Gene 548 (2014) 190–197

Contents lists available at ScienceDirect

Gene

j ourna l homepage: www.e lsev ie r .com/ locate /gene

Molecular analysis of porcine TDRD10 gene: a novel member of theTDRD family

Peiqing Cong a,1, Anning Li b,1, Qianqian Ji a, Yaosheng Chen a, Delin Mo a,⁎a State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou 510006, PR Chinab College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi 712100, PR China

Abbreviations: ACTB, beta-actin gene; Pfam, protein faRNA; RACE, rapid amplification of cDNA ends; RRM, RNAple modular architecture research tool; SMN, survivadomain-containing protein; TSS, transcription start site.⁎ Corresponding author.

E-mail address: modelin@mail.sysu.edu.cn (D. Mo).1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.gene.2014.07.0260378-1119/© 2014 Elsevier B.V. All rights reserved.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 22 November 2013Received in revised form 3 June 2014Accepted 9 July 2014Available online 11 July 2014

Keywords:TDRD10PigPromoter activity analysisSubcellular localization

Tudor domain-containing proteins (TDRDs) are characterized by various numbers of Tudor domains, which areknown to recognize and bind to symmetric methylated arginine residues. These proteins affect a wide variety ofprocesses, including differentiation, genome stability and gametogenesis. In mammals, there are 12 members(TDRD1–TDRD12) in the TDRD protein family. Among them, the information about TDRD10 is less known.Here, we analyzed the sequence and structure properties of porcine TDRD10 gene, and examined its expressionprofile and subcellular distribution. Our data show that porcine TDRD10 has an opening reading frame (ORF) of1068 bp, which encodes 355 amino acids. It localizes to chromosome 4. The gene product of porcine TDRD10 con-tains a Tudor domain and a RNA recognition motif (RRM). Serial deletion shows that the 5′-flanking sequence ofporcine TDRD10 contains several negative and positive regulatory elements and identifies a 670-bp TATA-less re-gion as an optimal promoter. Site-directedmutagenesis reveals that the nucleotides from−451 to−445 relativeto the transcriptional start site forms one of the very important positive regulatory elements. Real time PCR de-tects the highest expression level of porcine TDRD10 gene in heart among 12 tissues. In PK15 cells, it mainly dis-tributed in the cell nucleus, but also exhibited localization to the cytoplasm. These results increase our knowledgeof TDRD10 gene, and provide basis for further investigation of its function.

milies; piRNA, Piwi interactingrecognition motif; SMART, sim-l motor neuron; TDRD, Tudor

© 2014 Elsevier B.V. All rights reserved.

1. Introduction

Tudor domain-containing proteins (TDRDs) are an evolutionarilyconserved family of proteins. Each member in this family contains oneor more Tudor domains (Chen et al., 2011), which are discernible se-quence motifs of approximately 60 amino acid residues. Tudor domainwas first discovered in 1997 (Callebaut and Mornon, 1997; Ponting,1997), based on 10 repeated units of shared sequence homology inthe Drosophila melanogaster Tudor (Tud) protein. Thereafter, this do-main has been found in proteins from a wide range of organisms(Maurer-Stroh et al., 2003; Ponting, 1997; Talbot et al., 1998).

Despite the wide presence of the Tudor domain, its function is stillnot fully understood. Inquiries into the functions of Tudor domain pro-teins suggest a role of these proteins as chaperones for macromolecularassembly (Brahms et al., 2001). For example, the Tudor domain withinhuman survival motor neuron (SMN) protein binds methylarginineresidues within Sm proteins and is involved in snRNP assembly

(MacKenzie and Gendron, 2001). In so doing, the Tudor domain mayfunction as a reader of methylation in Sm proteins, since it is knownto recognize symmetrically dimethylated arginine or lysine residues(Cote and Richard, 2005; Selenko et al., 2001). However, some Tudordomains specially recognize and bind to methylarginine, including thedomains found in SMN and in TDRD proteins (Chen et al., 2011;Friesen et al., 2001). In fact, methylarginines were not only found inSm proteins, but also at the N-termini of Piwi family proteins (Kirinoet al., 2009). The Piwi family proteins are a subclass of argonaute pro-teins that are important to germ cell development (Aravin et al.,2007). In germ cells, methylarginines direct the Tudor-Piwi interaction(Kojima et al., 2009; Reuter et al., 2009). This methylarginine-dependent interaction between Piwis and TDRDs is essential for Piwiinteracting RNA (piRNA)-mediated retrotransposon silencing and forgermline development. This is supported by the fact that the integrityof TDRD proteins is essential for male fertility (Chuma et al., 2006; Panet al., 2005; Shoji et al., 2009; Vasileva et al., 2009). The similar sper-matogenic defects between TDRD and Piwi mutants further underscorethe significance of the Piwi-TDRD interaction in germline development(Wang et al., 2009).

Although most TDRD proteins are strongly associated with gameto-genesis, their functionsmay bemore diverse and complex. Inmammals,there are twelvemembers in the TDRD family (TDRD1–TDRD12). Theseproteins possess different numbers of Tudor domains and some

Table 1Primers utilized in experiments.

Name Sequence Position

Primers for CDSTDRD10-CDSF GACCCTCTGCTCAACTATTT 5′-UTRTDRD10-CDSR ACCTCCGTCTCTCTCTTCCT 3′-UTR

Primers for TSSTDRDGSP1 ATGGGAACCGCAAAGACGCTTGTCCTDRDGSP2 TTCTTTCCAACAGGATCTCCGTGGCUPM(F) CTAATACGACTCACTATAGGGC

Primers for real-time RT-PCRTDRD10-RT-F CAAGGATTTGCCAGAACCACTDRD10-RT-R GAGCAGCACCAAGAAGGAGCβ-Actin-F GGATGCAGAAGGAGATCACGβ-Actin-R CTCGTCGTACTCCTGCTTGCGAPDHF CGTCCCTGAGACACGATGGTGAPDHR GCCTTGACTGTGCCGTGGAAT

Primers for subcellular locationTDRD10-C-F CTTCGCATTTGTGGATCT 5′-UTRTDRD10-C-R CACGTATAGTTTTCGTTTAT 3′-UTR

Primers for promoter analysis−1568 CACTCTCGAGAGCTTTGCAATCCAT −1568/−1544−1261 TGCTCTCGAGGGGCAAATACATCCT −1261/−1237−972 CTTGCTCGAGCTGTTGATGTAGGTG −972/−948−662 TTCACTCGAGACTCCTTGAACCACT −662/−638−245 GCTTCTCGAGCCTTAAGTGGGAGAG −245/−221−564 CTCGAGCACAGAGAGGCGCCAGa −564/−549−540 CTCGAGGGGCCACTGCATTCCC −540/−525−471 CTCGAGTCCTCCGCCGGCCGTT −471/−456−359 CTCGAGGACAGGCACGACGCAC −359/−344−323 CTCGAGTCTTCAGGGGCTGCAC −323/−308TDQRb AAGCTTTCCCGAATACGCATC +8/−7

Primers for site-directed mutagenesisSP1TBf GCCGGCCGTTGCCCcccCCCCGTAGGGTGG −465/−436SP1TBr CCACCCTACGGGGgggGGGCAACGGCCGGC −436/−465

a Nucleotides underlined are restriction enzyme sites.b Reverse primer.

191P. Cong et al. / Gene 548 (2014) 190–197

combine these with other types of domains. For example, TDRD6 hasonly eight tandem Tudor domain repeats, whereas TDRD1 has four tan-dem Tudor domain repeats and a zinc–finger domain (Chen et al.,2011). Therefore, apart from bindingmethylarginine via Tudor domain,some TDRD proteins may have additional functions.

Using the SMART (simple modular architecture research tool) andPfam (protein families) databases, TDRD10 has been predicted to havea single Tudor domain and a RNA recognition motif (RRM), suggestingthat it may be involved in the metabolism of RNA. It was also predictedto contain extended Tudor domains (eTud), typically of ~180 residues,which flank the canonical Tudor module and could extend its capacityof binding methylarginine (H. Liu et al., 2010; K. Liu et al., 2010). How-ever, the information on TDRD10 gene and its expression profile is lim-ited. Here, we report that porcine TDRD10 contains a single Tudordomain and a RRM motif. It is expressed in a number of tissues and lo-calized to both the nucleus and cytoplasm. Serial deletions reveal thatseveral positive and negative regulation elements are located at the5′-flanking sequence of porcine TDRD10 gene. Site-directed mutagene-sis points out that one of the positive elements, which is predicted tobe an Sp1 binding site, plays key role in controlling the promoter activ-ity of porcine TDRD10 gene. Thus, our study provides basis for further in-vestigation of the porcine TDRD10 gene.

2. Materials and methods

2.1. Molecular analysis of porcine TDRD10 gene

The cDNA sequence of human TDRD10 gene (Gene ID: 126668) wasused as probe for doing BLAST searches in the porcine expressed se-quence tag (EST) database. The ESTs obtained were aligned to establisha consensus sequence. Some information of porcine TDRD10 gene, likeopen reading frame (ORF), amino acids encoded, calculated molecularmass, and isoelectric point (pI) were then predicted by DNASTAR(DNASTAR, Inc., Madison, WI, USA). The structural gene domains werepredicted online by motif scan.

2.2. Chromosome mapping

After comparison of cDNA sequences between porcine and mouseTDRD10 gene, the primers for chromosome mapping were designed inthe non-conservative 3′UTR. The PCRwas carried out under the follow-ing conditions: 95 °C for 5min, 35 cycles of 95 °C for 30 s, 60 °C for 30 s,72 °C for 30 s, 72 °C for 3min. The PCR typing datawere then submittedto IMpRH server for statistical analysis.

2.3. 5′-Rapid amplification of cDNA ends (5′-RACE)

The transcriptional start site for porcine TDRD10genewasdeterminedby 5′-RACE using RNA from the muscle tissues. The nest PCR primers(TDRD-GSP1 and TDRD-GSP2, Table 1) in combination with the UniversalPrimer A Mix (UPM) supplied in the SMARTTM RACE Kit (Clontech Inc.,Palo Alto, CA, USA) were used to amplify the 5′-end of the cDNA. Thefirst PCR was carried out with touchdown PCR conditions: 5 cycles of94 °C for 30 s, 72 °C for 3 min; 5 cycles of 94 °C for 30 s, 70 °C for 30 s,72 °C for 3 min; 30 cycles of 94 °C for 30 s, 67 °C for 30 s, 72 °C for3 min. The second PCR was performed as follows: 95 °C for 5 min,29 cycles of 94 °C for 30 s, 60 °C for 30 s, 72 °C for 30 s, 72 °C for 3 min.The template used in the second PCR was a 20-fold dilution of the firstPCRproducts. The second PCRproductswere purifiedby agarose gel elec-trophoresis and cloned into the pGEM-T-Easy vector prior to sequencing.

2.4. Dual-luciferase reporter assay

Serial deletions were made at the 5′-regulatory region of porcineTDRD10 gene by PCR, using a common 3′ primer and different 5′primers. These deletions were then subcloned into the HindIII–XhoI

site of pGL3-basic luciferase expression vector (Promega Corp.). Aftersequence verification, the plasmids were extracted with an Endo-freePlasmidMini Kit (OMEGA, USA) and quantifiedwith the ND-1000 Spec-trophotometer (NanoDrop Technologies, USA). Site-directed mutagen-esis was performed using the Quikchange XL Kit (Stratagene) with themutation primers (Table 1). Cell transfectionwas performed using Lipo-fectamine 2000 according to the manufacturer's instructions. C2C12cells were grown in 24-well plates and transfected with constructedvectors. After 18 h of transfection, cells were treated with or without100 nM 12-Otetradecanoylphorbol-13-acetate (TPA) (Sigma-Aldrich,St. Louis, MO) for 6 h. At the end of the treatment, cells were lysed andsubjected to luciferase activity analysis by using the dual-luciferasereporter assay system (Promega Corp.), following themanufacturer's in-structions. The luciferase activities were measured with a luminometer(Centro LB 960, Berthold, Bad Wildbad, Germany). The pGL3-basicvector was used as the external control. The Renilla luciferase reporterplasmid (pRL-TK vector, Promega Corp.) was co-transfected in eachcase to normalize the transfection efficiency. All experiments werecarried out in triplicate and repeated twice.

2.5. Real-time PCR analysis of TDRD10 expression in different tissues

The expression of TDRD10 gene was examined in 12 tissues (heart,testicle, back fat, spleen, lung, longissimus dorsal muscles, liver,stomach, kidney, brain, small intestines, and large intestines), whichwere obtained from three adult Chinese indigenous Lantang pigs. Brief-ly, total RNA from tissue samples was isolated by Trizol reagent(Invitrogen, Carlsbad, CA, USA) and treated with RNasefree DNase(MBI Fermentas, St. Leon-Rot, Germany). The quality of total RNAwas assessed by agarose gel electrophoresis and by the ND-1000

Fig. 2. Extension of the TDRD10 cDNA at its 5′ end (5′ RACE). Polymerase chain reactionamplification of the TDRD10 cDNA 5′ end was performed with the forward primer UPMand the reverse primers TDRD-GSP1 and TDRD-GSP2.

192 P. Cong et al. / Gene 548 (2014) 190–197

Spectrophotometer (NanoDrop Technologies, USA). Total RNA was thenreverse transcribed using M-MLV reverse transcriptase (Promega Corp.,Madison, WI). Real time PCR was carried out using beta-actin gene(ACTB) as an internal control. For quantification of transcripts, standardcurves were generated for ACTB and TDRD10 genes from a tenfold serialdilution of cDNA, whichwas pooled from a subset of the spleen samples.The efficiency values of primers forACTB and TDRD geneswere 1.969 and2.002, respectively. The results were analyzed using the 2−△△Ct method.The cycling conditions consisted of an initial single cycle of 95 °C for 10 s,followed by 40 cycles of 95 °C for 5 s and 60 °C for 20 s, then a singlecycle of 95 °C for 10 s, 65 °C for 15 s. The reaction was run on aLightCycler 480 Real-Time PCR System (Roche Ltd., Switzerland) usingSYBR Premix Ex Taq (TaKaRa, Biotechnology Co. Ltd., Dalian, P.R.C.).

2.6. Cell culture and transfection

Porcine kidney epithelial cell line PK15 was used in this study. PK15cells were maintained at 37 °C under 5% CO2 in Dulbecco's modifiedEagle's medium (DMEM) supplemented with 10% fetal bovine serum(GIBCO-Invitrogen), 100 U/mL penicillin, and 0.1 mg/mL streptomycin.Theywere seeded onto coverslips and grown in 6-well or 24-well platesuntil 80% confluence. Transient transfection of plasmids into PK15 cellswas then performed using Lipofectamine 2000 (Invitrogen) followingthe manufacturer's instructions.

2.7. Subcellular distribution of porcine TDRD10 protein

The CDS of TDRD10 genewas amplified (Table 1) and subcloned intothe HindIII–XhoI site of the pEGFP-C1 vector (BD Biosciences Clontech).After sequence verification, the plasmids were extracted using Endo-free Plasmid Mini Kit (Omega) and quantified with the ND-1000 Spec-trophotometer (NanoDrop Technologies). The plasmids (4 mg) andthe lipofectamine 2000 (10 mL) were co-transfected into PK15 cellsgrown in 6-well plates.

After 24 h of transfection, cells were incubated at 37 °C for 15min ingrowth medium containing 200 nMMito-Tracker® Orange (MolecularProbes; Eugene) for mitochondrial labeling, or ER-Tracker® Red(Molecular Probes; Eugene) for endoplasmic reticulum labeling,

Fig. 1. Schematic representation of the genomic organization of the porcine TDRD10 gene. Theand putative protein are also demonstrated.

respectively. After being washed with PBS, the cells were incubated at37 °C for 5min with 10mMHoechst 33342. Then, the slides were proc-essedwith formaldehyde,mounted, sealed, and analyzedwith anOlym-pus FluoViewTM FV1000 Confocal Microscope (Olympus). The resultswere processed with FV1000 Viewer software.

exon/intron structure is shown and the 13 exons are colored in pink. The mRNA structure

193P. Cong et al. / Gene 548 (2014) 190–197

3. Results

3.1. Molecular cloning and sequence analysis

Using the human TDRD10 gene cDNA sequence (Gene ID: 126668)as the probe, 20 porcine ESTs were identified via BLAST and these over-lapping sequences were assembled into a contig. Primers were designedbased on this contig, and a cDNA fragment corresponding to the porcineTDRD10 gene was generated by RT-PCR. The cDNA sequence of TDRD10,consisting of an ORF of 1056 bp and encoding 351 amino acids, was ob-tained and submitted to GenBank (GenBank accession no. EU650400).After alignment of the porcine TDRD10 cDNA sequence with the porcinegenomic sequence NW_001246198, we identified that TDRD10 spannedapproximately 52.7 kb of the genome, containing 13 exons and 12 in-trons (Fig. 1), and all exon/intron junctionswere in accordancewith uni-versal RNA splice criteria (GT-AG rule). The gene product of TDRD10 hasa calculated molecular mass of 39.19 kDa and an isoelectric point (pI) of8.112. Online analysis using motif scan showed that porcine TDRD10protein contains a Tudor domain and a RRM domain (Fig. 1).

Fig. 3. Structure of the porcine TDRD10 gene promoter. A 1576-bp genomic clone of porcine TDscription factors. The putative transcription initiation site is designated the +1 nucleotide, anmatches to the noted transcription factor or promoter element are depicted. Primers for prom

To determine the transcription initiation sites of the TDRD10gene, 5′-RACE was carried out in this study. A 755 bp fragmentwas cloned in thefirst PCR, and a 253 bp fragmentwas cloned in the sec-ond PCR (Fig. 2). A total of 7 positive clones revealed the same 5′-endin the first exon: 239 bp upstream to translational start site (Fig. 3),which was verified as transcription start site (TSS) and designatedas +1. The 5′-regulatory region of the gene, as well as genomicsequence, was obtained from the porcine genomic sequenceNC_010446.4. Sequence analysis of 1576 bp of 5′-regulatory region re-vealed many functional cis-elements, including the binding sites forTFIID, CAC-binding protein and Sp1. No TATA box or CAAT box wasidentified (Fig. 3).

3.2. Chromosome assignment

Using IMpRH server analysis, the porcine gene for TDRD10 wasassigned to chromosome 4. It closely linked to themicrosatellitemarkerS0214 (LOD score 5.63) with 20% retention frequency.

RD10 was sequenced and analyzed for consensus sequences to known mammalian tran-d the remainder of the sequence is numbered relative to this. Conservative homologousoter analysis are also indicated.

194 P. Cong et al. / Gene 548 (2014) 190–197

3.3. Functional promoter analysis of porcine TDRD10 gene

In order to define the promoter region that is critical for the expres-sion of TDRD10 gene, several promoter deletion fragments were gener-ated and cloned into pGL3-basic: −1568/+8, −1261/+8, −972/+8,−662/+8, and −245/+8 (Table 1, Fig. 3). The construct that showedthe highest promoter activity was−662/+8. Therefore, it was selectedfor further analysis, using five deletion constructs: −564/+8, −540/+8,−471/+8,−359/+8, and−323/+8 (Table 1, Fig. 3). Subsequentdeletions of the promoter region from −1568 to −662 caused contin-uous significant increases in the promoter activity, which implied thatthis region contained several negative regulatory elements (Fig. 4A).Deletion of the region from −471 to −359 induced a significant de-crease of promoter activity while a dramatic increase was observedafter further deletion from −359 to −323 (p b 0.01; Fig. 4B). Site-

Fig. 4. The 5′-deletion analysis of the promoter activity of porcine TDRD10 and site-directedmuthe TDRD10 promoter were inserted into luciferase reporter vectors, followed by transfection inan internal reference, and luciferase valueswere normalized to Rluc activity. The X-axis indicateSE of at least three independent experiments. **, P b 0.01. (A) 1576 bp of the 5′ promoterwas linked to the luciferase gene, designated −1568/+8. Serial constructs in which the prom−972/+8, −662/+8, and −245/+8. (B) Serial 5′-deletion constructs generated for −662and −323/+8. (C) Mutation of a cis-element on−471/+8, which was predicted to be a Sp1

directed mutagenesis of the putative Sp1 binding site located from−451 to −445 resulted in an almost 68% activity drop from wild-typeconstruct −471/+8 (p b 0.01; Fig. 4C). These results indicate that the−662/+8 acts as an optimal promoter and there are a great many ofnegative and positive regulation elements located at the region from−1568 to+8, regulating the promoter activity of porcine TDRD10 gene.

3.4. Spatial expression patterns of porcine TDRD10 gene

The expression of porcine TDRD10 gene was examined in 12 tissues.Among these tissues, heart displayed the highest levels of expression.TDRD10 was also expressed relatively high in testicle, back fat, spleen,and lung. Expression levels of TDRD10 in kidney, brain, small intestinesand large intestines were low and only detectable (Fig. 5).

tation of an important cis-element. The 5′ truncated or site-directedmutated fragments ofto the C2C12 cell line. The pRL-TK vector encoding Renilla luciferase was co-transfected ass fold-activation to normalized luciferase activities. The results are represented asmeans±region of pig TDRD10 (−1568 to +8 corresponds to the transcription initiation site)oter region was deleted are depicted. The resultant plasmids were named −1261/+8,

/+8. The resultant plasmids were named −564/+8, −540/+8, −471/+8, −359/+8,binding site.

Fig. 5. Porcine TDRD10 mRNA expression in different tissues. The expression of TDRD10was quantified. Data were normalized to large intestines (set to 1) and presented asmean ± SEM (n = 3).

Fig. 6. Localization of the porcine TDRD10 construct in PK15 cells. Cell nuclei were stained withGFP (green). Merging of the previous three signals can produce the last overlay image.

195P. Cong et al. / Gene 548 (2014) 190–197

3.5. Subcellular distribution of the TDRD10-GFP fusion protein in PK15 cells

We further visualized the subcellular distribution of the TDRD10-GFP fusion protein by confocal fluorescence microscopy. In PK15 cells,GFP signals weremainly distributed in cell nuclei. Some signals also ap-peared in the cytoplasm of these cells, but were excluded from mito-chondria (Fig. 6).

4. Discussion

Tudor domain containing proteins (TDRDs) are an evolutionarilyconserved family of proteins, containing 12 members. Each member inthis family contains one or more Tudor domains, which are discerniblesequence motifs of approximately 60 amino acid residues (Chen et al.,2011). Here, we studied the porcine TDRD10 gene, a novel member ofTDRD family, which had few information been revealed before.

Most of the 12 mammalian TDRD proteins have male germline­specific or germline­enriched expression patterns and are strongly as-sociated with the piRNA pathway and gametogenesis (Jin et al., 2009;Siomi et al., 2010). Knowledge of the subcellular distribution of TDRDproteins may provide further insights into their functions. Many TDRDfamily proteins, such as TDRD1, TDRD5/6/7, and TDRD9 specially local-ize to particular cytoplasmic structures called nuage or germinal gran-ules in germ cells, and contribute to chromatoid body assembly(Hosokawa et al., 2007; Tanaka et al., 2011; Vasileva et al., 2009;

DAPI (blue). Mitochondria were stained withMitoTracker (red). TDRD10 was tagged with

196 P. Cong et al. / Gene 548 (2014) 190–197

Yabuta et al., 2011). TDRD1 and TDRD5 also exhibit localizations to theintermitochondrial cement (Chuma et al., 2003, 2006; Yabuta et al.,2011). In U2OS cells, ectopically expressed TDRD1 collects in many cy-toplasmic foci (Vagin et al., 2009). TDRD3, however, functions both inthe cytoplasm and in the cell nucleus. In the cytoplasm, it interactswith FMRP in stress granules (Goulet et al., 2008; Linder et al., 2008),whereas in the nucleus, it binds to methylated arginines of histones topromote transcription of regions like estrogen-responsive element(Yang et al., 2010) and acts as a transcriptional co-activator (Simset al., 2011).

In this study, we cloned the cDNA sequence of the porcine TDRD10gene. Based on software analysis, we reported that porcine TDRD10gene had an ORF of 1068 bp, which encodes 355 amino acids. Using on-line tools, we also found that porcine TDRD10 had one Tudor motif. Weobserved porcine TDRD10 widely expressed and localized both to thenucleus and cytoplasm, like TDRD3 and TDRD11. It was detected in allthe twelve tissues by real time PCR, with heart, testicle, back fat, spleenand lung showing relative high levels of expression. These results indi-cate that TDRD10 may have functions in cells other than germline. Itmay be associated with specific cellular activities in these tissues or,alternatively, may play more general roles like regulation of RNAmetabolism.

After determining the transcriptional start site (TSS) of the porcineTDRD10 gene, which was designated as +1, we cloned the nucleotidesfrom −1568 to +8 relative to the TSS. This region shows 87% identityto that of Homo sapiens and Bos taurus. These three homologs are allcharacterized by the presence of abundant Sp1 binding sites afterbeing analyzed by online tools TFSEARCH and TESS.

Serial 5′ deletion of the porcine TDRD10 gene promoter revealed thatseveral negative regulation elements were located on the regions from−1568 to−662 and from−359 to−323, and several positive regula-tion elements were located on the nucleotides from −662 to −564,−471 to−359 and −323 to +8. The nucleotides that spanned −662to +8 acts as an optimal promoter. This complicated transcriptionalregulation pattern is consistent to its wide expression, implicating thatthe porcine TDRD10 gene may participate in different signal pathways,achieving multiple functions. Site-directed mutagenesis of one putativeSp1 binding site resulted in almost 68% decrease of the promoter activ-ity, suggesting that Sp1 may play a key role on the transcriptional regu-lation of the porcine TDRD10 gene.

Sp1 family proteins are ubiquitously expressed in many tissues andthey can promote the assembly of transcription complexes byinteracting with transcription factors, such as TFIID (Ellwood et al.,1999). Expression and gene-knockout studies are beginning to revealthat most, if not all, Sp1-like/KLF proteins are involved in growth-regulatory or developmental processes of a large number of tissues(Black et al., 2001; Kaczynski et al., 2003). For instance, the knockoutof Sp1 gene in murine cells leads to gross global morphological defectsvery early in development (Marin et al., 1997). Sp1 binds to GC or GT-box elements present in the promoters of a number of male germ celltarget genes that are developmentally expressed during spermatogene-sis. Several alternatively spliced transcripts have been identifiedencoding Sp1 isoforms that display stage and cell-type-specific expres-sion profiles in differentiating germ cells in the seminiferous epitheliumof the testis (Thomas et al., 2007). Taking together, it was suggested thatSp1 may act as a key factor regulating the transcription of porcineTDRD10 gene, to fulfill its multiple functions in such many differenttissues.

In summary, this study provides first evidence that the promoter ofporcine TDRD10 gene has a complicated transcriptional regulation pat-tern characterized by multiple positive and negative regulation ele-ments. It was detected in all the 12 tissues analyzed and observed inboth the nucleus and cytoplasm. The promoter sequence of porcineTDRD10 gene shows high identity to the homologs from H. sapiens andB. taurus. The regulatory element identified in the sequence from−451 to −445, which was predicted to be an Sp1 binding site, plays

a critical role in controlling the optimal promoter activity. Our findingsoffer new information on the transcription of porcine TDRD10 geneand point to a link between Sp1 transcription factor and TDRD10 gene.This may contribute to further investigation into the regulation mecha-nism behind the transcription of the porcine TDRD10 gene.

Acknowledgments

This study was funded by the “Fundamental Research Funds for theCentral Universities” (No. 11lgpy46), the Chinese National Basic Re-search Program (973 Program) (No. 2010CB945404), and the NationalTransgenic Major Program of China (No. 2011ZX08006-005).

References

Aravin, A.A., Hannon, G.J., Brennecke, J., 2007. The Piwi–piRNA pathway provides an adap-tive defense in the transposon arms race. Science 318, 761–764.

Black, A.R., Black, J.D., Azizkhan-Clifford, J., 2001. Sp1 and kruppel-like factor family oftranscription factors in cell growth regulation and cancer. J. Cell. Physiol. 188,143–160.

Brahms, H., Meheus, L., de Brabandere, V., Fischer, U., Luhrmann, R., 2001. Symmetricaldimethylation of arginine residues in spliceosomal Sm protein B/B′ and the Sm-likeprotein LSm4, and their interaction with the SMN protein. RNA 7, 1531–1542.

Callebaut, I., Mornon, J.P., 1997. The human EBNA-2 coactivator p100: multidomain orga-nization and relationship to the staphylococcal nuclease fold and to the tudor proteininvolved in Drosophila melanogaster development. Biochem. J. 321 (Pt 1), 125–132.

Chen, C., Nott, T.J., Jin, J., Pawson, T., 2011. Deciphering arginine methylation: Tudor tellsthe tale. Nat. Rev. Mol. Cell Biol. 12, 629–642.

Chuma, S., Hiyoshi, M., Yamamoto, A., Hosokawa, M., Takamune, K., Nakatsuji, N., 2003.Mouse Tudor Repeat-1 (MTR-1) is a novel component of chromatoid bodies/nuagesin male germ cells and forms a complex with snRNPs. Mech. Dev. 120, 979–990.

Chuma, S., Hosokawa, M., Kitamura, K., Kasai, S., Fujioka, M., Hiyoshi, M., Takamune, K.,Noce, T., Nakatsuji, N., 2006. Tdrd1/Mtr-1, a tudor-related gene, is essential formale germ-cell differentiation and nuage/germinal granule formation in mice. Proc.Natl. Acad. Sci. U. S. A. 103, 15894–15899.

Cote, J., Richard, S., 2005. Tudor domains bind symmetrical dimethylated arginines. J. Biol.Chem. 280, 28476–28483.

Ellwood, K., Huang, W., Johnson, R., Carey, M., 1999. Multiple layers of cooperativity reg-ulate enhanceosome-responsive RNA polymerase II transcription complex assembly.Mol. Cell. Biol. 19, 2613–2623.

Friesen, W.J., Massenet, S., Paushkin, S., Wyce, A., Dreyfuss, G., 2001. SMN, the product ofthe spinal muscular atrophy gene, binds preferentially to dimethylarginine-containing protein targets. Mol. Cell 7, 1111–1117.

Goulet, I., Boisvenue, S., Mokas, S., Mazroui, R., Cote, J., 2008. TDRD3, a novel Tudordomain-containing protein, localizes to cytoplasmic stress granules. Hum. Mol.Genet. 17, 3055–3074.

Hosokawa, M., Shoji, M., Kitamura, K., Tanaka, T., Noce, T., Chuma, S., Nakatsuji, N., 2007.Tudor-related proteins TDRD1/MTR-1, TDRD6 and TDRD7/TRAP: domain composi-tion, intracellular localization, and function in male germ cells in mice. Dev. Biol.301, 38–52.

Jin, J., Xie, X., Chen, C., Park, J.G., Stark, C., James, D.A., Olhovsky, M., Linding, R., Mao, Y.,Pawson, T., 2009. Eukaryotic protein domains as functional units of cellular evolution.Sci. Signal. 2, ra76.

Kaczynski, J., Cook, T., Urrutia, R., 2003. Sp1- and Kruppel-like transcription factors.Genome Biol. 4, 206.

Kirino, Y., Kim, N., de Planell-Saguer, M., Khandros, E., Chiorean, S., Klein, P.S., Rigoutsos, I.,Jongens, T.A., Mourelatos, Z., 2009. Argininemethylation of Piwi proteins catalysed bydPRMT5 is required for Ago3 and Aub stability. Nat. Cell Biol. 11, 652–658.

Kojima, K., Kuramochi-Miyagawa, S., Chuma, S., Tanaka, T., Nakatsuji, N., Kimura, T.,Nakano, T., 2009. Associations between PIWI proteins and TDRD1/MTR-1 are criticalfor integrated subcellular localization in murine male germ cells. Genes Cells 14,1155–1165.

Linder, B., Plottner, O., Kroiss, M., Hartmann, E., Laggerbauer, B., Meister, G., Keidel, E.,Fischer, U., 2008. Tdrd3 is a novel stress granule-associated protein interacting withthe fragile-X syndrome protein FMRP. Hum. Mol. Genet. 17, 3236–3246.

Liu, H.,Wang, J.Y., Huang, Y., Li, Z., Gong,W., Lehmann, R., Xu, R.M., 2010a. Structural basisfor methylarginine-dependent recognition of Aubergine by Tudor. Genes Dev. 24,1876–1881.

Liu, K., Chen, C., Guo, Y., Lam, R., Bian, C., Xu, C., Zhao, D.Y., Jin, J., MacKenzie, F., Pawson, T.,Min, J., 2010b. Structural basis for recognition of argininemethylated Piwi proteins bythe extended Tudor domain. Proc. Natl. Acad. Sci. U. S. A. 107, 18398–18403.

MacKenzie, A.E., Gendron, N.H., 2001. Tudor reign. Nat. Struct. Biol. 8, 13–15.Marin, M., Karis, A., Visser, P., Grosveld, F., Philipsen, S., 1997. Transcription factor Sp1 is

essential for early embryonic development but dispensable for cell growth and differ-entiation. Cell 89, 619–628.

Maurer-Stroh, S., Dickens, N.J., Hughes-Davies, L., Kouzarides, T., Eisenhaber, F., Ponting, C.P.,2003. The Tudor domain ‘Royal Family’: Tudor, plant Agenet, Chromo, PWWP andMBTdomains. Trends Biochem. Sci. 28, 69–74.

Pan, J., Goodheart, M., Chuma, S., Nakatsuji, N., Page, D.C., Wang, P.J., 2005. RNF17, a com-ponent of the mammalian germ cell nuage, is essential for spermiogenesis. Develop-ment 132, 4029–4039.

197P. Cong et al. / Gene 548 (2014) 190–197

Ponting, C.P., 1997. Tudor domains in proteins that interact with RNA. Trends Biochem.Sci. 22, 51–52.

Reuter, M., Chuma, S., Tanaka, T., Franz, T., Stark, A., Pillai, R.S., 2009. Loss of the Mili-interacting Tudor domain-containing protein-1 activates transposons and alters theMili-associated small RNA profile. Nat. Struct. Mol. Biol. 16, 639–646.

Selenko, P., Sprangers, R., Stier, G., Buhler, D., Fischer, U., Sattler, M., 2001. SMN tudor do-main structure and its interaction with the Sm proteins. Nat. Struct. Biol. 8, 27–31.

Shoji, M., Tanaka, T., Hosokawa, M., Reuter, M., Stark, A., Kato, Y., Kondoh, G., Okawa, K.,Chujo, T., Suzuki, T., Hata, K., Martin, S.L., Noce, T., Kuramochi-Miyagawa, S.,Nakano, T., Sasaki, H., Pillai, R.S., Nakatsuji, N., Chuma, S., 2009. The TDRD9–MIWI2complex is essential for piRNA-mediated retrotransposon silencing in the mousemale germline. Dev. Cell 17, 775–787.

Sims III, R.J., Rojas, L.A., Beck, D., Bonasio, R., Schuller, R., Drury III, W.J., Eick, D., Reinberg,D., 2011. The C-terminal domain of RNA polymerase II is modified by site-specificmethylation. Science 332, 99–103.

Siomi, M.C., Mannen, T., Siomi, H., 2010. How does the royal family of Tudor rule thePIWI-interacting RNA pathway? Genes Dev. 24, 636–646.

Talbot, K., Miguel-Aliaga, I., Mohaghegh, P., Ponting, C.P., Davies, K.E., 1998. Characteriza-tion of a gene encoding survival motor neuron (SMN)-related protein, a constituentof the spliceosome complex. Hum. Mol. Genet. 7, 2149–2156.

Tanaka, T., Hosokawa, M., Vagin, V.V., Reuter, M., Hayashi, E., Mochizuki, A.L., Kitamura, K.,Yamanaka, H., Kondoh, G., Okawa, K., Kuramochi-Miyagawa, S., Nakano, T.,

Sachidanandam, R., Hannon, G.J., Pillai, R.S., Nakatsuji, N., Chuma, S., 2011. Tudor do-main containing 7 (Tdrd7) is essential for dynamic ribonucleoprotein (RNP) remod-eling of chromatoid bodies during spermatogenesis. Proc. Natl. Acad. Sci. U. S. A. 108,10579–10584.

Thomas, K., Wu, J., Sung, D.Y., Thompson, W., Powell, M., McCarrey, J., Gibbs, R., Walker,W., 2007. SP1 transcription factors in male germ cell development and differentia-tion. Mol. Cell. Endocrinol. 270, 1–7.

Vagin, V.V., Wohlschlegel, J., Qu, J., Jonsson, Z., Huang, X., Chuma, S., Girard, A.,Sachidanandam, R., Hannon, G.J., Aravin, A.A., 2009. Proteomic analysis of murinePiwi proteins reveals a role for arginine methylation in specifying interaction withTudor family members. Genes Dev. 23, 1749–1762.

Vasileva, A., Tiedau, D., Firooznia, A., Muller-Reichert, T., Jessberger, R., 2009. Tdrd6 is re-quired for spermiogenesis, chromatoid body architecture, and regulation of miRNAexpression. Curr. Biol. 19, 630–639.

Wang, J., Saxe, J.P., Tanaka, T., Chuma, S., Lin, H., 2009. Mili interacts with tudor domain-containing protein 1 in regulating spermatogenesis. Curr. Biol. 19, 640–644.

Yabuta, Y., Ohta, H., Abe, T., Kurimoto, K., Chuma, S., Saitou, M., 2011. TDRD5 is requiredfor retrotransposon silencing, chromatoid body assembly, and spermiogenesis inmice. J. Cell Biol. 192, 781–795.

Yang, Y., Lu, Y., Espejo, A., Wu, J., Xu,W., Liang, S., Bedford, M.T., 2010. TDRD3 is an effectormolecule for arginine-methylated histone marks. Mol. Cell 40, 1016–1023.