947Research Article

IntroductionThe phylum Apicomplexa consists of several pathogens of immensemedical and veterinary importance, such as those causing malaria,toxoplasmosis or coccidiosis. Because they are obligate intracellularparasites, a key step during their life cycle is the invasion of thehost cell. Apicomplexan parasites actively invade the host cell ina complex, organised, stepwise process (Carruthers and Boothroyd,2006) that involves specialised secretory organelles (themicronemes, rhoptries and dense granules) and a unique form ofmovement termed gliding motility (Soldati and Meissner, 2004).Upon initial attachment to a surface, the parasite starts to glide ina substrate-dependent manner. Gliding involves the discharge ofadhesive transmembrane proteins at the apical end by specialisedsecretory organelles called micronemes. It has previously beendemonstrated that micronemal proteins of the TRAP family(thrombospondin-related anonymous protein) are essential forgliding motility and invasion (Huynh and Carruthers, 2006; Sultanet al., 1997) by binding to host-cell receptors and bridging them tothe cytoplasmic actin-myosin motor of the parasite via the glycolyticenzyme aldolase (Buscaglia et al., 2003; Jewett and Sibley, 2003;Starnes et al., 2006). The next step in invasion is the recognitionof the host cell followed by rhoptry secretion and intimateattachment to the host cell. A conditional-mutagenesis approach forthe micronemal protein AMA1 has demonstrated a distinct role fora micronemal protein during invasion. In the absence of AMA1,the parasite fails to form a moving junction (MJ) (Mital et al., 2005).The formation of the MJ depends on the secretion of rhoptry neckproteins (RONs) and their interaction with AMA1 (Alexander etal., 2005; Lebrun et al., 2005). In the absence of AMA1, the RONsare still secreted and associate with the host cell in loose patchesbut do not form an MJ (Alexander et al., 2005; Boothroyd andDubremetz, 2008). Up until now, the events leading to rhoptry

secretion and subsequently to the formation of the MJ are not wellunderstood. The functional linkage between micronemes andrhoptries led us speculate that additional micronemal proteins mightbe responsible for the establishment of the MJ.

Micronemal protein 8 (MIC8) was previously identified bysequence similarity to other micronemal proteins in the genome ofToxoplasma gondii. Analysis of MIC8 has demonstrated that it is,like other micronemal transmembrane proteins, secreted upon anincrease in intracellular calcium concentration and processed closeto its transmembrane domain (TMD). Furthermore, it has beendemonstrated that MIC8 interacts with the soluble micronemalprotein MIC3 during the transit through the secretory pathway(Meissner et al., 2002a). Here, employing a conditional gene-expression system, we present a detailed functional characterisationof this essential protein (Meissner et al., 2002b). We show thatinvasion depends on the function of MIC8. Further detailedcharacterisation of the resulting phenotype showed that this proteindoes not contribute to gliding motility. Instead it appears that MIC8plays an essential role in a step before the formation of an MJ. Weshow, in a novel complementation strategy, that the cytosolicdomains (CTDs) of MIC2, PfTRAP or AMA1 cannot substitute thefunction of the MIC8 CTD, whereas the CTD of the homologousprotein MIC8-like1 restores function. This indicates that thistransmembrane protein is involved in a novel invasion step leadingto formation of the MJ.

ResultsEstablishment of inducible conditional MIC8 knockoutWe employed a tetracycline-inducible system to generate aconditional knockout mutant for mic8. Parasites expressing thetetracycline-dependent transactivator TATi1 (Meissner et al., 2002b)were transfected with a construct encoding a recombinant Ty-tagged

Apicomplexan parasites rely on sequential secretion ofspecialised secretory organelles for the invasion of the host cell.First, micronemes release their content upon contact with thehost cell. Second, rhoptries are discharged, leading to theformation of a tight interaction (moving junction) with the hostcell, through which the parasite invades. The functionalcharacterisation of several micronemal proteins in Toxoplasmagondii suggests the occurrence of a stepwise process. Here, weshow that the micronemal protein MIC8 of T. gondii is essentialfor the parasite to invade the host cell. When MIC8 is notpresent, a block in invasion is caused by the incapability of theparasite to form a moving junction with the host cell. We

furthermore demonstrate that the cytosolic domain is crucialfor the function of MIC8 and can not be functionallycomplemented by any other micronemal protein characterisedso far, suggesting that MIC8 represents a novel, functionallydistinct invasion factor in this apicomplexan parasite.

Supplementary material available online athttp://jcs.biologists.org/cgi/content/full/121/7/947/DC1

Key words: Apicomplexa, Invasion, Microneme, Rhoptry, Tet system,Toxoplasma

Summary

Microneme protein 8 – a new essential invasion factorin Toxoplasma gondiiHenning Kessler1, Angelika Herm-Götz1, Stephan Hegge1, Manuel Rauch1, Dominique Soldati-Favre2,Friedrich Frischknecht1 and Markus Meissner1,*1Hygieneinstitute, Department of Parasitology, University Hospital Heidelberg, Im Neuenheimer Feld 324, D-69120 Heidelberg, Germany2Department of Microbiology and Molecular Medicine, University of Geneva, CMU, 1, rue Michel-Servet 1211, Geneva 4, Switzerland*Author for correspondence (e-mail: markus.meissner@med.uni-heidelberg.de)

Accepted 7 January 2008Journal of Cell Science 121, 947-956 Published by The Company of Biologists 2008doi:10.1242/jcs.022350

Jour

nal o

f Cel

l Sci

ence

948

version of MIC8 (MIC8Ty) under control of the Tet-induciblepromoters pT7S1 and pT7S4 (Meissner et al., 2001). We generatedthree independent clones expressing mic8Ty at different levels whengrown in the absence of anhydrotetracycline (ATc) (Fig. 1A). Thestrongest-expressing clone (T7S4-5) showed a partial localisationof MIC8 in an apically localised compartment that correspondedto early endosomes (Fig. 1B, Fig. 2D). By contrast, parasite strainsexpressing the transgene at a lower level showed a normallocalisation of MIC8Ty in the micronemes. Interestingly, prolongedculture in the absence of ATc resulted in loss of transgene expression,indicating that overexpression of MIC8 is unfavourable for theparasite (data not shown).

We removed endogenous mic8 in transgenic parasites (T7S1-4and T7S4-1) via homologous recombination with the constructMIC8KOCAT (see Materials and Methods) (Fig. 1C) and obtainedtwo independent clonal parasite populations, as shown in analyticalPCRs on genomic DNA (Fig. 1D). Both clones, MIC8KOi-T7S1-4 and MIC8KOi-T7S4-1, showed the same behaviour in phenotypicassays (data not shown). We chose MIC8KOi-T7S1-4 for detailedphenotypic analysis and refer to this parasite strain as MIC8KOi.

We analysed the expression of mic8Ty in MIC8KOi. Parasitesgrown in the absence of ATc showed almost identical levels ofexpression of MIC8 (~75%, as judged from immunoblots) comparedto wild-type parasites (Fig. 2A,B). Incubation of parasites for 48hours in the presence of ATc led to almost complete ablation ofMIC8Ty (to ~2%) compared with parasites grown in absence of

ATc for the same amount of time, as judged from immunoblots(Fig. 2A,B and see later). Unless otherwise indicated, parasites weregrown in the absence or presence of ATc for 48 hours before therespective experiment was performed. We confirmed that theobserved downregulation in mic8 expression was specific, becausethe expression levels of other micronemal proteins (MIC2 andMIC3) or of alpha-tubulin were not affected (Fig. 2B).

MIC8 is not required for trafficking of MIC3 to the micronemesPreviously, we found that MIC8 and MIC3 are capable of interactingwith each other during the transit through the secretory pathway,and we suggested that MIC8 could act as an escorter for MIC3(Meissner et al., 2002a), in analogy to other identified micronemalescorter proteins, such as MIC6 (Reiss et al., 2001) and MIC2(Rabenau et al., 2001). To test whether MIC8 is required for correctlocalisation of MIC3, we analysed localisation of MIC3 in parasitesdepleted for MIC8. Surprisingly, we did not observe amislocalisation or an altered expression level of MIC3 (Fig. 2B,C).Furthermore, we did not detect any accumulation of MIC3 in earlyendosomes when parasites overexpressing MIC8 were analysed(Fig. 2D).

Based on these results, we conclude that the interaction betweenMIC8 and MIC3 is not essential for targeting of MIC3 to themicronemes. To confirm that the observed accumulation of MIC8in T7S4-5 corresponds to the early endosomes, we performed co-localisation analysis with the Golgi marker GRASP-RFP (Pfluger

Journal of Cell Science 121 (7)

Fig. 1. Establishment of a conditional knockout for MIC8. (A) Regulation of mic8Ty expression by ATc in three independent parasite strains: T7S4-1, T7S4-5 andT7S1-4. Parasites were grown with (+) or without (–) ATc for 48 hours, fixed and stained with antibodies against Ty, or against MIC6 as a control. Pictures weretaken under identical exposure conditions. (B) Immunofluorescence analysis of parasite strains T7S4-1 and T7S4-5 grown for 48 hours in the absence of ATc, asshown in A. Parasites were stained with the indicated antibodies. Strong overexpression of MIC8Ty results in partial accumulation of MIC8 within the secretorypathway (arrows). Other micronemal proteins, such as MIC6, appear not to be affected by overexpression of MIC8. (C) Homologous recombination of endogenousmic8 with a knockout construct in which a CAT-expression cassette is flanked by 1.6 kb (5′FS) and 2.5 kb (3′FS) results in a knockout locus that can be identifiedusing analytical PCR with specific oligonucleotides, as indicated by the arrows. (D) Analytical PCR analysis to verify homologous recombination of the knockoutconstruct in the recipient strains T7S1-4 and T7S4-1. Numbers on top of each lane indicate the respective oligonucleotide combination (see C) used in each PCRreaction. Scale bars: 25 μm (A); 5 μm (B).

Jour

nal o

f Cel

l Sci

ence

949Role of MIC8 in T. gondii invasion

et al., 2005) and found that the majority of retained MIC8 localisedapical to the Golgi (Fig. 2D). When we performed co-localisationanalysis of MIC8 with an antibody against the propeptide of M2AP,which localises to early endosomes (Harper et al., 2006), we detectedretained MIC8 within the same compartment (Fig. 2D).

Phenotypic characterisation of MIC8KOiTo analyse the function of MIC8 in detail, we inoculated humanforeskin fibroblast (HFF) cells with parasites in the presence andabsence of ATc, and followed the propagation of parasites. WhereasMIC8KOi parasites grown in the absence of ATc showed normalgrowth when compared to wild-type parasites, no growth was seenwhen the expression of mic8 was ablated (Fig. 3A).

When we examined infected host cells within 4 days, weoccasionally detected huge parasitophorous vacuoles containinglarge numbers of parasites, indicating that parasites were capableof replicating in the absence of MIC8 (see also supplementarymaterial Fig. S1). Occasionally, we observed lysed vacuoles withfreshly egressed motile parasites; these parasites appeared to beincapable of invading neighbouring host cells (Fig. 3A). Severaldays after the inoculation of cells with parasites, we failed to detectany intracellular parasites, indicating that initially infected host cellshad been lysed and that released parasites were incapable of re-invading new host cells (Fig. 3B and data not shown).

Intracellular replication and host-cell egress are not affected bythe absence of MIC8To analyse the function of MIC8 during the asexual cycle of T.gondii, we generated MIC8KOi parasites constitutively expressingGFP. We inoculated HFF monolayers with equal numbers offreshly released MIC8KOi parasites that were grown in the absenceof ATc, and subsequently compared growth of the parasites andlysis of initially infected host cells in presence or absence of ATcover a 72-hour time-course (Fig. 3B). We did not see any differencein non-induced host-cell egress: the number of initially infected hostcells decreased irrespective of whether ATc was added to themedium or not. Whereas, at 24 hours post-infection, approximately90% of initially infected host cells were intact, these numbersdecreased to approximately 55% and 10% after 48 and 72 hours,respectively (Fig. 3B). However, under conditions of MIC8depletion, no subsequent infection of neighbouring host cells wasdetected. This indicates that this protein is specifically requiredduring host-cell invasion, whereas egress is not affected in parasitesdepleted of MIC8.

Host-cell exit can be artificially triggered by the use of thecalcium-ionophore A23187 (Black et al., 2000). When we treatedintracellular MIC8KOi parasites grown in the presence or absenceof ATc with A23187 for 5 minutes, no significant reduction in egresswas detected (supplementary material Fig. S1).

Depletion of MIC8 does not affect parasite attachment ormicroneme secretionInitial attachment is the first step in the invasion of the host cell,so we performed attachment assays on fixed host cells. MIC8KOi,TATi1-expressing and wild-type (RH) parasites grown in thepresence or absence of ATc were allowed to attach to the host cellfor 15 minutes. After removal of non-attached parasites, thenumber of parasites associated with the host cell was comparedbetween these groups. We found a slight reduction in attachmentwhen parasites expressing TATi1 were compared with wild-typeparasites. Efficiency in attachment appeared to be furtherdecreased in the case of MIC8KOi, irrespective of whether MIC8was expressed (Fig. 3C). The observed reduction in attachmentcould be due to the extensive genetic modifications of the parentalRH parasites, which required three independent stabletransfections in order to generate MIC8KOi. However, nodifference in initial host-cell attachment was observed in the case

Fig. 2. MIC8 is not required for trafficking of MIC3 to the micronemes.(A) Immunofluorescence analysis of MIC8KOi grown for 48 hours in thepresence (+) or absence (–) of ATc prior to fixation. Staining was performedwith alpha-MIC8, or with alpha-MIC2 as a control (same exposure time for allmicrographs). (B) Immunoblot analysis of MIC8KOi and RH parasites grownin the presence or absence of ATc for 48 hours and probed with the indicatedantibodies. No significant difference in the expression levels of MIC2, TUB1or MIC3 could be detected in MIC8KOi cells under the two conditions.(C) Localisation of MIC3 in MIC8KOi parasites grown in the presence of ATcfor 48 hours. Parasites were stained with the indicated antibodies. Mergedimages are shown on the right. Blue stain indicates DAPI (nuclei). (D) Co-localisation studies in the parasite strain T7S4-5, which overexpressesMIC8Ty (see also Fig. 1B). Upper panels: co-localisation study of MIC8Tyand GRASP-RFP (Pfluger et al., 2005) in the parasite strain T7S4-5 transientlytransfected with GRASP-RFP demonstrates accumulation of MIC8 in a post-Golgi compartment. Middle panels: co-localisation of MIC8Ty and thepropeptide of M2AP (Harper et al., 2006) in early endosomes. Lower panels:co-localisation study of MIC8Ty and MIC3 shows that MIC3 is not localisedin early endosomes because of overexpression of MIC8Ty. Right: enlargementof boxed parasite(s) in the merged pictures. Scale bars, 10 μm.

Jour

nal o

f Cel

l Sci

ence

950

of MIC8KOi parasites grown in the presence or absence of ATc.Therefore, MIC8 appears to be not involved in this invasion step(Fig. 3C).

To exclude the possibility that secretion of micronemal proteinswas affected, we compared the level of secreted MIC2. We foundno difference in secretion of MIC2 in parasites grown in the presenceor absence of ATc. Both constitutive microneme secretion as wellas induced secretion showed no difference to wild type in theabsence of MIC8 (supplementary material Fig. S1). Similar resultswere obtained with other micronemal proteins, such as MIC6 andMIC4 (data not shown).

MIC8 is required for invasion and not during egressNext, HFF cells were inoculated with MIC8KOi parasites in thepresence or absence of ATc. After host-cell lysis, equal numbers offreshly egressed parasites were analysed for their capability toinvade host cells. Parasites were allowed to invade for differentdurations before the removal of non-invaded parasites and werefurther incubated in the presence or absence of ATc. We found thatparasites depleted of MIC8 were completely deficient in invasion.Even a prolonged invasion time of more then 12 hours did notincrease invasion events significantly (Fig. 3D). A direct comparisonbetween MIC8KOi parasites grown in the presence or absence ofATc showed that less then 0.1% of the parasites were invasive. Toconfirm that MIC8 is a general, essential factor for host-cellinvasion, we performed analogous assays on different host-cell types(green monkey kidney cells, HeLa cells and macrophages) andobtained identical results (data not shown).

We were interested to know whether this protein is involved ina signalling cascade during egress of the host cell that prepares theparasite for the next round of invasion, because egress and invasionare tightly linked (Hoff and Carruthers, 2002). If this were the case,extracellular parasites expressing only nascent MIC8 would beincapable of invasion, because no modification of MIC8 can occurduring egress. In order to differentiate between a role of this proteinduring egress and invasion, we modified the above experiment. HFFcells were inoculated for 10 minutes with parasites grown in thepresence of ATc. Non-attached parasites were then removed.Subsequently, expression of mic8Ty was reactivated in attachedextracellular parasites by the removal of ATc for 12 hours beforethe invasion of host cells was analysed. Reactivation of MIC8expression in extracellular parasites restored the capability ofinvasion (up to 20%) when compared with MIC8KOi parasites thatwere constantly kept in absence of ATc (Fig. 3E). These resultsindicate that MIC8 is exclusively involved in invasion and is notrequired or modified during egress. As soon as a critical level ofMIC8 was reached in extracellular parasites, invasion competencywas restored. The observed reduction in invasion, when comparedto parasites constantly grown in the absence of ATc (Fig. 3E), isprobably due to reduced viability of parasites kept for a prolongedtime outside of the host cell.

MIC8 is dispensable for gliding motilityGliding motility is a prerequisite for active invasion of the hostcell. Several types of movement can be detected in wild-typeparasites (Fig. 4A) (Hakansson et al., 1999). Recently, it has been

Journal of Cell Science 121 (7)

Fig. 3. MIC8 is required for parasite survival and isessential during the invasion of the host cell.(A) Upper panels: growth of MIC8KOi parasiteswas compared to RHwt parasites using plaque assay.Parasites were inoculated on HFF cells in thepresence or absence of ATc for 7 days prior toGIEMSA staining. Lower panels: same experimentas above. Parasites were analysed 72 hours post-infection. Note that in the case of MIC8KOi grownin the presence of ATc, freshly egressed parasitesdid not invade neighbouring host cells. (B) Analysisof non-induced egress by quantification of intactinitially infected host cells. HFF cells wereinoculated with MIC8KOi-GFP parasites in thepresence or absence of ATc and the decrease ininitially infected host cells was analysed over time.The depicted quantification is representative of theresults derived from three independent experiments.(C) Attachment assay of freshly released parasitesgrown in the presence or absence of ATc to fixedcells. Equal numbers of parasites were allowed toattach on host cells at 37°C for 15 minutes beforenon-attached parasites were removed by consecutivewashing steps with cold PBS. Data are mean valuesof three independent experiments ± s.d.(D) Invasion assay of freshly egressed parasitesgrown in the presence or absence of ATc as in C.After the indicated time, non-invaded parasites wereremoved by several washing steps. Intracellularparasites were further incubated for 12 hours and thenumber of parasitophorous vacuoles was compared.ON, over night. Data shown are mean values ofthree independent experiments ± s.d. (E) Re-expression of MIC8 in extracellular parasitesrestores invasion capability. Invasion assay was performed similar to as in D. After MIC8KOi grown in the presence or absence of ATc were allowed to attach for10 minutes, non-attached parasites were removed. Attached parasites were further incubated in the presence or absence of ATc (–/–: parasites constantly kept in theabsence of ATc; +/+: parasites constantly kept in the presence of ATc; +/–: parasites kept in the presence of ATc and further incubated in media without ATc). Datarepresent mean values of three independent experiments ± s.d.

Jour

nal o

f Cel

l Sci

ence

951Role of MIC8 in T. gondii invasion

shown that the micronemal protein MIC2 is essential for helicaland twirling motility but not for circular gliding (Huynh andCarruthers, 2006). In the absence of MIC2, parasites show areduced ability to invade the host cell. To assess whether theobserved complete block in invasion upon depletion of MIC8 wasdue to a reduction in gliding motility, we performed quantitativelive imaging. As described previously, three forms of glidingmotility can be detected in this assay: circular gliding, uprighttwirling and helical rotation (Fig. 4A) (Hakansson et al., 1999).We performed time-lapse microscopy on RH parasites andMIC8KOi grown in the presence or absence of ATc. After imageacquisition (one frame/3 seconds for 5 minutes), overlayingprojections of the acquired frames revealed the respective motilitypatterns. All three forms of gliding motility were identified inparasites depleted of MIC8 (Fig. 4A). Although RH parasitesshowed a higher overall gliding motility than MIC8KOi (~30 vs12% overall gliding motility), no significant reduction in glidingmotility was observed between MIC8KOi grown in the presenceor absence of ATc (Fig. 4B). When the relative occurrences of thethree different forms of gliding were compared, no significantdifference between MIC8KOi grown in the presence or absenceof ATc was observed (Fig. 4C). The general reduction of glidingmotility in MIC8KOi parasites could be due to the extensive geneticmodifications of the parental RH parasites (similar to the effectobserved for attachment). However, because no difference ingliding motility was evident in the case of MIC8KOi parasitesgrown in the presence or absence of ATc, the total block in invasionis unlikely to be due to reduced gliding motility in the absence ofMIC8.

T. gondii expresses two highly conserved homologous of MIC8Two highly conserved homologous proteins, MIC8-like1 (accessionnumber 76.m01679) and MIC8-like2 (accession number49m.03396) can be found in the available genome database of T.gondii (www.toxoDB.org) (Cerede et al., 2005) (supplementarymaterial Fig. S2). We confirmed expression of MIC8-like1 andMIC8-like2 in T. gondii tachyzoites on the RNA level by reversetranscriptase (RT)-PCR (supplementary material Fig. S2). Thefunction of a micronemal transmembrane protein appears to bedetermined by the interaction of the C-terminal cytosolic taildomain (CTD). In the case of members of the TRAP family, it hasbeen demonstrated that the CTD interacts with the glycolyticenzyme aldolase, which links this protein to the actin-myosin motoressential for gliding motility (Jewett and Sibley, 2003; Buscagliaet al., 2003). An alignment of the CTDs of different micronemeproteins indicates that most sequences shown to be essential forinteraction with aldolase (Starnes et al., 2006) are not present inthe CTD of the MIC8 family members (supplementary materialFig. S2). This corresponds well with our phenotypiccharacterisation of MIC8KOi that suggests a different function ofMIC8 during invasion.

Complementation analysis of MIC8KOiWe were interested to determine whether the CTD of differentmicronemal proteins can be exchanged for the CTD of MIC8.Therefore, we designed a complementation strategy, takingadvantage of the tight regulation and clear invasion phenotype ofMIC8KOi, that allowed us to use ATc selection to obtain stabletransfected parasites.

Fig. 4. MIC8 is not involved in gliding motility. (A) Three different forms of movement can be identified by quantitative image analysis: circular gliding (C),helical gliding (H) and twirling (T). These forms give distinct patterns when the acquired images are projected. The projection (proj.) of 100 images acquired at 3-second intervals represents an overall observation time of 5 minutes. All three forms of movements can be detected in the case of RHwt and MIC8KOi grown in thepresence or absence of ATc. (B) Comparison of overall motility. Although differences between RH and MIC8KOi parasites can be observed (~30 vs 12% overallgliding motility, respectively), no significant reduction in gliding motility can be observed between MIC8KOi grown in the presence or absence of ATc.(C) Comparison of the relative frequency of each gliding type of motile parasites. A direct comparison between MIC8KOi grown in the presence or absence of ATcdid not show any significant differences in the frequency of the three forms of gliding motility. Mean values of three independent experiments ± s.d. are shown.

Jour

nal o

f Cel

l Sci

ence

952

Transfection of a construct leading to constitutive expression ofa myc-tagged version of MIC8 served as a positive control. Stableselection was performed in the presence of ATc to deplete theparasite of the inducible Ty-tagged copy of MIC8. After 5-6 days,

the obtained parasite population was analysed for expression ofeither the myc- or Ty-tagged version of MIC8. We observed threedifferent sub-populations that expressed MIC8Ty, MIC8myc or both(Fig. 5A,B) in the presence of ATc, indicating that three independent

Journal of Cell Science 121 (7)

Fig. 5. Complementation analysis of MIC8KOi using different chimeric proteins. (A) Schematic of the complementation strategy. Transfection of MIC8KOi withcomplementation constructs under ATc selection results in three different integration events: (1) homologous recombination leads to a promoter exchange resultingin constitutive expression of Ty-tagged MIC8 (stained in green); (2) a combination of both homologous and non-homologous recombination leads to constitutiveexpression of both MIC8Ty (stained in green) and the respective myc-tagged complementation construct (stained in red); (3) only non-homologous recombinationleads to exclusive, constitutive expression of the myc-tagged complementation construct. This event indicates functional complementation. Theimmunofluorescence analysis shown was performed on a representative pool of MIC8KOi parasites complemented with pMIC8MIC8mycTMCTDMIC8 after 6 daysunder ATc selection. (B) Top: overview of the complementation constructs used in this study. The TMD and CTD of MIC8myc have been substituted as indicated.In the case of MIC2, two constructs were generated (see text). In the case of MIC8mycGPI (GPI), the TMD and CTD of MIC8 was exchanged for the GPIanchoring signal of the major surface antigen SAG1. Bottom: representative immunofluorescence analyses of MIC8KOi transfected with the indicatedcomplementation construct. Stable transfection has been achieved by application of ATc selection as shown in A. Numbers in each image indicate the averagepercentage of parasites (± s.d.) in which random integration occurred in four independent experiments. Scale bars: 12.5 �m.

Jour

nal o

f Cel

l Sci

ence

953Role of MIC8 in T. gondii invasion

integration events of the complementation construct occurred:exchange of the promoter pT7S1 for pMIC8 (because ofhomologous recombination of the complementation constructpMIC8MIC8myc with construct T7S1MIC8Ty), random integrationof the complementation construct, and a combination of randomintegration and homologous recombination (Fig. 5A). Only randomintegration, which resulted in exclusive expression of the myc-tagged complementation construct, indicated functionalcomplementation for MIC8Ty (Fig. 5A).

We generated several complementation constructs in which theCTD and TMD of MIC8 were exchanged for the correspondingdomains of MIC2 (accession number AAB63303), AMA1 (accessionnumber AAB65410), PfTRAP (accession number AAA29776),MIC8-like1 or the GPI-anchoring signal of SAG1 (Fig. 5B, upperpanel). In the case of MIC2, we generated two differentcomplementation constructs: one including sequences upstream ofthe TMD that have previously been implicated in the correctprocessing of MIC2 (Brossier et al., 2003) (Mic2a), and oneincluding only the TMD and CTD (Mic2b). Exclusive expressionof the respective complementation construct was only achieved in

the case of the construct MIC8myc and in the case of the chimeraMIC8mycTMCTDMIC8-like1 (Fig. 5B). In all cases, we verified thecorrect localisation of the respective chimeric protein in themicronemes (Fig. 5B). Therefore, it appears that the correct targetingof the extracellular domains of MIC8 is not sufficient to restore thefunction of MIC8. Furthermore, we conclude that the CTD of MIC8is functionally distinct and cannot be complemented by the CTD ofmicroneme proteins belonging to the TRAP family or of AMA1.

Interestingly, when we generated a mutant in which the highlyconserved C-terminal tryptophan of MIC8 was substituted foralanine, we were able to achieve complementation, indicating thatthis residue, although highly conserved in the MIC8 family (seesupplementary material Fig. S2), is not absolutely required for thefunction of MIC8.

MIC8 is essential for formation of the moving junctionWhen parasites are treated with cytochalasin D (CD), which leadsto an arrest in invasion, an MJ is formed and the content of therhoptries is secreted into the cytosol of the host cell, leading to theformation of evacuoles (Fig. 6A) (Hakansson et al., 2001). To

Fig. 6. MIC8 is essential for the formation of the moving junction. (A) Formation of evacuoles is abolished in parasites depleted of MIC8. MIC8KOi, grown in thepresence or absence of ATc, was incubated with host cells in the presence of CD. Formation of evacuoles (green) and an MJ (red) was analysed with monoclonalantibodies against Rop2-5 and polyclonal antibodies against RON4. No evacuoles were observed when MIC8KOi was grown in the presence of ATc. Blue stainingindicates DAPI (nuclei). (B) Extracellular RON4 was detected by immunofluorescence analysis on non-permeabilised parasites expressing cytosolic GFP as aviability marker. MIC8KOi parasites were allowed to attach to host cells in the presence or absence of CD for 20 minutes. Red indicates an MJ. (C) Quantificationof extracellular RON4, the presence of which indicates the formation of an MJ. Approximately 200 parasites were analysed in each assay (error bars indicate s.d.obtained from five independent assays). The units on the y-axis are percent of parasites with RON4 signal. (D) Depletion of MIC8 does not affect RON4expression levels. Immunoblots from MIC8KOi and RH parasites, grown for 48 hours in the presence (+) or absence (–) of ATc, show efficient downregulation ofMIC8 expression in the presence of ATc. No differences in RON4 expression levels could be detected. Scale bars: 15 �m (A); 20 �m (B).

Jour

nal o

f Cel

l Sci

ence

954

determine whether parasites depleted of MIC8 were capable offorming an MJ and of secreting their rhoptries, MIC8KOi parasiteswere grown in the presence or absence of ATc, treated with CDand inoculated on HFF cells to determine evacuole formation. Inthe absence of MIC8, no formation of evacuoles was detected (Fig.6A). A similar phenotype has been reported for a conditionalknockout of the micronemal protein AMA1. Parasites depleted ofAMA1 still secrete RONs but fail to establish an MJ between theparasite and the host cell (Alexander et al., 2005; Mital et al., 2005).In this case, RONs associated with the MJ cannot be seen, but ratherthey localise in loose patches on the surface of the host cell. Wewere interested to determine whether a similar phenotype could beobserved upon depletion of MIC8.

To analyse secretion and localisation of RONs, we used RON4as a marker. MIC8KOi parasites expressing GFP as a viabilitymarker were grown in the presence or absence of ATc. Parasiteswere treated with or without CD before inoculation of HFF cells.Subsequently, analysis of RON4 secretion was performed inimmunofluorescence assays on non-permeabilised parasites (Fig.6B). In the absence of MIC8, the occurrence of a RON4 signal wasreduced by more then 90% (Fig. 6C) irrespective of whether theparasites were treated with CD. Ablation of MIC8 had no influenceon the expression level of RON4 (Fig. 6D). Together, these resultsdemonstrate a crucial role of MIC8 during establishment of the MJthat is upstream of AMA1.

DiscussionHost-cell invasion by apicomplexan parasites is a multi-step process,requiring the sequential secretion of specialised secretory organellesand the action of distinct sets of proteins (Carruthers and Boothroyd,2006). Whereas secretion of micronemes has been demonstrated todepend on a calcium-signalling cascade, the signals leading tosecretion of the rhoptries and formation of the MJ have not beenidentified so far. Given the functional linkage of microneme andrhoptry secretion, we speculated that micronemal proteins mightbe implicated in this role.

To shed light on the function of MIC8, we generated a conditionalknockout for MIC8 by employing a tetracycline-inducibletransactivator system (Meissner et al., 2007). For the generation oftransgenic recipient strains with a second controllable copy of mic8,it was necessary to keep expression of the transgene turned off toprevent any deleterious effects due to overexpression of mic8Ty.Interestingly, a strain overexpressing MIC8Ty showed a partialaccumulation of this protein in a post-Golgi compartment thatcorresponded with early endosomes, as shown by co-localisationwith the pro-peptide of M2AP (Harper et al., 2006). It is likely that,under conditions of MIC8 overexpression, a factor involved inquality control or maturation of this protein is limiting, resulting inpartial accumulation of MIC8 in early endosomes. A similarphenomenon was observed upon overexpression of MIC2 (Huynhand Carruthers, 2006).

It has previously been demonstrated that MIC8 interacts withMIC3 during the transit through the secretory pathway (Meissneret al., 2002a) and it was speculated that MIC8 might act as anescorter for MIC3, similar to other micronemal transmembraneproteins (Rabenau et al., 2001; Reiss et al., 2001). However,depletion of MIC8 in the established MIC8KOi parasites did notresult in any mislocalisation of MIC3, demonstrating that theobserved interaction between MIC8 and MIC3 is not essential forthe targeting of MIC3 to the micronemes. Currently, we can onlyspeculate on the mechanism involved in this targeting. It is possible

that MIC8 and MIC3 are sorted to the micronemes by interactingwith the same protein complex, that MIC3 contains sorting signalsthat ensure its transport to the micronemes independently of MIC8or that the escorter function of MIC8 is redundant. Furtherexperiments are required to clarify this complex issue.

We examined crucial events during the asexual life cycle of theparasite and found that depletion of MIC8 explicitly affects theability of the parasite to invade the host cell. We did not observeany effect on replication, egress or initial attachment to the hostcell. Interestingly, reactivation of MIC8 expression in extracellularparasites led to restoration of invasion potency. This shows thatMIC8 is not required during egress of the host cell and that theinvasion of parasites depends on a critical level of MIC8 expression.Furthermore, parasites depleted for this essential invasion factorshowed normal attachment and gliding motility, which is in sharpcontrast to the function determined for MIC2 (Huynh andCarruthers, 2006).

We noticed that parasites depleted of MIC8 did not form anyevacuoles, similar to a conditional mutant for AMA1 (Alexander etal., 2005; Mital et al., 2005). Parasites depleted for AMA1 are unableto form an MJ and it has been demonstrated that interaction of AMA1with RONs is essential for this invasion step (Boothroyd andDubremetz, 2008). However, in the absence of AMA1, RONs arestill released by the parasite and can be detected at the surface of thehost cell in loose patches (Alexander et al., 2005). In sharp contrast,we were not able to detect any signal for RON4 when intact non-permeabilised parasites were analysed for RON4 secretion. Thisindicates that MIC8 functions in an essential step during invasionthat is downstream of MIC2 but upstream of AMA1 function.

The absence of RON4 on the surface of the host cell suggeststhat MIC8 is either required for the initial association of RONs withthe surface of the host cell or for rhoptry secretion. In the first case,this role could be facilitated by function of the extracellulardomains of MIC8. However, we demonstrated in a novelcomplementation approach that correct targeting of chimericproteins consisting of the extracellular domains of MIC8 and theTMD and CTD of different micronemal proteins, such as MIC2,AMA1 and TRAP, did not restore the function conferred by wild-type MIC8. This demonstrates that correct targeting of theextracellular domains is not sufficient to restore the function ofMIC8.

Having established that the CTDs of MIC8 and MIC8-like1determine a novel functional role, we can now continue to identifythe cytosolic factors interacting with this domain to gain moremechanistic insights into its function during the establishment ofthe MJ. Given the clear phenotype of MIC8KOi in invasion, itappears that MIC8-like1 and MIC8-like2, which we show here tobe expressed at the RNA level, cannot compensate for the loss ofmic8 in tachyzoites.

Previously, it has been shown that MIC8 is capable of binding tothe host cell upon dimerisation (Cerede et al., 2002). It is thereforetempting to speculate that, upon dimerisation, MIC8 is involved ina signalling cascade that ultimately leads to rhoptry secretion. Similarmechanisms have been described in other eukaryotes for numerousnon-tyrosine kinase receptors that trigger receptor-mediatedendocytosis and subsequently a signalling cascade (Li, 2005). In fact,we have recently demonstrated that Rab11A, a small G-proteinessential for recycling endocytosis and associated with the rhoptries(Bradley et al., 2005), is required during invasion of the host cell(Herm-Gotz et al., 2007), indicating a link between receptor-mediatedendocytosis, receptor recycling and rhoptry secretion.

Journal of Cell Science 121 (7)

Jour

nal o

f Cel

l Sci

ence

955Role of MIC8 in T. gondii invasion

In conclusion, here, we present evidence that the micronemalprotein MIC8 of T. gondii plays an essential role during a distinctstep of host-cell invasion required for the early formation of theMJ. The characterisation of MIC8 as a key determinant for invasiondemonstrates that micronemal proteins are involved in severalindependent steps during invasion that are likely to be conservedin apicomplexan parasites. The identification of each individualstep will not only broaden our understanding of fundamentalapicomplexan biology but might also lead to the identification ofnew drug and vaccine candidates. The challenging issue now willbe to further elucidate the mechanistic action of MIC8, especiallythe role of the MIC8 CTD, which we show here to be essential forits function.

Materials and MethodsParasite strains, transfection and cultureT. gondii tachyzoites (RH hxgprt–) and TATi-1 (Meissner et al., 2002b) were grownin HFF cells and maintained in Dulbecco’s modified Eagle’s medium (DMEM),supplemented with 10% foetal calf serum (FCS), 2 mM glutamine and 25 μg/mlgentamycin. Selection based on chloramphenicol resistance or pyrimethamineresistance was performed as described previously (Kim et al., 1993; Donald and Roos,1993).

Generation of the inducible MIC8 knockoutTo introduce a Ty-tag into mic8 and generate a vector allowing inducible expressionof this gene, the cDNA of mic8 was cloned into the vector p7TetOS1 and p7TetOS4downstream of the inducible promoter (Meissner et al., 2001). Next, inverse PCRusing oligonucleotides MIC8Ty-as (antisense) (5′-CTTAATTAAGATGCATC -GAGGGGGTCCTGGTTGGTGTGGACTTCTGGTAAACACTGCAACTTTGA -CCC-3′) and MIC8Ty-s (sense) (5′-CCAATGCATCTACTGATCAGACAGATTTCG-3′). The PCR fragment was subsequently digested with NsiI and re-ligated, resultingin the expression vectors T7S1MIC8Ty and T7S4MIC8Ty, respectively. In order togenerate stable parasites with each construct, co-transfection of 60 μg T7S1MIC8Tyor T7S4MIC8Ty with 30 μg pDHFR (Donald and Roos, 1993) was performed.

The knockout construct was based on the vector pT230CAT (Soldati andBoothroyd, 1995), in which the 5′UTR was amplified using oligonucleotides MIC8-1 (5′-GGGGTACCACTCGTGGCGTCGCTG-3′) and MIC8-2 (5′-GGGGTACC -TGGTGGTGGGCGGAAAG-3′) and the 3′UTR with MIC8-3 (5′-GCGGATC -CTTAATTAAGCATAAGCTTTGTACCTGTGC-3′) and MIC8-4 (5′-TCCCCG -CGGCATTGAACAACATGTATGCG-3′) and placed within KpnI and BamHI/NotIrestriction sites, respectively. 30 μg of the MIC8KOCAT construct was transfectedand, subsequently, CAT selection was performed. MIC8KOi parasites were isolatedfrom the obtained stable pool of transfectants via limiting dilution and identifiedvia genomic PCR using insert-, genome- and integration-specific oligonucleotidecombinations (see Fig. 2A). MIC8KOi parasites were then verified in immunoblotsand immunofluorescence assays to confirm inducible expression of MIC8Ty. For asubset of studies, MIC8KOi was transfected with p5RT70GFP and GFP-expressingparasites were isolated based on green fluorescence.

Generation of complementation constructsFor the generation of complementation constructs encoding the extracellular domainsof MIC8 fused to the TMD and CTD of MIC2, AMA1, PfTRAP, MIC8/2,MIC8(W>A) and MIC8GPI, we exchanged the DNA sequence encoding the Ty-tagin T7S1MIC8Ty for a myc-tag using complementary oligonucleotides MIC8myc-s(5′-AATTCTTTCAAAGTTGCAGTGTTTACCTAGGGAGCAGAAGCTCATCTC -CGAGGAGGACCTAGATGCATCTTAAT-3′) and MIC8myc-as (5′-TAAGATGC -ATCTAGGTCCTCCTCGGAGATGAGCTTCTGCTCCCTAGGTAAACACTGC A -ACTTTGAAAG-3′). In a second step, the TMD and CTD of MIC8 were re-introduced within NsiI and PacI restriction sites. Next, the promoter p7TetOS1 wasexchanged for p5RT70 and pMic using KpnI/EcoRI, resulting in the constructsp5RT70MIC8myc and pMIC8MIC8myc, respectively. Amplification of pMIC8 wasachieved using oligonucleotides pMIC8-s (5′-CCCGGTACCTGGTGGTGGGCG-3′) and pMIC8-as (5′-GCCGAATTCGAAACGAAAGATACCGCGACCAGC-3′).Subsequently, the coding regions for different transmembrane CTDs were introducedinto MfeI/PacI restriction sites, resulting in different complementation constructs.The oligonucleotides used for amplification of the TMCTD-encoding DNAsequence were: MIC8CTD MIC8/2-tail: MIC8/2-sense2 (5′-GCGGCAAT -TGGACTG GCA ACGGGAGCC-3′) and MIC8/2-as (5′-GCCTTAATTAA TT -ATGACCA CATTGA GCCTG-3′); MIC8CTD MIC8W>A tail: MIC8sense-MfeI(5′-GCGGCAATT GCATTGGTGGTTGTGG-3′) and MIC8-W>Aas (5′-GCCT -TAATTAAGACG CG ATACCGCCCGAAGG-3′); PfTRAP-tail: PfTRAP-sense(5′-GCGGCAATTGC AGG TGGAATAGCTGGAGG-3′) and PfTRAP-as (5′-GCC -TTAATTAATTCCA CTCGTTTTCTTCAG-3′); AMA1-tail: AMA1-s (5′-GCGGCA -ATTGCTGGACT CG CCGTAGGAG-3′) and AMA1-as (5′-GCCTTAATTAACT -

AGTA ATC CCCCTCGACC-3′); MIC2tail-a: MIC2sense1 (5′-GCGGCAATTGA -AGAGGGAGAACAGTCCAAGAAAG-3′) and MIC2as (5′-GCCTTAATTAAC -TACTCCATCCACATATCAC-3′); MIC2tail-b: MIC2sense2 (5′-GCGGCAATTG -CGGGTGGCGTCATCGGCG-3′) and MIC2as (5′-GCCTTAATTAACTACTC -CATCCACATATCAC-3′). See also alignment in Fig. 5B.

Plaque assayThe plaque assay was performed as described previously (Roos et al., 1994).Monolayers of HFF, grown in six-well plates, were infected with 50-100 tachyzoitesper well. After 1 week of incubation at normal growth conditions (37°C, 5% CO2),cells were fixed for 10 minutes with –20°C methanol 100%, dyed with Giemsa stainfor 10 minutes and washed once with PBS. Documentation was performed with aNikon SMZ 1500 binocular at 70-fold magnification.

Invasion assayMonolayers of HFFs, grown in 24-well plates on glass slides, were infected with 107

parasites/well and incubated for 5, 10, 20 or 60 minutes, or overnight, at 37°C.Subsequently, infected cells were washed four times with PBS and incubated for 12hours in fresh medium before fixation and indirect immunofluorescence. Data werecompiled from more than three independent experiments each from counting six fieldsof view per clone at 1000� total magnification with a Leica DMIL microscope(Type:090-135-002 I/05).

Attachment assayAttachment assays were performed as described previously (Huynh et al., 2003).Monolayers of HFFs, grown in 24-well plates on glass slides, were washed threetimes in PBS (containing 1 mM CaCl2 and 1 mM MgCl2) and fixed with PBScontaining 2% glutaraldehyde for 5 minutes at 4°C. After three washing steps withPBS, cells were blocked with 0.16 M ethanolamine for 24 hours at 4°C. Subsequentlyto another washing step with PBS, 107 parasites were loaded on each well and allowedto attach for 15 minutes at 37°C and rinsed three times with PBS before counting.For each experiment, six fields of view at 400� total magnification were analysedwith a Leica DMIL microscope (Type: 090-135-002 I/05).

Analysis of microneme secretionFor preparation of excretory-secretory antigens (ESA), approximately 108 tachyzoiteswere washed and resuspended in 1 ml of HHE, stimulated to discharge micronemesby addition of ethanol to a final concentration of 1.0% and incubated at 37°C for 30minutes, as described previously (Carruthers et al., 1999). Cells were removed bycentrifugation at 2000 g and the supernatant and pellet were analysed on immunoblot.

Analysis of moving-junction formationAnalysis of evacuoles was performed as described previously (Hakansson et al., 2001).Freshly released parasites were incubated in Endo buffer [44.7 mM K2SO4, 10 mMMg2SO4, 106 mM sucrose, 5 mM glucose, 20 mM Tris, 0.35% (wt/vol) BSA, pH8.2] containing 1 μM CD for 10 minutes at room temperature, before adding themon confluent layers of HFFs. 3�106 parasites were added per well and kept for 3minutes at room temperature. After 20 minutes incubation at 37°C, medium wasreplaced with pre-warmed Hanks/HEPES/1% FCS/1 μM CD media and incubatedfor 15 minutes at 37°C. After two washing steps with PBS, the cells were fixed withmethanol at –20°C for 10 minutes before the immunofluorescence assay wasperformed.

Analysis of RON4 secretion was performed as above with modifications, employingGFP-expressing parasites to distinguish intact parasites from disrupted parasites. Afterincubation in the presence or absence of CD, parasites were fixed with 4%paraformaldehyde and immunofluorescence analysis was done withoutpermeabilisation of parasites to distinguish between secreted and non-secretedRON4. Equal numbers of GFP-positive parasites (~200) were analysed for RON4secretion per experiment.

Live video microscopy gliding assayGlass slides in a 24-well plate were coated with PBS including 50% FCS for 24hours at 4°C. The glass slides were washed once with PBS before adding 106 parasitesin a total volume of 300 μl pre-warmed Hank’s medium containing 20 mM HEPESand 1 mM EGTA. The parasites were then imaged (37°C/5% CO2) using an invertedZeiss microscope (Axiovert 200 M with incubator XL-3 and CO2 control) using 16�magnification (objective 10�, Optovar 1.6�) and differential interference contrast(DIC). Videos were captured at one frame per 3 seconds using Axiovision AxioVs40V 4.6.3.0 software and the type of gliding/movement was counted by observing everyindividual parasite. On average, 447 parasites/movie (101-1052 parasites/movie) weremonitored and enumerated for all strains. Using ImageJ 1.34r software, projectionsof the standard deviation and of the maximum of the fluorescent intensity betweenframes revealed motility patterns over a 5-minute period.

Immunofluorescence and immunoblotAll manipulations were carried out at room temperature if not mentioned otherwise.Tachyzoite-infected HFF cells on glass coverslips were fixed with 4% formaldehydein PBS for 20 minutes. Fixed cells were permeabilised with 0.2% Triton X-100 in

Jour

nal o

f Cel

l Sci

ence

956

PBS for 20 minutes and blocked in 3% bovine serum albumin in PBS for 20 minutes.The cells were then stained with the primary antibodies, as indicated in the text, for1 hour followed by Alexa-Fluor-594-conjugated goat anti-rabbit or Alexa-Fluor-488-conjugated goat anti-mouse antibodies (Molecular Probes). Images were taken usingZeiss (Axiovert 200M) and processed using ImageJ 1.34r software.

SDS page was performed as described previously (Laemmli, 1970). Freshlyegressed parasites were harvested by centrifugation at 300 g for 10 minutes and lysedin RIPA buffer (150 mM NaCl 1% Triton X-100, 0.5% DOC, 0.1% SDS, 50 mMTris, pH 8.0, 1 mM EDTA). Equal numbers of parasites were applied per line on a10% polyacrylamide gel. Transfer to nitrocellulose and immunoblot analysis wasperformed as described previously (Reiss et al., 2001).

The following previously described primary antibodies have been used in theseanalysis: α-MIC2 (6D10) (Wan et al., 1997), α-MI3 (T82C10) (Garcia-Reguet et al.,2000), α-Ron4 (t5 4H1) (Lebrun et al., 2005), α-RON4 (Alexander et al., 2006), α-MIC6 (Reiss et al., 2001), α-MIC8Nt (Meissner et al., 2002a) and α-Rop2,3,4 (T34A7) (Sadak et al., 1988).

Sequence analysis of micronemal proteinsDNA and predicted proteins homologous to MIC8 were identified using the BLASTprogramme provided at ToxoDB (http:/ToxoDB.org). Multiple sequence alignmentswere performed with the help of ClustalW. Expression of MIC8, MIC8-like1 andMIC8-like2 was confirmed by RT-PCR (Titan one tube RT-PCR; Roche) on mRNA(isolated with mRNAeasy; Biochain) using oligonucleotide pairs MIC8-s (5′-GCGGCAATTGCATTGGTGGTTGTGG-3′), MIC8as (5′-GCCTTAATTA AGA -CGCGATACCGCCCGAAGG-3′), MIC8/2-s (5′-GCGGCAATTGGACTG GCA -ACGGGAGCC-3′), MIC8/2-as (5′-GCCTTAATTAATTATGACCACATTGAG -CCTG-3′), MIC8/3-s (5′-GGCCAATTGCCGGCTGCGTTGTCGGC-3′), MIC8/3-as (5′-GTGTTGTCGCCTTCTCGC-3′), Tub-s (5′-GGAGCTCTTCTGCCTG -GAACATGGTATC-3′) and Tub-as (5′-AGAGTGAGTGGAAAG GACGGAGT -TGTACG-3′).

We are indebted to John Boothroyd, David Sibley, Vern Carruthers,Gary Ward, Jean-Francois Dubremetz and Maryse Lebrun for sharingreagents and helpful discussions. We thank Petra Rohrbach, VernCarruthers and Kai Matuschewski for helpful discussions and criticalcomments on the manuscript. This work was funded by the SFB544of the German research foundation (DFG) and the ‘Biofuture-Programm’ of the German Ministry of Science and Education (BMBF).

ReferencesAlexander, D. L., Mital, J., Ward, G. E., Bradley, P. and Boothroyd, J. C. (2005).

Identification of the moving junction complex of Toxoplasma gondii: a collaborationbetween distinct secretory organelles. PLoS Pathog. 1, e17.

Alexander, D. L., Arastu-Kapur, S., Dubremetz, J. F. and Boothroyd, J. C. (2006).Plasmodium falciparum AMA1 binds a rhoptry neck protein homologous to TgRON4,a component of the moving junction in Toxoplasma gondii. Eukaryotic Cell 5, 1169-1173.

Black, M. W., Arrizabalaga, G. and Boothroyd, J. C. (2000). Ionophore-resistant mutantsof Toxoplasma gondii reveal host cell permeabilization as an early event in egress. Mol.Cell. Biol. 20, 9399-9408.

Boothroyd, J. C. and Dubremetz, J. F. (2008). Kiss and spit: the dual roles of Toxoplasmarhoptries. Nat. Rev. Microbiol. 6, 79-88.

Bradley, P. J., Ward, C., Cheng, S. J., Alexander, D. L., Coller, S., Coombs, G. H.,Dunn, J. D., Ferguson, D. J., Sanderson, S. J., Wastling, J. M. et al. (2005). Proteomicanalysis of rhoptry organelles reveals many novel constituents for host-parasiteinteractions in Toxoplasma gondii. J. Biol. Chem. 280, 34245-34258.

Brossier, F., Jewett, T. J., Lovett, J. L. and Sibley, L. D. (2003). C-terminal processingof the toxoplasma protein MIC2 is essential for invasion into host cells. J. Biol. Chem.278, 6229-6234.

Buscaglia, C. A., Coppens, I., Hol, W. G. and Nussenzweig, V. (2003). Sites of interactionbetween aldolase and thrombospondin-related anonymous protein in plasmodium. Mol.Biol. Cell 14, 4947-4957.

Carruthers, V. and Boothroyd, J. C. (2006). Pulling together: an integrated model ofToxoplasma cell invasion. Curr. Opin. Microbiol. 10, 83-89.

Carruthers, V. B., Giddings, O. K. and Sibley, L. D. (1999). Secretion of micronemalproteins is associated with toxoplasma invasion of host cells. Cell. Microbiol. 1, 225-235.

Cerede, O., Dubremetz, J. F., Bout, D. and Lebrun, M. (2002). The Toxoplasma gondiiprotein MIC3 requires pro-peptide cleavage and dimerization to function as adhesin.EMBO J. 21, 2526-2536.

Cerede, O., Dubremetz, J. F., Soete, M., Deslee, D., Vial, H., Bout, D. and Lebrun, M.(2005). Synergistic role of micronemal proteins in Toxoplasma gondii virulence. J. Exp.Med. 201, 453-463.

Donald, R. G. K. and Roos, D. S. (1993). Stable molecular transformation of Toxoplasmagondii: a selectable markerDHFR-TS marker based on drug resistance mutations inmalaria. Proc. Natl. Acad. Sci. USA 90, 11703-11707.

Garcia-Reguet, N., Lebrun, M., Fourmaux, M. N., Mercereau-Puijalon, O., Mann, T.,Beckers, C. J., Samyn, B., Van Beeumen, J., Bout, D. and Dubremetz, J. F. (2000).The microneme protein MIC3 of Toxoplasma gondii is a secretory adhesin that bindsto both the surface of the host cells and the surface of the parasite. Cell. Microbiol. 2,353-364.

Hakansson, S., Morisaki, H., Heuser, J. and Sibley, L. D. (1999). Time-lapse videomicroscopy of gliding motility in Toxoplasma gondii reveals a novel, biphasic mechanismof cell locomotion. Mol. Biol. Cell 10, 3539-3547.

Hakansson, S., Charron, A. J. and Sibley, L. D. (2001). Toxoplasma evacuoles: a two-step process of secretion and fusion forms the parasitophorous vacuole. EMBO J. 20,3132-3144.

Harper, J. M., Huynh, M. H., Coppens, I., Parussini, F., Moreno, S. and Carruthers,V. B. (2006). A cleavable propeptide influences Toxoplasma infection by facilitating thetrafficking and secretion of the TgMIC2-M2AP invasion complex. Mol. Biol. Cell 17,4551-4563.

Herm-Gotz, A., Agop-Nersesian, C., Munter, S., Grimley, J. S., Wandless, T. J.,Frischknecht, F. and Meissner, M. (2007). Rapid control of protein level in theapicomplexan Toxoplasma gondii. Nat. Methods 4, 1003-1005.

Hoff, E. F. and Carruthers, V. B. (2002). Is Toxoplasma egress the first step in invasion?Trends Parasitol. 18, 251-255.

Huynh, M. H. and Carruthers, V. B. (2006). Toxoplasma MIC2 is a major determinantof invasion and virulence. PLoS Pathog. 2, e84.

Huynh, M. H., Rabenau, K. E., Harper, J. M., Beatty, W. L., Sibley, L. D. andCarruthers, V. B. (2003). Rapid invasion of host cells by Toxoplasma requires secretionof the MIC2-M2AP adhesive protein complex. EMBO J. 22, 2082-2090.

Jewett, T. J. and Sibley, C. H. (2003). Aldolase forms a bridge between cell surface adhesinsand the actin cytoskeleton in apicomplexan parasites. Mol. Cell 11, 885-894.

Kim, K., Soldati, D. and Boothroyd, J. C. (1993). Gene replacement in Toxoplasma gondiiwith chloramphenicol acetyltransferase as selectable marker. Science 262, 911-914.

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the headof bacterophage T4. Nature 227, 680-685.

Lebrun, M., Michelin, A., El Hajj, H., Poncet, J., Bradley, P. J., Vial, H. and Dubremetz,J. F. (2005). The rhoptry neck protein RON4 re-localizes at the moving junction duringToxoplasma gondii invasion. Cell. Microbiol. 7, 1823-1833.

Li, S. S. (2005). Specificity and versatility of SH3 and other proline-recognition domains:structural basis and implications for cellular signal transduction. Biochem. J. 390, 641-653.

Meissner, M., Brecht, S., Bujard, H. and Soldati, D. (2001). Modulation of myosin Aexpression by a newly established tetracycline repressor-based inducible system inToxoplasma gondii. Nucleic Acids Res. 29, E115.

Meissner, M., Reiss, M., Viebig, N., Carruthers, V. B., Toursel, C., Tomavo, S., Ajioka,J. W. and Soldati, D. (2002a). A family of transmembrane microneme proteins ofToxoplasma gondii contain EGF-like domains and function as escorters. J. Cell Sci. 115,563-574.

Meissner, M., Schluter, D. and Soldati, D. (2002b). Role of Toxoplasma gondii myosinA in powering parasite gliding and host cell invasion. Science 298, 837-840.

Meissner, M., Agop-Nersesian, C. and Sullivan, W. J., Jr (2007). Molecular tools foranalysis of gene function in parasitic microorganisms. Appl. Microbiol. Biotechnol. 75,963-975.

Mital, J., Meissner, M., Soldati, D. and Ward, G. E. (2005). Conditional expression ofToxoplasma gondii apical membrane antigen-1 (TgAMA1) demonstrates that TgAMA1plays a critical role in host cell invasion. Mol. Biol. Cell 16, 4341-4349.

Pfluger, S. L., Goodson, H. V., Moran, J. M., Ruggiero, C. J., Ye, X., Emmons, K. M.and Hager, K. M. (2005). Receptor for retrograde transport in the apicomplexan parasiteToxoplasma gondii. Eukaryotic Cell 4, 432-442.

Rabenau, K. E., Sohrabi, A., Tripathy, A., Reitter, A., Ajioka, J. W., Tomley, F. M.and Carruthers, V. B. (2001). TgM2AP participates in Toxoplasma gondii invasion ofhost cells and is tightly associated with the adhesive protein TgMIC2. Mol. Microbiol.41, 1-12.

Reiss, M., Viebig, N., Brecht, S., Fourmaux, M. N., Soete, M., Di Cristina, M.,Dubremetz, J. F. and Soldati, D. (2001). Identification and characterisation of anEscorter for two secretory adhesins in Toxoplasma gondii. J. Cell Biol. 152, 563-578.

Roos, D. S., Donald, R. G., Morrissette, N. S. and Moulton, A. L. (1994). Moleculartools for genetic dissection of the protozoan parasite Toxoplasma gondii. Methods CellBiol. 45, 27-63.

Sadak, A., Taghy, Z., Fortier, B. and Dubremetz, J. F. (1988). Characterization of afamily of rhoptry proteins of Toxoplasma gondii. Mol. Biochem. Parasitol. 29, 203-211.

Soldati, D. and Boothroyd, J. C. (1995). A selector of transcription initiation in theprotozoan parasite Toxoplasma gondii. Mol. Cell. Biol. 15, 87-93.

Soldati, D. and Meissner, M. (2004). Toxoplasma as a novel system for motility. Curr.Opin. Cell Biol. 16, 32-40.

Starnes, G. L., Jewett, T. J., Carruthers, V. B. and Sibley, L. D. (2006). Two separate,conserved acidic amino acid domains within the Toxoplasma gondii microneme protein2 cytoplasmic tail are required for parasite survival. J. Biol. Chem. 281, 30745-30754.

Sultan, A. A., Thathy, V., Frevert, U., Robson, K. J., Crisanti, A., Nussenzweig, V.,Nussenzweig, R. S. and Menard, R. (1997). TRAP is necessary for gliding motilityand infectivity of plasmodium sporozoites. Cell 90, 511-522.

Wan, K. L., Carruthers, V. B., Sibley, L. D. and Ajioka, J. W. (1997). Molecularcharacterisation of an expressed sequence tag locus of Toxoplasma gondii encoding themicronemal protein MIC2. Mol. Biochem. Parasitol. 84, 203-214.

Journal of Cell Science 121 (7)

Jour

nal o

f Cel

l Sci

ence