Microbial Community Composition and Dynamics of Moving BedBiofilm Reactor Systems Treating Municipal Sewage

Kristi Biswas and Susan J. Turner

The Centre for Microbial Innovation, School of Biological Sciences, The University of Auckland, Auckland, New Zealand

Moving bed biofilm reactor (MBBR) systems are increasingly used for municipal and industrial wastewater treatment, yet incontrast to activated sludge (AS) systems, little is known about their constituent microbial communities. This study investigatedthe community composition of two municipal MBBR wastewater treatment plants (WWTPs) in Wellington, New Zealand.Monthly samples comprising biofilm and suspended biomass were collected over a 12-month period. Bacterial and archaealcommunity composition was determined using a full-cycle community approach, including analysis of 16S rRNA gene libraries,fluorescence in situ hybridization (FISH) and automated ribosomal intergenic spacer analysis (ARISA). Differences in microbialcommunity structure and abundance were observed between the two WWTPs and between biofilm and suspended biomass. Bio-films from both plants were dominated by Clostridia and sulfate-reducing members of the Deltaproteobacteria (SRBs). FISHanalyses indicated morphological differences in the Deltaproteobacteria detected at the two plants and also revealed distinctiveclustering between SRBs and members of the Methanosarcinales, which were the only Archaea detected and were present in lowabundance (<5%). Biovolume estimates of the SRBs were higher in biofilm samples from one of the WWTPs which receivesboth domestic and industrial waste and is influenced by seawater infiltration. The suspended communities from both plantswere diverse and dominated by aerobic members of the Gammaproteobacteria and Betaproteobacteria. This study represents thefirst detailed analysis of microbial communities in full-scale MBBR systems and indicates that this process selects for distinctivebiofilm and planktonic communities, both of which differ from those found in conventional AS systems.

The moving bed biofilm reactor (MBBR) system was developedin the late 1980s for the treatment of domestic and industrial

wastewaters. These systems are now operating in more than 22countries (including New Zealand) and range from large- tosmall-scale wastewater treatment plants (WWTPs) (35). TheMBBR process combines features of both fixed-growth and acti-vated sludge (AS) systems in that the microbial community islargely retained within the reactor as a biofilm on suspended car-riers, with a smaller planktonic fraction being present in suspen-sion as free-floating cells or small flocs. MBBR technology offers anumber of advantages over conventional technologies for treatingwaste, including a high effluent quality, no bulking problems, andlower cost. Other advantages of fixed biofilm growth include thedecoupling of biomass retention from hydraulic retention timeleading to longer sludge ages and low waste sludge volumes(5, 37).

Studies on the microbial community composition of conven-tional activated sludge systems indicate that the community istypically dominated by aerobic or facultatively anaerobic hetero-trophic bacteria belonging to the Betaproteobacteria (41). It is un-clear whether similar communities are found in MBBR processes,as there have been no microbiological studies on full-scale waste-water systems. Differences in microbial communities might beexpected given that MBBR systems support development of mi-crobial biofilms within which microenvironments support thegrowth of both anaerobic and aerobic organisms within the sameecosystem (19). Molecular techniques such as FISH and denatur-ing gel gradient electrophoresis (DGGE) have demonstrated thepresence of organisms associated with simultaneous nitrificationand denitrification within a lab-scale continuous-flow MBBR sys-tem treating wastewater under aerobic conditions (16). The pres-ence of a reduced oxygen gradient within biofilms has the poten-tial to also support the growth of anaerobic ammonium-oxidizing

bacteria (anammox) (47). Anammox is a process that is of signif-icant recent interest in the field of wastewater treatment because ofthe energy efficiencies that can be achieved in the conversion ofammonium and nitrite to nitrogen gas under anaerobic condi-tions (46).

Biofilm development is a key process in the establishment of aneffective MBBR process. To maintain effective gas and nutrienttransfer, the ideal biofilm is relatively thin and evenly distributedover the carrier surface (31). This can be influenced by turbulencein the reactors, which also influences substrate and oxygen trans-fer. Aside from these few key factors, the effects of other opera-tional parameters and influent composition on microbial com-munity structure and function within MBBR systems are poorlyunderstood.

The aim of this study was to investigate the microbial commu-nities in Wellington’s Moa Point (MP) and Karori WWTPs andthus to provide the first comprehensive insight into the key mi-crobial groups in full-scale MBBR systems. Approximate monthlysamples, consisting of suspended biomass and biofilm scrapedfrom carriers, were collected over a 12-month period from the twoplants. A full-cycle community analysis approach, including anal-ysis of 16S rRNA gene libraries, fluorescence in situ hybridization(FISH) and automated ribosomal intergenic spacer analysis(ARISA), was used to determine bacterial and archaeal commu-

Received 16 August 2011 Accepted 18 November 2011

Published ahead of print 2 December 2011

Address correspondence to Susan J. Turner, s.turner@auckland.ac.nz.

Supplemental material for this article may be found at http://aem.asm.org/.

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.06570-11

0099-2240/12/$12.00 Applied and Environmental Microbiology p. 855–864 aem.asm.org 855

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 23

Feb

ruar

y 20

22 b

y 17

0.23

9.41

.245

.

nity composition and dynamics. Total dissolved sulfides and dry/wet weight of biofilm adhering to carriers were also determined.Microbial community analysis was also performed on a samplefrom a conventional floc-based activated sludge system for com-parison.

MATERIALS AND METHODSSample sites. Sampling was carried out at Wellington’s MP and KaroriWWTPs. The MBBR reactors at both plants contained suspended polyethyl-ene carriers (K1 media; AnoxKaldnes) comprising 30 to 50% of reactor vol-ume. Reactor samples, comprising suspended K1 carriers with adherent bio-film, were collected once a month over a year from three MBBR reactors atMP (designated M1, M2, and M3) and two reactors from Karori (designatedK1 and K2) treatment plants. For comparison, mixed liquor from a conven-tional activated sludge system was collected from a large municipal WWTP innorthern New Zealand. Samples were collected in one-liter bottles and trans-ported refrigerated overnight to the laboratory.

Physical and chemical analyses. Dry and wet weight determinationswere made on biofilm from five K1 carriers from each sample. To deter-mine the wet weight, carriers with adherent biofilm were blotted dry ontissue paper for 2 min and then weighed. The samples were then trans-ferred to a desiccator and dried for 1 week and then reweighed. Controlsamples comprising five unused carriers were also subjected to desiccationand then weighed. Dry and wet weight determinations were made follow-ing subtraction of the average weight of the control carriers. The statisticalsignificance of differences between samples was determined using a t test(unequal variance). To measure the suspended biomass, 1 ml of samplewas pelleted by centrifugation at 13,000 � g for 10 min in a 1.5-ml micro-centrifuge tube. The supernatant was carefully removed, the wet weightdetermined, and the opened tube subjected to desiccation and thenweighed as described above.

Total dissolved sulfide was measured immediately upon receipt ofsamples by a colorimetric method as outlined previously (13). A standardcurve was prepared using various concentrations of sodium sulfide. Theabsorbance of copper sulfide precipitate for each sample was measured at460 nm in a UV-Vis spectrophotometer.

DNA extraction. Total genomic DNA was extracted from biomassusing a phosphate, SDS, chloroform-bead beater method as describedpreviously (44). Extracted DNA was dissolved in 50 �l of DNase-freewater and stored at �20°C until further analysis.

ARISA. ARISA was used as a rapid method to profile bacterial commu-nity structure and to make comparisons between monthly samples. The in-tergenic spacer region between the 16S and 23S rRNA genes was amplifiedusing two universal bacterial primers, SDBact and LDBact (33), in a PCRdescribed previously (21). The fluorescently labeled products were purifiedusing a QIAquick PCR purification Kit (Qiagen) and analyzed along with aninternal LIZ1200 standard on a 3130XL capillary genetic analyzer using a50-cm capillary (Applied Biosystems Ltd., New Zealand).

Results from ARISA were analyzed using GeneMapper software (ver-sion 3.7) to create bacterial community profiles for each sample. Multidi-mensional scaling (MDS) plots were constructed from community profiledata using Primer 6 software (version 6.1.6). Manhattan distance waschosen as the measure between samples on the MDS plots.

16S rRNA gene analysis. (i) Clone library analysis. Cloning and re-striction fragment length polymorphism (RFLP) analysis of PCR-amplified16S rRNA genes was performed as generally described previously (7). For-

ward and reverse primers for PCR amplification of bacterial 16S rRNA geneswere 5=-AGRGTTTGATCMTGGCTCAG-3= and 5=-GKTACCTTGTTACGACTT-3=, respectively (39). Primers used for analysis of archaeal16S rRNA gene sequences were 5=-TTCCGGTTGATCCYGCCGA-3=(Arch21F) and 5=-YCCGGCGTTGAMTCCAATT-3= (Arch958R) (15).Cloned inserts were recovered by PCR amplification using the vector-specific primers PGEM-F (5=-GGCGGTCGCGGGAATTGATT-3=) andPGEM-R (5=-GCCGCGAATTCAACTAGTTGATT-3=) (1).

(ii) RFLP of clones. Restriction endonuclease HaeIII (Invitrogen) di-gestion was used to generate RFLP profiles for archaeal clones to investi-gate diversity prior to selection of clones for sequencing as previouslydescribed (7). The resulting products were resolved and visualized bypolyacrylamide gel electrophoresis (PAGE) through 6% nondenaturinggels as described previously (38). Gels were run at 120 V for 70 min andthen stained with ethidium bromide. Unique RFLP profiles were desig-nated operational taxonomic units (OTUs), and representative cloneswere selected for sequencing.

(iii) Sequencing and data analysis. PCR-amplified inserts from rep-resentative clones were purified and sequenced using the aforementionedvector-specific primers. Purification and sequencing were performed un-der contract by Macrogen Inc. (Kumchun-Ku, Seoul, South Korea) usinga 3730XL DNA analyzer (Applied Biosystems). A total of 96 clones weresequenced from each bacterial clone library, whereas one clone represent-ing each OTU was sequenced from the Archaea libraries.

Sequence data were processed using the high-throughput pipelineavailable through the Ribosomal Database Project II (http://rdp.cme.msu.edu) (49) and also compared with the GenBank database sequences (http://www.ncbi.nlm.nih.gov) using nucleotide-nucleotide BLAST (2).

(iv) Phylogenetic analysis. Sequences were screened for chimeras us-ing Mallard software (version 1.02; School of Biosciences, Cardiff Univer-sity [http://www.bioinformatics-toolkit.org/Mallard/index.html]) (6),and unreliable sequences were eliminated from further analysis. The re-maining partial and full-length 16S rRNA sequences were aligned usingthe SINA Web alignment tool, SILVA (www.arb-silva.de/aligner) (32).These sequences were imported into the ARB software (25) along with theSSU Ref database (SILVA version 106) to construct phylogenetic trees.The SSU Ref database contains more than half a million curated full-length (�1,200 bp) 16S rRNA sequences that have been previously pub-lished or uploaded to public databases (such as GenBank). Phylogenetictrees were constructed using maximum likelihood methods.

(v) FISH. FISH was used in combination with confocal laser scanningmicroscopy to examine samples for the presence of methanogens andDeltaproteobacteria (4, 27). Samples were fixed within 12 h of samplecollection using 4% paraformaldehyde as described previously (27) andstored at �20°C in a 1:1 phosphate-buffered saline (PBS) and ethanolmixture awaiting further analysis. Slides were prepared from fixed sam-ples by placing 20 �l of a sample into 6-mm diameter wells on Teflon-coated slides (ProSciTech), which were then air dried. Samples were de-hydrated by immersion in 50%, 80%, and 98% ethanol, respectively, for 3min each. Hybridization was carried out in a 50-m Falcon tube chamber at46°C for 2 h. Oligonucleotide probes were derived from published se-quences with a 5=-end fluorescent label (specified in Table 1) and synthe-sized by Thermo Fisher Scientific (Germany). Each well was hybridizedwith buffer (0.9 M NaCl, 0.01% SDS, 20 mM Tris-HCl, formamide atoptimal concentrations for each probe) and 1 �l of 50 ng/�l probe. Fol-lowing incubation, slides were immersed in preheated (48°C) wash buffer

TABLE 1 FISH probe sequences

Probe name Target group Probe sequence 5= ¡ 3= Label Reference

EUB338 Eubacteria GCTGCCTCCCGTAGGAGT CY3 3MSMX860 Methanosarcinales GGCTCGCTTCACGGCTTCCCT CY3 34DELTA495a Most Deltaproteobacteria and Gemmatimonadetes AGTTAGCCGGTGCTTCCT CY5 24cDELTA495a Competitor for DELTA495a AGTTAGCCGGTGCTTCTT 26

Biswas and Turner

856 aem.asm.org Applied and Environmental Microbiology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 23

Feb

ruar

y 20

22 b

y 17

0.23

9.41

.245

.

(20 mM Tris-HCl, 5 mM EDTA, NaCl at optimal concentrations for eachprobe) and air dried in the dark. Salts were removed from the slides bywashing in ice-cold distilled water. DAPI (4=,6-diamidino-2-phenylindole) (10 �g/�l) was then applied as a universal DNA stain.Slides were incubated in the dark for 5 min and then rinsed with distilledwater and air dried.

(vi) Confocal microscopy. FISH slides were viewed using an FV1000Olympus confocal laser scanning microscope (CLSM) equipped with a100� oil immersion objective lens. Excitation of fluorescein isothiocya-nate (FITC), Cy3, and Cy5 was performed at 488 nm (Ar laser), 543 nm(He-Ne laser), and 635 nm (red diode laser), respectively. Images wereviewed by using an FV10-ASW2.0 (Olympus) viewer.

For quantification, at least five z-series of 1-�m depth (6 to 10 sec-tions) were made for each sludge sample with a universal stain (DAPI) anda group-specific probe (MSMX860 or Delta495a). The biovolume per-centage was calculated by using DAIME software (version 1.2; http://www.microbial-ecology.net/daime) (14).

RESULTS

Sampling was carried out at Wellington’s MP and Karori WWTPs.Both plants are configured to include biological treatment in theform of aerated moving bed bioreactors. Solids are removed bycontact stabilization and clarification. MP receives household andindustrial waste, including that from an abattoir, and has an aver-age dry weather flow of 822 liters/s with a BOD of 0.23 kg/m3. TheKarori WWTP receives only domestic waste with an average dryweather inflow of 20 liters/s with a BOD of 0.37 kg/m3. Dissolvedoxygen levels were regulated at similar levels between the twoMBBR facilities of interest, with an annual average of 1.56 mg/literfor MP and 1.45 mg/liter for Karori. Elevated conductivity levels(yearly average, 4.072 mS/cm), indicative of seawater infiltration,are consistently detected at the MP plant while levels in influentsreaching the Karori plant are low and typical of domestic effluents.A total of 11 approximately monthly samples were collected fromeach of the two treatment plants over a period of 12 months.Samples were taken from the aeration tank of the MBBRs andcomprised K1 carriers with adherent biofilm and reactor fluid.

General characteristics of biofilm and suspended biomass.The color and odor of biofilms attached to K1 media differedbetween sites. At MP the biofilms were black in color and had asulfurous odor. In contrast, biofilm samples from the KaroriWWTP were consistently greyish-brown and had no obviousodor. A comparison of biofilm quantity was made by determiningthe wet and dry weights of biofilms from each MBBR for all timepoints. No significant differences (P � 0.124) were observed be-tween the dry weight of the biofilm samples from MP (0.029 � SD0.033 g, n � 8) and Karori (0.013 � SD 0.006 g, n � 8). Similarly,no significant differences were observed between the wet weightsof biofilm from the two sites (P � 0.379). P values of � 0.05 wereconsidered significant.

To provide an estimate of the amount of suspended biomass,dry and wet weight determinations were also made on pellets pre-pared from 1 ml of supernatant fluids. Supernatant dry weightvalues were low (�0.021 g/ml) for all samples. No significant dif-ferences (P � 0.427) were found between samples from the twoMBBR systems.

Total dissolved sulfides were detected in all samples from theMP site with values ranging between 1.5 to 13 mM. In contrast,sulfide was not detected (�1 mM) in samples collected from theKarori plant. Significant differences (P � 0.00012) were observedin sulfide values between the two MBBR sampling sites.

Bacterial community analysis. (i) ARISA. ARISA was used asa rapid method to profile and compare the bacterial communitystructures in both biofilms and suspended biomass. MDS wasused to investigate differences between ARISA community pro-files over time and between treatment plants. These data indicateddifferences between the two WWTPs and also between biofilmand suspended communities (Fig. 1).

(ii) 16S rRNA gene analysis. To determine the bacterial com-munity composition, clone libraries of PCR-amplified 16S rRNAgenes were prepared and sequenced from biofilm scraped fromcarriers and from suspended biomass. This analysis was per-formed on reactor samples collected at three time points (March2010, August 2010, and January 2011). Figure 2 presents a sum-mary of phyla detected in a representative sample from each plant.Phylogenetic trees constructed using the entire sequence data setare presented for all phyla (Fig. 3), the Deltaproteobacteria (Fig. 4)and the Epsilonproteobacteria (Fig. 5). A phylogenetic tree of se-quences aligning to the Firmicutes is presented in Fig. S1 in thesupplemental material.

Each treatment plant yielded a characteristic community com-position that was consistent between reactors and time points(Fig. 2A). Biofilm communities from both plants showed limitedbacterial diversity (Shannon-Wiener index of 0.93 to 1.18) andwere dominated by Firmicutes (40 to 44% of clones). Phylogeneticalignment of sequences indicated a broad diversity within the Fir-micutes (see Fig. S1 in the supplemental material), although themajority of clones represented members of the Clostridia (38% ofclones). Strictly anaerobic, sulfate-reducing members of the Del-taproteobacteria (SRBs) were the second most abundant group,comprising 29.4% of the biofilm clone library at MP and 24.7% atKarori. Members of Desulfobacterales (11 to 19%), Syntrophobac-terales (8 to 10%), and Desulfovibrionales (0.5 to 1.5%) were themost abundant SRBs found within these samples (Fig. 4). Thebiofilms from Karori WWTP differed due to an elevated incidenceof Betaproteobacteria and Gammaproteobacteria (17.6% ofclones), which were both in lower abundance (�7.4%) in thebiofilm community from MP. A number of other organisms, in-cluding representatives of the phyla Bacteroidetes, Synergistes,Planctomycetes, Verrucomicrobia, and Acidobacteria, as well as var-ious unclassified bacteria, were also detected at low abundance(�5% of clones) in the biofilm samples from both plants. Analysisof the archaeal community from the two MBBR systems indicateda very limited diversity, with only one RFLP pattern detectedamong the 20 clones screened. Sequence analysis indicated thatthis pattern represented organisms from the methanogen orderMethanosarcinales.

In contrast to the biofilm samples, the suspended biomassfrom both MBBR systems (Fig. 2B) was dominated by a morediverse group of aerobic organisms from the Alphaproteobacteria(Rhizobiales and Rhodobacterales), Gammaproteobacteria (Pseu-domonadales and Aeromonadales), and Betaproteobacteria (Burk-holderiales and Rhodocyclales). Members of the Clostridia, repre-senting the majority of the Firmicutes, were also present at MP(14% of clones) and Karori (40% of clones) treatment plants. Inaddition, MP samples had an elevated level of Epsilonproteobacte-ria (54% of clones) which were affiliated with the Campylobacte-raceae and aligned most closely to Arcobacter spp. (Fig. 5). Thougha diversity of sequences were observed, the majority aligned mostclosely to clones obtained from estuarine and river environmentsor to Arcobacter nitrofigilis.

Microbial Communities of Moving Bed Biofilm Reactors

February 2012 Volume 78 Number 3 aem.asm.org 857

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 23

Feb

ruar

y 20

22 b

y 17

0.23

9.41

.245

.

The clone library prepared for comparative purposes from amixed liquor sample from a conventional AS plant (Fig. 2A) wasmore diverse and dominated by members of the Betaproteobacte-ria (28%) and Bacteroidetes (25%).

(iii) FISH analysis. FISH was used as a PCR-independent ap-proach to validate the 16S rRNA gene library results and to inves-tigate the spatial distribution and abundance of Archaea using aMethanosarcinales probe and putative sulfate-reducing bacteria

using a Deltaproteobacteria probe. FISH analysis was performedon samples collected between March 2010 and June 2010, Septem-ber 2010, December 2010, and January 2011.

The distinctive black biofilm from MP revealed colloidal clus-ters of Deltaproteobacteria buried within the biofilm structures(Fig. 6A). Based on the clone library results, these are likely to besulfate-reducing bacteria. Samples from Karori also showed thepresence of Deltaproteobacteria, but these were fewer in abun-dance and were filamentous (Fig. 6B). Biovolume analysis con-firmed the occurrence of Deltaproteobacteria at both treatmentplants, with higher volumes recorded in samples from MP WWTP(Fig. 6). However, there was no significant (P � 0.282) differenceobserved between the biovolumes of Deltaproteobacteria betweenthe two study sites.

Methanosarcinales were observed in low numbers (�5% bio-volume) in biofilms from the two MBBR systems. However, insamples from the MP plant, these were observed in distinctiveclusters around cells hybridizing with the Deltaproteobacteriaprobe, which represent putative SRBs (Fig. 6A).

DISCUSSION

Since their invention, MBBR systems have been used to treat bothmunicipal and a wide range of industrial wastes, including pulpand paper (43), cheese factory waste (36), and phenolic wastewa-ter (11). Previous studies (35, 51) have reported on the physicaland engineering aspects of MBBR systems, while the compositionof the microbial communities responsible for the biological activ-ity has received no attention in full-scale systems treating munic-ipal wastewater. This study set out to investigate the prokaryoticcommunity dynamics in a parallel study of two MBBR treatmentplants over a 12-month period. The MBBR treatment systemsincluded in this study are situated in the same city and are oper-

FIG 1 MDS plot of ARISA data representing bacterial communities in samples collected over 12 months from MP and Karori WWTPs. Each symbol within thegraph represents a bacterial community for one given time point. Minimum stress, 0.1. Bacterial communities from Moa Point (black) and Karori (gray) sampleshave formed two distinct clusters. Evidence of biofilm communities (enclosed within the black circles) segregating away from the suspended biomass is alsodisplayed.

FIG 2 Composition of 16S clone libraries in biofilm (A) and suspended bio-mass (B) from Moa point and Karori reactors. Samples were collected inMarch 2010. For comparison, a clone library prepared from conventional ASmixed liquor (C) is also shown. Each color on the graph represents the dom-inant phyla or class found within the community.

Biswas and Turner

858 aem.asm.org Applied and Environmental Microbiology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 23

Feb

ruar

y 20

22 b

y 17

0.23

9.41

.245

.

ated under similar parameters to treat urban municipal wastewa-ter. The major operational difference between the two plants isthat the Karori plant receives effluent from a largely residentialcatchment, while the MP plant services a much larger catchmentthat includes mixed urban and industrial uses.

Biofilm communities. Differences in bacterial communityprofiles between the two WWTPs were expected due to the differ-ent sources of waste entering these systems. The results of thisstudy indicated no difference in the amount of biomass retainedon carriers, but distinct differences were noted in both colorationand dissolved sulfide concentrations. The observation that MPbiofilms were black in color and sulfurous in odor is consistentwith the detection of appreciable levels of dissolved sulfides at thissite. The detection of sulfides at MP indicates the possible activityof anaerobic SRBs, which are commonly found in anoxic systems(8, 29). Sulfate is reduced to sulfide by SRBs, resulting in a pungentsulfurous odor and upon reaction with metals yields black precip-itates.

Despite differences in the color of biofilms from the twosites, both yielded bacterial 16S rRNA gene libraries that weredominated by anaerobes, notably Clostridia and members ofthe Desulfobacterales and Syntrophobacterales, which areknown sulfate-reducing bacteria (29). Both plants also showedsimilar communities of Archaea, which were dominated byMethanosarcinales. Validation of these results was performed byFISH using probes targeted to the Methanosarcinales and the Del-

taproteobacteria. Although the Deltaproteobacteria probe is notspecific for sulfate-reducing bacteria, these were the only mem-bers of the class detected in the clone libraries. It was thereforepresumed that cells hybridizing to the Deltaproteobacteria probewere SRBs. Biovolume analysis confirmed the presence of SRBs inboth sample sets but indicated a higher abundance in the MP siteand different cell morphology than that seen in the Karori sam-ples. These differences may go some way toward explaining thehigher levels of sulfides detected at the MP site. It is also possiblethat differences in influent composition influence the communitystructure and function in these biofilms. In addition to domesticwastewater, the MP plant receives industrial waste from an abat-toir, expected to carry large amounts of fats, oils, and greases (28).The presence of long-chain fatty acids (LCFA) derived from thedegradation of lipids (45) and low water temperatures have beenshown to select for SRBs in a wastewater treatment system (9, 22).Enhanced SRB activity would also require access to excess sulfateas an electron acceptor. The source of this in the MP plant has notyet been clearly established, although seawater infiltration is sus-pected in this system, as indicated by elevated conductivity levels.Seawater is known to contain appreciable concentrations of sul-fate, and high concentrations have been found in an MBBR systemtreating waste from a marine aquarium (20).

FISH and biovolume analysis confirmed the presence of mem-bers of the Methanosarcinales in approximately equal abundanceat both sites. This analysis also revealed a clear association of these

FIG 3 Maximum likelihood tree showing alignment of sequences from clone libraries prepared from biofilm and suspended communities. Numbers withinbrackets indicate percentages of clones from the MP biofilm, Karori biofilm, MP suspended, and Karori suspended samples, respectively. These numbers differfrom those presented in Fig. 2, as they indicate percentages over three time points (March 2010, August 2010, and January 2011). The scale bar indicates 10%sequence divergence.

Microbial Communities of Moving Bed Biofilm Reactors

February 2012 Volume 78 Number 3 aem.asm.org 859

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 23

Feb

ruar

y 20

22 b

y 17

0.23

9.41

.245

.

860 aem.asm.org Applied and Environmental Microbiology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 23

Feb

ruar

y 20

22 b

y 17

0.23

9.41

.245

.

methanogens with Deltaproteobacteria in the MP samples. Themajority of SRBs described in the past are putatively free-living(29), but recent studies of the marine environment using FISHhave revealed consortia of SRBs and methanogens (10, 18), sug-gesting a symbiotic bacterial-archaeal interaction. The physiolog-ical basis of this symbiosis is still a matter of conjecture. Althoughmethanogens were detected at the Karori site, these were not ob-served in association with the filamentous SRBs, further support-ing the notion that this community differs from that found in theMP samples. Filamentous SRBs belonging to the genus Desul-

fonema have been detected previously in marine and freshwatersediments (17, 50). Members of this genus exhibit gliding motility,which is presumed to confer the ability to move along gradientswithin dense mats and avoid predation by grazing protozoa. Thesefeatures would be equally advantageous in both MBBR biofilms,though filamentous SRBs were detected only in the Karori sam-ples. This further supports the notion that the biofilm communi-ties in these two systems are influenced by external factors, whichmay include differences in influent composition. Indeed, otherstudies have confirmed that specialized groups of microorganisms

FIG 4 Maximum likelihood tree showing alignment of sequences from clone libraries to the sulfate-reducing members of the Deltaproteobacteria. Clonesequences are presented in bold and identified by sample type, date, and clone reference, respectively. Sample type identifiers: M1, Moa Point biofilm; MS1, MoaPoint suspended biomass; K1, Karori biofilm; KS1, Karori suspended biomass. Numbers in parentheses after the sequence identifier indicate number of cloneswithin the cluster. Shaded boxes indicate diversity within a group of clones. Dotted lines indicate partial sequences (450 to 750 bp). Open and filled circles indicateclades supported by bootstrap values of �75% and � 90%, respectively. Horizontal bars indicate groups within the Syntrophobacterales (Syn.), Desulfobacterales(Dsb.), and Desulfovibrionales (Dsv.). Outgroup consists of sequences from other bacterial phyla.

FIG 5 Maximum likelihood tree showing alignment of sequences from clone libraries to the Epsilonproteobacteria. Vertical bars with brackets in bold indicategroups within the genus Arcobacter. Details are the same as those provided in Fig. 3 and 4.

Microbial Communities of Moving Bed Biofilm Reactors

February 2012 Volume 78 Number 3 aem.asm.org 861

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 23

Feb

ruar

y 20

22 b

y 17

0.23

9.41

.245

.

develop over time in response to changes in complex organic mat-ter entering the system (40).

Suspended biomass. Clone library analysis indicated that thesuspended fraction was dominated by aerobic members of theAlphaproteobacteria, Betaproteobacteria, Gammaproteobacteria,and Epsilonproteobacteria. Members of the Clostridia were alsopresent but in much lower abundance than in biofilm samples,possibly resulting from biofilm detachment processes which areknown to occur periodically in such systems (23). A notable dif-ference between the two plants was the high abundance of se-quences in the MP clone library that aligned to Arcobacter spp.,including Arcobacter nitrofigilis. The genus Arcobacter was pro-posed in 1991 (48) to describe a group of aerotolerant members ofthe Campylobacteraceae and has been of increasing interest as anemerging zoonotic pathogen. The genus includes species isolatedfrom a diverse range of aquatic and terrestrial environments aswell as the feces and reproductive tracts of domestic livestock,

sewage, and abattoir effluents. The genus type species, Arcobacternitrofigilis, is a nitrogen-fixing organism that was isolated from theroot zone of a salt-marsh plant although not all species are salttolerant (12). The reason for the abundance of Arcobacter spp. inthe MP suspension samples remains unclear although the MPplant receives effluent from a local abattoir, and it is possible thatthey derive from this source.

Consistent differences between the planktonic and biofilmcommunities are indicated by the MDS analysis of the ARISAresults. These differences may be explained by the different con-ditions that prevail within these structured environments. Therelatively short hydraulic retention time within the MBBR systemselects for organisms that have a high growth rate in order towithstand washout and to be retained in the reactor. The bulkliquid phase is also aerated, supporting aerobic metabolism.While members of the Clostridia were detected in the suspendedphase, the majority of taxa identified in the clone library analysis

FIG 6 Biofilm samples scraped from carriers (as seen in column 1) were hybridized with fluorescently labeled probes targeting methanogenic Archaea(MSMX860; red), Deltaproteobacteria (DELTA495a; cyan), and eubacteria (EUB338; green). DAPI (blue) was used as a universal DNA stain. (A) Clusters ofDeltaproteobacteria (arrowed “s”) were abundant in black biofilm from MP. (B) Clusters of Deltaproteobacteria from Karori were present as filaments. Metha-nogenic Archaea (arrowed “m”) are visible in both samples. Biovolume estimates of methanogens and Deltaproteobacteria relative to DAPI-stained material areshown in graphs for both samples.

Biswas and Turner

862 aem.asm.org Applied and Environmental Microbiology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 23

Feb

ruar

y 20

22 b

y 17

0.23

9.41

.245

.

were from putatively fast-growing aerobic species, includingmembers of the Burkholderiales, Rhodocyclales, Aeromonadales,Pseudomonadales, and Rhodobacterales.

Comparison with activated sludge. Microbial communities inactivated sludge systems have been widely discussed in the litera-ture as the majority of modern wastewater treatment facilities uti-lize this technology (42). Activated sludge typically comprisesfree-swimming planktonic cells and aggregated flocs that can bemaintained under both aerobic and anoxic conditions. Bacterialcommunities in AS plants treating industrial and municipalwastewater are typically dominated by Betaproteobacteria, fol-lowed by Alphaproteobacteria and Gammaproteobacteria. Othergroups of bacteria found in low abundance are Bacteroidetes andFirmicutes (30, 41). The clone library prepared from a conven-tional AS mixed liquor sample in this study yielded results consis-tent with studies reported in the literature and suggests that boththe attached biofilm and suspended communities in MBBR sys-tems differ substantially from that found in conventional AS.

In summary, this study provides the first detailed investigationof key microbial groups in full-scale MBBR systems treating mu-nicipal wastewater. The results indicate that MBBR communitiesdiffer substantially from those in conventional AS systems by se-lecting for two distinct bacterial communities: a biofilm commu-nity that is dominated by anaerobes and a suspended communitythat includes fast-growing aerobic bacteria. The observation, fromFISH analyses, of a close association between Methanosarcinalesand putative SRBs in the MP biofilms implies a functional rela-tionship between these two groups of microorganisms. Furtherstudies that include consideration of both the prokaryotic andeukaryotic communities are required to elucidate the nature ofthese microbial relationships and to develop food web models thatwill underpin manipulation of the system for optimal perfor-mance.

ACKNOWLEDGMENTS

We acknowledge the assistance of United Water Limited staff from MoaPoint and Karori WWTPs for provision of samples and support for thisstudy.

REFERENCES1. Aislabie J, et al. 2009. Bacterial diversity associated with ornithogenic soil

of the Ross Sea region, Antarctica. Can. J. Microbiol. 55:21–36.2. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local

alignment search tool. J. Mol. Biol. 215:403– 410.3. Amann R, Krumholz L, Stahl DA. 1990. Fluorescent-oligonucleotide

probing of whole cells for determinative, phylogenetic, and environmen-tal studies in microbiology. J. Bacteriol. 172:762–770.

4. Amann R, Ludwig W, Scheleifer K. 1995. Phylogenetic identification andin situ detection of individual microbial cells without cultivation. Micro-biol. Rev. 59:143–169.

5. Anderottola G, Foladori P, Ragazzi M, Tatáno F. 2000. Experimentalcomparison between MBBR and activated sludge system for the treatmentof municipal wastewater. Water Sci. Technol. 41:375–382.

6. Ashelford KE, Chuzhanova NA, Fry JC, Jones AJ, Weightman AJ. 2006.New Screening software shows that most recent large 16S rRNA geneclone libraries contain chimeras. Appl. Environ. Microbiol. 72:5734 –5741.

7. Ayton J, Aislabie J, Barker G, Saul D, Turner S. 2010. Crenarchaeotaaffiliated with group 1.1b are prevalent in coastal mineral soils of the RossSea region of Antarctica. Environ. Microbiol. 12:689 –703.

8. Barton LL, Fauque GD. 2009. Biochemistry, physiology and biotechnol-ogy of sulfate-reducing bacteria. Adv. Appl. Microbiol. 68:41–98.

9. Ben-Dov E, Kushmaro A, Brenner A. 2009. Long-term surveillance ofsulfate-reducing bacteria in highly saline industrial wastewater evapora-tion ponds. Saline Systems 5:2.

10. Boetius A, et al. 2000. A marine microbial consortium apparently medi-ating anaerobic oxidation of methane. Nature 407:623– 626.

11. Borghei SM, Hosseini SH. 2004. The treatment of phenolic wastewaterusing a moving bed biofilm reactor. Process Biochem. 39:1177–1181.

12. Collado L, Figueras MJ. 2011. Taxonomy, epidemiology, and clinicalrelevance of the genus Arcobacter. Clin. Microbiol. Rev. 24:174 –192.

13. Cord-Ruwisch R. 1985. A quick method for the determination of dis-solved and precipitated sulfides in cultures of sulfate-reducing bacteria. J.Microbiol. Methods 4:33–36.

14. Daims H, Lücker S, Wagner M. 2006. daime, a novel image analysisprogram for microbial ecology and biofilm research. Environ. Microbiol.8:200 –213.

15. DeLong EF. 1992. Archaea in coastal marine environments. Proc. Natl.Acad. Sci. U. S. A. 89:5685–5689.

16. Fu B, Lia X, Ding L, Ren H. 2010. Characterization of microbial com-munity in an aerobic moving bed biofilm reactor applied for simultaneousnitrification and denitrification. World J. Microbiol. Biotechnol. 26:1981–1990.

17. Fukui M, Teske A, Abmus B, Muyzer G, Widdel F. 1999. Physiology,phylogenetic relationships, and ecology of filamentous sulfate-reducingbacteria (genus Desulfonema). Arch. Microbiol. 172:193–203.

18. Knittel K, et al. 2003. Activity, distribution, and diversity of sulfate re-ducers and other bacteria in sediments above gas hydrate (Cascadia Mar-gin, Oregon). Geomicrobiol. J. 20:269 –294.

19. Kolenbrander PE. 2000. Oral microbial communities: biofilms, interac-tions, and genetic systems. Annu. Rev. Microbiol. 54:413– 437.

20. Labelle MA, et al. 2005. Seawater denitrification in a closed mesocosm bya submerged moving bed biofilm reactor. Water Res. 39:3409 –3417.

21. Lear G, Lewis GD. 2009. Impact of catchment land use on bacterialcommunities within stream biofilms. Ecol. Indic. 9:848 – 855.

22. Leloup J, et al. 2005. Dynamics of sulfate-reducing microorganisms(dsrAB genes) in two contrasting mudflats of the Seine estuary (France).Microb. Ecol. 50:307–314.

23. Lewandowski Z, Beyenal H, Myers J, Stookey D. 2007. The effect ofdetachment on biofilm structure and activity: the oscillating pattern ofbiofilm accumulation. Water Sci. Technol. 55:429 – 436.

24. Loy A, et al. 2002. Oligonucleotide microarray of 16S rRNA gene-baseddetection of all recognized lineages of sulfate-reducing prokaryotes in theenvironment. Appl. Environ. Microbiol. 68:5064 –5081.

25. Ludwig W, et al. 2004. ARB: a software environment for sequence data.Nucl. Acids Res. 32:1363–1371.

26. Macalady JL, et al. 2006. Dominant microbial populations in limestonecorroding stream biofilms, Frasassi cave system, Italy. Appl. Environ. Mi-crobiol. 72:5596 –5609.

27. Manz W, Amann R, Ludwig W, Wagner M, Schleifer KH. 1992. Phy-logenetic oligodeoxynucleotide probes for the major subclasses ofproteobacteria: problems and solutions. Syst. Appl. Microbiol. 15:593– 600.

28. Mittal GS. 2006. Treatment of wastewater from abattoirs before landapplication—a review. Bioresour. Technol. 97:1119 –1135.

29. Muyzer G, Stams AJM. 2008. The ecology and biotechnology of sulfate-reducing bacteria. Nat. Rev. Microbiol. 6:441– 454.

30. Nielsen PH, Thomsen TR, Nielsen JL. 2004. Bacterial composition ofactivated sludge—importance for floc and sludge properties. Water Sci.Technol. 49:51–58.

31. Ødegaard H, Rusten B, Suljudalen J. 1999. The development of themoving bed biofilm process—from idea to commercial product. Eur. Wa-ter Manage. 2:36 – 43.

32. Pruesse E, et al. 2007. SILVA: a comprehensive online resource for qualitychecked and aligned ribosomal RNA sequence data compatible with ARB.Nucl. Acids Res. 35:7188 –7196.

33. Ranjard L, et al. 2001. Characterization of bacterial and fungal soil com-munities by automated ribosomal intergenic spacer analysis fingerprints:biological and methodological variability. Appl. Environ. Microbiol. 67:4479 – 4487.

34. Raskin L, Poulsen LK, Noguera DR, Rittmann BE, Stahl DA. 1994.Quantification of methanogenic groups in anaerobic biological reactorsby oligonucleotide probe hybridization. Appl. Environ. Microbiol. 60:1241–1248.

35. Rusten B, Eikebrokk B, Ulgenes Y, Lyngren E. 2006. Design and oper-ations of the Kaldnes moving bed biofilm reactors. Aquaculture Eng. 34:322–331.

36. Rusten B, Siljudalen JG, Strand H. 1996. Upgrading of a biological-

Microbial Communities of Moving Bed Biofilm Reactors

February 2012 Volume 78 Number 3 aem.asm.org 863

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 23

Feb

ruar

y 20

22 b

y 17

0.23

9.41

.245

.

chemical treatment plant for cheese factory wastewater. Water Sci. Tech-nol. 14:41– 49.

37. Rusten B, Kolkinn O, Ødegaard H. 1997. Moving bed biofilm reactorsand chemical precipitation for high efficiency treatment of wastewaterfrom small communities. Water Sci. Technol. 35:71–79.

38. Sambrook J, Russell D. 2001. Molecular cloning.Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

39. Saul D, Aislabie J, Brown C, Harris L, Foght J. 2005. Hydrocarboncontamination changes the bacterial diversity of soil from around ScottBase, Antarctica. FEMS Microbiol. Ecol. 53:141–155.

40. Schink B. 1997. Energetics of syntrophic cooperation in methanogenicdegradation. Microbiol. Mol. Biol. Rev. 61:262–280.

41. Schmid M, et al. 2003. Characterization of activated sludge flocs byconfocal laser scanning microscopy and image analysis. Water Res. 37:2043–2052.

42. Seviour R, Nielsen PH. 2010. Microbial communities in activated sludgeplants, p 95–126. In Seviour R, Nielsen PH (ed), Microbial ecology ofactivated sludge. IWA Publishing, Norfolk, United Kingdom.

43. Sigrun JJ, Jukka AR, Ødegaard H. 2002. Aerobic moving bed biofilmreactor treating thermomechanical pulping whitewater under thermo-philic conditions. Water Res. 36:1067–1075.

44. Smith BY, Turner SJ, Rogers KA. 2003. Opal-A and associated microbes

from Wairakei, New Zealand: the first 300 days. Mineralog. Mag. 67:563–579.

45. Sousa DZ, Alves JI, Alves MM, Smidt H, Stams AJM. 2009. Effects ofsulfate methanogenic communities that degrade unsaturated and satu-rated long-chain fatty acids (LCFA). Environ. Microbiol. 11:68 – 80.

46. Strous M, et al. 1999. Missing lithotroph identified as new Planctomycete.Nature 400:446 – 449.

47. Tal Y, Watts JEM, Schreier SB, Sowers KR, Schreier HJ. 2003. Charac-terization of the microbial community and nitrogen transformation pro-cesses associated with moving bed bioreactors in a closed recirculatedmariculture system. Aquaculture 215:187–202.

48. Vandamme P, et al. 1991. Revision of Campylobacter, Helicobacter, andWolinella taxonomy: emendation of generic descriptions and proposal ofArcobacter gen. nov. Int. J. Syst. Bacteriol. 41:88 –103.

49. Wang Q, Garrity GM, Tiedje JM, Cole JR. 2007. Naïve Bayesian classifierfor rapid assignment of rRNA sequences into the new bacterial taxonomy.Appl. Environ. Microbiol. 73:5261–5267.

50. Widdel F. 1983. Methods for enrichment and pure culture isolation offilamentous gliding sulfate-reducing bacteria. Arch. Microbiol. 134:282–285.

51. Yang S, Yang F, Fu Z, Lei R. 2009. Comparison between a moving bedmembrane bioreactor and a conventional membrane bioreactor on or-ganic carbon and nitrogen removal. Bioresour. Technol. 100:2369 –2374.

Biswas and Turner

864 aem.asm.org Applied and Environmental Microbiology

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/a

em o

n 23

Feb

ruar

y 20

22 b

y 17

0.23

9.41

.245

.