6971

Abstract. – OBJECTIVE: The aim of the study is to detect the effect of miR-126 in autophagy after acute myocardial infarction (AMI).

MATERIALS AND METHODS: First, the changes of miR-126 and autophagy in myocar-dial infarction tissue and normal heart tissue were compared by establishing the myocardi-al infarction rat model, so as to clarify the relationship between miR-126 and changes of myocardial infarction and autophagy. Second, the regulation of miR-126 on autophagy relat-ed protein Beclin-1 and the role in myocardial infarction were studied to clarify whether miR-126 regulates autophagy through Beclin-1 and participates in the occurrence and development of myocardial infarction. Finally, the relationship between plasma miR-126 was observed.

RESULTS: MiR-126 expression can regulate Beclin-1 expression and influence the cardiac function after AMI. The results are of great sig-nificance to reveal the new mechanism of myo-cardial infarction.

CONCLUSIONS: The down-regulation of miR-126 will lead to the over-activation of myocardial auto-phagy induced by Beclin-1, which is an autophagy related protein. The plasm expression of miR-126 may be a clinical marker of autophagy after AMI.

Key Words:MiR-126, Autophagy, AMI.

Introduction

Acute myocardial infarction is myocardial ne-crosis caused by acute and persistent ischemia and hypoxia of coronary artery1,2. The disease is com-mon and its incidence has been on the rise in Chi-na in recent years2. Therefore, it is very important to find new ways to treat or detect it3,4. We know that cell death pathways are divided into two types including nonprogrammed cell death, namely ne-crosis, and programmed cell death5 (programmed death or apoptosis, autophagy, sequential cell death, and other programmed death). Excessive autopha-

gy can lead to cell death6. Autophagic programmed cell death is caused by autophagy overactivation without Caspase7. Autophagy is an important way of protein degradation in eukaryotic cells, whose function is mainly to remove and degrade dam-aged cell structures, aging organelles, and redun-dant biological macromolecules8,9. Meanwhile, it also provides raw materials for the construction of intracellular organelles, namely, the recycling of cell structures10. Autophagy is an important regu-latory mechanism for the growth, differentiation, executive function, and death of eukaryotic cells11. It is related to many physiological and pathological processes of cells, including tumors, degenerative diseases, and other human diseases. The role of au-tophagy in cardiovascular disease has attracted in-creasing attention. The pathological process of var-ious cardiovascular diseases is accompanied by the change of autophagy activity of the cardiovascular system. Different levels of autophagy have differ-ent roles in cardiovascular diseases, which play different roles in different stages of diseases12,13.

MicroRNAs can regulate target genes and play roles in the occurrence and development of dis-eases. Currently, more than 18,000 microRNAs have been reported. MicroRNAs have many func-tions, such as regulating cell development, differ-entiation, aging and so on, and they are involved in the occurrence and development of various dis-eases, especially in cardiovascular diseases14. As an important regulatory molecule, microRNAs affect the process of diseases15.

Materials and Methods

Cell CultureThe H9c2 cells (Cell Culture Center, Shang-

hai, China) were cultured with Dulbecco’s Modi-fied Eagle’s Medium (DMEM; Gibco, Rockville, MD, USA), 10% fetal bovine serum (FBS; Gibco,

European Review for Medical and Pharmacological Sciences 2020; 24: 6971-6979

C.-C. SHI1, L.-Y. PAN2, Z.-Y. PENG3, J.-G. LI3

1Department of Intensive Care Unit, Henan Provincial People’s Hospital, Zhengzhou, China2Department of Physiology, Henan Health Cadre College, Zhengzhou, China3Department of Intensive Care Unit, Zhongnan Hospital of Wuhan University, Wuhan, China

Corresponding Author: Jianguo Li, MM; e-mail: lijianguo1817@163.com

MiR-126 regulated myocardial autophagyon myocardial infarction

C.-C. Shi, L.-Y. Pan, Z.-Y. Peng, J.-G. Li

6972

Rockville, MD, USA) and 1% penicillin and strep-tomycin. H9C2 cells were cultured in a humidified chamber at 37°C, and supplied with 5% CO2.

Transfection

When 50% of myocardial cells were fused, they were transfected using the Lipofectamine® RNAiMAX Transfection Reagent (Shanghai Jik-ai Gene Chemical Technology, Shanghai, China), specifically as follows: 150 μL Opti-MEM was added into two Eppendorf (EP) tubes, and 9 μL of Lipofectamine® RNAiMAX reagent was added into one 150 μL Opti-MEM and beaten. Mean-while, 3 μL microRNA-126 mimic/inhibitor/NC was added into another 150 μL Opti-MEM and beaten. The two tubes were mixed with Opti-MEM with RNAiMAX Reagent and miRNA-126 mim-ic/inhibitor/NC, respectively. After 5 min of in-cubation at room temperature, the mixture (a to-tal of 300 μL) was added into 1.5 ml of medium, inoculated into a 6-well plate, and cultured in a cell culture box for 2 days. Beclin-1-specific siR-NA (Shanghai Jikai Gene Chemical Technology, Shanghai, China) was used for lentivirus infec-tion (4x105 cardiomyocytes were given 20 μL vi-rus) and polybrene. Beclin-1 overexpression vec-tor (Shanghai Jikai Gene Chemical Technology, Shanghai, China) was transfected with Lipofect-amine™ LTX and PLUS Reagents (Shanghai Jik-ai Gene Chemical Technology, Shanghai, China).

Flow CytometryThe medium was discarded and the cells were

washed with phosphate-buffered saline (PBS) twice x 5 min. MDC was dissolved to 50 ul with DMEM, and added into cells and cultured in 37°C, 5% CO2 in the dark for 60 min. After MDC was abandoned, the cells were washed with PBS for 3 times x 5 min at room temperature. After PBS was abandoned, 500 ul of trypsin containing 0.25% eth-ylenediaminetetraacetic acid (EDTA) was added to each well (six-well plate) and cultured in 37°C, 5%CO2 in the dark for 5 min to shed cells. The di-gested cells were transferred to 167 μL of newborn bovine serum to neutralize trypsin. Serum was centrifuged at 1200 rpm for 5 min, and the cells were resuspended with 400 μL PBS solution, fol-lowed by observation using the Kaluza analysis software (355 nm excitation, 525 nm emission).

Animal ExperimentSPF SD rats (Wuhan University Animal Center,

Wuhan, China) weighing 250 g ± 7.2 g were used. They were randomly divided into two groups:

Sham group (n = 6) and AMI group (n = 6). 8 h be-fore molding, the rats were deprived of water. Af-ter anesthesia via intraperitoneal injection of 10% chloral hydrate with a concentration of 0.3 mL/100 g, the muscle was separated layer by layer, and the left anterior descending branch was ligated. After operation, 5% ampicillin was intramuscularly in-jected (1 mL/kg/d) for 3 days to prevent infection. This study was approved by Animal Ethics Com-mittee of Henan Provincial People’s Hospital.

EchocardiographyAfter modeling, the rats were fed conventional-

ly until weighing at 4 weeks after surgery. After in-traperitoneal injection of 10% chloral hydrate (0.3 mL/100 g), the rats were fixed, the chest and abdo-men hairs were shaved, and the L15-7io high-fre-quency array probe was used to detect the heart and abdominal aorta. Two-dimensional echocardi-ography was used to detect the parameters of left ventricular end-systolic diameter (LVSD), left ven-tricular end-diastolic diameter (LVED), and left ventricular ejection fraction (LVEF) in rats.

HE StainingFirst, the rat myocardial tissues were fixed with

4% formaldehyde (Wuhan University, Wuhan, Chi-na) for 24 h and then flushed with running water for 30 min, followed by transparentization via xylene, immersion in wax and embedding. After action with 100%, 95%, 85%, and 70% alcohol for 5 min, the sec-tions were stained with the hematoxylin dye solution for 5-10 min and with 0.1-0.5% eosin dye for 1 min, followed by observation under an optical microscope.

Masson StainingMasson Staining solution (Jiancheng, Nanjing,

China) was used for 5-10 min, and the tablets were immersed in 2% glacial acetic acid solution. 1% mo-lybdate aqueous solution was differentiated for 3-5 min. Sections were stained with Aniline blue for 5 min and then were washed with 0.2% glacial ace-tic acid solution for 3 min. Xylene was transparent (twice) for a total of about 10 min. By wiping off the excess xylene around the slice, quickly add an appropriate amount of neutral gum, and then cap the slide cementing. Using optical microscope, and the results were analyzed with image pro software.

RT-PCR (Quantitative Reverse-Transcription Polymerase Chain Reaction)

The expression of mir-126 was detected by the TRIzol method (Invitrogen, Carlsbad, CA, USA).

The effect of miR-126 on autophagy in AMI

6973

RNA was extracted from tissues and then reverse transcription RNA was used to obtain cDNA (ac-cording to the instruction manual). The reaction system was prepared according to the instruc-tions and pre-denaturated at 94°C for 30 s. De-naturation at 94°C for 5 s, annealing at 60°C for 15 s, extension at 72°C for 10 s, and amplification for 45 cycles were conducted. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was served as an internal reference. The corresponding ΔΔCt values in each group of cells were calculated, and the quantitative analysis was performed based on the quantitative amount of the target factor (2-

ΔΔCt). All the primers were listed in Table I.

Western BlotSodium dodecyl sulphate (SDS) gel with 10-

12% concentration was prepared according to the size of target protein (10% for GAPDH and Beclin-1, 15% for LC3). The gel was put into the electrophoresis tank, and the upper and lower tanks were added into the electrophoresis buffer. The prepared samples were thoroughly mixed and the sample was filled with 50 ul of protein. 150 V electrophoresis for 1 h. After electrophoresis, poly-vinylidene difluoride (PVDF) film (Roche, Basel, Switzerland) was immersed in methanol for 15 min. Then we took out the membrane and washed it with 1×Tris-Buffered Saline (TBS) for 5 min × 3 times. Then, the sealing liquid was added onto the membrane at room temperature for 1 h. After dis-carding the sealing fluid, the primary antibody was added at 4°C overnight. Then, the membrane was washed with Tris-Buffered Saline and Tween-20 (TBST) at room temperature for 5 min×4 times. After TBST was discarded, the protein was incu-bated with horseradish peroxidase (HRP)-labeled secondary antibodies. Then, the film was washed with TBST solution for 5 min×3 times, followed by color development using enhanced chemilu-minescence (ECL) luminescent solution and film exposure. Each experiment was repeated three times. The gray analysis of the strip GAPDH was used as the reference. Specific antibodies includ-

ing Beclin-1(Abcam, Cambridge, MA, USA, Rab-bit, 1:1000), LC3 (Abcam, Cambridge, MA, USA, Rabbit, 1:2000) and GAPDH (Proteintech, Rose-mont, IL, USA 1:5000) were used.

Luciferase Reporter AnalysisMiR-126 overexpression was co-transfected

with reporter gene plasmids: 293T culture was performed on 24-well plates. 48 h later, lentivirus containing miR-126 mimics was infected [4 x 105

cells with 20 μL virus (109 TU/mL) and polybrene (final concentration 5 mg/mL)], Luciferase activi-ty was detected on day 5.

Statistical AnalysisThe data are expressed as mean ± standard

deviation. The Shapiro-Wilk test is used to de-termine whether the distribution is normal. For comparison between two groups of measurement data, Student’s t-test is used for normally distrib-uted data. Comparison between multiple groups was done using One-way ANOVA test followed by Post-Hoc Test (Least Significant Difference). p<0.05 was considered statistically significant. SPSS 19.0 software (IBM, Armonk, NY, USA) was used for statistical analysis.

Results

Changes of Cardiac Autophagy and MiR-126 after Myocardial Infarction in Rats

On the 7th day after myocardial infarction, the rats were given echocardiography. (Figure 1A).After HE staining, cardiomyocytes in the control group showed normal morphology and no edema, while cardiomyocytes in the AMI group showed significant morphological changes with evident structural damage, cell edema and interstitial fi-brosis (Figure 1B). We used Masson staining to analyze the features of myocardial tissues. The re-sults showed changes of cell shape and lining in the rat myocardium after AMI. Compared with the

Table I. Real time PCR primers.

RT-PCR, quantitative reverse-transcription polymerase chain reaction.

Gene name Forward (5'>3') Reverse (5'>3')

miR-126 CAUUAUUACUUUUGGUACGCGCTCGC CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAU6 TTCGGCAGCACA AACGCTTCACGAATTTGCGTBeclin-1 CCATCATGGATCCACGCATA CTAGCTAGTGTCTCCTGGGGTGA GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC

C.-C. Shi, L.-Y. Pan, Z.-Y. Peng, J.-G. Li

6974

control group, myocardial fibrosis and collagen ag-gregation were evident in the AMI group (Figure 1C). The use of RT-PCR to detect the expression of miR-126 in the 2 groups and the result showed that in AMI group the expression of miR-126 decreased dramatically (Figure 1D). We also detected the ex-pression of Beclin-1 protein in the border zone us-ing Western blot. Beclin-1 protein expression was

found upregulated in AMI group, and the expres-sion of LC3 II/I also increased (Figure 1E and 1F).

Beclin-1 Induced Autophagy After HypoxiaThe detection results of autophagy level of

cardiomyocytes showed that with Beclin-1 inhi-bition, the autophagy level of cardiomyocytes was correspondingly inhibited. Beclin-1 inhibitor in-

Figure 1. Changes of cardiac autophagy and miR-126 after myocardial infarction in rats. A, Representative photographs in rat echocardiography. B, H&E staining of Sham and AMI groups (magnification, x400). C, Masson staining of Sham and AMI groups (magnification, x400). D, RT-PCR detect the relative expression of miR-126. E-F, Western blot bands of Beclin-1 and LC3 II/I in sham and AMI group. H&E, hematoxylin and eosin; AMI, acute myocardial infarction, (“*” indicates statistical difference from the control group p<0.05, “#” p<0.05 vs. hypoxia group).

A

C

E

B

D

F

The effect of miR-126 on autophagy in AMI

6975

duced the expression of Beclin-1in myocardium down-regulated compared with hypoxia group (Figure 2A). The expression of Beclin-1 was also decreased by WB in the hypoxia + siRNA group compared with hypoxia group (Figure 2B), and the autophagy rate of cardiomyocytes by flow cy-tometry with MDC staining was also decreased (Figure 2C and 2D). After Beclin-1 was down-reg-ulated, the autophagy rate of cardiomyocytes was significantly decreased. All these results showed that silencing Beclin-1 expression in cardiomyo-cytes can inhibit autophagy induced by Beclin-1.

MiR-126 Regulates the Autophagy of Myocardium After Hypoxia

Bioinformatics prediction shows that miR-126 has a sequence that matches Beclin-1, and the tar-

get gene of miR-126 may be Beclin-1. Luciferase activity analysis showed that when transfected with pGL3-Beclin-1 3’-UTR-wild type, lucifer-ase activity in the over-expressed miR-126 group decreased. When transfected with pGL3-Beclin 1 3’-UTR-mutation type, there was no significant difference in luciferase activity in the over-ex-pressed miR-126 group compared with the con-trol group (Figure 3A). Therefore, it was verified that miR-126 targeted Beclin-1 3’-UTR. Com-pared with the control group, Beclin-1 protein expression of the overexpressed miR-126 group decreased (Figure 3B and 3C). The expression of protein LC3 II/ LC3 I in the over-expressed miR-126 group decreased (Figure 3D and 3E). Flow cytometry was used to detect the autophagy rate of cardiomyocytes with MDC staining. Com-

Figure 2. Beclin-1 induced autophagy after hypoxia in H9C2 cells. A, RT-PCR detects the relative expression of Beclin-1in control, hypoxia, hypoxia + siRNA, hypoxia + NC. B, Western blot bands of Beclin-1 in control, hypoxia, hypoxia + siRNA, hypoxia + NC. C-D, Representative images of flow cytometry (“*” p<0.05 vs. control, n = 3, “#” p<0.05 vs. hypoxia group).

A

B

C

D

C.-C. Shi, L.-Y. Pan, Z.-Y. Peng, J.-G. Li

6976

pared with the hypoxia group, the autophagy rate of the overexpressed miR-126 group + hypoxia group significantly decreased (Figure 3F and 3G). All these results can illustrate that miR-126 could regulate myocardial autophagy after hypoxia.

MiR-126 In Plasma and AMIPlasma miR-126 expression of 6 rats in Sham

group and 6 rats in AMI group were detected, and t-test was used for comparison between the two groups. The plasma level of miR-126 in AMI group was 4 times that in Sham group (Figure 4A). Plasma was collected from 10 patients in

the control group and the myocardial infarction group. The result showed that the expression of miR-126 also increased in the AMI group (Fig-ure 4B). The mRNA expression of Beclin-1 dra-matically decreased in the plasma (Figure 4C and 4D). These showed that the plasma level of has-mir-126 is significant in the clinical apply of AMI.

Discussion

The role of autophagy in cardiovascular disease has attracted increasing attention. The patholog-

Figure 3. MiR-126 regulates the autophagy of myocardium after hypoxia. A, Luciferase reporter containing WT or mutant 3′-UTR of Beclin-1 mRNA with miR-126 mimics or NC into HEK293T cells for Dual-Luciferase reporter assay. MiR-126 overexpression significantly decreased the relative Luciferase activity of Beclin-1 mRNA WT 3′-UTR, but did not decrease the relative Luciferase activity of mutant 3′-UTR (“*” p<0.05 vs. Beclin-1-WT+NC, n = 3). B-C, Western blot bands of Beclin-1 in control, hypoxia and hypoxia + miR-126 mimics, hypoxia + NC. D-E, Western blot bands of LC3 II/I in control, hypoxia and hypoxia + miR-126 mimics, hypoxia + NC. F-G, Representative images of flow cytometry (“*” p<0.05 vs. control, n = 3, “#” p<0.05 vs. hypoxia group).

A

D

E F

G

BC

The effect of miR-126 on autophagy in AMI

6977

ical process of various cardiovascular diseases is accompanied by the change of autophagy activi-ty of the cardiovascular system. We found that the expressions of autophagy related proteins Beclin-1, LC3 - II/I rose in heart tissues of AMI rats, indi-cating that Beclin-1 induced increased autophagy in AMI rat heart tissue. The up-regulation of auto-phagy in AMI rat cardiac tissue may be the result of abnormal hemodynamic pressure response. Per-sistent and long-term autophagy can over degrade essential proteins and organelles. Beclin-1 induced autophagy up-regulation is harmful to the body. In this experiment, autophagy was detected by var-ious methods. The protein expression of LC3 II/LC3 I was detected in the tissue samples mentioned above, and flow cytometry was added to detect au-tophagy vesicles, namely, the staining method of Dansylcadaverine (MDC). It has been reported that this is a specific method to detect autophagosomes by analyzing the mechanism at the molecular level. The second ubiquitin-like binding system (Atg8), which is dependent on autophagosome formation, is

a biochemical marker that is specifically bound to MDC on the vesicle membrane of autophagy16. By MDC fluorescence staining, positive chromogenesis of the nuclear perinuclear region can be seen under the fluorescence microscope. Combined detection of Beclin-1 and LC3 II/LC3 I expression and flow cytometry autophagy rate after MDC staining can comprehensively evaluate Beclin-1 induced autoph-agy level. MiRNAs are endogenous (≈22 nucleotide) non-coding RNA molecules17, through complemen-tary binding with the 3’UTR of target gene mRNA, regulate gene expression at a post-transcriptional level, leading to degradation or inhibition of trans-lation. MicroRNAs regulate biological health, dis-eases, including cardiovascular disease. Accord-ing to the bioinformatics software (http://www.targetscan.org), it was found that Beclin 1 may be miR-126 target genes. We observed the relationship between miR-126 and Beclin-1 in cardiomyocytes: the expression of endogenous Beclin-1 mRNA and protein in cardiomyocytes could be inhibited by overexpressing miR-126 in cardiomyocytes, and

Figure 4. Beclin-1 induced autophagy after hypoxia in H9C2 cells. A, RT-PCR detects the relative expression of miR-126 in control, AMI rats’ plasm. (“*” p<0.05 vs. control, n = 6). B, RT-PCR detects the relative expression of miR-126 in control, AMI patients’ plasm. (“*” p<0.05 vs. control, n = 6). C, RT-PCR detects the relative expression of Beclin-1 in control, AMI rats’ plasm, (“*” p<0.05 vs. control, n = 10). D, RT-PCR detects the relative expression of Beclin-1 in control, AMI patients’ plasm. (“*” p<0.05 vs. control, n = 10).

A

C

B

D

C.-C. Shi, L.-Y. Pan, Z.-Y. Peng, J.-G. Li

6978

the expression of endogenous Beclin-1 mRNA and protein in cardiomyocytes could be up-regulated by inhibiting the level of miR-126 in cardiomyocytes. Moreover, the luciferase reporter system proved that Beclin-1 was the target gene of miR-126. MiR-126 may act as a diagnostic marker for AMI patients. In 2008, Mitchell et al18 first reported that miRNAs were very stable in human plasma. This is because the miRNA in plasma is wrapped in “exosomes”. Exosomes are small particles of 50-90 nm and are abundant in plasma19. Clinically, it is difficult to obtain living heart specimens. Information on the

pathophysiological process of heart disease can be obtained by analyzing the level of miRNA in the pe-ripheral blood of patients. Therefore, studies on the diagnosis of cardiovascular diseases by circulating blood miRNA have been reported2,5. We hypothe-size that supplementation of exogenous miR-126 may improve the symptoms of AMI patients. If so, this will give us a new way to intervene in myocar-dial infarction. From all results, our data showed that overexpression of miR-126 can protect cardio function by reducing cardiomyocyte autophagy and preserving cardiac function after AMI, and the plas-ma miR-126 may be as a clinical marker (Figure 5).

Conclusions

The down-regulation of miR-126 will lead to the over-activation of myocardial autophagy induced by Beclin-1, which is an autophagy related protein.

Conflict of InterestsThe authors declare that they have no conflict of interests.

References

1) Aguero F, MArrugAt J, elosuA r, sAlA J, MAsiA r, rAMos r, grAu M. New myocardial infarction defi-nition affects incidence, mortality, hospitalization rates and prognosis. Eur J Prev Cardiol 2015; 22: 1272-1280.

2) Zheng hF, sun J, Zou ZY, ZhAng Y, hou gY. MiRNA-488-3p suppresses acute myocardial infarction-induced cardiomyocyte apoptosis via targeting ZNF791. Eur Rev Med Pharmacol Sci 2019; 23: 4932-4939.

3) Zhu h, tAnnous P, Johnstone Jl, Kong Y, shelton JM, richArdson JA, le V, leVine B, rotherMel BA, hill JA. Cardiac autophagy is a maladaptive response to hemodynamic stress. J Clin Invest 2007; 117: 1782-1793.

4) ZhAng Y, liu d, hu h, ZhAng P, Xie r, cui W. HIF-1alpha/BNIP3 signaling pathway-in-duced-autophagy plays protective role during myocardial ischemia-reperfusion injury. Biomed Pharmacother 2019; 120: 109464.

5) Xing r, liu d, cheng X, tiAn X, YAn c, hAn Y. MiR-207 inhibits autophagy and promotes apoptosis of cardiomyocytes by directly targeting LAMP2 in type 2 diabetic cardiomyopathy. Biochem Bio-phys Res Commun 2019; 520: 27-34.

6) WAng l, ning n, WAng c, hou X, YuAn Y, ren Y, sun c, YAn Z, WAng X, liu h. Endoplasmic reticulum stress contributed to β1-adrenoceptor autoantibody-induced reduction of autophagy

Figure 5. Proposed mechanism of circFndc3b mediated cardiac repair. MiR-126 therapy increases miR-126 levels in the post-MI heart leading to its interaction with Beclin-1, which impacts autophagy signaling. This preserves post-MI cardiac function.

The effect of miR-126 on autophagy in AMI

6979

in cardiomyocytes. Acta Biochim Biophys Sin (Shanghai) 2019; 51: 1016-1025.

7) Qu X, chen X, shi Q, WAng X, WAng d, YAng l. Resveratrol alleviates ischemia/reperfusion inju-ry of diabetic myocardium via inducing autopha-gy. Exp Ther Med 2019; 18: 2719-2725.

8) Nishida K, Otsu K. Autophagy during cardiac remodeling. J Mol Cell Cardiol 2016; 95: 11-18.

9) linton PJ, gurneY M, sengstocK d, MentZer rJ, gottlieB rA. This old heart: cardiac aging and autophagy. J Mol Cell Cardiol 2015; 83: 44-54.

10) VerheYe s, MArtinet W, KocKX MM, KnAAPen MW, sAlu K, tiMMerMAns JP, ellis Jt, KilPAtricK dl, de MeYer gr. Selective clearance of macrophages in atherosclerotic plaques by autophagy. J Am Coll Cardiol 2007; 49: 706-715.

11) nAKAi A, YAMAguchi o, tAKedA t, higuchi Y, hiKoso s, tAniiKe M, oMiYA s, MiZote i, MAtsuMurA Y, AsAhi M, nishidA K, hori M, MiZushiMA n, otsu K. The role of autophagy in cardiomyocytes in the basal state and in response to hemodynamic stress. Nat Med 2007; 13: 619-624.

12) sAlA-MercAdo JA, Wider J, undYAlA VV, JAhAniA s, Yoo W, MentZer rJ, gottlieB rA, PrZYKlenK K. Profound cardioprotection with chloramphenicol succinate in the swine model of myocardial isch-emia-reperfusion injury. Circulation 2010; 122: S179-S184.

13) cAo dJ, gillette tg, hill JA. Cardiomyocyte autophagy: remodeling, repairing, and recon-structing the heart. Curr Hypertens Rep 2009; 11: 406-411.

14) Zhong g, long h, MA s, shunhAn Y, li J, YAo J. miRNA-335-5p relieves chondrocyte inflamma-tion by activating autophagy in osteoarthritis. Life Sci 2019; 226: 164-172.

15) shAng J, chen ZZ, WAng Zh, Wei tn, Wu WB, chen WM. [Association of miRNA-196b-5p and miRNA-99a-5p with autophagy and apoptosis in multiple myeloma cells]. Zhonghua Xue Ye Xue Za Zhi 2018; 39: 766-772.

16) MAchAriA MW, tAn W, dAs PP, nAQVi ni, Wong sM. Proximity-dependent biotinylation screening identifies NbHYPK as a novel interacting partner of ATG8 in plants. BMC Plant Biol 2019; 19: 326.

17) tAn X, Qin W, ZhAng l, hAng J, li B, ZhAng c, WAn J, Zhou F, shAo K, sun Y, Wu J, ZhAng X, Qiu B, li n, shi s, Feng X, ZhAo s, WAng Z, ZhAo X, chen Z, Mitchelson K, cheng J, guo Y, he J. A 5-microR-NA signature for lung squamous cell carcinoma diagnosis and hsa-miR-31 for prognosis. Clin Cancer Res 2011; 17: 6802-6811.

18) Mitchell Ps, PArKin rK, Kroh eM, FritZ Br, WYMAn sK, PogosoVA-AgAdJAnYAn el, Peterson A, note-BooM J, o’BriAnt Kc, Allen A, lin dW, urBAn n, drescher cW, Knudsen Bs, stireWAlt dl, gentleMAn r, VessellA rl, nelson Ps, MArtin dB, teWAri M. Circulating microRNAs as stable blood-based markers for cancer detection. Proc Natl Acad Sci U S A 2008; 105: 10513-10518.

19) Qu Y, ZhAng Q, cAi X, li F, MA Z, Xu M, lu l. Exosomes derived from miR-181-5p-modified adipose-derived mesenchymal stem cells pre-vent liver fibrosis via autophagy activation. J Cell Mol Med 2017; 21: 2491-2502.