern California, Los Angeles,California. 3Division of Endocrinology, Diabetes, and Hypertension, Brig-ham and Women's Hospital and Harvard Medical School, Boston, Mas-sachusetts. 4Department ofMedicine, Brigham andWomen's Hospital andHarvard Medical School, Boston, Massachusetts.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

Corresponding Author: Alan L. Epstein, USC Keck School of Medicine,2011 Zonal Avenue, HMR 205, Los Angeles, CA 90033. Phone: 323-442-1172; Fax: 323-442-2809; E-mail: [email protected]

doi: 10.1158/1078-0432.CCR-14-0879

2014 American Association for Cancer Research.

ClinicalCancer

Research

Clin Cancer Res; 20(23) December 1, 20146034

on April 23, 2018. 2014 American Association for Cancer Research. clincancerres.aacrjournals.org Downloaded from

Published OnlineFirst October 7, 2014; DOI: 10.1158/1078-0432.CCR-14-0879

http://clincancerres.aacrjournals.org/

antigen expression by cancer cells is an important strategyfor immune evasion (911). HLA-ABC loss has beenreported in a number of cancers, including in approximate-ly 70%of head and neck squamous cell carcinomas, 96%ofbreast carcinomas, 87% of colon carcinomas, 39% of pan-creatic carcinomas, and 63% of melanomas (12, 13).In PTC, immunosuppressive strategies, including tumor

expression of immune inhibitory molecules (1417) andtumor infiltration by suppressive immune cells (1722),have been described, but the contribution of immuneevasion in PTC has not been investigated. In this study, wereport in PTC a high proportion of cases with downregu-lated HLA-ABC and b2-microglobulin (b2m) expressionandanassociated attenuationof tumor-infiltrating immunecell populations. Furthermore, we identify potential thera-pies to reverse loss of antigenicity in cell line models of PTCand demonstrate increases in immune cell activation fol-lowing recovery of MHC class I expression.

Materials and MethodsTissue specimensPTC specimens from patients with thyroid cancer with

anonomized clinical datawere obtained from theUSCKeckMedical Center Tissue Bank (IRB protocol HS-11-00215).When available, contralateral thyroid lobe normal tissuewas collected and evaluated in parallel.

ImmunohistochemistryFormalin-fixed paraffin-embedded (FFPE) tissue sections

were deparaffinized, rehydrated, and subjected to heat-induced antigen retrieval (0.01 mol/L citrate, pH 6.0)followed by treatment with 3% H2O2 for 10 minutes toblock endogenous peroxidase activity. Sections were incu-batedovernight at 4Cwithprimary antibodies against CD3(PC3/188; Santa Cruz Biotechnology), CD8 (C8/144B,Dako), CD16 (O.N.82, Abcam), CD68 (PG-M1, Dako),CD163 (10D6, Abcam), FoxP3 (236A/E7, Novus), HLA-ABC (C-6, Santa Cruz Biotechnology), or b2m (BBM.1,Santa Cruz Biotechnology). Secondary antibody staining

and antigen detection with 3,30-diaminobenzidine wasperformed using Vectastain ABC Kit (Vector Laboratories).Sections were counterstained with hematoxylin, dehy-drated, and mounted. Appropriate positive and negativecontrols were used for all stains. Hematoxylin and eosin(H&E)-stained sections were provided by the USC Transla-tional Pathology Core. Representative immunohistochem-ical (IHC) images and stain controls are shown in Supple-mentary Fig. S1.

Scoring of immune markersUsing an adapted immune infiltrate scoring system to

evaluate cancer specimens previously developed in ourlaboratory (23), areas of tumor and associated tumor-infil-trating leukocytes (TIL), intratumorally or at the invadingmargin, were identified on H&E-stained sections. Areas ofobvious lymphoid follicle arrangement, necrosis, or hem-orrhage were excluded. Tumor expression of HLA-ABC orb2mwas assessed qualitatively as intact, reduced, or absent.Positively stained leukocytes for CD3, CD8, CD16, CD68,CD163, or FoxP3 were counted in five representative high-power fields (hpf) for each tumor section. Two independentobservers scored each section and the results were pooledwith rare disagreements resolved by a third evaluator.

BRAF mutational analysisThe gene mutation BRAFT1799A encodes for the mutated

protein BRAFV600E. For BRAFT1799A mutation detection,tumor DNA was isolated from FFPE sections by excisionof tumor tissue and DNA purification using a QiagenQIAmp FFPE Kit (Qiagen). Human BRAF exon 15 wasamplified by PCR (forward: TCATAATGCTTGCTCTGA-TAGGA; reverse: GGCCAAAAATTTAATCAGTGGA; ref. 24).PCRDNAamplicons electrophoresedon1.5%agarosewereextracted and purified using aQiagenMiniElude Gel Extrac-tion Kit and sequenced at the USC Genomics Core Facility.Given the rarity of other BRAF mutations, cases withouta BRAFT1799A substitution were considered wild-type(BRAFWT).

Cell lines and cell culturePTC cell lines BCPAP (BRAFV600E mutation), K-1

(BRAFV600E mutation, PI3K mutation), and TPC-1 (RET/PTC1 translocation, BRAFWT) were obtained from the Uni-versity of Colorado Tissue Bank in 2013 and authenticationwas performed by the University of Colorado Cancer CenterDNA Sequencing and Analysis Core using DNA profiling ofshort tandemrepeatmarkers (25).Cellsweremaintained in a5% CO2, 37

C, humidified incubator in complete medium(RPMI1640 with 10% fetal calf serum, 2 mmol/L L-gluta-mine, 100 U/mL penicillin, and 100 mg/mL streptomycin).

In vitro treatment of PTC cell lines for HLAmodulationTumor cell lineswere seeded in6-well tissue culture plates

overnight (7.5 105 cells/well). For small-molecule inhib-itor treatment, tumor cells were treated for 5 days, withrefreshment of media and drug every 48 hours. Drugsevaluated included two specific BRAFV600E inhibitors

Translational RelevanceWhile theprognosis for papillary thyroid cancer (PTC)

is generally good, a subset of patients suffer significantmorbidity and mortality from recurrent or progressivedisease. Existing treatments show limited benefit in thesecases and new therapies are needed. This study identifiesMHC class I downregulation as a frequentmechanismofimmune escape in PTC patients that is associated withdecreased intratumoral immune cell infiltration. Treat-ment of PTC cell lines with tyrosine kinase inhibitorselumetinib and IFNs augmented MHC class I expres-sion and increased tumor recognitionby immune cells invitro, suggesting MHC class I modulation as a novelimmunotherapy approach for patients with advancedPTC.

HLA Expression in PTC

www.aacrjournals.org Clin Cancer Res; 20(23) December 1, 2014 6035




vemurafenib and PLX 4720, tyrosine kinase inhibitorssunitinib and sorafenib (Selleck Chemicals; resuspendedin DMSO), and a specific MEK1/2 inhibitor selumetinib(MedChem Express; resuspended in DMSO), with drugconcentrations selected on the basis of reported drug IC50in humandifferentiated thyroid cancer cell lines. Tumor celltreatment with IFNg or a (Sigma-Aldrich) was similarlydone for 72 hours, with cytokines refreshed at 48 hours. Forradiation treatment, tumor cellswere exposed to30or 60Gyusing an X-RAD 320 IX irradiator (Precision X-Ray, Inc.).Experiments were performed in duplicate using noncon-fluent monolayers. After in vitro treatment, cell lines wereanalyzed for surfacemarker expression by flow cytometry orcocultured with healthy donor peripheral blood leukocytes(PBL) to assess their antigenicity, as described below.

Measurement of immune cell activationFunctionally relevant changes in HLA expression on

PTC cell lines following drug, radiation, or IFN treatmentwere assessed by a modified mixed lymphocyte reactionin which nave healthy donor PBL were cocultured withthe tumor cell lines and then indicators of immune cellactivation were measured. Peripheral blood from healthydonors was obtained by routine venipuncture with IRBapproval (protocol HS-06-00579), and PBL were isolatedby differential density gradient centrifugation. After invitro pretreatment of tumor cell lines with drug, radiation,cytokine, or vehicle control, the medium was replacedand tumor cells were cocultured with freshly isolatedCFSE-labeled PBL (106 cells/well). Coculture experimentcontrols included single donor PBL alone (i.e., withoutallogeneic tumor cell lines) in the presence or absence ofanti-CD3/CD28 stimulation (Invitrogen; SupplementaryFig. S2). After 72 hours, PBL were collected from cocul-tures and analyzed for immune cell markers as describedbelow. In addition, coculture supernatants were collectedand analyzed for levels of the T-cell cytokine IL2 bycytometric bead array (BD Biosciences) as per manufac-turers instructions. In two independent experiments, IL2production by K-1, BCPAP, and TPC-1 cell lines alone wasundetectable.

Flow cytometryMHC class I molecule expression on tumor cell lines

and immune markers on PBL from tumor cell line cocul-tures were evaluated by flow cytometry. Tumor cells werecollected from wells using Detachin (Genlantis) to min-imize cell surface protein digestion. Cell washing andstaining was performed as described previously (11)using fluorescently conjugated monoclonal antibodiesagainst CD25 (4E3, Miltenyi Biotec), HLA-ABC (G46-2.6, BD Biosciences), PD-L1 (M1H1, BD Biosciences),PD-L2 (MIH18, BD Biosciences), HLA-G (MEM-G/9, LifeTechnologies), CD3 (UCHT1, BD Biosciences), or iso-type-matched controls (BD Biosciences). Samples were run(20,000 live events) in duplicated on an Attune flowcytometer (LifeTechnologies), or a BD LSRII flow cytometerusing FACSDIVA software (BD Biosciences) for acquisition

and compensation, and analyzed using FlowJo software(FlowJo).

Quantitative reverse transcriptase PCRThyroid cancer cell lines BCPAP, K-1, and TPC-1 were

treated with selumetinib 10 mmol/L or vehicle alone for 48hours in triplicate and then evaluated for gene expression ofMHC class I molecules, antigen-processing machinery, andcytokines by quantitative reverse transcriptase PCR (qRT-PCR), as reported previously (23). Briefly, RNAwas isolatedfrom tumor cell lines using RNeasy Micro Kit with on-column DNase treatment (Qiagen). For real-time RT-PCR,100 ng of DNase-treated RNA was amplified with gene-specific primers using one-step Power SYBR green RNA-to-Ct kit (Applied Biosystems) and an MX3000P Strategenethermocycler in duplicate. Primer sequences were from thevalidated NIH qRT-PCR database (http://primerdepot.nci.nih.gov), are listed in Supplementary Table S1, and weresynthesized by the USC Microchemical Core Facility. Geneexpression was normalized to housekeeping gene GAPDHand reported as a mean fold change in expression for eachgene in selumetinib-treated thyroid cancer cell lines relativeto expression in vehicle-treated cells.

Statistical analysisStatistics are shown as mean SD or SEM as indicated.

Unpaired student t tests with Bonferroni correction formultiple comparisons was used to compare differences inmean positively stained immune cells/hpf between tumorswith absent or reduced versus intact MHC class I (HLA-ABCor b2m) expression. Differences in HLA expression amongtreated and untreated tumor cell line groups, differences inthe mean fraction of activated T cells, and mean cytokinelevels from PBL in tumor cell line cocultures among treatedand untreated groups were evaluated by ANOVA followedby pairwise comparisons with Dunnett test or Bonferronicorrected t test. Gene expression differences by qRT-PCRbetween selumetinib or vehicle control-treated PTC celllines were compared by student t test with correction formultiple comparisons by the HolmSidak method, with a 0.05. Statistical tests were performed using GraphPadPrism 6.0 software and graphs and figures were producedusing GraphPad and Abobe Photoshop.

ResultsPatient characteristics

Tumor specimens and clinical data from 33 PTC patientswere retrospectively obtained from the KeckMedical CenterTissue Bank, as summarized in Supplementary Table S2.Female patients constituted 29 of 33 (87.8%) of the sample,and the median patient age was 49 years (range 2275).Primary tumors were noninvasive (TNM 1 or 2) in 26(78.8%) and invasive (TNM 3 or 4) in 7 (21.2%) cases.Lymph nodemetastases were present at initial surgery in 12of 33 (35.2%) patients. No patient had known distantmetastases at the time of the initial surgery. Evaluationrevealed the BRAFV600E mutation in 17 of 33 (51.5%) oftumor samples.

Angell et al.

Clin Cancer Res; 20(23) December 1, 2014 Clinical Cancer Research6036




Loss of MHC class I expression in PTCExpression ofMHC class Imolecules by tumor specimens

was evaluated by staining of FFPE sections for HLA-ABC byimmunohistochemistry. As shown in Fig. 1, HLA-ABCexpression was decreased or absent in 29 of 33 (87.9%)tumor specimens compared with normal thyroid tissue,withonly four specimens showing intact cellularmembranestaining. Expression of b2mby immunohistochemistry wassimilar, though demonstrating more cases (7/33, 21.2%)with intact expression. When considering only cases withcongruous HLA-ABC and b2m results, 25 of 33 cases (76%)had "absent or reduced" expression of both of these MHCclass I markers. Of cases with intact expression of eithermarker, 6 of 8 (75%) were BRAFV600E positive, comparedwith only 11 of 25 (44%) in BRAFWT tumors, though thedifference between these proportions was not statisticallysignificant, possibly attributable to small sample size.Because MHC class I molecules facilitate immune recog-

nition, we hypothesized that those tumors retaining strongHLA-ABCand/orb2mexpressionwould demonstrate great-er tumor leukocyte infiltration. For these studies, tumorspecimens were grouped as "intact" if either HLA-ABCor b2m expression was intact (n 8) or "reduced/absent"if bothHLA-ABC and b2mwere reduced and/or absent (n25) compared with normal thyroid tissue. As shownin Fig. 2, intact expression of HLA-ABC or b2m by tumorcells was associated with a greater number of intratumoralimmune cells. The mean number of CD3 T cells/hpf was51.47 15.67 compared with 15.15 1.88 in tumors withintact versus reduced/absent HLA-ABC expression, respec-

tively (P 0.0011). Similarly, tumors with intact comparedwith reduced/absent HLA-ABC or b2m demonstrated ahigher mean number of tumor-infiltrating CD8 T cells of13.284.08 cells/hpf comparedwith 5.670.91 cells/hpf,respectively (P 0.013). Linear regression analysis betweenmean CD3 cells/hpf infiltration and increasing HLA-ABCexpression score demonstrated a significant positive corre-lation (r20.29,P0.0011; Fig. 2B). All other immune cellpopulations examined, namely CD16 natural killer cells,FoxP3 regulatory T cells, CD68 pan-macrophages, andCD163 M2 macrophages, were found to be more abun-dant in HLA-ABC/b2m intact tumors, but these differencesdid not reach statistical significance (Fig. 2C). Representa-tive IHC staining of tissue sections is shown in Supplemen-tary Fig. S1.

Effect of tyrosine kinase inhibitors onPTC cell lineHLAexpression

Tyrosine kinase inhibitors are clinically available drugsused in thyroid cancer treatment and some have beenshown to modulate PTC expression of differentiated thy-roid antigens (26, 27). Using papillary thyroid cancer celllines as an in vitromodel of disease, several kinase inhibitorspreviously examined in thyroid cancer were evaluated fortheir respective effects on MHC class I expression andpotential as immunotherapeutic reagents.HLA-ABC expres-sion was measured by flow cytometry following incubationof each cell line with drug or vehicle control. As shownin Fig. 3, baseline HLA-ABC expression of cell lines BCPAP,K-1, and TPC-1 in culture was similar and treatment with

Figure 1. Frequent loss of MHCClass I expression in PTC. A, bargraph showing the number ofspecimens with intact, reduced, orabsent expression of HLA-ABC orb2-microglobulin (b2m). B, IHCstaining of representative PTCtumor specimens for HLA-ABCand b2m demonstrating (from leftto right) intact and absentexpression in PTC specimens,lymph node control, and intactexpression in normal thyroidfollicular cells (originalmagnification, 400). Black arrowindicates membrane localization ofstaining for HLA-ABC consistentwith intact expression.






JAK/STAT inhibitor sunitinib or MEK1/2 inhibitor selume-tinib produced significant, dose-responsive increases inHLA-ABC expression in all three PTC cell lines. Treatmentwith sorafenib, another tyrosine kinase inhibitor, yieldedmodest and nonsignificant increases in HLA-ABC expres-sion. Two specific BRAFV600E inhibitors, vemurafenib andPLX 4720, each generated a modest increase in HLA-ABCexpression on the K-1 cells, and no significant changein HLA-ABC expression on BCPAP cells (SupplementaryFig. S3A).

The kinase inhibitors sunitinib and selumetinib showedthe greatest efficacy in upregulatingHLA-ABC across all PTCcell lines, but sunitinib also produced significant upregula-tion of immunosuppressive ligands PD-L1 (Fig. 3B), PD-L2(data not shown), and HLA-G (Fig. 3C), making it a lessattractive candidate for immunotherapy. Therefore, selu-metinib was selected for further evaluation. To determinewhether the observed phenotypic changes in MHC class Iexpression after drug treatment corresponded to functionalincreases in antigen expression in thyroid cancer cell lines, amodified mixed lymphocyte reaction was performed. Forthis, nave PBL from an unrelated, healthy donor werecocultured with PTC cells after the tumor cells were pre-treated with a kinase inhibitor or vehicle control. Given therole ofMHC class Imolecules in immune recognition of selfversus nonself tissues, a more robust immune response wasexpected from a donors PBL to a PTC cell line with greatercompared with lesser HLA expression. Indicators ofimmune activation assessed after exposure of PBL to the

PTC cell lines included greater T-cell activation (CD25

fraction of CD3 T cells) and cytokine production (IL2; Fig.3D and E). Selumetinib (10 mmol/L) pretreated cells of allthree PTC cell lines caused a statistically significant increasein IL2 productionby cocultured PBLs (P

there was a trend toward increased CD25/CD3 T cellswhen PTC cell lines were pretreated with 30 or 60 Gy,though these increases were statistically significant only forBCPAP (Supplementary Fig. S3C). Similarly, IL2 produc-tion by PBL cocultured with radiation-treated BCPAP cellswas increased modestly, and no appreciable increase wasnoted for PBL cocultured with K-1 or TPC-1 (Supplemen-tary Fig. S3D).

Effect of IFN treatment on PTC cell line HLA expressionThe effect of IFNs IFNg and IFNa on antigen expression

by PTC cell lines was evaluated by in vitro treatment over 72hours followed by measurement of HLA-ABC surface

expression byflowcytometry. In response to IFNg treatmentat 50 or 100 U/mL, all three PTC cell lines showed strongupregulation of MHC class I molecules, as shown in Fig. 4(P < 0.05 for BCPAP and TPC-1, trend for K-1). IFNasimilarly induced a significant and dose-related increase inHLA-ABC expression in BCPAP and TPC-1 PTC cell lines atdoses of 100 and 500 U/mL, with a trend toward greaterexpression in K-1 cells, though the changes in expressionwere more modest. As shown in Fig. 4B and C, the greaterexpression of MHC class I on PTC cell lines following IFNgpretreatment produced a significant increase in T-cell acti-vation and IL2 production in all three PTC cell lines in adose-responsive fashion. IFNa treatment of cell lines

Figure 3. Select tyrosine kinase inhibitors increase the antigenicity of PTC cell lines. A, the effect of in vitro treatment of PTC cell lines with kinase inhibitorssunitinib, sorafenib, and selumetinib on HLA-ABC expression as measured by flow cytometry. Representative flow cytometry histograms for PTC cell lines(BCPAP,K-1, andTPC-1) stainedwith fluorescence-labeledmonoclonal antibodies after treatmentwith sunitinib, selumetinib, or vehicle/media control. B andC, expression of immunosuppressive ligands PD-L1 and HLA-G by PTC cell lines following sunitinib or selumetinib treatment. For all graphs in AC, meanSEM is shown,with statistically significant difference from vehicle control indicated by ,P

yielded significant but smaller increases in cytokine IL2production by PBL in PTC cell line cocultures.

Additive effect of combination selumetinib and IFNtherapy

As both MEK1/2 inhibitor selumetinib and IFN therapyproduced significant increases in MHC class I expressionand antigenicity, as indicated by greater T-cell activationand cytokine productionby coculturedPBL for all three PTCcell lines, combinations of selumetinib (10 mmol/L) andIFNg (100U/mL)or IFNa (500U/mL)were investigated. Asshown in Fig. 5, the addition of IFNaor IFNg to selumetinibtreatment produced further increases in HLA-ABC expres-

sion in all three PTCmodels. Pretreatment of PTC cell lineswith the combination of selumetinib and IFNa produced atrend toward increased donor PBL T-cell activation com-pared with pretreatment with either selumetinib or IFNaalone. IL2 production by these cocultured T cells wasstatistically greater for combination therapy than for IFNatreatment alone for all cell lines, and selumetinib treatmentalone in some of the cell lines. Selumetinib and IFNgcombination pretreatment of PTC cell lines was similarlyfound to be superior to single-agent therapy, yieldingincreased T-cell activation and significantly greater IL2production (Fig. 5C). While the mechanism of IFNs onMHC class I molecules and antigen-processing machinery

Figure 4. IFN produces significantupregulation of HLA-ABC in PTCcorresponding to increasedantigenicity. A, the effect of IFNa orIFNg in vitro treatment of PTC celllines on HLA-ABC expressionmeasured by flow cytometry. Datashown are mean SEM andsignificant differences from vehiclecontrol are indicated by , P < 0.05;, P < 0.01; , P < 0.001.Representative flow cytometryhistograms for HLA-ABCexpression are shown to the right.B, T-cell activation CD25 fractionof CD3 T cells or IL2 production inPBL-PTC cell line cocultures (C)after PTC were pretreated with IFNor vehicle control. B and C, datashown are mean (n 4) SEM,with significant differences fromvehicle control-treated PTCindicated by ,P

has been evaluated previously, the mechanism of selu-metinib to increase antigenicity has not been studied indetail. Furthermore, the observed effect of selumetinibto increase MHC class I expression was intrinsic, occur-ring in the absence of infiltrating immune cells. To studythis further, expression of common antigen-processingmachinery (APM), cytokines, STAT, and MHC class Imolecule genes in thyroid cancer cell lines after selume-tinib treatment was evaluated by quantitative RT-PCR.These preliminary results showed upregulation in all celllines of TAP1, STAT1, STAT6, and LMP2 with selumetinibtreatment, though these differences did not meet statis-tical significance for all cell lines (Supplementary Fig. S4).Increases in the expression of APM genes were greatest inK-1, the cell line showing the greatest phenotypicresponse to selumetinib treatment.

DiscussionBoth recurrent and metastatic thyroid cancer remain

difficult to treat, often necessitating additional therapiessuch as radioactive iodine ablation, surgical resections, and/or tyrosine kinase inhibitor therapy, all of whichmay causesubstantial morbidity. Novel therapeutic approaches likeimmunotherapy may be of benefit in these cases.

Barriers to tumor clearance by the host immune systeminclude evasion and inhibition strategies adopted by thecancer during its evolution. Antigen expression by MHCclass I molecules on the surface of tumor cells is critical toimmune recognition and loss of these proteins is a well-recognized mechanism of tumor immune escape (9,10, 23). In this retrospective analysis of PTC tumor speci-mens, we report a striking loss of MHC class I expression inPTC, with 76% of cases demonstrating reduced or absentexpression of both HLA-ABC and b2m. Autoimmune thy-roid disease and thyroiditis associated with immunothera-py for other cancer types are common, and may suggest aparticular susceptibility of thyroid tissue to immune acti-vation anddestruction (7, 30).MHCclass I-mediated tumorantigen display may induce an early immune response inPTC, possibly explaining the overall good prognosisobserved. During the process of tumor immunoediting byhost immune cells (31), highly antigenic tumor cellsmaybeeliminated, selecting for survival of PTCwith lowMHCclassI expression. Low antigen expression by thyroid cancer cells,in concertwith upregulationof immunosuppressive ligands(1417), may effectively hide the tumor cells from hostimmune surveillance and help explain the difficulty ofachieving disease-free status in persistent PTC. This sugges-tion is supported by the present findings of a global decrease

Figure 5. Combinationselumetinib and IFN treatmentof PTC cell lines producesadditive increases in HLA-ABCexpression and antigenicity.A, the effect of selumetinib andIFNg or IFNa treatment on PTCHLA-ABC expression. Datashown are mean SEM, withstatistically significantdifferences from vehicle controlindicated by , P < 0.05;, P < 0.01; , P < 0.001;,P < 0.0001. Representativeflow cytometry histograms forHLA-ABC expression areshown to the right of therespective graph. B, T-cellactivation measured as thefraction CD25 of CD3 T cellsor IL2 production in PBL-PTCcocultures (C) after PTC werepretreated with interferon,selumetinib, or combinationtherapy. B and C, data shownare mean (n 4) SEM, withsignificant differences fromsingle reagent therapy indicatedby , P < 0.05; , P < 0.01;, P < 0.001.






in immune cell infiltration in PTC specimens associatedwith loss of HLA-ABC and b2m compared with those withintact expression. The relationship between highMHC classI expression and greater antitumor immune responses hasbeen established in a number of other solid malignancies,including colorectal cancer (32), head and neck squamouscell carcinoma (23), and experimental tumor models (11).Specific to thyroid cancer, Cunha and colleagues (33)recently showed improved outcomes in differentiated thy-roid cancer patients with greater TILs, and better clinicalprognosis has been demonstrated in patients with thyroidcancer who have concurrent Hashimotos thyroiditis (34).

Recognition of low MHC class I expression as a frequentmechanism of immune escape in papillary thyroid canceridentifiesHLA augmentation as a target for immunotherapyprotocols.

Garrido and colleagues (35) proposed classification ofHLA tumor loss into two categories based upon the func-tional ability to recover or upregulate HLA expressionfollowing immunotherapy (e.g., cytokine treatment). Theyproposed that irreversible defects in HLA expression, orthose that do not reverse with cytokine treatment, arisesecondary to structural genetic problems. The most com-mon etiologies of these structural changes are loss of het-erozygosity (LOH) ormutations/deletions affecting HLA orb2m genes on chromosomes 6 and 15, respectively. Incontrast to this, they propose that reversible MHC class Ialterations are primarily defects in the gene regulation ofHLA class I heavy chain genes, b2m gene, and componentsof the antigen-processing machinery. This framework pro-vides insight to the mechanisms underlying MHC class Idefects in a tumor and the likely responsiveness to immu-notherapy treatment. Garrido and colleagues evaluatedclinical responses to immunotherapy in patients with mel-anoma showing MHC class I loss, and found that diseaseregression was more frequent in those patients with revers-ible HLA expression (i.e., regulatory gene defects) than inthose with irreversible HLA defects (i.e., structural defects).Preliminary in vitro data in the present study suggests thatthe MHC class I defects observed in thyroid cancer may beprimarily reversible by cytokine therapy and likely amena-ble to immunotherapy. Using tumor cell lines as models ofPTC, we demonstrate that HLA-ABC expression can beincreased by treatment with the MEK1/2 inhibitor selume-tinib and IFNs. Furthermore, this phenotypic change cor-relates with increased antigenicity, as evidenced by anincrease in markers of T-cell activation (CD25 positivity)and IL2 production by allogeneic donor PBL coculturedwith the tumor cell lines. These data are consistent with thephysiologic function of IFNs andprevious findings showingincreased antigen expression by cancer cells following IFNtherapy. IFNs are lymphocyte-produced cytokines critical incell-mediated immune responseswith pleiotropic effects onantigen presentation through MHC class I, including upre-gulation of MHC class I expression directly, and enhance-ment of antigen processing and loading through upregula-tion of proteasomal subunits LMP2 and LMP7, transportersassociated with antigen processing (TAP) proteins, and the

proteasome regulator PA28 (3639). Previous studies dem-onstrated enhancement of HLA class I antigen expressionand immunogenicity following IFNg or IFNa treatment inmelanoma, embryonal carcinoma, and glioblastomamulti-forme (36, 38, 39). Of interest, the induction of thyroiditis,including immune cell-mediated follicular cell destruction,is a common secondary effect of IFNa treatment for hep-atitis (40) and cancer immunotherapy (41). In addition toMHC class I changes, IFNa has also been shown to upre-gulate immune costimulatory molecules B7.1 and HLA-DRon thyroid follicular cells that could contribute to thyroid-directed immune reactions (42, 43). In this study, IFNgproduced greater increases in HLA-ABC expression andantigenicity of PTC cell lines than IFNa. Prior clinicalevaluations of recombinant IFNg therapy in patients withcancer in the mid-1980s to 1990s produced modest, if any,clinical benefit and were accompanied by frequent sideeffects of pyrexia and malaise during treatment (44, 45).Compared with these earlier studies, we now recognize thatcancers evolve different strategies to escape host immunedestruction (11), and that immunotherapy is effective inproducing tumor regression only when the regimen ismatched to the specific mechanisms of immune escapepresent in that tumor (23, 46, 47). The efficacy of IFNgtreatment in cancers withmarkedMHC class I loss, like PTC(76%),may be greater than for other solid tumor types withlower prevalence of HLA downregulation. We previouslydeveloped chTNT-3/muIFNg , a tumor-targeted fusion pro-tein consisting of recombinant IFNg and the tumor necro-sistargeted monoclonal antibody chTNT-3 to overcomesystemic toxicity by targeting IFNg to the tumor site (48). Inmice transplanted with the metastatic MAD109 lung carci-noma tumor model, which we demonstrated to have lowMHC class I expression in vivo (11), treatment with chTNT-3/muIFNg produced a significant increase in intratumoralinfiltration by leukocytes and a decrease in the number ofmetastatic foci without causing observable toxicity (48). Ananalogous human IFNg tumor-targeted fusion protein,chTNT-3/huIFNg (49), was also generated, and may be anideal immunotherapy reagent for immunotherapy of pro-gressive PTC.

Tyrosine kinase inhibitors are an important group ofclinically available adjuvant therapies for PTC. In this study,selumetinib effectively increased MHC expression on PTCcell lines, a finding supported by similar effects seen inmelanoma cell lines (50). Themechanism by whichMEK1/2 inhibitor selumetinib increases MHC class I expression isless well understood. Preliminary evaluation in this studysuggested that selumetinib produces increases in TAP1,STAT1, STAT6, and proteasomal component LMP2 geneexpression, with variable downregulation of IFNg and/orIFNa in PTC cell lines. These preliminary data suggest thatthe intrinsic effects of selumetinib to increase HLA expres-sion on PTC cells lines are not mediated through upregula-tion of IFNs. Together, with the additive effect of combi-nation treatment with selumetinib and IFNg or IFNa onincreasing PTC cell line expression of HLA-ABC and sub-sequent PBL immune activation, these data suggest two

Angell et al.





complementary mechanisms of action augmenting MHCclass I expression.Other kinase inhibitors were evaluated in this study,

though their effects on antigenicity were not significant orwere accompanied by increases in immunosuppression.The JAK/STAT inhibitor sunitinib, for example, augmentedHLA-ABC expression by PTC cell lines but this change wasconcurrentwith upregulation of PD-L1, PD-L2, andHLA-G,which are likely to hinder effective antitumor immuneresponses. In addition, in some tumor models, radiationtreatment has been shown to augment endogenous tumor-antigen priming (8) but was not found to significantly alterHLA-ABC expression in this study. One reason for thisdifference may be that enhanced antigenicity of tumor cellsfollowing radiation is thought to be due in part to theindirect effects of lymphocyte-derived IFNs secreted in thetumor microenvironment (31), which was not present inour in vitro experiments.In conclusion, we identified frequent MHC class I mol-

ecule downregulation as a unique feature of PTC tumorsthat is associated with low T-cell infiltration and suggestiveof a highly immunoedited cancer. Furthermore, recovery ofMHC class I expression on PTC cell lines following treat-ment with selumetinib and IFNs improved antitumorimmune responses and may be a promising immunother-apy approach in patients with progressive PTC.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: T.E. Angell, M.G. Lechner, A.L. EpsteinDevelopment of methodology: T.E. Angell, M.G. Lechner, A.L. EpsteinAcquisitionofdata (provided animals, acquired andmanagedpatients,provided facilities, etc.): T.E. Angell, M.G. Lechner, J.K. Jang, J.S. LoPresti,A.L. EpsteinAnalysis and interpretation of data (e.g., statistical analysis, biosta-tistics, computational analysis): T.E. Angell, M.G. Lechner, J.K. Jang,A.L. EpsteinWriting, review, and/or revision of themanuscript: T.E. Angell, J.K. Jang,J.S. LoPresti, A.L. EpsteinAdministrative, technical, or material support (i.e., reporting or orga-nizing data, constructing databases): A.L. EpsteinStudy supervision: T.E. Angell, A.L. Epstein

AcknowledgmentsThe authors thank the USC Translational Pathology Core staff for col-

lection andprocessing of thyroid cancer specimens, andRikki Sevell, ConnorChurch, and Lillian Young for assistance with IHC.

Grant SupportThis work was supported by NIH grants 3T32GM067587-07S1 (to M.G.

Lechner) and P30CA014089, DOD grant W81XWH-11-1-0466 (to A.L.Epstein), and Cancer Therapeutics Laboratories, Inc., of which A.L. Epsteinis a co-founder. This research was also supported in part by the NationalCenter for Research Resources and the National Center for AdvancingTranslational Sciences, NIH, through Grant Award Number TL1TR000132.J.K. Jang is a TL1 Trainee awarded under the TL1 (pre-doctoral) TrainingAward through Southern California Clinical and Translational ScienceInstitute at University of Southern California, Keck School of Medicine (LosAngeles, CA).

The costs of publication of this article were defrayed in part by thepayment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

Received April 10, 2014; revised August 1, 2014; accepted August 18, 2014;published OnlineFirst October 7, 2014.

References1. Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer

J Clin 2013;63:1130.2. Chen AY, Jemal A, Ward EM. Increasing incidence of differentiated

thyroid cancer in the United States, 19882005. Cancer 2009;115:38017.

3. Hay ID, Thompson GB, Grant CS, Bergstralh EJ, Dvorak CE, GormanCA, et al. Papillary thyroid carcinoma managed at the Mayo Clinicduring six decades (19401999): temporal trends in initial therapy andlong-term outcome in 2444 consecutively treated patients. World JSurg 2003;26:87985.

4. American Thyroid Association (ATA) Guidelines Taskforce on Thy-roid Nodules and Differentiated Thyroid Cancer, Cooper DS, Doh-erty GM, Haugen BR, Kloos RT, Lee SL, Mandel SJ, et al. RevisedAmerican Thyroid Association management guidelines for patientswith thyroid nodules and differentiated thyroid cancer. Thyroid2009;19:1167214.

5. Callahan MK, Wolchok JD, Allison JP. Anti-CTLA-4 antibody therapy:immune monitoring during clinical development of a novel immuno-therapy. Semin Oncol 2010;37:47384.

6. Shablak A, Sikand K, Shanks JH, Thistlethwaite F, Spencer-Shaw A,Hawkins RE. High-dose interleukin-2 can produce a high rate ofresponse and durable remissions in appropriately selected patientswith metastatic renal cancer. J Immunother 2011;34:10712.

7. McDermott DF. Improving the therapeutic index of IL-2. Clin AdvHematol Oncol 2010;8:8624.

8. Lechner MG, Russell SM, Bass RS, Epstein AL. Chemokines, costi-mulatorymolecules and fusion proteins for the immunotherapy of solidtumors. Immunotherapy 2011;3:131740.

9. Stewart TJ, Abrams SI. How tumours escape mass destruction.Oncogene 2008;27:5894903.

10. Garrido F, Ruiz-Cabello F, Cabrera T, Perez-Villar JJ, Lopez-Botet M,Duggan-Keen M, et al. Implications for immunosurveillance of alteredHLA class I phenotypes in human tumours. Immunol Today 1997;18:8995.

11. Lechner MG, Karimi SS, Barry-Holson K, Angell TE, Murphy KA,Church CH, et al. Immunogenicity of murine solid tumor models asa defining feature of in vivo behavior and response to immunotherapy.J Immunother 2013;36:47789.

12. Garrido F, Algarra I. MHC antigens and tumor escape from immunesurveillance. Adv Cancer Res 2001;83:11758.

13. Aptsiauri N, Cabrera T, Garcia-Lora A, Lopez-Nevot MA, Ruiz-CabelloF, Garrido F. MHC class I antigens and immune surveillance intransformed cells. Int Rev Cytol 2007;256:13989.

14. Moretti S, Menicali E, Voce P, Morelli S, Cantarelli S, Sponziello M,et al. Indoleamine 2,3-dioxygenase 1 (IDO1) is upregulated inthyroid carcinoma and drives the development of an immunosup-pressant tumor microenvironment. J Clin Endocrinol Metab2014;99:E83240.

15. Smallridge RC, Chindris AM, Asmann YW, Casler JD, Serie DJ, ReddiHV, et al. RNA Sequencing identifies multiple fusion transcripts,differentially expressed genes, and reduced expression of immunefunction genes in BRAF (V600E) mutant vs BRAF wild-type papillarythyroid carcinoma. J Clin Endocrinol Metab 2014;99:E33847.

16. Cunha LL, Marcello MA, Morari EC, Nonogaki S, Conte FF, Gerhard R,et al. Differentiated thyroid carcinomas may elude the immune systemby B7H1 upregulation. Endocr Relat Cancer 2013;20:10310.

17. Angell TE, Lechner MG, Jang JK, Correa AJ, LoPresti J, Epstein AL.BRAFV600E in papillary thyroid carcinoma is associated withincreased programmed death ligand 1 expression and suppressiveimmune cell infiltration. Thyroid 2014;24:138593.






18. Ryder M, Ghossein RA, Ricarte-Filho JC, Knauf JA, Fagin JA.Increased density of tumor-associated macrophages is associatedwith decreased survival in advanced thyroid cancer. Endocr RelatCancer 2008;15:106974.

19. French JD, Weber ZJ, Fretwell DL, Said S, Klopper JP, Haugen BR.Tumor-associated lymphocytes and increased FoxP3 regulatory Tcell frequency correlate with more aggressive papillary thyroid cancer.J Clin Endocrinol Metab 2010;95:232533.

20. Cunha LL, Morari EC, Nonogaki S, Soares FA, Vassallo J, Ward LS.Foxp3 expression is associated with aggressiveness in differentiatedthyroid carcinomas. Clinics 2012;67:4838.

21. Cunha LL, Morari EC, Guihen AC, Razolli D, Gerhard R, Nonogaki S,et al. Infiltration of amixture of different immune cells may be related tomolecular profile of differentiated thyroid cancer. Endocr Relat Cancer2012;19:L316.

22. Gogali F, Paterakis G, Rassidakis GZ, Kaltsas G, Liakou CI, Gousis P,et al. Phenotypical analysis of lymphocytes with suppressive andregulatory properties (Tregs) and NK cells in the papillary carcinomaof thyroid. J Clin Endocrinol Metab 2012;97:147482.

23. Russell SM, Angell TE, LechnerMG, Liebertz DJ, Correa AJ, Sinha UK,et al. Immune cell infiltration patterns and survival in head and necksquamous cell carcinoma. Head Neck Oncol 2013;5:24.

24. Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, et al.Mutations of the BRAF gene in human cancer. Nature 2002;417:94954.

25. Shweppe RE, Klopper JP, Korch C, Pugazhenthi U, Benezra M, KnaufJA, et al. Deoxyribonucleic acid profiling analysis of 40 human thyroidcancer cell lines reveals cross-contamination resulting in cell lineredundancy and misidentification. J Clin Endocrinol Metab 2008;93:433141.

26. Ye L, Santarpia L, Gagel RF. The evolving field of tyrosine kinaseinhibitors in the treatment of endocrine tumors. Endocr Rev 2010;31:57899.

27. Hayes DN, Lucas AS, Tanvetyanon T, Krzyzanowska MK, Chung CH,Murphy BA, et al. Phase II efficacy and pharmacogenomic study ofselumetinib (AZD6244; ARRY-142886) in iodine-131 refractory papil-lary thyroid carcinoma (IRPTC) with or without follicular elements. ClinCancer Res 2012;18:205665.

28. Pohl F, Grosse J, Grimm D, Brockhoff G, Westphal K, Moosbauer J,et al. Changes of apoptosis, p53, and bcl-2 by irradiation in poorlydifferentiated thyroid carcinoma cell lines: a prognostic marker for theprospect of therapeutic success? Thyroid 2010;20:15966.

29. Reits EA, Hodge JW, Herberts CA, Groothuis TA, Chakraborty M,Wansley EK, et al. Radiation modulates the peptide repertoire,enhances MHC class I expression, and induces successful antitumorimmunotherapy. J Exp Med 2006;203:125971.

30. Weber J. Review: anti-CTLA-4 antibody ipilimumab: case studies ofclinical response and immune-related adverse events. Oncologist2007;12:86472.

31. Schreiber RD, Old LJ, Smyth MJ. Cancer immunoediting: integratingimmunity's roles in cancer suppression and promotion. Science2011;331:156570.

32. Gajewski TF, Fuertes M, Spaapen R, Zheng Y, Kline J. Molecularprofiling to identify relevant immune resistance mechanisms in thetumor microenvironment. Curr Opin Immunol 2011;23:28692.

33. Cunha LL, Morari EC, Guihen AC, Razolli D, Gerhard R, Nonogaki S,et al. Infiltration of a mixture of immune cells may be related to goodprognosis in patients with differentiated thyroid carcinoma. Clin Endo-crinol 2012;77:91825.

34. Dvorkin S, Robenshtok E, Hirsch D, Strenov Y, Shimon I, Ben-bassat CA. Differentiated thyroid cancer is associated with lessaggressive disease and better outcome in patients with coexistingHashimoto's thyroiditis. J Clin Endocrinol Metab 2013;98:240914.

35. Garrido F, Cabrera T, Aptsiauri N. "Hard" and "soft" lesions underlyingthe HLA class I alterations in cancer cells: implications for immuno-therapy. Int J Cancer 2010;127:24956.

36. Seliger B, Dunn T, Schwenzer A, Casper J, Huber C, Schmoll HJ.Analysis of the MHC class I antigen presentation machinery in humanembryonal carcinomas: evidence for deficiencies in TAP, LMP andMHCclass I expression and their upregulation by IFN-gamma. Scand JImmunol 1997;46:62532.

37. Zhou F. Molecular mechanisms of IFN-gamma to up-regulate MHCclass I antigen processing and presentation. Int Rev Immunol2009;28:23960.

38. Yang I, Kremen TJ, Giovannone AJ, Paik E, Odesa SK, Prins RM, et al.Modulation ofmajor histocompatibility complex Class I molecules andmajor histocompatibility complex-bound immunogenic peptidesinduced by interferon-alpha and interferon-gamma treatment ofhuman glioblastoma multiforme. J Neurosurg 2004;100:310.

39. GarbeC,KrasagakisK, ZouboulisCC,SchroderK,KrugerS, StadlerR,et al. Antitumor activitiesof interferonalpha, beta, andgammaand theircombinations on human melanoma cells in vitro: changes of prolifer-ation, melanin synthesis, and immunophenotype. J Invest Dermatol1990;95(6 Suppl):231S7S.

40. Tomer Y,Menconi F. Interferon induced thyroiditis. Best Pract ResClinEndocrinol Metab 2009;23:70312.

41. Pichert G, Jost LM, Zobeli L, Odermatt B, Pedia G, Stahel RA.Thyroiditis after treatment with interleukin-2 and interferon alpha-2a.Br J Cancer 1990;62:1004.

42. You X, Teng W, Shan Z. Expression of ICAM-1, B7.1 and TPO onhuman thyrocytes induced by IFN-alpha. Chin Med J 1999;112:616.

43. Todd I, Pujol-Borrell R, Hammond LJ, Bottazzo GF, Feldmann M.Interferon-gamma induces HLA-DR expression by thyroid epithelium.Clin Exp Immunol 1985;61:26573.

44. Foon KA, Sherwin SA, Abrams PG, Stevenson HC, Holmes P, MaluishAE, et al. A phase I trial of recombinant gamma interferon in patientswith cancer. Cancer Immunol Immunother 1985;20:1937.

45. Mani S, Poo WJ. Single institution experience with recombinantgamma-interferon in the treatment of patients with metastatic renalcell carcinoma. Am J Clin Oncol 1996;19:14953.

46. Galon J, Pages F, Marincola FM, Thurin M, Trinchieri G, Fox BA, et al.The immune score as a new possible approach for the classification ofcancer. J Transl Med 2012;10:1.

47. Gajewski TF, Louahed J, Brichard VG. Gene signature in melanomaassociated with clinical activity: a potential clue to unlock cancerimmunotherapy. Cancer J 2010;16:399403.

48. Mizokami MM, Hu P, Khawli LA, Li J, Epstein AL. Chimeric TNT-3antibody/murine interferon-gamma fusion protein for the immuno-therapy of solid malignancies. Hybrid Hybridomics 2003;22:197207.

49. Sharifi J, Khawli LA, Hu P, Li J, Epstein AL. Generation of humaninterferon gamma and tumor necrosis factor alpha chimeric TNT-3fusion proteins. Hybrid Hybridomics 2002;21:42132.

50. Maen Stefan. Targeting MAPK signaling in melanoma cells: Implica-tions for immune recognition and cell fate [dissertation]. Heidelberg(Germany): Heidelberg University, Ruperto Carola; 2010. Availablefrom: http://www.ub.uni-heidelberg.de/archiv/11169.


Angell et al.




2014;20:6034-6044. Published OnlineFirst October 7, 2014.Clin Cancer Res Trevor E. Angell, Melissa G. Lechner, Julie K. Jang, et al.

In VitroSelumetinib Treatment Papillary Thyroid Cancer That Is Reversed by Interferon and MHC Class I Loss Is a Frequent Mechanism of Immune Escape in

Updated version

10.1158/1078-0432.CCR-14-0879doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2014/10/08/1078-0432.CCR-14-0879.DC1

Access the most recent supplemental material at:

Cited articles

http://clincancerres.aacrjournals.org/content/20/23/6034.full#ref-list-1

This article cites 49 articles, 7 of which you can access for free at:

Citing articles

http://clincancerres.aacrjournals.org/content/20/23/6034.full#related-urls

This article has been cited by 5 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/20/23/6034To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-14-0879http://clincancerres.aacrjournals.org/content/suppl/2014/10/08/1078-0432.CCR-14-0879.DC1http://clincancerres.aacrjournals.org/content/20/23/6034.full#ref-list-1http://clincancerres.aacrjournals.org/content/20/23/6034.full#related-urlshttp://clincancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://clincancerres.aacrjournals.org/content/20/23/6034http://clincancerres.aacrjournals.org/

/ColorImageDict > /JPEG2000ColorACSImageDict > /JPEG2000ColorImageDict > /AntiAliasGrayImages false /CropGrayImages false /GrayImageMinResolution 200 /GrayImageMinResolutionPolicy /Warning /DownsampleGrayImages true /GrayImageDownsampleType /Bicubic /GrayImageResolution 300 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict > /GrayImageDict > /JPEG2000GrayACSImageDict > /JPEG2000GrayImageDict > /AntiAliasMonoImages false /CropMonoImages false /MonoImageMinResolution 600 /MonoImageMinResolutionPolicy /Warning /DownsampleMonoImages true /MonoImageDownsampleType /Bicubic /MonoImageResolution 900 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False

/CreateJDFFile false /Description > /Namespace [ (Adobe) (Common) (1.0) ] /OtherNamespaces [ > /FormElements false /GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks false /IncludeInteractive false /IncludeLayers false /IncludeProfiles false /MarksOffset 18 /MarksWeight 0.250000 /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe) (CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA /PageMarksFile /RomanDefault /PreserveEditing true /UntaggedCMYKHandling /LeaveUntagged /UntaggedRGBHandling /LeaveUntagged /UseDocumentBleed false >> > ]>> setdistillerparams> setpagedevice

Documents

MHC Class I Loss Is a Frequent Mechanism of Immune …clincancerres.aacrjournals.org/content/clincanres/20/23/6034.full.pdf · Trevor E. Angell1,2,3, Melissa G. Lechner2,4, Julie