miR-17-92 cluster accelerates adipocytedifferentiation by negatively regulatingtumor-suppressor Rb2/p130Qiang Wang*, Yan Chun Li*, Jinhua Wang*, Juan Kong*, Yuchen Qi†, Richard J. Quigg*, and Xinmin Li*‡

*Department of Medicine, Biological Sciences Division, University of Chicago, 5841 South Maryland Avenue, Chicago, IL 60637; and †College of Life Sciences,Beijing University, Beijing 10091, China

Communicated by Janet D. Rowley, University of Chicago Medical Center, Chicago, IL, January 7, 2008 (received for review October 27, 2007)

Adipogenesis involves cell proliferation and differentiation, both ofwhich have been shown to be regulated by micro (mi)RNA. Duringmouse preadipocyte 3T3L1 cell differentiation, we found that miR-17-92, a miRNA cluster that promotes cell proliferation in variouscancers, was significantly up-regulated at the clonal expansion stageof adipocyte differentiation. Stable transfection of 3T3L1 cells withmiR-17-92 resulted in accelerated differentiation and increased tri-glyceride accumulation after hormonal stimulation. By using a lucif-erase reporter assay, we demonstrated that miR-17-92 directly tar-geted the 3� UTR region of Rb2/p130, accounting for subsequentlyreduced Rb2/p130 mRNA and protein quantities at the stage of clonalexpansion. siRNA-mediated knock-down of Rb2/p130 at the samestage of clonal expansion recapitulated the phenotype of overex-pression of miR-17-92 in the stably transfected 3T3L1 cells. These dataindicate that miR-17-92 promotes adipocyte differentiation bytargeting and negatively regulating Rb2/p130.

Given the global obesity epidemic, deciphering the mechanismsunderlying adipocyte differentiation in mammals poses an

important challenge. The mouse 3T3L1 preadipocyte cell line hasbeen an ideal in vitro system for unraveling the molecular events ofadipocyte differentiation (1, 2). The entire process of 3T3L1preadipocyte cell differentiation involves several cellular stages.First, proliferating preadipocytes become growth-arrested by con-tact inhibition, which can be reversed by hormonal induction andreentry into the cell cycle. After several rounds of clonal expansion,the cells again become quiescent with the initiation of coordinatetranscriptional activation of adipocyte genes such as C/Ebp�, Ap2,Lpl, Srebp, and Ppar�. Expression of these genes leads to terminaladipocyte differentiation (3).

Among the above cellular programs, clonal expansion is one ofthe key events taking place in early adipogenesis (4, 5). Blocking cellcycle reentry with a DNA synthesis inhibitor prevents adipocytedifferentiation, suggesting that an active clonal expansion is re-quired for the differentiation process (4, 6). Clonal expansion iscritically regulated by retinoblastoma family (pRB) genes throughinteractions with the E2F transcription factors. A significant role oftwo members of the pRB family p130 and p107 in early adipocytedifferentiation is suggested by the dramatic change in their expres-sion within the first 24 h (i.e., clonal expansion) of hormonalinduction. In growth-arrested preadipocytes, there are significantlevels of p130 with little or no detectable p107. However, this trendis completely reversed at 24 h, with a significant decrease in p130accompanied by a marked increase in p107. This dramatic regula-tion has been designated as the p130:p107 switch (6). The functionalsignificance of the p130:p107 switch has now been demonstrated bydisrupting the p130 expression pattern during the mitotic clonalexpansion phase, resulting in complete inhibition of adipocytedifferentiation (7).

In addition to the understanding of the classic molecular signal-ing involved in protein-coding genes, recent studies indicate thatmicro (mi)RNAs also play critical roles in adipocyte differentiation.Esau et al. (8) showed that inhibition of up-regulated miRNA(miR)-143 in human differentiating adipocytes effectively reduced

the level of triglyceride accumulation as well as the expression levelof adipocyte specific genes, which ultimately abolished adipocytedifferentiation. miRNAs have been shown to play key roles in othercell differentiation events, including embryonic stem cell differen-tiation (9), myogenesis (10), angiogenesis and hematopoiesis (11),and neurogenesis (12). miRNAs are also actively involved in cellproliferation. One example is the miR-17-19 cluster, which com-prises seven miRNAs (miR-17-5p, miR-17-3p, miR-18, miR-19a,miR-20, miR-19b, and miR-92-1) and resides in intron 3 of theC13orf 25 gene at 13q31.3 (13). This miR-17-92 cluster is frequentlyamplified and substantially overexpressed in B-cell lymphomas andlung cancers, and promotes tumor growth in human and mouse cellmodels (14, 15). The experimental data suggest that the growthstimulatory effect of miR-17-92 cluster is at least partially attrib-utable to the rebalance between cell proliferation and apoptosisthrough interacting with E2F and pRB families (16)

In an effort to understand the functional significance of miRNAsduring adipocyte differentiation, we used 3T3L1 preadipocyte cellsto screen miRNA expression over seven time points after hormonalinduction. Surprisingly, we found all five members of the miR-17-92cluster queried were markedly up-regulated after hormonal stim-ulation and peaked at the clonal expansion stage. This distinctiveexpression pattern suggests that the miR-17-92 cluster may alsoregulate adipocyte differentiation. In this report, we describe theexpression profiles of miR-17-92 and demonstrate that overexpres-sion of miR-17-92 can accelerate adipocyte differentiation throughtargeting the tumor suppressor Rb2/p130.

ResultsmiRNAs Are Critical for Adipocyte Differentiation. Before we tried toidentify critically important miRNAs for adipocyte differentiation,we functionally tested transfection efficiency by siRNA-mediatedknockdown of PPAR�, a master regulator of adipocyte differen-tiation. In 3T3L1 cells in which the expression of PPAR� proteinwas reduced 78% by siRNA targeting, differentiation was absent(Fig. 1 A, B, and I), confirming the utility of this approach. Then,we addressed whether miRNAs are important for adipocyte dif-ferentiation by siRNA-mediated suppression of Drosha, an essen-tial enzyme for miRNA maturation. Results showed that transfec-tion of Drosha-targeted siRNA 2 days before hormonal inductionsuppressed 80% of Drosha expression and effectively abolishedadipocyte differentiation (Fig. 1 C, D, and I); the effectivenesssignificantly decreased 1 day before hormonal induction, althougha 4.2-fold reduction of Drosha expression was achieved by siRNA-mediated knockdown (Fig. 1 E, F, and I), and no obvious effect was

Author contributions: Q.W., Y.C.L., R.J.Q., and X.L. designed research; Q.W., Y.C.L., J.W.,and Y.Q. performed research; J.K. contributed new reagents/analytic tools; X.L. analyzeddata; and R.J.Q. and X.L. wrote the paper.

The authors declare no conflict of interest.

‡To whom correspondence should be addressed at: Department of Pathology and Labo-ratory Medicine, University of California, 1000 Veteran Avenue, Los Angeles, CA 90095.E-mail: xinminli@mednet.ucla.edu.

© 2008 by The National Academy of Sciences of the USA

www.pnas.org�cgi�doi�10.1073�pnas.0800178105 PNAS � February 26, 2008 � vol. 105 � no. 8 � 2889–2894

CELL

BIO

LOG

Y

observed 1 day after induction (Fig. 1 G–I). These data suggest thatmiRNAs are critical at the early stage of adipocyte differentiation.

miR-17-92 Cluster Is Significantly Up-Regulated During AdipocyteDifferentiation. To identify potential miRNAs that regulate adipo-cyte differentiation, we systematically profiled miRNA at 2, 4, 8,and 12 h and 1, 2, and 6 days after hormonal induction. These datashowed 74–219 miRNAs were differentially expressed (�2-fold)over these time periods. The complete lists for these seven sets ofdata are available upon request. A striking observation was thatevery member of the miR-17-92 cluster (miR-17-5p, miR-17-3p,miR-18, miR-19b, and miR-20) was up-regulated at each time point(Fig. 2 A and B). Two-way ANOVA showed that expression levelsof all members, except for miR-19, were significantly higher thannoninduced controls at all time points, except for 8 h. Expressionlevels over times exhibited two peaks at 4 h and 1 day afterinduction. We independently confirmed the differential expressionof miR-17-5p and miR-18 at 1, 2, and 6 days after induction byquantitative (Q)RT-PCR (Fig. 2C).

miR-17-92 Cluster Accelerates Adipocyte Differentiation. Given thesestriking observations, we hypothesized that the up-regulation of themiR-17-92 cluster has a functional significance in adipocyte differ-entiation. To test this hypothesis, we established a 3T3L1 cell linewith stable transfection of miR-17-92 cluster in an murine stem cellvirus (MSCV) vector; a vector-only stable transfectant served ascontrol for these studies. QRT-PCR analysis showed that enhancedexpression of miR-17-92 resulted in 2.8- and 2.7-fold increases in

expression of miR-17-5p and miR-18, respectively, compared withcontrols with vector alone, and 2.5- and 1.4-fold increases comparedwith nontransfected 3T3L1 cells (Fig. 3A). There was no evidentchange in 3T3L1 cells in which there was overexpression of themiR-17-92 cluster without hormonal induction (data not shown).However, when hormonally induced, the cells transfected withmiR-17-92 cluster differentiated into adipocytes significantly fasterthan vector alone (Fig. 3B). The accelerated differentiation wasaccompanied by the increased mRNA levels of several key tran-scription factors considered to be adipocyte-specific markers. Asdepicted in Fig. 3C, Ppar�, Ap2, and Lpl mRNA expressions weresignificantly increased in the cells transfected with miR-17-92compared with controls (vector alone) during the progression ofadipocyte differentiation. The expression levels of C/Ebp� andSrebp were also significantly elevated at 2 and 3 days after hormonalinduction (data not shown).

Search for Targets of miR-17-92 Cluster. As a first step to understandmechanisms underlying the actions of the miR-17-92 cluster, wefocused initially on identifying the potential targets of the miR-17-92 cluster. Because the miR-17-92 cluster was up-regulatedduring differentiation, we expected that the expression of its targetsshould be concomitantly down-regulated. Therefore, we comparedgene expression profiles between baseline (no induction control)and 1 day of hormonal induction by using Affymetrix mouse 430 2.0arrays. We identified 323 genes that were down-regulated �1.5-foldafter induction and were also predicted to be potential targets of themiR-17-92 cluster (a list of the genes is available upon request).

A

F

D C B

H

Fo

ld C

han

ge

0

5 0 . 0

1 . 0

5 1 . 0

2 . 0

5 2 . 0

3 . 0

r a p P γ y a d - 2 e r o f e b n o i t c u d n i

- 2 a h s o r D e r o f e b y a d

n o i t c u d n i

- 1 a h s o r D e r o f e b y a d

n o i t c u d n i

- 1 a h s o r D r e t f a y a d n o i t c u d n i

I

E

G

± 5 0 7 3 1 : d e r f o a e r A 1 3 3 2 1 0 7 5 1 : y t i s n e D d e t a r g e t n I

± 5 1 3 : d e r f o a e r A 7 1 8 6 3 2 4 : y t i s n e D d e t a r g e t n I

± 6 6 8 5 1 : d e r f o a e r A 3 3 6 5 5 8 4 7 1 : y t i s n e D d e t a r g e t n I

± 2 9 2 2 : d e r f o a e r A 4 2 0 7 9 7 8 2 : y t i s n e D d e t a r g e t n I

± 7 0 1 4 1 : d e r f o a e r A 1 3 7 8 6 9 9 5 1 : y t i s n e D d e t a r g e t n I

± 9 4 6 7 : d e r f o a e r A 3 3 6 5 0 3 7 8 : y t i s n e D d e t a r g e t n I

± 6 8 7 4 2 : d e r f o a e r A 6 2 8 5 5 4 8 1 3 : y t i s n e D d e t a r g e t n I

± 5 6 8 5 2 : d e r f o a e r A 1 3 9 8 3 5 4 8 2 : y t i s n e D d e t a r g e t n I

Fig. 1. Representative oil red O staining of 3T3L1 cells after 7 days differentiation under varied experimental conditions. A, C, E, and G are negative siRNAcontrols (siCONTROL Non-Targeting siRNA Pool purchased from Dharmacon) for B, D, F, and H, respectively. Transfection of Ppar� siRNA 2 days before hormonalinduction abolished adipocyte differentiation (B). Transfection of Drosha siRNA 2 days before hormonal induction effectively blocked adipocyte differentiation(D). Transfection of the same Drosha siRNA 1 day before induction had a limited effect on blocking differentiation (F), whereas transfection 1 day after hormonalinduction had no effect on adipocyte differentiation (H). The area of red droplets and their integrated density were measured for each image by using IPLabssoftware 4.0 from BD Biosciences, which quantitatively reflects the degree of adipocyte differentiation. QRT-PCR analyses confirmed effective siRNA knockdownof Ppar� and Drosha, which led to a �4-fold reduction of their mRNA levels compared with the control siRNA transfections (I).

2890 � www.pnas.org�cgi�doi�10.1073�pnas.0800178105 Wang et al.

Among these genes, Rb2/p130 was arguably the most relevantbecause several members of miR-17-92 cluster, including miR-17-5p, miR-18, and miR-20, can target the 3� UTR of Rb2/p130;additionally, previous studies have indicated that decreased expres-sion of Rb2/p130 within the first day of hormonal stimulation iscritically important for adipocyte differentiation (7).

miR-17-92 Cluster Directly Targets Rb2/p130. To examine whether themiR-17-19 cluster can regulate the expression of Rb2/p130, wemeasured Rb2/p130 mRNA and protein quantities in 3T3L1 cellsstably transfected with miR-17-92 cluster or vector alone by QRT-PCR and Western blotting, respectively. As shown in Fig. 4A,Rb2/p130 mRNA in cells overexpressing miR-17-92 was lower thanthat in control cells by 1.5-, 2.7-fold, and 2.0-fold at 0, 12, and 24 hafter induction, respectively. Similarly, Rb2/p130 protein was visiblylower at baseline and nearly undetectable at 24 h in the miR-17-92cluster-transfected cells (Fig. 4B). These data are consistent withthe hypothesis that Rb2/p130 is a direct target of miR-17-92 clusterin 3T3L1 cells. To test this hypothesis, a standard reporter assay inwhich the miR-17-5p predicted target sequence in the Rb2/p130 3�UTR was inserted downstream of the firefly luciferase gene. Thesestudies were performed in MES13 cells, in which the level ofendogenous miR-17-92 expression is 50 times lower than that of3T3L1 cells (data not shown). There was a significant reduction inluciferase activity when chemically synthesized miR-17-5p wastransfected into MES13 cells. The degree of the reduction inluciferase activity depended on the quantity of synthetic mir-17-5p

(Fig. 4C). These data provide evidence that Rb2/p130 is a directtarget of the miR-17-19 cluster during adipocyte differentiation.

siRNA-Mediated Knockdown of Rb2/p130 Recapitulates the Differen-tiation Phenotype of Overexpression of miR-17-92. To establish afunctional link between the promotion of adipocyte differentiationand suppression of Rb2/p130 expression by miR-17-92, we trans-fected siRNA against Rb2/p130 into the 3T3L1 cells 6 h beforehormonal induction, which led to a 3.3-fold reduction of Rb2/p130expression 24 h after hormonal stimulation (data not shown).Consistent with the role of miR-17-92 in accelerating differentia-tion by repressing Rb2/p130, siRNA-mediated knockdown of Rb2/p130 enhanced adipocyte differentiation (Fig. 5A) and up-regulated several adipocyte-specific markers, such as Ap2, Lpl, andSrebp (Fig. 5B).

DiscussionThe present study establishes for the first time the important roleplayed by miR-17-92 in adipogenesis. After the observation ofelevated expression of miR-17-92 cluster members during adipo-cyte differentiation, we demonstrated that: (i) overexpression ofmiR-17-92 is associated with the accelerated adipocyte differenti-ation; (ii) miR-17-92 directly targets and down-regulates the ex-pression of Rb2/p130; and (iii) siRNA knockdown of Rb2/p130recapitulates the differentiation phenotype created by overexpres-sion of miR-17-92. Thus, we conclude that miRNA-17-92 acceler-ates adipocyte differentiation by negatively regulating the key cellcycle regulator and tumor suppressor, Rb2/p130.

srH2D srH2G srH4D srH4G srH8D srH8G srH21D srH21G srh42D srh42G srH84D srH84G srh441D srh441G

eman elpmas10.0

1.0

1

01

srH2D srH2G srH4D srH4G srH8D srH8G srH21D srH21G srh42D srh42G srH84D srH84G srh441D srh441G

eman elpmas10.0

1.0

1

01

MD :deRMG :wolleY

2

2

2

2

2

b91_Rim

81_Rim

p5_71_Rim

p3_71_Rim

02_Rim

h4 h2 h8 h21 h42 h84 h441

A

B

C

Fig. 2. Expression profiles of five members of the miR-17-92 cluster over seven time points with and without hormonal induction. (A) Box plots showing thedata distribution of the miR-17-92 cluster over time. The horizontal lines in the boxes indicate the median values; the lower and upper edges of the boxes indicatethe 25th and 75th percentiles of the datasets, respectively; the whiskers indicate the minimum and maximum values (or 1.5 times the interquartile range). Thered- and yellow-colored boxes represent cells grown in differentiation and growth medium, respectively. (B) Cluster analysis for all five members of miR-17-92cluster available on Invitrogen miRNA chips. The red color shows relatively abundant expression of the same miRNA compared with other time points, whereasthe blue color indicates a low expression relative to others. Cluster analyses were performed with GeneSpring GX 7.3.1 by using the default settings. (C) Therelative expression levels of miR-17-5p and miR-18 at days 1, 2, and 6 after differentiation, as detected by QRT-PCR. The red line represents miR-17-5p, and theblue line denotes miR-18. The data shown are means and SDs of three replicates.

Wang et al. PNAS � February 26, 2008 � vol. 105 � no. 8 � 2891

CELL

BIO

LOG

Y

Before terminal differentiation of 3T3L1 preadipocytes, growth-arrested preadipocytes must undergo clonal expansion through cellcycle events before undergoing terminal differentiation. In thisstudy, we observed two elevated expression peaks of miR-17-92members during the clonal expansion. The first was at 4 h, corre-sponding to the G1 stage, when RNAs and proteins are activelysynthesized and the G1 checkpoint is activated to ensure thateverything is ready for DNA synthesis. This is a critical stage toinitiate and/or prepare for reentering the cell cycle. The secondexpression peak was at 24 h, coinciding with the end of clonalexpansion. In contrast, the expression of miR-17-92 in control cells(without hormonal induction) remained relatively constant after aninitial moderate elevation at 2 h. These differential expressionpatterns suggest that miR-17-92 may modulate adipocyte differen-tiation by regulating the reentry and exit of cell cycle. This isconsistent with the data obtained by siRNA-mediated Droshainhibition, which showed an essential role for miRNAs at the clonalexpansion stage of adipocyte differentiation.

To evaluate the functional significance of the distinctive expres-sion pattern of miR-17-92 cluster members during the clonalexpansion stage of adipocyte differentiation, we established a stablytransfected 3T3L1 cell line overexpressing miR-17-92 cluster genes.In agreement with expression data, enhanced expression of miR-17-92 had profound effects on adipocyte differentiation. However,up-regulation of miR-17-92 cannot trigger adipocyte differentiation

without hormonal induction, which suggests that miR-17-92 is anecessary adjunct to hormonal signals to initiate differentiation.

In an effort to find target genes of miR-17-92, gene expressionprofiles were compiled during adipocyte differentiation. Amongthe numbers of down-regulated genes 1 day after the onset ofhormonal induction, we focused on Rb2/p130 because it has anestablished role in adipogenesis and its 3� UTR has several targetingsites for miR-17-5p, miR-18, and miR-20. In differentiating 3T3L1cells, we observed reduced Rb2/p130 mRNA levels, as well asconcomitantly decreased protein levels, when miR-17-92 clusterwas overexpressed within the first 24 h of differentiation, therebyconfirming in silico predictions that Rb2/p130 would represent atarget gene of the miR-17-92 cluster. Subsequent luciferase assaysprovided evidence that miR-17-5p directly targets the 3� UTR ofRb2/p130 mRNA. Clearly, Rb2/p130 is unlikely the only target ofmiR-17-92, because the members of the miR-17-92 cluster have anumber of other potential targets that were also observed to bedown-regulated during adipocyte differentiation.

The peaks of miR-17-92 expression, which coincided with thetime of reentry and exit of the cell cycle, suggest that the molecularmechanism behind the acceleration of adipocyte differentiation bymiR-17-92 is linked to the clonal expansion. As previously shown,the reentry into the cell cycle is a key event for initiating adipocytedifferentiation. This event depends on the activation of the pRB–E2F pathway that controls the G1-to-S transition of the cell cycle.

e n o l a r o t c e v V C S M – V C S M 2 9 - 7 1 - R i m

A

B

C

Fo

ld c

han

ge

0

0 5

0 0 1

0 5 1

0 0 2

0 5 2

0 0 3

h 8 4 h 4 2 h 2 1 h 6 h 0

l o r t n o C

2 9 - 7 1 - r i m * *

*

Rel

ativ

e A

P2

mR

NA

leve

l

0

2

4

6

8

0 1

2 1

4 1

6 1

h 8 4 h 4 2 h 2 1 h 6 h 0

l o r t n o C

2 9 - 7 1 - r i m *

*

Rel

ativ

e P

PA

R γ

mR

NA

leve

l

0

2

4

6

8

0 1

2 1

4 1

h 0 h 8 4 h 4 2 h 2 1 h 6

l o r t n o C

2 9 - 7 1 - r i m

* *

* *

Rel

ativ

e L

PL

mR

NA

leve

l

0

5 . 0

1

5 . 1

2

5 . 2

3

y l n o l l e c s v 2 9 - 7 1 - R i m r o t c e V s v 2 9 - 7 1 - R i m

p 5 - 7 1 - R i m 8 1 - R i m

± 0 1 6 4 : d e r f o a e r A 9 1 7 7 5 8 7 4 : y t i s n e D d e t a r g e t n I

± 7 1 3 2 : d e r f o a e r A 4 2 9 6 3 1 0 2 : y t i s n e D d e t a r g e t n I

Fig. 3. Overexpression of miR-17-92 cluster accelerates adipocyte differentiation. (A) Enhanced expression of the miR-17-92 cluster resulted in an elevatedexpression of miR-17-5p and miR-18, as shown by QRT-PCR. RNA was extracted from stably transfected 3T3L1 cells with either MSCV-miR-17-92 construct or MSCValone without hormonal induction, respectively. The empty and cross-hatched bars represent miR-18 and miR-17-5p, respectively. The left two bars are theexpression ratios of measured miRNAs between cells with MSCV-miR-17-92 and the MSCV vector alone, and the right two bars are the expression ratios ofmeasured miRNAs between cells harboring the MSCV-miR-17-92 construct and 3T3L1 cells only. (B) Overexpression of miR-17-92 resulted in a �2-fold increaseof adipocyte differentiation (Right) compared with vector control (Left), as shown by oil red O staining and measured by the area of red and integrated density7 days after hormonal induction. (C) QRT-PCR analyses of key adipogenic transcription factors during 3T3L1 adipocyte differentiation. The expression levels ofPpar�, Ap2, and Lpl were significantly increased in the cells transfected with miR-17-92 construct compared with vector alone at 24 and 48 h. The data shownare means and SDs of three replicates. **, P � 0.01; *, P � 0.05.

2892 � www.pnas.org�cgi�doi�10.1073�pnas.0800178105 Wang et al.

In this pathway, E2F transcription factors control the expression ofgenes involved in cell cycle progression, whereas pRB familymembers regulate E2F activities through complex formation (17).Specifically, Rb2/p130 can form heterodimers with E2F4 and E2F5(18), leading to repression of target genes (19). Based on ourexperimental data [showing that (i) the peaks of miR-17-92 ex-pression coincided with the time of reentry and exit of the cell cycle;(ii) miR-17-92 directly targeted Rb2/130; and (iii) overexpression ofmiR-17-92 significantly suppressed both Rb2/p130 mRNA andprotein within the first 24 h], we propose the following model: afterhormonal induction, the expression of miR-17-92 increases, result-ing in a decrease of Rb2/p130. Insufficient quantities of Rb2/p130with which to dimerize lead to an increase of free E2F4 and E2F5.These then activate E2F target genes, triggering reentry into the cellcycle. After 1 day of hormonal stimulation, the expression ofmiR-17-92 reached a peak and then started to decrease, whichcorresponds to increased complex formation between Rb2/p130and E2F. Loss of activities of E2F silences E2F-responsive genes,leading to the induction of cell cycle exit and terminal differenti-ation. This model not only explains our experimental observationsbut is also consistent with previously published data, i.e., inactiva-tion of Rb2/p130 enables clonal expansion, whereas growth arrestafter this expansion phase requires active Rb2/p130, which posi-tively influence terminal differentiation (20).

In summary, the current study represents, to our knowledge, thefirst demonstration that miR-17-92 promotes adipocyte differenti-

ation by directly targeting Rb2/p130. Overexpression of miR-17-92cannot trigger adipocyte differentiation without hormonal induc-tion. Thus, miR-17-92 is necessary, but not sufficient, to initiatedifferentiation. The results described here provide an experimentalframework for further functional dissection of this miRNA clusterand its targets to fully delineate its role in adipocyte differentiation.

Materials and Methods3T3L1 Cell Culture and Differentiation. 3T3-L1 cells were obtained from AmericanType Culture Collection and were cultured to confluence in DMEM containing10% FCS by changing the medium every 2 days. Two days after cell confluence,differentiation was initiated by adding differentiation medium (5 �M methyli-sobutylxanthine, 0.25 �M dexamethasone, and 1 �g/ml insulin in DMEM con-taining 10% FBS). Methylisobutylxanthine and dexamethasone were removedafter 2 days, but insulin (1 �g/ml) was maintained for an additional 2 days.Thereafter, cells were grown in DMEM containing 10% FBS by replacing themedia every 2 days.

Ppar�, Drosha, and Rb2/p130 Gene Knockdown. The siRNAs for Ppar�, Drosha,and Rb2/p130 knockdown were purchased from Dharmacon. There are fourindividual siRNA sequences for each gene. The Ppar� siRNA target sequences areCGAAGAACCAUCCGAUUGA, ACCCAAUGGUUGCUGAUUA, UCACAAUGCCAU-CAGGUUU, and CGACAUGAAUUCCUUAAUG. The Drosha siRNA sequences areUGGAAGGAGUUACGCUUUA, GCCAAAUACGGAUCGGCAA, UGUGUAAAGU-GAUUCGAUU, and GGAUGGAAUUUCUGGGCGA. The Rb2/p130 siRNA se-quences are GCGAUGAUCUGGUCAAUUC, GGGACAGAAUUAGAGAUAA, GGC-UAUCGCUGACAGAUUG, and GUACAGUUAUCUCAAAGUC. The negativecontrol siRNA used in the experiments was siCONTROL Non-Targeting siRNA Pool(Dharmacon). The siRNAs were transfected into the cell with DharmaFECT-3transfection reagent (Dharmacon) according to the instructions of the manufac-turer. Briefly, 3T3L1 cells were cultured, and differentiation was induced underthe same conditions as described above. At day �2, �1, and 1 after hormonalinduction, the cells were transfected separately with each Ppar� and DroshasiRNA at 40 nM with 2 �l of DharmaFECT-3 transfection reagent. Knockdowns of

A

B h42 h0 h0 h84 h42 h84

29-71-rim-VCSM lortnoC VCSM

031p/2BR

nitcA

ylno rotcev VCSM sv 29-71-Rim+VCSM

0

1.0

2.0

3.0

4.0

5.0

6.0

7.0

8.0

9.0

1

h0 h21 h42 h84

Fo

ld C

han

ge (

Rb

2/p

130 m

RN

A)

****

C

Fig. 4. Rb2/p130 is a direct target of miR-17-92. (A) Rb2/p130 mRNA in the cellstransfected with miR-17-92 was lower than that in the control cells at differenttime points of hormonal induction. (B) Rb2/p130 protein in the cells transfectedwith miR-17-92 was markedly reduced compared with the cells transfected withempty MSCV vector. (C) Luciferase activities were decreased in MES13 cells in adose-dependent fashion by transfection of different concentration of syntheticmiR-17-5p. There was no difference in luciferase activities between the cellsharboring the pGL3-Rb2/p130 construct and the cells harboring the pGL3 controlconstruct before cotransfection. The luciferase activities were decreased with theincrease of synthetic miR-17-92 concentrations. ***, P � 0.001 between 0 and 60nM; *, P � 0.05 between 60 and 80 nM. There was no significant differencebetween 80 and 100 nM, which could be attributable to the saturation ofsynthetic miR-17-5p at 80 nM.

A

B A N R i s l o r t n o c s v A N R i s 2 b R

0 0 . 0

0 5 . 0

0 0 . 1

0 5 . 1

0 0 . 2

0 5 . 2

L P L 2 P A P B E R S

Fo

ld c

han

ge

(mR

NA

lev

el)

± 3 8 5 2 : d e R f o a e r A 6 1 7 2 3 6 8 2 : y t i s n e D d e t a r g e t n I

± 9 5 6 4 : d e R f o a e r A 7 0 4 4 3 6 5 : y t i s n e D d e t a r g e t n I

A N R i s 2 b R f o n w o d - k c o n k A N R i s g n i t e g r a T - n o N l o r t n o C

Fig. 5. siRNA-mediated knockdown of Rb2/p130 accelerates adipocyte dif-ferentiation. (A) siRNA knockdown of Rb2/p130 accelerated adipocyte differ-entiation (Right) compared with control siRNA (Left), as shown by oil red Ostaining and measured by the area of red and integrated density 7 days afterhormonal induction. (B) QRT-PCR analyses of key adipocyte markers during3T3L1 adipocyte differentiation. The y axis represents the mRNA expressionratio of Ap2, Lpl, and Srebp between the cells transfected with siRNA againstRb2/p130 and the cell transfected with control siRNA at 48 h after induction.The siRNA transfection was performed 6 h before hormonal induction. Thedata shown are mean ratios and SDs of three replicates.

Wang et al. PNAS � February 26, 2008 � vol. 105 � no. 8 � 2893

CELL

BIO

LOG

Y

Ppar� and Drosha were confirmed at the mRNA level by QRT-PCR. The Rb2/p130siRNA transfection was performed 6 h before hormonal induction. The knock-down of Rb2/p130 was confirmed at both mRNA and protein levels by QRT-PCRand Western blot.

Oil Red O Staining. Cells were washed twice with PBS and fixed with 10%formalin for 60 min at room temperature. After fixation, cells were stained withfiltered oil red O solution (stock solution: 3 mg/ml in isopropanol; workingsolution: 60% oil red O stock solution and 40% distilled water) for 2 h at roomtemperature. Cells were then washed with water to remove unbound dye,visualized by light microscopy, and photographed. Oil red O stain was quantifiedbyusing IPLabs software4.0 (BDBiosciences).After correctionofbackground, thecolor images were segmented by using the red channel intensity. The area of reddroplets, as well as their integrated density, was measured to quantitativelyindicate the degree of cell differentiation.

Generation of Stable Clones. pMSCV-mir-17-92 and pMSCV negative controlconstructs, which contains a PGK–puromycin–IRES–GFP (PIG) cassette, were kindgifts from Lin He (14). The miR-17-92 cluster sequence was PCR-amplified andcloned into MSCVpuro–IRES–GFP vector through multiclone site (21). pMSCV–mir-17-92 and pMSCV negative control constructs were transfected into 3T3 L1cells by Lipofectamine 2000 (Invitrogen). The stably transfected cell lines wereestablished by puromycin selection (2 �g/ml) in DMEM, which were thenconfirmed by fluorescence microscopy (GFP marker) and by QRT-PCR.

miRNA Microarray/Gene Array Hybridization and Data Analysis. Total RNAs wereisolated by TRIzol (Invitrogen) from 3T3L1 cell cultures growing either on growthmedium or differentiation medium at 2, 4, 8,12, 24, 48, and 144 h after hormonalinduction. miRNAs were enriched by using a PureLink miRNA isolation kit (In-vitrogen). The labeled miRNAs were hybridized to a Ncode MultiSpecies miRNAMicroarray (Invitrogen) according to the instructions of the manufacturer. Dataanalyses were performed by using GeneSpring GX 7.3.1. All mouse 430 2.0 genearray hybridizations were performed at the Functional Genomics Facility (Uni-versity of Chicago). The target preparation protocol followed the GeneChipexpression analysis manual (Affymetrix). The arrays were washed and stainedwith streptavidin phycoerythrin in Fluidics Station 450 by using the AffymetrixGeneChipprotocolandscannedbyusingtheAffymetrixGeneChip7Gscanner (allfrom Affymetrix). Data analyses were performed by using DNA-Chip Analyzer 1.3(22). The invariant set approach was used for data normalization. The thresholdsfor selecting significant genes were set at a relative difference of �1.5-fold, anabsolute difference of �100 signal intensity, and P � 0.05.

Quantitative Real-Time PCR Analyses. miRNA mmu–mir-17-5p and mmu–mir-18wereanalyzedbyaTaqManMicroRNAassaykit (AppliedBiosystems).Thesno234

gene was used as an internal control for normalization. An SYBR Green-baseddetection system was used for QRT-PCR analysis (Applied Biosystems) with thefollowingprimers:Rb2forward,AGGTCATGCCACCTCAAAAC;Rb2reverse,TCTC-GAATAGCCGCCTTCTA; Rb1 forward, TCACCACGCCTGTAGCTTCA; Rb1 reverse,CCAGCGACGATGCTCTGTAA; Ppar� forward, AAGAGCTGACCCAATGGTTG;Ppar� reverse, ACCCTTGCATCCTTCACAAG; Drosha forward, GGACCATCAC-GAAGGACACT; Drosha reverse, GATGTACAGCGCTGCGATAA; SREBP1 forward,GATCAAAGAGGAGCCAGTGC; SREBP1 reverse, TAGATGGTGGCTGCTGAGTG;Ap2 forward, TCACCTGGAAGACAGCTCCT; Ap2 reverse, AATCCCCATTTACGCT-GATG; Lpl forward, GGGCTCTGCCTGAGTTGTAG; and Lpl reverse, CCATCCT-CAGTCCCAGAAAA. Expression levels were normalized to Gapdh mRNA with thefollowing l primers: Gapdh forward, AACTTTGGCATTGTGGAAGG; and Gapdhreverse, ACACATTGGGGGTAGGAACA. All QRT-PCR measurements wereperformed by using a 7900 HT Fast Real Time PCR system (Applied Biosystems).

Western Blotting. 3T3L1 cells were lysed in radioimmunoprecipitation assaybuffer (150 mM NaCl, 1.0% IGEPAL CA-630, 0.5% sodium deoxycholate, 0.1%SDS, and 50 mM Tris, pH 8.0) with protease inhibitor mixture (Roche AppliedScience). Protein concentrations were determined with BCA protein assay kit(Pierce). Proteins were separated on 10% SDS/PAGE gels under reducing condi-tions and electroblotted onto a PVDF membrane. The membranes were probedwith primary (Rb2/p130 antibody; BD Biosciences) and secondary antibodies asdetailed previously (23). The membranes were reprobed with anti-actin antibody(Sigma) for data normalization.

Luciferase Assay. The pGL3 vector was modified by insertion of a puromycinfragment into the plasmid between KpnI and XhoI sites. The 3� UTR sequence ofRb2/p130 was generated by PCR with the following primers: ATATCTAGAGT-GTCCAGGAGGAAACTGTC (forward) and ATATCTAGATGCCACTACCACAAATG-GAAG (reverse). The PCR product was digested with XbaI and then inserted intopGL3-Puro vector at the downstream of luciferase gene. The correct clone ofpGL3-puro-Rb2–3UTR plasmid was transfected into a mouse mesangial cell line,MES13, growing on DMEM plus 10% FBS. The stable cell line harboring theplasmid was selected by using 1 �g/ml puromycin in DMEM. Mmu–mir-17-5pmimic (Dharmacon) was transfected into this cell at the concentration of 0, 60, 80,and 100 nM by using HiPerFect (Qiagen). Twenty-four hours after transfection,firefly luciferase activities were measured by using a luciferase assay kit (Pro-mega) and were normalized to protein concentrations.

ACKNOWLEDGMENTS. We thank Dr. Lin He (Cold Spring Harbor Laboratory,Watson School of Biological Sciences, Cold Spring Harbor, NY) for providing theMSCV-mir-17-92 construct. This work was supported in part by National Institutesof Health Cancer Research Center Grants R01DK055357 and R01HL085793.

1. MacDougald OA, Lane MD (1995) Transcriptional regulation of gene expression duringadipocyte differentiation. Annu Rev Biochem 64:345–373.

2. Cowherd RM, Lyle RE, McGehee RE, Jr (1999) Molecular regulation of adipocytedifferentiation. Cell Dev Biol 10:3–10.

3. Cornelius P, MacDougald OA, Lane MD (1994) Regulation of adipocyte development.Annu Rev Nutr 14:99–129.

4. Patel YM, Lane MD (2000) Mitotic clonal expansion during preadipocyte differentia-tion: Calpain-mediated turnover of p27. J Biol Chem 275:17653–17660.

5. Debril MB, Renaud JP, Fajas L, Auwerx J (2001) Peroxisome proliferator-activatedreceptor gamma: From adipogenesis to carcinogenesis. J Mol Med 79:30–47.

6. Richon V, Lyle RE, McGehee REJ (1997) Regulation and expression of retinoblastomaproteins p107 and p130 during 3T3–L1 adipocyte differentiation. J Biol Chem272:10117–10124.

7. Prince AM, May JS, Burton GR, Lyle RE, McGehee RE, Jr (2002) Proteasomal degradationof retinoblastoma-related p130 during adipocyte differentiation. Biochem BiophysRes Commun 290:1066–1071.

8. Esau C, et al. (2004) MicroRNA-143 regulates adipocyte differentiation. J Biol Chem279:52361–52365.

9. Murchison EP, Partridge JF, Tam OH, Cheloufi S, Hannon GJ (2005) Characterization ofDicer-deficient murine embryonic stem cells. Proc Natl Acad Sci USA 102:12135–12140.

10. Naguibneva I, et al. (2006) The microRNA miR-181 targets the homeobox proteinHox-A11 during mammalian myoblast differentiation. Nat Cell Biol 8:278–284.

11. Yang WJ, et al. (2005) Dicer is required for embryonic angiogenesis during mousedevelopment. J Biol Chem 280:9330–9335.

12. Schratt GM, et al. (2006) A brain-specific microRNA regulates dendritic spine develop-ment. Nature 439:283–289.

13. Ota A, et al. (2004) Identification and characterization of a novel gene, C13orf25, as atarget for 13q31–q32 amplification in malignant lymphoma. Cancer Res 64:3087–3095.

14. He L, et al. (2005) A microRNA polycistron as a potential human oncogene. Nature435:828–833.

15. Hayashita Y, et al. (2005) A polycistronic microRNA cluster, miR-17-92, is overexpressedin human lung cancers and enhances cell proliferation. Cancer Res 65:9628–9632.

16. Woods K, Thomson JM, Hammond SM (2007) Direct regulation of an oncogenicmicro-RNA cluster by E2F transcription factors. J Biol Chem 282:2130–2134.

17. Trimarchi JM, Lees JA (2002) Sibling rivalry in the E2F family. Nat Rev Mol Cell Biol3:11–20.

18. Cobrinik D, Whyte P, Peeper DS, Jacks T, Weinberg RA (1993) Cell cycle-specificassociation of E2F with the p130 E1A-binding protein. Genes Dev 7:2392–2404.

19. Dyson N (1998) The regulation of E2F by pRB-family proteins. Genes Dev 12:2245–2262.20. Fajas L, Debril MB, Auwerx J (2001) Peroxisome proliferator-activated receptor-

gamma: From adipogenesis to carcinogenesis. J Mol Endocrinol 27:1–9.21. Hemann MT, et al. (2003) An epi-allelic series of p53 hypomorphs created by stable

RNAi produces distinct tumor phenotypes in vivo. Nat Genet 33:396–400.22. Li C, Wong WH (2001) Model-based analysis of oligonucleotide arrays: Expression index

computation and outlier detection. Proc Natl Acad Sci USA 98:31–36.23. Li X, et al. (2007) Genetic network and pathway analysis of differentially expressed

proteins during critical cellular events in fracture repair. J Cell Biochem 100:527–543.

2894 � www.pnas.org�cgi�doi�10.1073�pnas.0800178105 Wang et al.