Molecular and biological characterization of circulating ...shodhganga.inflibnet.ac.in/bitstream/10603/50803/1/deepti thesis.pdf · This is to certify that the present work entitled

Molecular and biological characterization of

circulating human enteroviruses

Thesis Submitted to the

University of Lucknow, Lucknow

For the Degree of

DOCTOR OF PHILOSOPHY

By

Deepti Shukla

DEPARTMENT OF BOTANY

UNIVERSITY OF LUCKNOW

LUCKNOW-226007

INDIA

2013

August 2013

Certificate

This is to certify that the present work entitled “Molecular and Biological

characterization of circulating human enteroviruses” carried out by Deepti Shukla has

been fully observed. She has fulfilled all the requirements necessary for the award of the

degree of Doctor of Philosophy of Lucknow University, UP, Lucknow, India.

Dr. Y. K. Sharma

Prof. & Head

Department of Botany

University of Lucknow

Lucknow

August 2013

Certificate

This is to certify that the present work entitled “Molecular and biological characterization

of circulating human enteroviruses” has been carried out by Deepti Shukla, under our

direct supervision and guidance. The techniques and methods described were undertaken

by the candidate himself and observations have been periodically checked by us. The

results contained in the thesis have not been submitted, in part or full, to any other

University or Institute for the award of any degree or diploma.

It is further certified that the candidate has been also fulfilled all the pre-requisites

necessary for the submission of this research work as required by the University.

Guide Co-Guide

Dr. Shalini Srivastava Dr. Tapan N Dhole Reader Prof. & Head

Department of Botany, Department of Microbiology

Lucknow University Sanjay Gandhi Post Graduate

Lucknow- 226007 Institute of Medical Sciences

Lucknow-226014

Acknowledgement

I would like to put into words my gratitude and appreciations to all whosoever have

helped in the completion of my thesis work.

Particularly, I would like to express my deep sense of gratitude and indebtedness

towards my guide Dr. Shalini SrivastavaDr. Shalini SrivastavaDr. Shalini SrivastavaDr. Shalini Srivastava, Department of Botany, University of Lucknow,

Lucknow. It’s a great learning experience to work under her supervision and continuous

support during the conduct of my work.

I have been very fortunate to have Dr. Tapan N DholeDr. Tapan N DholeDr. Tapan N DholeDr. Tapan N Dhole, Prof. & Head, Department of

Microbiology, Sanjay Gandhi Post Graduate Institute of Medical Sciences (SGPGIMS),

Lucknow as my co-guide. It gives me immense pleasure to express my deepest gratitude and

regards for his supervision and continuous support during the conduct of my thesis work. I

take this opportunity to thank him for giving me boundless amount of freedom, and clarity to

my ideas. He has always placed his full faith and trusted me that further inspire me to believe

in my research goals and instilled self-confidence and determination to achieve them. It was

his constant encouragement which made this seemingly difficult task a challenging one. I wish

to thank him for all the support and love that he bestowed on me.

I wish to convey my regards to the Vice Chancellor of University of Lucknow,

Lucknow for registering me as a Ph.D student at their prestigious Institution.

I also express my sincere thanks to The Director, Sanjay Gandhi Post Graduate

Institute of Medical Sciences, Lucknow to acquiescence for the study.

I am grateful to faculty members of Department of Microbiology, SGPGIMS,

Lucknow ((((Dr. K.N. Prasad, Dr. JanDr. K.N. Prasad, Dr. JanDr. K.N. Prasad, Dr. JanDr. K.N. Prasad, Dr. Janak Kishore, Dr. Ujjala Ghoshal and Dr. Rungmei SK ak Kishore, Dr. Ujjala Ghoshal and Dr. Rungmei SK ak Kishore, Dr. Ujjala Ghoshal and Dr. Rungmei SK ak Kishore, Dr. Ujjala Ghoshal and Dr. Rungmei SK

Marak)Marak)Marak)Marak) for invigorating academic sessions to make us better scholars.

I am fortunate to have a friend, Dr. Arvind KumarArvind KumarArvind KumarArvind Kumar who provided much needed

assistance and timely support throughout the course of my work.

I would like to extend my thanks to my seniors and colleagues Dr. Rashmi Chowdhary, Dr. Rashmi Chowdhary, Dr. Rashmi Chowdhary, Dr. Rashmi Chowdhary,

Dr. Amit Prasad, Dr. Manju Ohri, Dr. Amit Prasad, Dr. Manju Ohri, Dr. Amit Prasad, Dr. Manju Ohri, Dr. Amit Prasad, Dr. Manju Ohri, Dr. Anurag Rathore, Dr. Anurag Rathore, Dr. Anurag Rathore, Dr. Anurag Rathore, Dr. Animesh Chatterjee, Dr. Kishan Dr. Animesh Chatterjee, Dr. Kishan Dr. Animesh Chatterjee, Dr. Kishan Dr. Animesh Chatterjee, Dr. Kishan

Kumar Nyati, Dr. Sanjeev Tripathi, Dr. Vikas MishraKumar Nyati, Dr. Sanjeev Tripathi, Dr. Vikas MishraKumar Nyati, Dr. Sanjeev Tripathi, Dr. Vikas MishraKumar Nyati, Dr. Sanjeev Tripathi, Dr. Vikas Mishra,,,, Vijay Prakash, Deepak, PraVijay Prakash, Deepak, PraVijay Prakash, Deepak, PraVijay Prakash, Deepak, Pramesh, mesh, mesh, mesh,

Dharamveer, Nagendra, Hemant, Richa, Rambha, Pooja, Kavita, Sanjukta, Nikky Srivastava Dharamveer, Nagendra, Hemant, Richa, Rambha, Pooja, Kavita, Sanjukta, Nikky Srivastava Dharamveer, Nagendra, Hemant, Richa, Rambha, Pooja, Kavita, Sanjukta, Nikky Srivastava Dharamveer, Nagendra, Hemant, Richa, Rambha, Pooja, Kavita, Sanjukta, Nikky Srivastava

, Swati, Nivedita, , Swati, Nivedita, , Swati, Nivedita, , Swati, Nivedita, Aparna, Aparna, Aparna, Aparna, Vinod k Tripathi Vinod k Tripathi Vinod k Tripathi Vinod k Tripathi and Virendra K Mishraand Virendra K Mishraand Virendra K Mishraand Virendra K Mishra for providing exciting

and entertaining environment to learn and grow.

I am particularly thankful to all the computer staff of Virology, Saurabh,Saurabh,Saurabh,Saurabh, Aparna, Aparna, Aparna, Aparna,

Misha, Misha, Misha, Misha, and and and and Anil BabuAnil BabuAnil BabuAnil Babu for rendering their help in computer related work.

No words can complement the love and support provided by my parentsparentsparentsparents. The moral and

ethical values inherited, gave me the strength to take on this exigent task.

I would like to thank my husband RinkeshRinkeshRinkeshRinkesh, my sister MonikaMonikaMonikaMonika, my brothers PankajPankajPankajPankaj,

ShivamShivamShivamShivam, my nephew ShubhShubhShubhShubh, whole family and friends to keep faith in me by their continuous

support.

I am extremely thankful to the guardian of study subjects for providing clinical

samples of their child for this research work.

The financial support provided by Indian Council of Medical ResearchIndian Council of Medical ResearchIndian Council of Medical ResearchIndian Council of Medical Research, New Delhi,

and infrastructure provided by SGPGIMS, Lucknow for conducting this study is duly

acknowledged.

I firmly believe and thank “Divine Destiny of God”“Divine Destiny of God”“Divine Destiny of God”“Divine Destiny of God” for bestowing me with all his

blessings that have helped me to sail through good and bad times.

Deepti Shukla

Abbreviations

AFI Acute febrile illness

AFP Acute flaccid paralysis

AHC Acute Hemorrhagic Conjuntivitis

bp Base pair

CDC Centre for disease control and Prevention

cDNA Complementary deoxyribonucleic acid

CNS Central nervous system

Cont Control

CO2 Carbondioxide

CPE Cytopathic effect

CSF Cerebrospinal fluid

CV Coxsackievirus

DMSO Dimethyl sulfoxide

dNTP Deoxy-nucleotide triphosphate

DTT Dithiothreitol

ECV Echovirus

ELISA Enzyme Linked Immunosorbent Assay

EMEM Eagle’s minimal essential growth medium

EV Enterovirus

FBS Fetal bovine serum

FCS Fetal calf serum

GI Gastrointestinal infection

HEp-2 Human epithelial carcinoma cell line

HEV Human enterovirus

HRV Human rhinovirus

HSV Herpes simplex virus

ISVC Integrated shell vial culture

IC Intracereberal

IgG Immunoglobulin G

Kb Kilobases

MEM Minimal essential medium

Mg Milligram

Ml Milliliter

MEGA Molecular evolutionary genetic analysis

MRI Magnetic resonance imaging

MTT 3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium

bromide

MOI Multiplicity of Infection

NaCl Sodium chloride

NPEV Non polio enterovirus

nt Nucleotide

ORF Open reading frame

p1, p2, p3 The three positions of a codon

PABP1 Poly (A) binding protein 1

PBS Phosphate-buffered saline

PCR Polymerase chain reaction

PEG Polyethylene glycol

PFU Plaque forming unit

pH Phenophthaline

PV Poliovirus

Rct Reproductive capacities at different temperature

RD Human rhabdomyosarcoma cell line

RNA Ribonucleic acid

RT-PCR Reverse transcription - polymerase chain reaction

RT Reverse transcriptase

RTI Respiratory tract infection

SD Standard Deviation

SEAR South East Asia Region

SVDV Swine vesicular disease virus

TBS Tris buffered Saline

TCID Tissue culture infective dose

TE Tris EDTA buffer

µg Microgram

µM Micromole

Tm Melting temperature

UTR Untranslated region

URIs Urinary respiratory infections

UV Ultraviolet

VP Viral protein

WHO World Health Organization

WPV Wild Polio Virus

W/V Weight/volume

Contents

Chapter Page No.

1. Introduction 1-3

2. Aim and Objectives 4

3. Review of Literature 5-50

3.1. Classification 5-6

3.2. Epidemiology 6-7

3.3. Enterovirus structure and genome 7-10

3.4. Replication 10-11

3.5. Enterovirus pathogenesis 12-18

3.6. Clinical classification 18

3.6.1. Poliomyelitis 18-21

3.6.2. Aseptic meningitis and encephalitis 21-23

3.6.3. Neonatal sepsis 23-24

3.6.4. Nonspecific febrile illness 24-25

3.6.5. Respiratory illnesses 25-26

3.6.6. Herpangina 26-27

3.6.7. Hand foot and mouth disease 27-28

3.6.8. Pleurodynia 28-29

3.6.9. Acute hemorrhagic conjunctivitis 29-30

3.6.10. Acute myocarditis 30-32

3.6.11. Chronic Dilated Cardiomyopathy 32-33

3.6.12. Gastrointestinal illness 33

3.6.13. Juvenile onset diabetes-mellitus 33-34

3.6.14. Inflammatory Myositis 34-35

3.6.15. Chronic Fatigue syndrome 35

3.7. Laboratory diagnosis 36

3.7.1. Virus Isolation 36-37

3.7.2. Antigen detection 37

3.7.3. Serotyping and Serologic assays 37-39

3.7.4. Interpretation of results 39-40

3.7.5. Nucleic acid detection 40-42

3.8. Prevention 43

3.9. Treatment 43

3.9.1 Interferon 43-44

3.9.2 Immunoglobulins 44-45

3.9.3 Capsid inhibiting compounds 45-50

4. Material and Methods 51-65

4.1. Sample size 51

4.2. Inclusion criteria for disease patients 51-52

4.3. Clinical specimens 52-53

4.3.1 Clinical sample processing 53

4.3.2 Virus isolation from clinical specimens 53-54

4.4. Environmental sample 54

4.4.1 Environmental sample processing 54

4.4.2 Conventional viral isolation method 54-55

4.4.3 Shell vial culture method 55-56

4.5. RNA extraction 56-57

4.6. Real time RT-PCR for EV detection 57

4.7. Molecular identification of EV 57-58

4.8. RT PCR of CV A24v 3C region 59

4.9. Alignment and phylogenetic analysis 59-60

4.10. Virus titration 60

4.11. Cytopathogenic properties of the isolated EV in epithelium and neuronal cell

Line 60-61

4.12. MTT Assay 61

4.13. Rct Marker test 62

4.14. Mice inoculation 62-65

4.14.1. Mice 62-63

4.14.2. Organ suspension for viral isolation in tissue culture 63

4.14.3. Quantification of infectious virus in organs 64

4.14.4. Histology 64

4.15. Statistical analysis 64-65

5. Results 66-98

5.1 Detection and identification of enterovirus in clinical specimen 66-69

5.2 Detection and identification of enterovirus by Shell vial culture 69-70

and conventional method in sewage specimen

5.3 Prevalence of HEV infection in patient 71-73

5.4 Phylogenetic analysis 75-91

5.5 Cytopathogenic properties of the isolated EV in cell line 92

5.5.1 Temperature sensitivity of EV isolates 92-94

5.6 In vivo study of pathogenecity of predominant EV serotype in 95

BALB/c mice

5.6.1 Histopathological changes in selected organs 95-98

6 Discussion 99-107

7 Summary 108-115

8 References 116-130

9 Appendices 131-132

10 Publication and Scientific presentations 133-135

1. Introduction

Human enteroviruses (HEVs) are non-enveloped, RNA viruses that belong to the

genus Enterovirus in the family Picornaviridae. The enterovirus (EV) genome is a

single-stranded RNA molecule of approximately 7500 nucleotide (nt.) consisting of a

single open reading frame flanked by 5’ and 3’ untranslated (UTR) regions. The 5’ UTR

contains an internal ribosome-binding site, which is essential for translation initiation

(Chen et al. 1995). The 3’ UTR forms highly conserved secondary and tertiary structures

that are thought to be important in replication initiation (Mirmomeni et al. 1997). The

open reading frame is translated into a single, large polypeptide, which is subsequently

cleaved by viral proteases. The polypeptide is divided into three domains, P1 to P3,

consisting of three to four proteins each. The P1 region contains viral capsid proteins

VP1 to VP4, whilst P2 and P3 contain the non structural proteins (Hellen et al. 1995).

HEVs were originally classified on the basis of antigenic and pathogenic

properties in humans and mice. As phylogenetic methods to classify HEVs became

available, it became apparent that pathogenic properties were not sufficient to classify the

evolutionarily related viruses into correct groups. Using molecular properties, HEVs have

been classified into four species, human enterovirus A (HEVA), HEV B, HEV C, HEV D

(Knowles et al. 2011). Within an EV species, sequence divergence is greatest in the

capsid protein (VP1) coding region of the virus genome, and classifications based on

sequence variation in this region correlate completely with the classification made using

antigenic properties. It has been suggested that HEVs should be classified in the same

serotype if they have >75% nucleotide similarity in the VP1 coding sequence (>85%

amino acid sequence similarity) and into different serotypes if they have <70% nucleotide

similarity (<85% amino acid similarity) (Oberste et al. 2004).

Although the majority of HEVs infections are subclinical, HEV infection can lead

to a variety of acute and chronic diseases including mild upper respiratory illness, febrile

rash, aseptic meningitis, encephalitis, acute haemorrhagic conjunctivitis (AHC),

pleurodynia, acute flaccid paralysis (AFP), diabetes, myocarditis and neonatal sepsis-like

disease (Pallansch et al. 2001).

HEVs are transmitted by fecal-oral route, multiply in the gastrointestinal tract,

and are finally excreted in large numbers into the environment through feces.

Environmental surveillance of sewage is a suitable method for the detection of HEV

serotypes circulating in the community because infected humans shed virus into

environment through feces; this provides an alternative approach that would complement

the clinical data (Khetsuriani et al. 2010). Environmental surveillance of waste water for

poliovirus has been shown to be a sensitive method for the detection of wild or vaccine

derived poliovirus circulating in the community and monitoring the effectiveness of

vaccination against poliomyelitis. Continuous molecular epidemiological study of HEV

serotypes is necessary to study the changing patterns of enterovirus infection and disease

association, detection of new serotypes or variants and establishment of an

epidemiological link among cases during outbreak (Pallansch et al. 2003, Lukashev et al.

2005, Bingiun et al. 2008).

The conventional method for typing of HEV serotypes is isolation of the virus in

cell culture, followed by neutralization with mixed hyperimmune equine serum pools and

specific monovalent polyclonal antisera. The problems with this method are that some

HEV serotypes do not grow in culture and emergence of antigenic variants (Lukashev et

al. 2005, Trallero et al. 2010, Rahimi et al. 2009). In recent years, these method have

been replaced by molecular methods which is based on reverse transcription-polymerase

chain reaction (RT-PCR) and sequencing. Currently molecular diagnosis of HEVs is

based on the amplification of highly conserved 5’ UTR for HEV detection followed by

amplification and sequencing of the partial VP1 capsid region for serotype identification

(Oberste et al. 1999, Nix et al. 2006, Rahimi et al. 2009, Leitch et al. 2009).

The pathogenicity of HEVs is a complex phenomenon, evidently due to variation

in the genetic and immunological background of host, and is difficult to investigate in

humans. In vivo study related to pathogenesis of predominant serotype of isolated EVs in

an animal model will be helpful in understanding the tissue tropism properties, virulence

properties for the development of the vaccine.

However HEVs are ubiquitous; but some serotypes may be endemic at a

particular geographical area which might emerge into new variant causing epidemics

periodically. Hence, molecular and biological characterization of HEVs isolates from

clinical and environmental source may contribute significantly to the identification of

various epidemics and to the subsequent effective surveillance of populations by

determining the source of infection, the correlation between EV serotype and clinical

symptoms, the characteristics and pathogenesis of particularly virulent viruses, the

possible means of transmission, the emergence of new strains or the re-emergence of

older strains.

Chapter Chapter Chapter Chapter 2222 Aims and ObjectivesAims and ObjectivesAims and ObjectivesAims and Objectives

2. Aims and Objectives

To study enteroviruses infection and its socio-epidemiological determinants,

pathogenecity of predominant circulating enterovirus serotype.

1. Identification and molecular characterization of enteroviruses isolated from clinical

and environmental samples.

2. Phenotypic characterization of enterovirus isolated from clinical and environmental

samples.

3. In vivo study of pathogenicity of predominant enterovirus serotype in BALB/c mice.

Review of LiReview of LiReview of LiReview of Literatureteratureteratureterature

3. Review of literature

3.1. Classification

The genus Enterovirus in the family Picornaviridae is a group of non-enveloped

RNA viruses that cause a wide range of diseases in humans and other mammals. Based

on their ability to replicate in cells of human and primate origin, antigenic differences,

infectivity and pathogenicity in different animal species, HEVs were originally

subclassified into poliovirus (PV) serotypes 1 to 3, coxsackievirus (CV) group A

serotypes 1 to 22 and coxsackievirus group B serotypes 1 to 6; echoviruses (ECV)

serotypes 1 to 7, 9, 11 to 27, and 29 to 33 (Pallansch et al. 2006). The value of these

distinctions has to some extent been diminished by the availability of recently described

cell lines permissive for a wider range of enteroviruses and by the intrinsic variability of

biological phenotypes observed among naturally occurring enterovirus strains. Since

1970, newly identified serotypes have not been assigned to the above groups, but rather,

they have been numerically classified as enterovirus (EV) serotypes 68 to 71, 73, 74 to

78, and 89 to 91. In the present classification scheme, which takes into account both

biological and molecular properties of the viruses, the HEVs are divided among four

species differing from each other by >40% nucleotide sequence divergence in the capsid

region (Knowles et al. 2011).

The species Human enterovirus A consists of 22 serotypes: CV A2, CV A3, CV

A4, CV A5, CV A6, CV A7, CV A8, CV A10, CV A12, CV A14, CV A16, EV 71, EV

76, EV 89, EV 90, EV 91, EV 114 and the simian enteroviruses EV 92, SV 19, SV 43,

SV 46 and A13.


The species Human enterovirus B consists of 60 serotypes: CV B1, CV B2, CV

B3, CV B4, CV B5 (incl. swine vesicular disease virus [SVDV]), CV B6, CV A9, ECV

1, ECV 2, ECV 3, ECV 4, ECV 5, ECV 6, ECV 7, ECV 9, ECV 11, ECV 12, ECV 13,

ECV 14, ECV 15, ECV 16, ECV 17, ECV 18, ECV 19, ECV 20, ECV 21, ECV 24, ECV

25, ECV 26, ECV 27, ECV 29, ECV 30, ECV 31, ECV 32, ECV-33 and EV 69, EV 73,

EV 74, EV 75, EV 77, EV 78, EV 79, EV 80, EV 81, EV 82, EV 83, EV 84, EV 85, EV

86, EV 87, EV 88, EV 93, EV 97, EV 98, EV 100, EV 101, EV 106, EV 107, EV 110

(from a chimpanzee) and the simian enterovirus SA5.

The species Human enterovirus C consists of 21 types: PV 1, PV 2, PV 3, CV A1,

CV A11, CV A13, CV A17, CV A19, CV A20, CV A21, CV A22, CV A24, EV 95, EV

96, EV 99, EV 102, EV 104, EV 105, EV 109, EV 113 and EV 116.

The species Human enterovirus D consists of four serotypes, EV 68, EV 70, EV

94 and EV 111 (from both humans & chimpanzees). Human rhinovirus (HRV) 87 has

been reclassified as a strain of EV 68.

3.2. Epidemiology

EVs infections are of ubiquitous in nature and the wide variety of clinical

presentations, the demographics of the various infections and diseases have some

consistent characteristics. Several environmental factors are known to influence the

epidemiology of EVs. In tropical climates, the circulation of EVs is more or less constant

around the year (Melnick 1996), whereas in temperate climates, infections are typical for

late summer and fall (Moore 1982). Frequent and close person-to-person contact

facilitates the circulation of enteroviruses: intrafamiliar transmission is common (Kogon


et al. 1969, Lagercrantz et al. 1973) and spreading in day care centers and nurseries has

also been described (Gear et al. 1973, Helfand et al. 1994). Crowding, low socio

economic status and poor sanitation sometimes go hand in hand and they all have been

shown to be connected with an increased incidence of EV infections.

EV infections occur more frequently in males than in females. In numerous

reports, the male to female ratio appears to generally range between about 1.2 and 2.5: 1;

i.e. approximately 55% to 70% of such diseases occur in males. Male predominance

tends to be greater for the more severe diseases, for e.g. pleurodynia, hand foot and

mouth disease, respiratory disease, acute hemorrhagic conjunctivitis (AHC), rash, or

undifferentiated febrile illness.

In addition to transmission by direct person to person contact, EVs may be

recovered from houseflies, wastewater and sewage. Humans are probably the only

significant natural reservoir for the EVs.

3.3. Enterovirus structure and genome

The EV genome is a single-stranded RNA molecule, approximately 7,500 nt.

long, of positive polarity (Bouslama et al. 2007). An approximately 750 nt. 5' UTR is

followed by a long open reading frame coding for an approximately 2,100-amino-acid

polyprotein. This is followed by a short 3' UTR and a poly (A) tail. Salient features of the

genome are as follows:


5' UTR

Several important functions have been mapped to the 5' UTR. For PV, the first

100 nt. (approximately) play a role in viral replication. EVs use internal initiation of

translation rather than the ribosome-scanning model proposed for cellular mRNAs

(Rousset et al. 2003). This internal initiation has been shown to require a large portion

Figure 1: Scheme of the organization of the human enterovirus genomic RNA

adapted from http://www.sciencedirect.com/science/article/pii/S1473309910701948


(nt. 130 to about 600) of the PV 5' UTR (Yoke-Fun et al. 2006), but the exact ribosome-

binding sequence is not known. Point mutations in the 5' UTR have been shown to affect

virulence (Mirand et al. 2007), temperature sensitivity, and plaque morphology (Kung et

al. 2006).

Open reading frame

The open reading frame following the 5' UTR is translated into a polyprotein

which is co and posttranslationally cleaved to give four structural proteins (VP4, VP2,

VP3, and VP1), which form the viral capsid, and seven nonstructural proteins (Gharbi et

al. 2006). VP1 to VP3 are partially exposed on the virion surface, while VP4 is

completely internalized in infectious virions. Three or four neutralization determinants

have been identified for each PV serotype by using monoclonal antibody neutralization

escape mutants, and they have been mapped to VP1, VP2, and/or VP3 (Rotbart et al.

1995). Neutralization determinants have also been identified on VP1 for CBV 3 and 4

(WHO 2001). Determinants of attenuation of virulence (Mistchenko et al. 2006), virion

thermostability (Bru et al. 2006), altered host range (Chowdhry et al. 2005), persistent

infection (Nix et al. 2006), and plaque morphology (Kung et al. 2007) have also been

mapped to the capsid-encoding region.

Some functions of the non-structural proteins and their precursor forms are

known. Protein 2A is one of the viral proteinases that cleaves the polyprotein in trans

between proteins VP1 and 2A, and releases the capsid protein precursor from the rest of

the polyprotein (Thompson et al. 2004). Proteinase 2A has also been shown to participate

in host cell shut off by indirectly inducing cleavage of the cellular p220 protein, which is


an important factor in cap-dependent initiation of translation (Tamura et al. 2004). The

specific functions of 2B and 2C are not known, although protein 2C and its precursor

form 2BC have been found in the replication complex of PV (Saitou et al. 1987), and

protein 2C has a helicase activity. Protein 3AB is a precursor of 3B, the small

polypeptide covalently linked to the 5' UTR of picornavirus RNA molecules (Kimura et

al. 1980). Protein 3C is the second viral proteinase which participates in polyprotein

processing (Felsenstein et al. 2003), while 3D is the RNA-dependent RNA polymerase

(Kim et al. 2005).

3' UTR

The coding region is followed by a 70 to 100 nt. 3' UTR. This region is important

in the initiation of the minus-strand RNA synthesis, but no specific sequences have been

identified for polymerase binding. Several secondary and tertiary structures

(pseudoknots) have been proposed for this region (Mosmann et al. 1983) and supported

by biochemical studies (Kim et al. 2003). A genomic poly (A) tail with an average length

of 75 nt. follows the 3' UTR of all EVs (Bopegamage et al. 2003).

3.4 Replication:

Poliovirus requires a receptor to attach and enter cells. Poliovirus initially binds

to a specific plasma membrane protein, the poliovirus receptor (PVR; CD 155) and a

member of the immunoglobulin superfamily of proteins. The binding to the receptor

triggers conformational changes in the capsid structure that is necessary for the release

of the genome into the cytoplasm. No other picornaviruses use this protein as their


cellular receptor. On infection of a susceptible cell, RNA is translated to yield a large

polyprotein that is cleaved after translation into the virus-specific proteins and the viral

RNA becomes susceptible to RNase within 30 to 60 minutes after infection. Progeny

viral RNA appears in cells approximately 3 hours after infection. Once the viral genome

has entered the cell, the replication cycle begins when the viral RNA is transcribed by

the viral polymerase beginning at the 3’ end of the infecting viral RNA to generate a

complementary RNA (cDNA). In the next step, which is dependent on host factor, the

progeny viral RNA is synthesized from the cRNA. The newly synthesized viral RNA is

covalently linked to the VPg protein at the 5’ end of the RNA, and then only the

positive sense of RNA is encapsidated in the viral structural proteins to form infectious

viral particles. As the virion assembly has started, production of capsid protein and

replication of RNA is closely linked and integeration of viral RNA into the virion

follows within several minutes. Morphogenesis appears to involve the combination of

viral RNA with a shell of viral proteins (VP0, VP1, VP3) during which the VP0

procapsid protein is cleaved to yield VP2 and VP4. After final assembly, virions are

released initially through vacuoles but after several hours escape by cell lysis and death.

Thus, the interval from cell entry to release of virions; in vitro may require

approximately 4 to 5 hours (Fig. 2).


Figure 2: Replication of Enterovirus

3.5. Enterovirus Pathogenesis

The pathogenesis of EV infections has been studied at the molecular, cellular, and

organ system levels (Melnick 1990, Rueckert 1990, Rotbart et al. 1992) and, while much

has been learned, much more remained unexplained. EVs are transmitted by the fecal oral

route and, virus may be shed up to 2 weeks from the nasopharynx and for several weeks

to month in the feces. Most of the virus spread subsequently within the host was derived

from experimental poliovirus infections in chimpanzees more than four decades ago


(Bodian 1955). While some replication occurs in the nasopharynx with spread to upper

respiratory tract lymphatics; most of the virus inoculum is swallowed. Stability at acidic

pH, the characteristic responsible for the ability of the EVs to transverse stomach in route

to the site of primary infection in the lower gastrointestinal tract, distinguishes the EVs

from the HRV, another large genus of the picornaviruses. EVs presumably blind to

specific receptors on enterocytes; it is unknown precisely which cells are susceptible. M

cells which are responsible for reovirus uptake and penetration have been shown to blind

and endocytes polioviruses, suggesting a similar role in invivo infection (Scinski et al.

1990). The virus traverses the initial lining cells, perhaps with replication but without

apparent cytopathicity, and reaches the Peyers patches in the lamina propria, where

significant viral replication occurs. A minor viremia ensues seedings numerous organ

systems including the central nervous system (CNS), liver, lungs and heart. More

significant replication at these sites results in a major viremia associated with the signs

and symptoms of viral infection. If the CNS has not been seeded in the initial viremic

episode, spread there may occur with the major viremia. Although fairly well established,

viremia as the source of CNS infection was long debated, with direct neural spread

(Wyatt 1976) suggested as an alternate hypothesis. The mechanism by which EVs leave

the blood and enter the CNS is unknown. In the case of poliomyelitis, evidence obtained

with a transgenic mouse model (Ren et al. 1992) supports earlier hypothesis about the

importance of muscle infection. PVs may spread to skeletal muscle via the blood,

reaching neuromuscular endplates from which the viruses ascend along nerves to the

spinal cord and from there may widely disseminate within the CNS.


Figure 3: Pathogenesis of enteroviruses. The target tissue infected by the

enterovirus determines the predominant disease caused by the virus. Adapted

from http://www.meddean.luc.edu/lumen/MedEd/mech/cases/case28/entero.htm

For the nonpolio EVs “leakiness” in the vessels of the choroid plexus (meningitis)

or of the parenchyma (encephalitis) is probably the patch by which viruses enter the CNS


from the blood, probably influenced by the titer of virus in the blood, active transport of

virus particles across the blood brain barrier has not been demonstrated. Endothelial cells

may express EV receptors, which may influence tissue tropism (Huber et al. 1990) and

which if up-regulated e.g. during systemic EV infection, may facilitate virus entry into

the CNS and other organs. During clinical infections, EVs have been recovered from both

the cellular and plasma fractions of the blood (Parther et al. 1984), and the more

important of the blood compartments for establishing specific organ system infection is

not known. Differences in susceptibility of mononuclear cells to various EV serotypes

have been demonstrated (Dagan et al. 1992) and may affect patterns of neurotropism if

cell-associated transport is important. In vitro, EVs are released into the medium by

infected cells and can survive cell free for many days; hence, cell association (e.g.,

monocytes or lymphocytes) may not be as important as it is for other viruses.

At the cellular level, the events of infection with PVs are well studied; NPEVs

probably has analogous cellular pathogenesis. The virus binds to a specific cell receptor

at a single viral capsid canyon site (Rotbart et al. 1992, Racaniello 1995) this probably

occurs first in the intestine, and with subsequent progression of infection, it occurs in

other target tissue sites. The human cellular receptor for PV and certain other EVs maps

to chromosome 19 (Rotbart et al. 1992, Racaniello 1995) and sensitivity of cells to PV

infection has been sublocalized to the proximal long arm of that chromosome (Siddique

et al. 1988). The PV receptor has been well characterized and represents a unique

molecule within the “immunoglobulin superfamily” (Rotbart et al. 1992, Racaniello

1995). Competition studies have shown that the PV, CV B1-B6, and CV A21 virus may

each represent different receptor families (Lonberg-Holm et al. 1976). At least one ECV


serotype (ECV 1) binds to a cellular receptor which is a member of the integrin family of

surface molecules known as decay-accelerating factor, a glycoprotein that protects cells

from complement-mediated lysis (Bergelson 1994). Still other ECV serotypes do not bind

to either the integrin or decay-accelerating factor molecules (Racaniello 1995).

Preliminary binding studies also have revealed putative specific receptors for CV A and

B serotypes (Bergelson et al. 1994, Roivainen et al. 1994, Racaniello 1995) it appears as

if certain adenoviruses (Bergelson et al. 1994). Following attachment of the virus,

recruitment of additional cellular receptor occurs, and the virion is enveloped by cell

membrane, bound new at multiple viral protomers (Rotbart et al. 1992; Racaniello 1995).

A steric shift in the capsid confirmation occurs, resulting in extrusion of the VP4 viral

protein and destabilization of the capsid structure (Guttman et al. 1977). The now

uncoated RNA is released freely into the cellular cytoplasm, where it rapidly binds to the

ribosomes and begins protein synthesis. A single polypeptide is produced, which is

almost in stantaneously autocleaved by viral proteases (Haller et al. 1995) to form all of

the viral protein products, including those, such as the RNA-dependent RNA polymerase

required for viral RNA replication. After 2 hr infection, all host cell protein synthesis has

been shut down by the EV and the cell has become a factory for viral production (Haller

et al. 1995). Infectious virion cells are released by cell lysis and spread to neighboring

and distant cells via the surrounding growth medium in vitro and the blood in vivo. The

cytopathic effect of the EVs in tissue culture cells has been well described (Hsiung 1973)

and remains an important diagnostic tool. Light microscopy reveals a characteristic

rounding of cells and, ultimately, detachment from the tissue culture dish. By electron

microscopy, a series of change occurs, beginning with alteration of nucleus morphology


and margination of the chromatin. Ribosomes aggregate in the cytoplasm, and many

clusters of membranous vesicles form; ultimately the rounded and detached cells lyse.

The membranous vesicles serve as the platform for viral RNA replication.

Molecular determinants of pathogenesis are being increasingly investigated to

understand the phenotypes of specific EV serotypes and subgroups. While all three

serotypes of wild type PVs are neurotropic and neurovirulent, specific tropisms and

virulence patterns vary widely among the NPEVs, with certain serotypes consistently

reported as causes of specific organ system disease. The most common serotypes

associated with CNS infections, in addition to the PVs, are ECV 7, 9, 11, and 30, CV B5,

and EV 70 and 71 (Strikas et al. 1986, Dagan et al 1988, Rotbart 1995). CV is the most

frequent EVs implicated in heart infection (Martino et al. 1995). ECV 11, followed by

several other ECV and CV, are the most important pathogens of neonatal EV sepsis

(Abzug et al. 1999) ECV 11 is also the most common serotype causing chronic

meningoencephalitis in antibody-deficient patients (Mckinney et al. 1987). Confounding

the analysis of genotype-phenotype correlation is the observation that while certain

serotypes are more commonly associated with certain diseases, virtually every serotype

has been associated with virtually every EV disease manifestation. The presence or

absence of specific cellular receptors is unlikely to explain all of this heterogeneity since

variations in tropism exists even within receptor families. CV B6, for example, is a rare

cause of CNS or cardiac infections, in contrast to the other five CV B1-B5 (Melnick

1990, Martino et al. 1995).

The determinants of neurotropism and neurovirulence have been investigated

extensively for the PVs. The viral RNAs of both neurovirulent and attenuated (vaccine)


strains have been sequenced, and only a few differences exist between them. At least two

single base changes are felt to be responsible for the attenuation of previously

neurovirulent PVs (Minor et al. 1989, Hellen et al. 1995). Following vaccination with

attenuated strains, “back mutation” to virulence has been observed in the fecally shed

virions recovered from normal children (Minor et al. 1986). Molecular neurovirulence

determinants among the NPEVs are now being studied in hopes of finding a genomic

explanation for the increased frequency of aseptic meningitis and encephalitis observed

with certain serotypes and the virtual absence of those diseases with others (Rotbart

1995). Studies of the ECV have identified specific base changes in the 5’ UTR of the EV

genome which are unique to serotypes that rarely cause CNS disease; neurotropic ECV,

in contrast, have base sequences identical to those of the PV in these regions (Romero et

al. 1995). CV B4 strains with pancreatic tropism and virulence are distinguished from

avirulent CV B4 strains by a single amino acid residue in the VP1 capsid protein

(Coggana et al. 1993). Genotypic determinants of myocarditis remain to be elucidated;

cardiovirulent strains of CV have been sequenced and demonstrate mutations throughout

the genome, suggesting that tertiary structure rather than specific base changes are

virulence determinants (Martino et al. 1995). One mechanism of CV induced

cardiomyopathy may involve the ability of the 2A protease molecule of the virus to

cleave dystrophin, a cytoskeleton protein found in the heart (Badroff et al. 1999).

3.6. Clinical manifestations

3.6.1. Poliomyelitis

At least 90% of wild type PV infections are asymptomatic and only 0.1% of PV

infections result in the paralysis. The remaining infections (less than 10%) result in a flu


like illness termed abortive poliomyelitis or the minor illness (Simoes 1884). In these

patients, fever, fatigue, headache, anorexia, myalgias, and sore throat may last 2 to 3 days

and are followed by complete recovery without neurologic sequelae; these symptoms are

accompanied by viremia. Approximately 10% of patient with abortive poliomyelitis (1%

of all patients with PV infections) will develop concomitant aseptic meningitis

(nonparalytic poliomyelitis) indistinguishable from that due to the NPEV. Onset may be

more abrupt and may follow, rather than accompany, the flu like minor illness, in which

case the meningitis may be classified, along with paralytic manifestation, as the major

illness. The pattern of onset, particularly in young infants and children, may be biphasic,

with minor illness (Weinstein et al. 1952).

The paralytic manifestations of PV infections reflect the regions of the CNS most

severely affected (Horstmann 1949, Weinstein et al. 1952, Auld et al. 1960). Paralysis is

often heralded by severe myalgia in the involved limb, resulting from involvement of

single or multiple muscle groups; motor and sensory disturbances may observed in the

same affected muscle groups. Exercise relieves muscle aches, resulting in anxious and

sometimes frenzied movement patterns by affected patients. Weakness manifests as

paresis or paralysis within 1 to 2 days of onset of myalgias; the distribution is

characteristically asymmetric, with proximal muscles more affected than distal and legs

affected more than arms. The natural history of the weakness is highly variable, ranging

from transient paresis with complete resolution to rapid progression with complete and

permanent paralysis; the short term outcome, i.e., resolution or paralysis is evident within

several days coincident with the normalization of temperature and resolution of

constitutional illness (Horstmann 1949, Weinstein et al. 1952, Auld et al. 1960, Simoes


1884). Single limb involvement is most common, but quadriplegia is also known to

occur.

Cranial nerve involvement may result in so-called bulbar paralysis, with resultant

difficulties in any or all of speech, swallowing, breathing, eye movement, and facial

muscle movements. Medullary centers controlling respiration and vasomotor function can

become involved, with potentially fatal outcome (Simoes 1884). Paralysis of the muscles

of the diaphragm may also result in respiratory failure, rekindling the images of the iron

lung negative pressure ventilator used to treat such patients.

The long term outcome of paralytic poliomyelitis appears to be determined during

the first 6 months after onset; absence of improvement during that period usually

suggests permanent paralysis with concomitant limb atrophy and deformity. If

improvement occurs, it is typically gradual and may continue for 9 to 18 months

(Horstmann 1949, Weinstein et al. 1952, Simoes 1884). The overall mortality of spinal

poliomyelitis is about 5%. Bulbar and medullary poliomyelitis had high mortality rates

(50% or greater) during the epidemic years in the United States, when modern respiratory

support techniques were not available. Some individuals who recover from paralytic

disease may develop the syndrome of postpoliomyelitis muscular atrophy (Dalakas et al.

1984). Characterized by recurrent weakness, pain and atrophy 25 to 30 years after the

initial acute infection, the clinical course of this manifestation is usually a gradual one

that seldom results in total disability of the affected areas. While ongoing viral infection

or reactivation has been postulated and some laboratory evidence has been found to

corroborate that mechanism (Sharief et al. 1991, Muir et al. 1995), most researcher think


the postpoliomyelitis syndrome is a result at least in part of aging and neuronal dropout in

already compromised neuromuscular connections (Dalakas et al. 1995).

3.6.2. Aseptic Meningitis and Encephalitis

Aseptic meningitis is a nonbacterial inflammation of the meninges associated with

fever, headache, photophobia, and meningeal signs in the absence of signs of

parenchymal involvement (Rotbart 1990). The syndrome is the most common CNS

infection with 7,000 cases of aseptic meningitis reported per year in the United States and

an actual incidence believed to be 10 fold higher (Pallansch et al. 2006). Fever is the most

common clinical symptom with biphasic pattern, initially associated with constitutional

symptoms and then meningeal signs in patients with enterovirus induced aseptic

meningitis (Dos Santos et al. 2006, Mistchenko et al. 2006, Brunel et al. 2008). Rashes

were also reported in enteroviral aseptic meningitis cases caused by CV A5, A9, A16 and

ECV 4, 6, 9 and 16 (Dos Santos et al. 2006, Frantzidou et al. 2007). In one survey from

Finland, aseptic meningitis occurred in 219 of 100,000 children under 1 year of age, and

in 19 of 100,000 children 1 to 4 years, demonstrating a decreased incidence with increase

in age. EVs are the main recognized cause of aseptic meningitis in both children and

adults in developed countries, and EVs were identified in 85% to 95% of cases in which a

specific pathogen was cultured (Cabrerizo et al. 2008, Choi et al. 2010, Cui et al. 2010).

In a study by Frantzidou et al. 2007, 62% of infants less than 3 months old with aseptic

meningitis had CV B as the etiologic agent. The seasonal increase between summer and

fall in incidence of enteroviral aseptic meningitis has been seen (Pallansch et al. 2006).

Mostly serotypes of EVs have been reported in aseptic meningitis cases (Avellon et al.


2006, Zhao et al. 2006, Frantzidou et al. 2007, Brunel et al. 2008, Logotheti et al. 2009,

Trallero et al. 2010).

Encephalitis signifies that the brain parenchyma is infected, with the possibility of

a disturbed state of consciousness, focal neurological signs, and seizures. Encephalitis is

typically a rare complication of EV infection and often presents in conjunction with a

meningeal infection, resulting in a meningoencephalitis (Katz et al. 1998). Sometimes EV

encephalitis may also present as focal encephalitis, suggestive of HSV encephalitis

(Peters et al. 1979, Whitley et al. 1989, Modlin et al. 1991). In neonates, a variety of EVs

have also been associated with serious complications, including encephalitis and death

(Rotbart et al. 2001, Khetsuriani et al. 2006). In a study from New York State USA,

during 2005-06, EV prevalence was found to be 4.9% prevalence with aseptic

meningitis/encephalitis cases. The most prevalent serotype was found to be CV B5, ECV

18 and 6 (Tavakoli et al. 2008). Brunel et al. also reported a fatal case of

leukoencephalitis associated with ECV 18 (Brunel et al. 2007). During 2003-2006, a

study from Greece, reported 22% prevalence of EVs with aseptic meningitis and 9% with

encephalitis cases (Frantzidou et al. 2008). Dalwai et al. reported ECV 9 associated

encephalitis in children from Kuwait (Dalwai et al. 2009). Outbreaks involving

substantial numbers of EV 71 encephalitis cases have been observed among young

children in Taiwan and some other countries (Lin et al. 2002).

Several NPEVs have been associated with outbreaks of paralytic myelitis,

including CV A7 (Grist et al. 1984), EV 70 (Wadia et al. 1983), and EV 71 (Solomon et

al. 1959, Huang et al. 1999). Sporadic cases of paralysis have been reported in

association with isolation of an EV from the stool (Grist et al. 1984, Cherry 1992), a


situation in which causality is difficult to establish due to the known prolonged fecal

shedding period of the EVs.

Cerebellar ataxia has occasionally been associated EV infections, as have Guillian

Barre syndrome and transverse myelitis (Cherry 1992). All such associations suffer from

the same difficulty in distinguishing the pathogenicity of a throat or stool isolate from

coincidental shedding.

3.6.3. Neonatal Sepsis

The infected neonate appears to be at greatest risk for severe morbidity and

mortality when signs and symptoms develop in the first days of life, consistent with

either intrapartum or perinatal acquisition (Abzug et al. 1968, Abzug et al. 1999).

Maternal illness has been reported for 59 to 68% of infected neonates (Abzug et al. 1968,

Abzug et al. 1999) however additional risk to the neonate associated with maternal illness

has been difficult to establish. The timing of maternal infection versus delivery of the

infant appears to be critical; when enough time for antibody formation in the mother has

elapsed, positive protection of the baby occurs. If, however, delivery occurs during

maximal viremia and prior to adequate maternal antibody formation, the prognosis for the

neonate is worse (Abzug et al. 1968, Abzug et al. 1999). Even in the youngest patients,

fever is ubiquitous, accompanied early by nonspecific signs such as vomiting, anorexia,

rash, and upper respiratory findings. Neurologic involvement may or may not be

associated with signs of meningeal inflammation, including nuchal rigidity and bulging

anterior fontanelle. As the neonatal disease progresses, major systemic manifestations

such as hepatic necrosis, myocarditis, and necrotizing enterocolitis may develop (Abzug


et al. 1999). Disseminated intravascular coagulation and other findings of “sepsis” result

in a patient with illness which may be indistinguishable from that due to overwhelming

bacterial infection. The CNS disease may progress to a more encephalitic picture, with

seizures and focal neurologic findings suggestive of herpes simplex virus infection. The

incidences of morbidity and mortality due to potential EV infections are not precisely

known but may be as such as 74 and 10%, respectively (Abzug et al. 1999). When death

occurs, it is typically due to hepatic failure (ECV) or myocarditis (CV).

3.6.4. Nonspecific Febrile illness

It is estimated that between 10 million people in the United States annually

develop minor EV infections, characterized by fever and nonspecific symptoms with or

without rashes (Moore 1982, Strikas et al. 1986). These illnesses are of significance

mainly for other diseases that they mimic, including bacterial sepsis, other viral

exanthematous diseases, and herpes simplex virus infections; also, their age distribution

makes them of great practical concern to the clinician. Most affected patients are young

infants in whom differentiation of viral illness from the more alarming cause of

nonspecific fever and rashes is extremely difficult. In a prospective study of newborn in

infants in Rochester, New York, as many as 13% of infants born in the summer months

were infected with EVs during the first month of life; 21% of the infected infants were

admitted to the hospital with suspected bacterial sepsis and received unnecessary

antibiotics or antiheroes therapy (Jenista et al. 1984). It was calculated during the months

of seasonal prevalence, about 7 infants per 1,000 live births require hospitalization for

neonatal EV infection, indeed, EVs have been shown by many investigators to be the


major cause of hospitalization of young infants for suspected sepsis during the summer

and fall months (Rotbart et al. 1999). Clinical manifestations include abrupt onset of

fever usually >39°C, with accompanying irritability; the fever may be biphasic (Dagan et

al. 1995.). Additional symptoms, in order of decreasing frequency, include lethargy,

anorexia, diarrhea, vomiting, rash (23% of patients), and respiratory symptoms. Sign and

symptoms do not differ in the age group between the echoviruses and coxsackieviruses

(Dagan et al. 1995). Aseptic meningitis may accompany the nonspecific symptoms of EV

infection in infants, and there are no clinical features which distinguish between EV

infected infants with and without meningitis (Dagan et al. 1988). The systemic, global

nature of this illness results in hospitalization of many of these infants to the rule out

bacterial sepsis. The duration of symptomatic illness in young infants beyond the

neonatal period is usually 4 to 5 days.

3.6.5. Respiratory illnesses

Many EV infections are accompanied by nonspecific respiratory sign and

symptoms, which are usually mild. Pharyngitis, tonsillitis, and laryngotracheobronchitis

(croup) have been frequently reported (Chonmaitree et al. 1991). Bronchitis and

pneumonia are less commonly seen. Most EV respiratory illness is benign, but symptoms

may persist for many days, and the resultant disruption in school and work days may be

substantial. The EVs are responsible for approximately 15% of upper respiratory

infections (URIs) for which an etiology is identified (Chonmaitree et al. 1995)

conversely, respiratory illness is the major manifestation reported in 15 to 20% of cases

EV infections (Grist et al. 1978, Moore 1982). In a recent 10 year review of EV


associated respiratory illnesses, 46% of patients presented with URIs , 13% presented

with respiratory distress or apnea, 13% presented with pneumonia, 12% presented with

otitis media, and fewer presented with bronchiolitis, wheezing, croup and

pharyngotonsilitis (Chonmaitree et al. 1995). Many EV serotypes are identified in

respiratory infections, divided approximately equally among the major subgroups (Grist

et al. 1978, Moore 1982). The clinical manifestations of EV associated URIs, otitis

media, and pharyngotonsilitis are indistinguishable from those due to other respiratory

viruses. Pneumonia due to the EVs has been associated with numerous serotypes in

infants and children (Cherry 1992). The clinical manifestations caused by these agents

include fever, hyperpnea, and cyanosis. The laboratory findings usually include a normal

leukocyte count although extreme leukocytosis is occasionally encountered. Chest X ray

may reveal perihilar infiltrates. Deaths have occurred in infants and young children.

Histopathologic study of the lungs reveals thickening and infiltration of the alveolar septa

but no necrosis or giant cells. In adults, bronchopneumonia has been associated with

coxsacievirus group B3 and echovirus 9 (Cherry 1992, Chonmaitree et al. 1995). Several

distinctive syndromes of EV respiratory illness have been well described (Pichichero et

al. 1998), and are discussed in the following paragraphs. These illnesses, seen with high

frequency in the private practice setting, are of both clinical and economic significance

(Pichichero et al. 1998).

3.6.5. Herpangina

Group A CV is the most common causes of herpangina, but the syndrome has

been reported with the coxsackie B viruses and the echoviruses as well (Cherry et al.


1965). The highest incidence is among children 1 to 7 year old (Pichichero et al. 1998),

but infection has also been described in neonates and adults. There is usually an abrupt

onset of fever associated with a sore throat, dysphagia, and malaise. One fourth of the

patients may have vomiting and abdominal pain. Early in the illness, grayish white

vesicles measuring 1 to 4 mm in diameter appear over the posterior portion of the palate,

uvula, tonsillar pillars, and occasionally the oropharynx. These vesicles are discrete,

surrounded by erythema and usually number fewer than 20. The vesicles usually rupture,

leaving punched out ulcer that may enlarge slightly, while new vesicles may appear.

There may be also mild cervical adenopathy, headache, myalgia, arthralgia, and rarely

parotitis or aseptic meningitis. Coryza and other respiratory symptoms are lacking and

clinical laboratory studies are usually normal. The fever lasts 1 to 4 days; local and

systemic symptoms begin to improve in 4 to 5 days, and recovery is usually complete

within a week of onset (Parrott et al. 1951, Cherry et al. 1965, Pichichero et al. 1998).

3.6.6. Hand-Foot-and-Mouth Disease

Although Hand-Foot-and-Mouth Disease is one of the more common and unique

syndromes associated with CV A16, other serotypes are often isolated (Cherry 1992). In

outbreaks, the highest attack rates are among children younger than 4 years but adults are

also frequently affected. The disease is usually mild, and the onset is associated with a

sore throat with or without a low grade fever. Scattered vesicular lesions occur randomly

on the oral structures, the pharynx, and the lips; these ulcerate readily, leaving shallow

lesions with red areolae. About 85% of patients also develop sparse grayish vesicles (3 to

5 mm in diameter, surrounded by erythematous areolae) on the dorsum of the fingers,


particularly in periungual areas, and on the margins of the heels. Occasionally, palmar,

plantar and groin lesions appear, particularly those due to EV 71, have been associated

with diffuse systemic and neurologic disease (Ho et al. 1999, Huang et al. 1999).

3.6.7. Pleurodynia

Pleurodynia is actually primarily a disease of muscle masquerading as pleuriti

disease, although pleural involvement can occur; hence, it is often discussed as a

respiratory manifestation of EV infection. Various members of the group B CV are the

usual causes of pleurodynia (also known as epidemic myalgia, Bornholm disease, or

devil’s grip); however, like all other EV associated illnesses, it may also be caused by

other EV serotypes (Cherry 1992). The onset is abrupt in about three fourths of patients,

and the remainder first develops prodromal symptoms of headache, malaise, anorexia,

and vague myalgia lasting 1 to 10 days. The major symptom is severe paroxysmal pain

referred to the lower ribs or the sternum (Kantor et al. 1962, Grist et al. 1978, Ikeda et al.

1993). Deep breathing, coughing, or other movement accentuates the pain, which is

described as knife like stabbing, smothering, or catching; it may radiate to the shoulders,

neck, or scapula and is characteristically lacking between paroxysms. Abdominal pain

occurs concomitantly in about half of the patients but may occur alone. Other symptoms

include fever, headache, cough, anorexia, nausea, vomiting, and diarrhea. Fever is usually

about 38ºC but ranges to 40ºC. The mean duration of the illness is 3.5 days, varying from

1 to 14 days. Muscle tenderness is ordinarily not prominent, nor is frank myositis or

muscle swelling, but some patients experience marked cutaneous hyperesthesia over the

affected areas. A pleural friction rub is heard in 25% of patients. There may be splinting


and tenderness on abdominal examination, especially in the upper quadrants and

periumblical area. The chest X ray is typically normal.

3.6.8. Acute Hemorrhagic Conjunctivitis (AHC)

AHC is a highly contagious disease characterized by conjunctivitis, keratitis,

foreign body sensation, pain, respiratory symptoms and severe neurological symptoms

including acute flaccid paralysis (Abzug et al. 1968). Coxsackievirus A24 in human

enterovirus C species and enterovirus 70 in human enterovirus D species are the main

enterovirus serotype associated with outbreaks of acute hemorrhagic conjunctivitis

worldwide. However, some other enterovirus serotype in human enterovirus B species

including echovirus 7 and 11, coxsackievirus B1 and B2 have been also reported in

coujunctivitis cases (Abzug et al. 1995).

Coxsackievirus A24 variant (CV A24v), an antigenic variant of CV A24 strain

was first isolated in Singapore from an outbreak of AHC in 1970 (Abzug et al. 1999).

The CV A24v has caused several epidemics and outbreaks of AHC in different countries

of the world including India, China, Nepal, Malaysia, Taiwan, Korea, Japan, Caribbean,

Tunisia, Spain, Cuba, Brazil and France. Phylogenetic analysis of the VP1 capsid and 3C

protease region of the CV A24v genome has been used to determine the epidemiological

relationship among strains responsible for epidemics and outbreak (Auld et al. 1960,

Badroff et al. 1999). Previous phylogenetic analysis of the 3C protease region of CV

A24v strains described four genogroups (GI-GIV) (Bergelson et al. 1997). Genogroup I

and II include strains isolated from Singapore, Hong Kong and Thailand during 1970-

1975. Genogroup III includes six clusters of strains isolated from Asia, Africa and Ghana


during 1985-1994. Recently a new genogroup IV divided into three clusters was

identified and includes strains isolated from South Korea, China, India, Congo, Guiana,

Morocco, Brazil and Cuba between 2000 and 2009. In India, CV A24v has been reported

in several epidemics and outbreak of AHC in different part of the country including

Vellore (1979), Delhi (1988), Uttar Pradesh (1994), Chennai (1999), Gujarat and

Maharashtra (2003) and Mumbai (2007) since after the first epidemic in 1971 (Bodian

1955, Caggana et al. 1993).

3.6.9. Acute Myocarditis

The EVs are among the most commonly identified etiologies of myocarditis,

although most cases of that disease may be undiagnosed (presenting as sudden death

without autopsy) or, if diagnosed have no identifiable cause. EVs may cause between 25

and 35% of cases of myocarditis for which a cause is found based on serologic, nucleic

acid hybridization, and PCR based studies of endomyocardial biopsy and autopsy

specimens (Martino et al. 1995). Using the rigorous and now widely accepted Dallas

Criteria in the examination of more than 12,000 autopsy cases in Sweden, the overall

incidence of myocarditis was approximately 1% (Gravanis et al. 1991). Conversely, it is

estimated that only 1 to 2% of all symptomatic EV infections have associated signs or

symptoms of myocardial involvement (Grist et al. 1978), with myocardial involvement

being more common during coxsackie B virus infections than during infections with

other serotypes. Bias in the estimation of the frequency of myocarditis during EV

infection is possible in both directions- the subclinical nature of some cardiac

involvement may result in an underestimate of the true cardiopathogenicity of the EVs,


but the study of patients presenting to physicians and hospitals with EV infection

probably select for the sickest patients and may overestimate the cardiac impact of the

EVs.

Neonates and young infants (younger than 6 months) are particularly susceptible

to CV B virus associated myocarditis accompanying systemic infection with dose

serotypes. Most cases occur in young adults, between the ages of 20 to 39 years. Males

are more commonly affected than females (the male/female ratio is approximately 1.5:1).

Anecdotally, rigorous exercise is reported as a precedent to many cases of myocarditis in

animal models, exercise increases the incidence and severity of myocardial involvement

during EV infections (Gatmaitan et al. 1970).

Clinical manifestations reflect the regions and extent of the cardiac involvement.

Symptoms include palpitations and chest pains, often with accompanying fever or a

history of recent viral respiratory illness. Arrhythmias and sudden death reflect a

prominent involvement of the conducting system, which may be of very recent onset;

congestive heart failure or myocardial infection like presentation suggest more significant

necrosis of myocytes and probably indicate longer standing disease. Pericardial friction

rub indicates myopericarditis. Electrocardiographic findings include an evolution from

early stage S-T segment elevation and T wave inversion to intermediate stage

normalization to late stage recurrence of T wave inversion (Matrino et al. 1995).

Myocarditis enzyme elevations are detected in the blood. Magnetic resonance imaging

(MRI) and nuclear imaging may be of ancillary help in establishing a diagnosis of

myocarditis, but endomyocardial biopsy remains the “gold standard” techniques for

confirming the histopathologic diagnosis of myocarditis (Matrino et al. 1995).


While most patients recover uneventfully from clinically apparent myocarditis,

many have residual electridiographic abnormalities for months to years. Smaller

percentages of patients develop congestive heart failure, chronic myocarditis, or dilated

cardiomyopathy.

3.6.10. Chronic Dilated Cardiomyopathy

There is a growing body of evidence to suggest that some cases of acute

myocarditis progress to chronic dilated cardiomyopathy. This syndrome is characterized

by dilation and dysfunction of the cardiac ventricles. The incidence is estimated at

between 1 and 10 per 100,000 populations, and the contribution of preceding EV

myocarditis to these figures is highly disputed. Some etiologic, nucleic acid hybridization

and PCR studies suggest ongoing EV involvement in 15 to 30% of cases, less than that in

acute myocarditis but still substantial (Matrino et al. 1995). Other investigators

consistently fail to find evidence of persistent EVs in patients with chronic

cardiomyopathy (Keeling et al. 1992, Liljeqvist et al. 1993). Even if EV RNA is detected

in cardiac samples of patients with dilated cardiomyopathy, its role may be anything from

the causative pathogen to a leftover footprint of asymptomatic infection in the past.

Like acute myocarditis, heart failure, chest pain or arrhythmias may herald the

onset of recognizable disease in patient with chronic dilated cardiomyopathy. Ventricular

dilation and its concomitant physical findings of mitral insufficiency, cardiomegaly, and

congestive heart failure dominate the physical examination and the electrodiographic and

echocardiographic findings. Active myocarditis may be found concomitantly with


chronic changes by endomyocardial biopsy, reinforcing the relationship between these

processes in some patients.

3.6.11. Gastrointestinal illness

EVs derive their name from their site of replication and shedding in the

gastrointestinal tract; however, enteric illness (vomiting and diarrhea) is usually a minor

manifestation of EV infections (Cherry 1992). Neither coxsackieviruses nor echoviruses

have been epidemiologically implicated as important primary causes of acute

gastroenteritis. Isolation of an EV from the feces of a patient with gastroenteritis must be

interpreted with caution because it may present asymptomatic carriage in a patient made

ill by a noncultivable agent. The coxsackie B viruses have been rarely associated with

acute abdominal pain and mesenteric adenitis syndromes, which may mimic acute

appendicitis. In addition to the occurrence of hepatitis as one aspect of general disease in

the newborn, coxsackievirus groups B2, B3, and A9 have been associated with hepatitis

in older children (Cherry 1992). In adults, coxsackievirus groups B3 and B5 have been

associated with hepatitis on rare occasions.

3.6.12. Juvenile-Onset Diabetes Mellitus

In the United States, juvenile onset diabetes mellitus occurs at an incidence of 12

to 15 cases per 100,000 persons per year; the worldwide incidence ranges from 3 to 30

per 100,000 persons per year. Many serologic studies have found higher titer of

antibodies to coxsackievirus group B in children with diabetes than in controls (Barrett-

connor 1985, Rewers et al. 1995). An occasional patient dying of ketoacidosis as the


initial presentation of diabetes has had coxsackievirus isolated from the pancreas and

elsewhere at autopsy (Yoon et al. 1979). EV RNA has been purportedly identified by

PCR in the sera of children with new onset diabetes mellitus (Clernents et al. 1995).

Maternal EV infections during pregnancy appear to be correlated with later development

of diabetes in offspring (Dahiquist et al. 1995). Occasional patients have developed anti

islet call antibodies in close proximity to acute EV infection (Lonnrot et al. 1998).

Diabetes occurs with an inverse seasonality to EV infections (i.e., trough incidence

during the EV season and peak incidence in the winter), consistent with a post infections

autoimmune disease mechanism (Barrett-Connor 1985). Numerous animal models have

been developed that prove the diabetogenic potential of EVs in mice and rats. The most

widely accepted model for encompassing epidemiologic, immunologic, and genetic

observations from studies of diabetes is that an EV infection in a genetically susceptible

host results in an exaggerated autoimmune response and destruction of pancreatic islet

cells (Rewers et al. 1995).

3.6.13. Inflammatory Myositis

In much the same way that diabetes is felt to be an autoimmune response to a

triggering EV infection, there is also evidence for such a mechanism in polymyositis and

dermatomyositis. The evidence for associating these rheumatologic diseases with EVs as

with diabetes includes serologic studies (Travers et al. 1977). In addition, EV like

particles has been seen by electron microscopy in muscle biopsy specimens from these

patients (Chou et al. 1970). Certain, in situ, dot blot hybridization, and PCR studies of

muscle tissue suggest the presence of EV RNA (Rosenberg et al. 1989). Other


investigators, using the same molecular techniques failed to find EV traces in affected

muscles from myositis patient (Leon-Monzon et al. 1992). It is known that EVs can cause

inflammatory muscle disease because about 50% of aggamaglobulinemia patients with

chronic CNS EV infections also develop myositis (McKinney et al. 1987). In these

patients, cultivable virus is recovered from muscle-tissue. An occasional patient with

myositis and normal immunoglobulin concentrations has responded to gamma globulin

therapy, with improvement or resolution of the disease.

3.6.14. Chronic (Postviral) Fatigue Syndrome

The chronic fatigue syndrome (CFS) has been known by a variety of names for

more than 150 years. Alternatively called neurasthenia, epidemic neurasthenia, myalgic

encephalomyelitis, fibromyalgia, fibrositis, Icelandic disease and Royal free disease, CFS

has long been a disease in search of an etiology. The links to EVs were initially made

either serologically or by monoclonal antibody analysis (for EV antigen) of patients’

blood nucleic acid hybridization and PCR evidence for EV infection has been represented

by the same groups of investigators. These studies, reported mostly from England,

involved outbreaks of myalgic encephalomyelitis (Gow et al. 1991). Other investigators

have failed to find an association of CFS with the EVs when using the same methods

(Swanick et al. 1994).


3.7. Laboratory Diagnosis

3.7.1. Viral Isolation

John Enders and his colleagues received the Nobel Prize in 1954 for successfully

propagating PV in a continuous cell culture system, paving the way for vaccine

development (Enders et al. 1989). Isolation of EVs in cell culture remains the gold

standard for diagnosis. The commercial availability of increasing numbers and types of

continuous cell lines has provided numerous options for routine EV culture. However, no

single cell line is optimal for all EV serotypes. Monkey kidney cell lines, the traditional

first choice for EV isolation, have good sensitivity for PV, CV, and ECV. RD cells

derived from a human rhabdomyosarcoma are the most sensitive for detection of

coxsackievirus group B strains.

Isolation of EVs in cell culture and recognition of cytopathic effect require a high

level of expertise and may be quite labor-intensive. Some EV serotypes, particularly

within group A CV, do not grow at all in cell culture (Melnick et al. 1964, Hsiung 1973,

Lipson et al. 1988, Rotbart 1999). Of greater significance, 25 to 25% of specimens from

patients with characteristic EV infections of any serotype will be negative by cell culture

(Chonmaitree et al. 1982) because of antibody neutralization in situ; because of

inadequate collection, handling and processing of the samples; or because of intrinsic

insensitivity to the cell lines, used. EVs which do grow in cell culture may do so slowly.

Reported mean isolation times for EVs from CSF range from 3.7 to 8.2 days (Rotbart

1999) EVs from other sites, where viral titers are higher, often grow more rapidly

(Rotbart 1999). Although the most sensitive method for laboratory diagnosis of some


group A CV infections, isolation of EVs in suckling mice is rarely performed any longer

because the difficulty of the technique and of animal maintenance.

3.7.2. Antigen Detection

The absence of a widely shared antigen has hampered the development of

immunoassays for the EVs (Herrmann et al. 1979). The greatest success has been with

assays limited to a particular subgroup of EV serotypes e.g., the group B CV strains,

which have a common antigen. Reports of monoclonal antibodies (Yousef et al. 1987)

that cross react with multiple EV serotypes are promising, but further testing is required

to determine the clinical relevance of those observations. These reagents have been

successfully applied to serotyping of EV isolates, but with the exception of a single report

of a monoclonal antibody specific for ECV 11, utility of these reagents for direct

detection of EVs in clinical specimens has not been demonstrated.

3.7.3. Serotyping and Serologic Assays

The determination of the specific serotype of infecting EVs is often unnecessary

because the disease caused by the EVs is not serotype specific. In most circumstances,

therefore it is adequate and useful for the diagnostic laboratory to report the presence of

“an EV” without further detail. The most common exception to this principle is in

pediatrics, where distinguishing between vaccine strain PVs and NPEVs is critical to

interpretation of viral culture results. During the first 2 years of life, most children are

repeatedly immunized with trivalent oral polio vaccine (Sabin strains), which, like all

EVs may be shed from the throat for 1 to 2 weeks and in the feces for several weeks to


months. Hence, isolates from those two sites must be identified as either nonpolio EV or

polio virus serotypes, with the later presumed to be of vaccine origin unless unusual

clinical circumstances suggest wild type infection. Vaccine poliovirus has only rarely

been recovered from CSF or blood (Melnick et al. 1966, Gutierrez et al. 1990), therefore,

further characterization of EV isolates from those sites is less important. The standard

method for distinguishing between poliovirus and nonpolio EVs employs neutralization

of the isolate with a pool of antisera directed against the three poliovirus serotypes

(Rotbart 1999). A method that is still experimental uses a set of PCR primer specific for

three poliovirus serotype; the PCR assay is performed on the culture passaged isolate and

has been shown to discriminate accurately between poliovirus and nonpolio EVs (Egger

et al. 1995). Further identification of a nonpolio EV by serotype is useful under certain

circumstances. The gold standard for serotype determination continues to be the use of

intersecting pools of lyophilized antisera, as established by Lim and BenyeshMelnick

(Melnick et al. 1973). Broadly reactive and serotype specific EV monoclonal antibodies

have now been developed (Yagi et al. 1992) and are commercially available tissue culture

confirmation by immunofluorescence. Preliminary studies have shown that these reagents

used singly and in pools, may find an important role in serotype identification.

Immunofluorescence is a more rapid and simple procedure than traditional neutralization

based serotyping and the supply of monoclonal antibodies are unlimited.

Serologic testing like immunoassays has played only a limited role in EV

diagnosis because of the great diversity of EV serotypes and the lack of a single common

antigen. If the specific serotype of an infecting EV is known or suspected e.g., in

community wide outbreaks confirmatory IgG serologic testing can be performed on


samples from individual patient to document a rise in antibody titer from the acute to the

convalescent phase of infection, thus providing useful epidemiologic information little

actual benefit accrues to the individual patient. In a situation where an EV is recovered

from the feces or throat of a patient with unusual clinical manifestations, the etiologic

role of the EV may be more firmly established by documenting a fourfold rise in

antibody titer to that serotype in paired acute and convalescent phase sera. In the usual

scenario when a patient presents with meningitis or other acute manifestations of illness

and an EV is suspected serologic testing is not a practical option.

3.7.4. Interpretation of Results

The body site at which EVs are detected is critical to the interpretation of EV

assays and to the differentiation between EV “colonization” and actual EV associated

disease. The nasopharynx and gastrointestinal tract are permissive sites of infection i.e.,

EVs have ready access to these sites and may remain as colonizers for weeks to months.

Detection of EVs by virus isolation or PCR at these sites must be interrupted cautiously

because their presence alone does not establish casuality of the illness in question

(Johnson et al. 1995). Indeed virtually 100% of patients with EV aseptic meningitis will

have detectable EV in feces (Rotbart 1999). But most persons shedding EV in the feces at

any particular time are asymptomatic feces are the most sensitive and least specific site

for detecting true EV associated illness. Since the shedding period in the nasopharynx

after EV infection is shorter than in the feces the specificity of EV isolate from feces but

is far short of a definitive association. Further complicating the evaluation of results with

specimen from these two body sites in young children is the frequent administration of


live attenuated oral poliovirus vaccine in the first year of life. Most EV isolates from

feces and nasopharynx of young children encountered by the diagnostic virology

laboratory are, in fact vaccine strain polioviruses. Reporting an EV isolate in this setting

without specifying poliovirus versus a nonpolio EV can lead the physician to wrongly

discontinue antibiotic treatment or antiherpes therapy in the belief that an EV etiology

has been established.

In contrast the CNS bloodstream and genitourinary tract are not usually colonized

with EVs; i.e., detection of virus in specimens from these sites implies true invasive

infection and a high likelihood of association with current illness. Reports of coinfections

of CSF by bacteria and EVs have appeared (Eglin et al. 1984). In these patients, the

bacterium associated clinical sequelae usually dominate. In the much more common

situation where the clinical presentation is typical of viral meningitis coinfection with a

clinically silent bacterium would be extraordinarily unlikely. Hence, identification of an

EV from as it not ordinarily colonized in a patient clinically compatible illness is usually

sufficient evidence for establishing EV casuality. The distinction between poliovirus and

nonpolio EVs in specimens from these sites is less important since vaccine strains of

poliovirus rarely have been reported in such specimens and in those are rare instances,

may actually be causing the illness in question (Melnick et al. 1966, Guiterrez et al.

1990).

3.7.5. Nucleic Acid Detection

In 1984, two laboratories reported the successful detection of multiple EV serotypes of

different sub classifications with single molecular probes derived from a single serotype


(Hyypia et al. 1984). This accomplishment demonstrated that genetic homology among

the EVs extended well beyond the few serotypes for which genomic sequence

information was known at that time in the ensuing 6 years numerous investigators

extended those observations using cDNA probes, RNA probes and oligomeric probes

(Rotbart 1991). Although EVs were readily detected in body fluid during reconstruction

experiments (Rotbart et al. 1985), the sensitivity in actual clinical specimens was only

33% or less. The limiting variable in all of these hybridization based assays was the low

titer of EVs in many specimens, particularly CSF from patients with aseptic meningitis,

which may contain as few as 1 to 10 titerable virions per ml (Rotbart 1999).

The most promising development in direct detection of the EVs has been

employed: universal detection of many or all serotypes serotype specific or group specific

detection of a limited number of serotype, and strain specific detections of variations

within a single serotype. A potentially important application of group specific EV PCR

namely the discrimination of polioviruses from the nonpolio EVs in clinical specimens is

discussed below. Strain specific PCR is of use mainly for the study of the genetic shifts

and drifts of individual EV strains and the study of specific molecular virulence

determinants.

Three sets of universal PCR primers and probes for the EVs were reported

between the end of 1989 and early 1990, each with broad reactivity among many EV

serotypes and with high specificity for the EVs (Hyypia et al. 1989, Chapman et al.

1990). All are detected at highly conserved regions of the 5’ noncoding region of the viral

genome and designed for reverse transcription PCR (RT-PCR). Most serotypes tested

with these primers and probes are successfully detected in laboratory reconstruction


experiments, which would predict successful application of these reagents in clinical

testing. EV RT PCR using these and other primer probe sets has been found to be

consistently more than culture and virtually 100% specific (Rotbart et al. 1994).

One of the original sets of primers and probes has been modified and adapted to a

one step; microwell based colorimetric RT PCR kit which is user friendly enough to be

performed in 5 h by personnel in the routine diagnostic virology (Rotbart et al. 1994). An

accurate diagnosis of EV infections available in less than 1 day has the potential of

significantly impacting the quality and cost of patient management. In two large clinical

studies of CSF specimens from a combined total of 658 patients with EV aseptic

meningitis, other CNS infections, and noninfected controls, the sensitivity of the

colorimetric microwell RT PCR assay compared to viral culture and clinical diagnosis

was 94.7 to 96.3%, the specificity was 94.7 to 99%, the positive predictive value was

94.7 to 96.3%. in a study of neonatal EV infections using the same kit format, RT-PCR of

serum and urine specimens was shown to be nearly three times as sensitive as was culture

of the same specimens and to be 100% specific (Abzug et al. 1995). The method has now

been extended to other body fluids and specimens including blood, urine, throat swabs,

and stool (Rotbart et al. 1997).

Finally a quantitative RT PCR assay for the EVs has been reported (Martino et al.

1993). Such a test may become clinically important when antiviral therapy for these

pathogens becomes available and monitoring of the viral load in response to therapy

become desirable.


3.8. Prevention

Vaccines are available only for the polioviruses, and they provide no protection

against the nonpolio EV serotypes. Recent policy changes in the united States have

resulted in a return to the use of inactivated poliovirus vaccines (American Academy of

Pediatrics 1999) in an attempt to reduce or eliminate the few remaining vaccine

associated cases of poliomyelitis that occur annually in this country.

3.9. Treatment

As with other viral pathogens, there are several steps in the replication cycle of

the picornaviruses that are potential targets in antiviral therapy (Rotbart 1985). Cell

susceptibility viral attachment, viral uncoating, viral RNA replication and viral protein

synthesis have all been studied as targets of antipicornaviral compounds.

3.9.1. Interferon

Interferon is potent selective mediators of cellular changes which induce a

number of antiviral antiproliferative and immunological effects of all which collectively

affect host cell susceptibility to picornavirus infection (Rotbart et al. 1998). The cellular

antiviral effects of interferon are mediated through specific receptor signal transduction

pathways. In conjunction with double stranded RNA interferon induce the expression of

proteins some of which mediate an antiviral activity. The best described pathways are (i)

2’, 5’ adenylate synthetase (ii) double stranded RNA dependent protein kinase, and (iii)

the Mx proteins. Through transfection expression systems and isoform of the 2’, 5’

adenylate synthetase has been linked to the inhibition of replication of picornaviruses


(Chebath et al. 1987). Clinically, children with acute EV meningitis have significant

elevations in endogenous interferon levels in the CSF (Ichimura et al. 1985, Chonmaitree

et al. 1991), which may be important in recovery from the infection. Although alpha

interferon itself is a very potent inhibitor of picornavirus infection, additive or synergistic

protective effects are seen when it is used in conjunction with humoral antibodies and

macrophages to eliminate picornavirus infections (Rotbart 2000). Despite in vitro

efficacy and limited clinical utility in infections due to the closely related rhinoviruses,

interferons have not been clinically evaluated in EV infections.

3.9.2. Immunoglobulins

The primary mechanism of clearance of EVs by the host is via humoral immunity.

Patients who lack antibody because of congenital or acquired immunodefeciencies are

uniquely susceptible to infections with the EVs (McKinney et al. 1987). Similarly,

normal neonates are at high risk for severe EV disease because of a relative deficiency of

EV antibodies (Abzug et al. 1968, Modlin et al. 1981). Antibodies act by binding to EVs

and preventing attachment and binding to host cells, which correlates with neutralization

of EVs observed in cell cultures treated with antibody.

Immune serum globulin has been used prophylactically and therapeutically

against the EVs in two clinical settings: the neonate and the immunocomprised host.

Neonates may develop an overwhelming sepsis syndrome from transplacental or

peripartum acquisition of EV infection. The high mortality rate of this disease, coupled

with the known association of severe EV disease with absolute or relative antibody

deficiency states, has prompted numerous investigators to administer antibody


preparations to neonates with EV sepsis. Anecdotal reports of clinical success with

maternal serum or plasma (Jantausch et al. 1995) or commercial immunoglobulin

preparations (Johnston et al. 1989) against a variety of EV serotypes causing neonatal

sepsis have been reported; other reports describe progressive disease and death despite

such therapy (Wong et al. 1989). A blinded randomized controlled study was too small to

demonstrate clinical benefit but did show a reduction in viral titer in neonates receiving

intravenous immunoglobulin preparations that were subsequently shown to contain high

antibody titers to the infecting serotype (Abzug et al. 1995). Individuals with congenital

or acquired antibody deficiencies are also at risk for severe EV infections. Prior to the

availability of intravenous immunoglobulin preparations, mixed results were reported

with intramuscular and/or intrahecal administration of immunoglobulin preparations. As

with the neonatal sepsis, some antibody deficient patients appeared to benefit from

supplemental immunoglobulin whereas others progressed and died despite therapy

(McKinney et al. 1987). Since known antibody deficient patient have begun receiving

maintenance supplementation with intravenous immunoglobulin, the incidence of

chronic, progressive EV meningoencephalitis has fallen (demonstrating the prophylactic

benefit of these preparations) and the clinical profile of patients developing such

infections has been modified (Webster et al. 1993). Therapeutic efficacy in established

EV meningoencephalitis in antibody deficient patients has only been anecdotally studied.

3.9.3. Capsid- Inhibiting Compounds

Capsid inhibiting compounds block viral uncoationg and/or viral attachment to

host cell receptors. The resolved three dimensional structures of the EVs reveal a


“canyon” formed by the junctions of VP1 and VP3. Beneath the canyon lies a pore, this

leads to a hydrophobic pocket into which a variety of diverse hydrophobic compounds

and integrates. Although the compounds integrate into a virus capsid via a number of

noncovalent hydrophobic type interactions, the affinity is high, with constant ranging

from 2.0 x 10-8

to 2.9x10-7

M (Fox et al. 1991). Several hypotheses have been proposed

for the mechanism of picornavirus inhibition by compounds that affect the function of the

virus capsid. Filling the hydrophobic pocket results in increased stability of the virus,

making the virus more resistant to uncoating. The increased stability of the virus

compound complex is evidenced by the resistance to thermal inactivation (Cherry et al.

1965, Rotbart et al 1998). This property can be used as a rapid screen to identify

molecules with binding avidity; most but not all compounds with potent antiviral activity

also result in thermal stability. It is also possible that a degree of capsid flexibility may be

required for uncoating, and activity of these compounds within hydrophobic pocket may

reduce this necessary flexibility, inducing a more rigid structure. Alternatively, changes

in the conformation of the canyon floor as a result of drug activity within underlying

pocket may affect the attachment of the virus to the host cell receptor (Pevear et al.

1989). It has been shown, however, that such perturbations in the canyon floor do not

absolutely correlate with antiviral potency (Zhang et al. 1992). The capsid inhibiting

compounds vary in their spectrum of activity, perhaps as a result of factors such as a

pocket fit.

Pleconaril (3-13,5-dimethyl-4-[3-methyl-5-isoxazolyl0 propyl]phenyl]-5-

(trifluromethyl)-1,2,4-oxadiazole) is the first of a new generation of metabolically stable

capsid function inhibitors. This compound has demonstrated broad spectrum and potent


anti EV and antirhinovirus activity and is highly orally-bioavailable (Kearns et al. 1999,

Pevear et al. 1999). In a mouse model of multiorgan system infection following

intracranial inoculation of EVs, pleconaril reduced viral titers in all affected organs and

prevented death of the animals (Pevear et al. 1999). High levels of pleconaril are

achieved in the CNS and in the nasal epithelial tract (M. McKinley, personal

communication). Pharmacokinetic studies of pleconaril have been undertaken with

adults, children, and neonates (Rotbart 2000). The pharmacokinetics of pleconaril in

adults is best characterized as a one compartment open model with first order absorption

(1). Concentrations of pleconaril 12 h after a single oral dose remain 2.5-fold greater than

that required to inhibit 95% of EVs in vitro. Neonates and older children have

pharmacokinetic profiles similar to those in adults (Rotbart 2000). Oral bioavailability, in

animals and humans, approaches 70%. In preclinical trials, pleconaril was devoid of

cardiovascular and CNS side effects and no differences from placebo have been noted in

terms of adverse events in any of the clinical trials to date.

In a challenge study of coxsackievirus group A21 respiratory infection, 33

volunteers were randomized to receive either 400 mg of pleconaril or matching placebo,

orally, 14 h before inoculation with virus (Schiff et al. 2000). Beginning after inoculation,

subjects receive either 200 mg capsules twice daily for 6 days. Pleconaril had a

significant beneficial effect on symptom scores, global assessment, fever, and nasal

mucus production, with 41% of placebo treated subjects experiencing moderate colds

versus none in the pleconaril treated group. Peak viral titers, which occurred on the peak

day of symptoms, were reduced by more than 99% in the pleconaril group compared to

the placebo group (Schiff et al. 2000).


In a placebo controlled trial of pleconaril in 221 pediatric patients with EV

meningitis, significant reductions in the total morbidity (composite measurement of all

disease symptoms) and global assessment (caregiver’s assessment of patient’s illness)

scores were documented for the overall study population treated with pleconaril.

Headache duration was significantly reduced by pleconaril treatment in children older

than 8 years. Responses were noted as early as 24 h after initiation of treatment. Viral

shedding from the throat was also reduced in the pleconaril treated group compared with

placebo. In a double blind, placebo-controlled trial, 198 adults aged 14 to 65 years

received either 200 mg of pleconaril three times per day for 7 days or placebo. Those

receiving pleconaril had a 2 day reduction in duration of headache and a 2 day faster

resolution of all symptoms of meningitis. Pleconaril treated patients also returned to work

or school 2 days sooner. Phase III trials of pleconaril have now been conducted in adult

and pediatric EV meningitis. The results confirmed efficacy of pleconaril in certain

populations of adults, but statistically significant differences from placebo were not

observed in the overall adult treatment group or, in a separate study in pediatrics patients.

Pleconaril has been used in a compassionate release protocol for more than 90

patients with potentially life threatening EV infections, 38 of whom have been monitored

long enough to assess therapeutic responses (Rotbart et al. 2001). Among 16 antibody

deficient patients with chronic EV meningoencephalitis, 12 showed some clinical

improvement and 3 others stabilized concurrent with therapy. Six out of the eight

patients cleared the virus, and eight out of nine had improvement in other laboratory

parameters. Clinical responses were also seen in three out of the four patients with severe

neonatal EV disease, three of four with myocarditis, three of three patients with chronic


EV infection related to bone marrow transplant, two out of three patients with vaccine

associated or wild type poliomyelitis, and one of with post-polio muscular atrophy

syndrome (Rotbart et al. 2001)

In a double blind placebo controlled study of 1,024 adults with respiratory

infection during the fall rhinovirus season, patients receiving pleconaril recovered from

all cold symptoms and returned to overall wellness (measured via a global assessment

score) 3.5 days sooner than did patients receiving placebo. Individual symptom

(including nasal congestion, rhinorrhea, and pharyngitis) each resolved 1 to 2 days sooner

in the pleconaril treated patients.

In all clinical studies to date (140, 142; Hayden et al., 39th

ICAAC; Sawyer et al.,

APS/SPR Meet.), a very favorable safety profile has been observed with pleconaril.

There have been no differences in adverse events between treatment and placebo groups.

This observation is probably the result of the unique site of the action of the compound

on the viral capsid and the paucity of metabolic by products.

Supportive care for the patient with EV meningitis is usually adequate to ensure

complete recovery. Attention to fluid balance is necessary to avoid or ameliorate the

syndrome of inappropriate antidiuretic hormone or brain edema. Electrolytes and on

occasion, urine and serum osmolarity may require monitoring. Brain edema is a rare

complication of EV meningitis but is readily managed with mannitol. Seizures may result

from fever alone or may reflect direct viral or indirect inflammatory damage of brain

parenchyma. Phenytoin or phenobarbital is the preferred agents for managing this

complication. Rapidly progressive deterioration requiring more intensive support speaks


strongly against an EV etiology, and other potentially treatable causes must be

immediately considered.

Treatment for the neonate with sepsis or the child or adult with myocarditis is

likewise symptomatic. Maintenance of blood pressure is, of course, paramount in each of

those syndromes. Steroids have been widely debated in the therapy of myocarditis but are

now felt to be contraindicated in most cases (Martino et al. 1995). No significant benefit

has been reported for other immunosuppressive classes of drugs either and some are

clearly harmful in animal models of viral myocarditis (Rotbart et al. 2001).

Adequate hydration is the only indicated therapy in children with herpangia and

hand foot and mouth syndrome due to the EVs. Other respiratory manifestations of EV

infections are managed symptomatically.

Material and MethodsMaterial and MethodsMaterial and MethodsMaterial and Methods

4. Material and Methods

4.1. Sample Size

Based on the published literature on the South East Asia Region (SEAR), it was

assumed that the prevalence of NPEV could be 25% with a possible error of 10% on

either side. For α = 0.05 and 90% level of confidence, the minimum sample size required

167. Taking 10% chances of missing on mishandling of sample, the sample will be 183

samples for the study.

4.2. Inclusion criteria for disease patients

The diagnosis of AFP was made on the basis of clinical symptoms and signs such

as acute onset of focal weakness or paralysis characterized as flaccid (reduced tone),

without other obvious cause (e.g. trauma) in children < 15 years old. Detection of virus

was done from stool specimen (WHO 2001).

The diagnosis of aseptic meningitis/viral meningoencephalitis was made on the

basis of (i) clinical symptoms and signs of meningitis, such as fever, vomiting, headache,

neck stiffness and meningeal irritation, (ii) CSF pleocytosis (≥ 5 leukocytes/mm3) with

normal CSF protein and sugar levels and (iii) negative results on bacterial culture and

latex particle agglutination test. Detection of virus was done from stool specimen, rectal

swab or CSF (Mistchenko et al. 2006).

The diagnosis of hand, foot and mouth disease was made on the basis of clinical

symptoms and signs such as fever, vesicle up to 5 mm in diameter localized on the buccal

mucosa and tongue as well as on the hands and feet. Detection of virus was done from

stool specimen, rectal swab or throat swab (Bru et al. 2002).


The diagnosis of myocarditis/pericarditis was made on the basis of: clinical

symptoms and signs such as fever, chest pain and dyspnea. Other signs will be pericardial

rub, heart dilation and arrhythmias. Detection of virus was done from stool and serum

specimen (Bru et al. 2002).

The diagnosis of herpangia was made on the basis of clinical symptoms and signs

such as fever some 8-10 vesicles or small ulcers, 1-3 mm in diameter seen on the

posterior pharyngeal wall, pain on swallowing. Detection of virus was done from stool

specimen, rectal swab or throat swab (Bru et al. 2002).

The diagnosis of AHC was made on the basis of clinical symptoms and signs such

as pain, swelling of the eyelids and subconjunctival hemorrhages of a few days’ duration.

Detection of virus was done from conjunctival swab collected within 24 hour after the

appearance of symptoms (Bru et al. 2002).

The diagnosis of rashes was made on the basis of clinical symptoms and signs

such as pharyngitis, fever and maculopapular rashes. Detection of virus was done from

stool specimen (Bru et al. 2002).

4.3. Clinical specimens

A total of 256 clinical specimens [CSF (n=25), throat swab (n=60), serum (n=15),

stool (n=90) and counjunctival swab (n=66)] were collected from same number of

patients (age range 1 month to 65 years; mean 12.6 years) who had received medical care

in department of gastroenterology, neurology, and cardiology, at Sanjay Gandhi Post

Graduate Institute of Medical Sciences (SGPGIMS) Lucknow and Dept. of pediatrics

from King George’s Medical University Lucknow, Uttar Pradesh, or their clinical


specimens were sent for EV diagnosis at department of Microbiology, SGPGIMS

Lucknow, Uttar Pradesh. The throat swab, rectal swab and conjunctival swab was

collected into transport medium containing 2 ml of Eagle’s minimum essential medium

(pH 7.2) with penicillin (400 U/liter), streptomycin (400 µg/liter), gentamycin

(50µg/liter) and amphotericin B (1.25 g/liter). All specimens were immediately

transported in frozen conditions to the laboratory, and stored at –70°C till further use.

The study protocol was approved by the Institutional Ethical Committee (A-

10:PGI/EP/EC/44/28.11.2008).

4.3.1. Clinical sample processing

Stool suspensions was prepared by adding 5 ml of phosphate-buffered saline, 1 g

of glass beads (Corning Inc., Corning, NY), and 0.5 ml of chloroform to 1 g of stool

sample, shaking the mixture vigorously for 20 min in a mechanical shaker, and

centrifuged at 1,500 x g for 30 min at 4°C (WHO 2001). For rectal swab samples, the

fluid was centrifuged at 13,000 x g for 1 min at room temperature to remove the solids,

and the supernatant was transferred to a fresh tube. Other specimen type (including CSF;

supernatants from conjunctival swab sample) were processed without pretreatment

(WHO 2001).

4.3.2. Virus isolation from clinical specimen

Virus isolation was done into three continuous cell lines; RD (human

rhabdomyosarcoma), HEp-2 (human epidermoid carcinoma), and L20B (mouse fibroblast

cells expressing the poliovirus receptor CD155). Specimen (0.2 ml) was inoculated into


RD, L20 B and HEp-2 cells (1 x 10 6/ml), and was incubated at 36.5°C. Cytopathic

effects (CPE) in the tubes were examined for seven days from the day of incubation. If

CPE was not observed on first passage, a second blind passage was performed in the

respective cell line. When a CPE was observed, the tubes were kept at -70°C for RNA

extraction and phenotypic characterization.

4.4. Environmental sample

The sewage samples were collected once a month between January, 2009 and

December, 2010 from the Daulatganj sewage treatment plant in Lucknow city, Uttar

Pradesh. The Daulatganj sewage treatment collection site covers the entire north zone,

central zone and a part of west zone of Lucknow city. It covers a population of

approximately 10, 00,000 and is the main sewage treatment plant in the area. In the

morning hours after 10:00 A.M. approximately 2 liters of free flowing sewage sample

was collected in a stainless steel bucket (free of any infection). Then sample was

transferred into a clean and autoclaved sterile glass bottle from the collection site and

transported it to the laboratory within 1 hour of collection on dry ice. The Collected

sewage sample was stored at -70°C till further processing.

4.4.1. Environmental sample processing

Sewage samples were processed for virus isolation as soon as they were received

in the laboratory. The sewage sample was concentrated by two-phase concentration

method on the same day as described previously (Chowdhary et al. 2008). In brief, the

pH of the sample was adjusted to 7.2 and the sample was centrifuged at 5000g for 30


minutes at 4ºC to pellet the solids. The supernatant was retained and the sediment was

extracted twice with 5 parts (vol/vol) 3% beef extract and 3 part (vol/vol) chloroform.

After centrifugation at 5000g for 30 minutes at 4οC, the aqueous supernatant from these

extraction and initial supernatant were combined and the virus was concentrated by use of

polyethylene glycol (PEG) precipitation (8% wt/vol and .3 mol/L NaCl) for 18 hr. at 4οC.

After centrifugation at 5000g for 30 minutes at 4οC, the PEG pellet was suspended in a

small volume of sterile PBS (5-20 ml) and was extracted with a 0.5 volume of

chloroform. After centrifugation at 5000g for 30 minutes at 4οC, the chloroform phase

was re-extracted with 1 part of 3% beef extract. After the aqueous supernatant were

combined, 3% fetal calf serum (FCS), 30 µg/ml streptomycin and 50 µg/ml fungizone

will added. Approximately 4 ml of concentrated sewage was obtained and stored at -70°C until

used for virus isolation.

4.4.2. Conventional virus isolation method

All three cell lines (RD, HEp-2 and L20B) were grown in EMEM containing 10%

growth medium in culture tubes (Nalge Nunc, Rochester, NY). After the development of

confluent monolayer, growth medium was decanted from culture tube and 1 ml

maintenance medium was added into each tube. Concentrated filtered sewage (0.3 ml)

was added into each tube and incubated at 36.5°C. CPE in tubes were examined for seven

days from the next day of incubation. If CPE was not observed on first passage, a second

blind passage was performed in the respective cell line. When a CPE was observed, tubes

were kept at -70°C for RNA extraction.


4.4.3. Shell vial culture method

Virus isolation was done into three continuous cell lines; RD (human

rhabdomyosarcoma), HEp2 (human epithelium larynx) and L20B (mouse fibroblast cells

expressing the poliovirus receptor CD155) to maximize EV detection. All three cell lines

were grown in Eagle’s minimal essential growth medium (EMEM) containing 10% foetal

calf serum (Gibco) with penicillin and streptomycin (0.1 mg/ml each) in flat-bottom

culture tubes (Nunc Chemi-Con). After development of confluent monolayer, growth

medium was decanted from culture tube and concentrated filtered sewage (0.3 ml) was

inoculated. The inoculated tubes were then centrifuged at 1000 × g for 30 min at room

temperature and incubated for further 30 min at 36.5°C. After incubation, 1 ml of EMEM

containing 2% foetal calf serum (maintenance medium) was added in each tube and again

incubated at 36.5°C for 2 days. The tubes were observed on the next day for bacterial

contamination and toxicity. After 2 days all the tubes were kept at -70°C for RNA

extraction.

4.5. RNA extraction

RNA was extracted from the clinical specimens/virus isolates by using a QIAamp

Viral RNA mini kit (QIAGEN, Inc., Valencia, CA), using a protocol according to the

manufacturer's instructions. In brief, 560µl of buffer AVL containing 5.6 µl carrier RNA

was added to 140 µl specimen in 1.5 ml microcentrifuge tube. For the lysis of viral

particle, the samples was homogenized by pulse vortexing for approx. 30 seconds and

incubated it at room temperature for 10 min. 600 µl of 100% ethanol was added to the

homogenized sample and mixed well by pulse vortexing for 20 seconds. 600 µl of the


sample was added to the QIAamp mini column placed in a 2 ml collection tube and

centrifuged at 10,000 rpm for 15 sec in a table-top microcentrifuge (Eppendrof). The

flow through was discarded. Remaining sample was added to the QIAamp mini column

placed in a 2 ml collection tube and centrifuged at 10,000 rpm for 15 sec. The flow

through was discarded. 500 µl of buffer AW1 was added to the QIAamp mini column and

centrifuged at 10000 rpm 15 sec. Flow through with the collection tube was discarded. A

new collection tube was attached to the column and 500 µl of AW2 buffer was added to

the column, followed by centrifugation at 10,000 rpm for 15 sec. The column was

centrifuged again at 14,000 rpm for 1 min to eliminate any traces of AW2 buffer. The

column was placed in a new 1.5 ml microfuge and RNA was eluted by adding 30 - 50 µl

of RNase free water and centrifuged at 10,000 rpm for 1 min. Eluted RNA was stored at -

700C.

4.6. Real time RT-PCR for EV detection

Real time quantitative PCR was performed in a Rotor-Gene 6000 real-time

instrument (Corbett Research, Mortlake, Victoria, Australia) using Geno-Sens

Quantitative real time PCR kit (Professional Biotech Ltd., India) specific for each virus.

The standard control was run in each test provided with the kit.

4.7. Molecular identification of EV

Synthesis of cDNA was carried out in a 10 µl reaction mixture containing 5 µl of

RNA, 100 µM each deoxynucleoside triphosphate, 2 µl of 5X reaction buffer (Invitrogen,

Carlsbad, CA), 0.01 M dithiothreitol, 1 pmol each cDNA primer (primers AN32, AN33,


AN34, and AN35; Table 1), 20 U of RNasin (Roche Applied Science), and 100 U of

SuperScript II reverse transcriptase (Invitrogen). Following incubation at 22°C for 10

min, 45°C for 45 min, and 95°C for 5 min, the entire 10 µl RT reaction mixture were

used in the first PCR (final volume, 50 µl) (PCR1), consisting of 5 µl of 10X PCR buffer

(Roche Applied Science), 200 µM each dNTP, 50 pmol each of primers 224 and 222

(Table 1), and 2.5 U of Taq DNA polymerase (Roche Applied Science), with 40 cycles of

amplification (95°C for 30 s, 42°C for 30 s, 60°C for 45 s). One microliter of the first

PCR was added to a second PCR (PCR 2) for seminested amplification. PCR 2 contained

40 pmol each of the primers AN89 and AN88 (Table 1), 200 µM each dNTP, 5 µl of 10X

FastStart Taq buffer (Roche Applied Science), and 2.5 U of FastStart Taq DNA

polymerase (Roche Applied Science) in a final volume of 50 µl. The FastStart Taq

polymerase were activated by incubation at 95°C for 6 min prior to 40 amplification

cycles of 95°C for 30 s, 60°C for 20 s, and 72°C for 15 s (Nix et al., 2006).

Specific products (~350 - 400 bp) were cut and purified from the gel by using a

QIAquick gel extraction kit (QIAGEN). The resulting DNA templates were directly

sequenced by using primer AN 89 and AN 88 on automated sequencer (both from

Applied Biosystem, Foster City, CA) from the commercially available sequencing

company .

Virus serotypes were identified by pairwise comparison of the VP1 amplicon

sequence with a database of complete VP1 sequences of all EV serotypes using the

BLAST program (www.ncbi.nlm.gov/BLAST) from GenBank. Strains that are at least

75% identical in VP1 sequence belong to the same serotype.


4.8. RT-PCR of CV A24v 3C region

Amplification of CV A24v 3C protease region was performed with 3C-F and 3C-

R primer according to Kishore et al., 2002 with some modification (Kishore et al. 2002).

In brief, cDNA synthesis was carried out in a 20 µl reaction mixture containing 5 µl of

RNA, 100 µM each deoxynucleoside triphosphate, 4 µl of 5X reaction buffer (Invitrogen,

Carlsbad, CA), 0.01 M dithiothreitol, 100 pmol Hepta N primer (synthesized by Ocimum

Biosolutions, India), 20 U of RNasin (Roche Applied Science), and 100 U of SuperScript

II reverse transcriptase (Invitrogen Carlsbad, CA). The RT reaction mixture was

incubated at 25°C for 10 min, 42°C for 45 min and 95°C for 5 min. PCR reaction

mixtures of 30 µL contained: 2 µL cDNA, 3 µL 10X PCR buffer, 1.5 mM MgCl2, 0.2

µmol/L of each primer (3C-F/3C-R), 2.5 units of Roche Taq DNA Polymerase (Roche

Applied Science), and 10 µM dNTP. Reactions were incubated at 95°C for 2 min,

followed by 35 cycles of 95°C for 30 s, 52°C for 30 s and 72°C for 45 s. After the last

cycle, final extension was continued at 72°C for 5 min. The products were analyzed by

electrophoresis in a 1.5% agarose gel containing ethidium bromide (0.5 µg/ml) using a

100 bp DNA Ladder (Invitrogen Carlsbad, CA) and visualized in a UV transilluminator.

Specific product was purified with the QIAquick PCR Purification Kit (QIAGEN,

Hilden, Germany), and sequenced by using 3C-F and 3C-R primer on automated

sequencer (Applied Biosystem, Foster City, CA) according to manufacturer’s instruction.

4.9. Alignment and phylogenetic analysis

The nucleotide sequence was compared with all of the enterovirus sequence

available in the GenBank. The Clustal W software was used to perform sequence


alignment (Thompson et al. 1994). Phylogenetic tree was designed by imputing the

aligned sequences into the MEGA program (version 3.1) (Kumar et al. 2004) and

constructed with the neighbor-joining algorithm (Saitou et al. 1987). Genetic distances

were calculated with the Kimura-2 parameter model (Kimura et al. 1980) with a

transition/transversion ratio of 2.0, and the reliability of the trees was determined by

bootstrap analysis with 1,000 pseudoreplicate data sets (Felsenstein et al. 1993).

4.10. Virus titration

Virus titre was measured on RD/HEp-2 cells by endpoint titration as per standard

procedure. In brief, RD/HEp-2 cell was grown in 96 well (103 cells per well) tissue

culture plates (Nunc, Denmark). Ten fold serial dilutions of the virus through 10−9

were

made in 2% MEM. To the 65-70% confluent cell monolayer, 100 µl of each serial

dilution was inoculated into four wells of each well and plate was incubated at 36.50C

with 5% CO2. Plain MEM was used as a negative control. After 5 days of incubation, the

titres were determined by an endpoint micromethod and were expressed in log10 50%

tissue culture infective dose units (TCID50) per ml.

4.11. Cytopathogenic properties of the isolated EV in epithelium and neuronal cell

line

In Uttar Pradesh state of India, EV has been reported in central nervous system

infection in children (Kumar et al. 2008). To study the phenotypic characteristics of EV

isolated from clinical and environmental specimen, we used the cell line neuronal and

epithelium origin.


Neuronal and epithelium cells (1 X 10 6/ml) was infected with each EV isolate

from this study at multiplicity of infection (MOI) 10 as determined by the titration of

virus stocks on RD/HEp-2 cells respectively. Subsequently plate was incubated at 36.5°C

for 1 hr to allow absorbing the virus by cells, After adhering, cells was washed three

times with serum-free DMEM to remove unbound virus particles and covered with

DMEM supplemented with 2% FBS. The appearance of CPE was examined after 24 hr

post infection under an inverted light microscope at 100-200X magnification (WHO

2001, Joo et al. 2005).

4.12. MTT Assay

The quantitative measurement of cell damage (cytotoxicity) was estimated by cell

viability using the MTT assay (Mosmann et al. 1983) which measures mitochondrial

enzyme activity inside living cells. In brief, cells maintained after 24 hr post infection

were incubated with 50 µl of MTT (1 mg/ml in PBS) for 4 hr. After 4 hr the media was

discarded from the plate, and 50 µl of dimethyl sulfoxide (DMSO) was added to the wells

and mixed thoroughly to dissolve the dark blue formazan crystals produced by viable

cells. Absorbance was read on an ELISA reader, using a test wavelength of 540 nm and a

reference wavelength of 650 nm. Each value was estimated by the following equation

(absorbance of the sample-absorbance of the blank) / (absorbance of the uninfected-

absorbance of the blank) X 100. Each experiment was done in duplicate.


4.13. Rct marker test

Reproductive capacities at different temperatures (Rct marker) were evaluated by

the Rct test. The Rct value is defined as the difference between the log10 virus titer of a

viral stock measured at the optimal temperature (37°C) and that of the supraoptimal

temperature (40°C). Briefly, each virus stock was decimally diluted through 10−9. A 0.1-

ml volume of medium containing 4 × 104 RD/HEp-2 cells was added into each well of

two 96-well plastic plates. A 0.1 ml volume of each virus dilution was inoculated into

four wells of each of the two plates. One plate was incubated at 37°C and the other at

40°C. After 5 days of incubation at the appropriate temperatures, the titers were

determined by as previously described method in section 4.10. Viruses were considered

to be thermosensitive (ts) if the Rct value (between 37°C and 40°C) was greater or equal

to 2.00 and thermoresistant (not-ts) when the Rct value was less than 2.00 (Pilaka et al.

2011).

4.14. Mice inoculation

4.14.1. Mice

BALB/c mice (10-15 days old) were acquired from animal house of Sanjay

Gandhi post graduate institute of medical sciences. Mice were divided into two groups

for clinical and environmental strain. After the virus titer determination, specified dose of

virus i.e. 3 x 106 PFU was inoculated in BALB/c mice by intracereberal and oral route.

Sterile PBS was inoculated in age and sex matched control mice. Mice were monitored

daily for sign and symptoms. Mice were sacrificed at the same intervals after 5, 10, 15

and 20 days post inoculation. At each time point 6 mice (2 for clinical strain, 2 for


environmental strain and 2 for control group) were sacrificed and bled retro-orbitally

followed by euthanization by cervical dislocation. Blood was obtained by cardiac

puncture. Portions of heart, pancreas, thymus, spleen, small and large intestine were

obtained, washed in PBS and stored at -80ºC or fixed in 10% formaldehyde for

histological studies.

4.14.2 Organ suspensions for virus isolation in tissue cultures

Snap-frozen tissues were freeze–thawed twice and 10% suspensions in PBS were

prepared by sonification (Bopegamage et al., 2003). Penicillin (50 units/ml) and 40 mg

streptomycin were added. Suspensions were incubated overnight at 4ºC, centrifuged at

1500 g for 30 min at 4ºC, passed through a 0.45 mm Millipore filter and frozen at -80ºC.

Each homogenate was titrated separately.

4.14.3. Quantification of infectious virus in organs

Tenfold serial dilution of the sera and organs were prepared. Of these diluted

suspensions, 100 µl was added (eight wells per dilution) to monolayers of HEp-2 cells

grown on 96-well flat-bottom microtitre plates and incubated at 37ºC in a CO2 incubator.

Virus titres were expressed as TCID50 values, calculated by the Karber method. The

results were read at 4–7 days after infection. To confirm that CPE was not due to toxicity,

each sample was passaged further in HEp-2 cells.


4.14.4. Histology

Serial 4–7 mm thick sections of formalin-fixed, paraffin embedded samples of

heart; spleen, pancreas, large intestine, thymus, brain and small intestine were stained

with haematoxylin and eosin. Two slides with two or three sections each, cut 40 mm

apart, were prepared from each sample, and histopathologic changes were examined

under a light microscope by two investigators independently. Cellular infiltration (I) and

necrosis (N) in the tissue were graded as described by Opavsky et al. (1999). A score of 0

corresponds to the absence of inflammation or necrosis; 1, incipient, focal inflammation

or necrosis (only one or two foci in the whole section); 2, mild to moderate infiltration or

necrosis (10–40% of section affected); 3, moderate infiltration (40–70% of section

affected); 4, extensive areas of infiltration or necrosis (70–100% of the tissue section

affected).

4.15. Statistical analysis

Chi-square test, independent samples t test were used to compare data between

groups when appropriate by using SPSS for Windows version 16 (SPSS Inc, Chicago,

USA) or Fisher exact test using online (http://in-silico.net/statistics/fisher_exact_test).


Table 1: Primer used in this study

Primer Name Sequence (5’-3’) *Region

AN 32 GTYTGCCA VP1

AN 33 GAYTGCCA VP1

AN 34 CCRTCRTA VP1

AN 35 RCTYTGCCA VP1

224 GCIATGYTIGGIACICAYRT VP1

222 CICCIGGIGGIAYRWACAT VP1

AN 89 CCAGCACTGACAGCAGYNGARAYNGG VP1

AN 88 TACTGGACCACCTGGNGGNAYRWACAT VP1

CV A24 3C-F TACAAACTGTTTGCTGGGCA 3C

CV A24 3C-R ACTTCTTTTGATGGTCTCAT 3C

ResultsResultsResultsResults

5. Results

5.1. Detection and identification of enterovirus in clinical specimen

A total of 256 clinical specimens [CSF (n=25), throat swab (n=60), serum (n=15),

stool (n=90), and conjunctival swab (n=66) were collected between January 2009 and

December 2010. Out of 256 clinical specimens (Table 2), 90 (35.1%) were positive for

EV by real time RT-PCR targeting the highly conserved 5’ UTR region. The most

suitable clinical specimen for EV detection was conjunctival swab (n=32, 48.4%)

followed by stool (n=32, 35.5%), throat swab (n=19, 31.6%), CSF (n=5, 20%) and serum

(n=2, 13.3%). All clinical specimens (n=256) were also inoculated into RD, HEP-2 and

L20B cell line. Virus isolation was successful in 57 (22.2%) samples, out of which 53

were EV positive.

Table.2 Positivity in different clinical sample by RT PCR and Virus isolation

Specimen Name Real time PCR Virus isolation

Cerebrospinal fluid(n=25) 5 (20%) 1(4%)

Serum(n=15) 2 (13.3%) 1(6.67%)

Throat swab(n=60) 19 (31.6%) 13 (21.6%)

Stool(n=90) 32 (35.5%) 26 (28.8%)

Conjunctival swab(n=66) 32 (48.4%) 12 (18.18%)

Total(256) 90 (35.16%) 53 (20.7%)


Table 3: Demographic and laboratory finding of EV serotypes identified from clinical

specimen in this study

Month

of collection

Clinical

Diagnosis

Age in

year/

Sex

Specimen RT-

PCR

Virus

isolation

EV Serotype/Strain % Nt.

identity

01/2009 RTI 0.2/M TS POS NEG CV A4/ Deep 466 80

01/2009 AFI 1.4/F Stool POS NEG CV A8/Deep 297 81

01/2010 RTI 2.8/F TS POS NEG CV A10/Deep 51 79

02/2010 GI 2.4/M Stool POS POS CV A10/Deep 588 80

01/2010 Encephalitis 2.4/F TS POS NEG EV 76/Deep 559 77

03/2009 AFP 2.4/M Stool POS NEG EV 76/Deep 592 78

03/2009 AFP 0.9/M Stool POS POS EV 76/Deep 660 80

04/2009 AFI 2.9/M Stool POS POS CV B1/Deep 320 81

07/2009 Encephalitis 7.6/M TS POS POS CV B3/Deep 284 79

09/2009 Meningitis 2.9/F CSF POS NEG CV B3/Deep 140 80

09/2009 AFP 2.8/F Stool POS POS CV B3/Deep 311 77

05/2010 AFP 1.4/M Stool POS POS CV B3/Deep 39 81

05/2010 AFP 11.8/F Stool POS POS CV B3/Deep 70 79

04/2009 AFP 4.4/M Stool POS POS CV B3/Deep 507 80

05/2009 Meningitis 2.0/F CSF POS POS CV B3/Deep 556 77

09/2009 Encephalitis 2.1/F Stool POS NEG CV B5/Deep 248 80

09/2009 Encephalitis 7.7/M Stool POS POS CV B5/Deep 251 81

05/2010 Meningitis 8.4/M Stool POS POS CV B5/Deep 259 79

05/2010 RTI 4.1/M TS POS POS CV B5/Deep 172 80

06/2010 AFI 5.4/M Stool POS POS CV B5/Deep 80 77

07/2010 GI 2.0/F Stool POS POS CV B6/Deep 303 80

08/2010 AFI 2.9/F Stool POS POS CV B6/Deep 317 81

05/2009 Encephalitis 2.1/F TS POS POS ECV 3/Deep 25 80

05/2009 Encephalitis 1.4/M TS POS POS ECV 3/Deep 20 77

11/2010 Meningitis 1.9/M CSF POS NEG ECV 3/Deep 11 78

11/2010 Meningitis 1.2/M Stool POS POS ECV 3/Deep 07 80



03/2010 Meningitis 3.0/F Stool POS POS ECV 6/Deep 22 77


09/2010 RTI 2.3/F TS POS POS ECV 6/Deep 12 80

09/2010 AFI 2.7/M Stool POS POS ECV 6/Deep 69 81














07/2010 Encephalitis 1.9/F TS POS NEG ECV 29/Deep 28 79


07/2010 GI 2.1/F Stool POS POS ECV 30/Deep 142 77


07/2009 RTI 2.9/M TS POS NEG ECV 33/Deep 476 80

09/2010 Encephalitis 2.0/M CSF POS NEG EV 74/Deep 46 81

07/2010 Meningitis 2.1/F Stool POS NEG EV 75/Deep 66 79

07/2010 Encephalitis 2.6/M TS POS POS EV 75/Deep 13 80

07/2010 Encephalitis 5.0/F TS POS POS EV 75/Deep 10 77

07/2010 Encephalitis 5.2/M CSF POS POS EV 80/Deep 08 78

11/2009 RTI 2.9/M TS POS POS CV A13/Deep 301 80

07/2010 GI 14.2/M Stool POS NEG CV A13/Deep 312 81

07/2010 AFI 13.4/M Serum POS NEG CV A21/ Deep 307 79

05/2010 AFP 2.8/F Serum POS POS EV 83/Deep 283 80

07/2010 AHC 3.0/F CS POS POS CV A24/Deep 321 77


07/2010 AHC 18.0/M CS POS POS CV A24/Deep 323 80




07/2010 AHC 32.0/F CS POS NEG CV A24/Deep 327 77

07/2010 AHC 65.0/M CS POS NEG CV A24/Deep 328 78











CS; conjunctival swab, CSF; cerebrospinal fluid, CV; coxsackievirus, EV; enterovirus,

PV; poliovirus, ECV; echovirus, RTI; respiratory tract infection, AFI; Acute febrile illness,

GI; gastrointestinal infection, AHC; Acute hemorrhagic conjunctivitis, AFP; Acute flaccid

paralysis, POS; positive, NEG; Negative.

5.2. Detection and identification of enterovirus by Shell vial culture and

conventional method in sewage specimen

From a total of 24 sewage samples, all sewage samples (100%) were positive for

EV by shell vial culture method; while only 21 (87.5%) were positive for EV by

conventional virus isolation method. The sensitivities of RD, HEp2 cell line for EV

detection in shell vial culture and conventional virus isolation method were {89.65% and

75.86%}, {51.72% and 37.93%}, respectively (Table 4). A total of 17 different EV

serotypes were identified by ISVC-RT PCR method while only 11 by conventional

method. Echovirus (ECV) 11 (n=4) was the predominant serotype followed by poliovirus

(PV) 3 {wild PV 3 (n=3) and vaccine PV 3 (n=2)}, Coxsackievirus (CV) B3 (n=3), CV

















B5, ECV 13 and ECV 19 (n=2 each), CV A13, CV A17, CV B6, ECV 2, ECV 6, ECV 7,

ECV 12, ECV 18, ECV 25, ECV 33 and EV 75 (n=1 each).

Table 4: Enterovirus detection by shell vial and conventional method in different cell line

Month of

collection

Serotype Shell vial method

RD HEp2 L20B

Conventional method

RD HEp2 L20B

*01/2009 CV A13 - + - - - -

*01/2009 WPV 3 + + + + + +

02/2009 ECV 13 + - - + - -

*03/2009 WPV 3 + + + + + +

*03/2009 ECV 19 + - - + - -

04/2009 ECV 18 + - - + - -

05/2009 CV B3 + - - - - -

06/2009 CV B5 + + - + + -

07/2009 ECV 33 + - - - - -

*08/2009 ECV 25 + - - + - -

*08/2009 VPV 3 + + + - - -

09/2009 ECV 11 + + - + + -

10/2009 CV B3 + + - + + -

*11/2009 WPV 3 + + + + + +

*11/2009 CV B3 + + - + + -

12/2009 ECV 7 + - - + - -

*01/2010 VPV 3 + + + + + +

*01/2010 ECV 19 + - - + - -

02/2010 ECV 6 + - - + - -

03/2010 CV A17 - + - - - -

04/2010 ECV 11 + + - + - -

05/2010 ECV 11 + - - + - -

06/2010 CV B5 + + - + + -

07/2010 ECV 11 + - - + - -

08/2010 ECV 12 + - - + - -

09/2010 EV 75 + - - - - -

10/2010 CV B6 - + - - + -

11/2010 ECV 2 + + - + + -

12/2010 ECV 13 + - - + - -

*= more than one EV serotype was detected in each sample of the same date.


5.3. Prevalence of HEV infections:

Central nervous system syndrome (CNS) and acute hemorrhagic conjunctivitis

was the most common clinical manifestations (n=32) followed by acute flaccid paralysis

(n=7), respiratory tract infection (n=6), acute febrile illness (n=9) and gastrointestinal

disease (n=4).

Among the 90 specimens positive for HEV, 37 (41.1%) were less than 3 year of

age. A pattern of low rate of HEV detection rate with increase of age; 4 year - 6 year

(16.67%), 7 year - 9 year (8.9%), 10 year - 12 year (6.67%) and 12 year to above (26.6%)

was observed. A seasonal pattern was observed throughout the study with high detection

rate from June to October (Fig. 7).

A total of 26 different EV serotypes were identified from the clinical specimen in

the present study shown in Table 4. CV A24v (n=32) was the predominant serotype

followed by CV B3 (n=7)ECV 6 (n=6), CV B5 (n=5), ECV 3 (n=4), ECV 24, ECV 29,

EV 75 and EV 76 (n=3), CV A10, CV A13, CV B6, ECV 11, ECV 19, ECV 20 and ECV

33 (n=2 each), CV A4, CV A8, CV A21, CV B1, ECV 13, ECV 14, ECV 30, EV 74, EV

80 and EV 83 (n=1 each).

HEV B was the most prevalent species in throughout the study (57.5%), HEV A

species was present only in (6.19%), HEV C species was present only in (36.3%), and no

enterovirus was detected from HEV D (Table 5).


Table 5: Enteroviruses detected in 2009 and 2010 in this study

EV

serotype

EV

species

No detected in

year 2009

No detected

in year 2010

Total detected in

year 2009 & 2010

CV A4 HEV A 1 0 1

CV A8 HEV A 1 0 1

CV A10 HEV A 0 2 2

EV 76 HEV A 2 1 3

CV B1 HEV B 1 0 1

CV B3 HEV B 5 4 9

CV B5 HEV B 2 5 7

CV B6 HEV B 0 2 2

ECV 2 HEV B 0 1 1

ECV 3 HEV B 2 2 4

ECV 6 HEV B 1 6 7

ECV 7 HEV B 1 0 1

ECV 11 HEV B 3 3 6

ECV 12 HEV B 0 1 1

ECV 13 HEV B 2 1 3

ECV 14 HEV B 1 0 1

ECV 18 HEV B 1 0 1

ECV 19 HEV B 1 3 4

ECV 20 HEV B 0 2 2

ECV 24 HEV B 1 2 3

ECV 25 HEV B 1 0 1

ECV 29 HEV B 1 2 3

ECV 30 HEV B 1 0 1

ECV 33 HEV B 2 0 2

EV 74 HEV B 0 1 1

EV 75 HEV B 0 3 3

EV 80 HEV B 0 1 1

EV 83 HEV C 0 1 1

CV A13 HEV C 1 1 2

CV A21 HEV C 0 1 1

CV A24 HEV C 0 32 32

WPV3 HEV C 3 0 3

VPV3 HEV C 1 1 2


Figure 7: Seasonal distribution of enterovirus positive cases. The peak occurred in

the rainy season.

5.4. Phylogenetic analysis

To investigate the genetic relationships between EV strains from this study and

different part of the world, phylogenetic analysis of partial VP1 region was performed

with all corresponding sequences of the respective serotypes available in GenBank (on

dated 31.12.2012). As expected, the viruses were characterized by substantial divergence

from their respective prototype strains. In most cases, nucleotide sequence identity to the

prototype was less than 80% except Sabin poliovirus (Table 3). The divergence range

among each serotype (CV A10, CV A13, CV A24 (0-2%), CV B3, CV B5, CV B6, ECV

3, ECV 6, ECV 11, ECV 19, ECV 20, ECV 13, ECV 24, ECV 29, ECV 33, EV 75, EV

76 and PV3) was 0-8%, 1-2%, 5%, 9%, 12%. All EV strains in this study clustered with

their respective reference strain with bootstrap values higher than 75% shown in

phylogenetic tree. Five serotypes were represented by more than one genetic lineage,


including EV 75 (Fig. 20) with three lineages and four serotypes (CV A13, CV B3, ECV

19 and ECV 20) with two lineages (Fig. 10, 11, 15, 16). In most cases, different lineages

of the same serotype co-circulated in the same year. When the same serotype was

detected in both environmental and clinical samples, the strains were closely related

genetically, indicating the lack of substantial differences among strains by source of

isolation (Fig. 10, 11, 12, 15, 19, 20). The closest matches of the EV strains from this

study were mainly from Bangladesh and Georgia country identified within last 12 years.

5.4.1. Molecular characterization of CV A24 variant

During this study CV A24 was the predominant serotype associated with an

acute hemorrhagic conjunctivitis outbreak in 2010. To study molecular epidemiology of

CV A24v, we compared VP1 (236 nucleotide) gene sequences of CV A24v from this

study with all CV A24v isolate sequence available in GenBank. The nucleotide variation

in the VP1 region among CV A24v strain from this study was 0-2% and 14-16% with

EH24/70 prototype strain (Accession no D90457). Phylogenetic analyses of the CV A24v

isolate from this study showed that all Indian strains from 2010 outbreak was clustered

with CV A24v strains in genogroup IV associated with AHC outbreak in Brazil in 2009

(97% identity) (Wu et al. 2008), China in 2010 (97-98% identity) (Leveque et al. 2006)

and recent outbreak in France in 2012 (97-99%) (Taveras et al. 2006) (Fig. 22).

However, most studies of AHC outbreaks caused by CV A24v have used 3C

region for molecular epidemiological analysis (Leveque et al. 2006, Wu et al. 2008, De et

al. 2012, Fonseca et al. 2012). To perform phylogenetic analysis, we amplified and

sequenced the 3C protease gene of the Indian isolates collected in this study and


compared with all available sequences. The nucleotide sequence divergence among

Indian strains from 2010 outbreak was 0-2% and 14-15% with EH24/70 prototype strain

(Accession no D90457). Phylogenetic analysis showed that four genogroups were

chronologically discerned in the tree (Figure 23). All isolates from this outbreak were

included in genogroup IV and clustered with an strain from Brazil isolated from the 2009

outbreak (Taveras et al. 2012), Cuba isolated between 2008 and 2009 (Fonseca et al.

2012) and China in 2010 (De et al. 2012).


Figure 8: Phylogenetic tree of CV B5 isolates from this study (Indicated by

filled circle) and other reference strains. Scale bar indicates nucleotide

substitutions per site.


Figure 9: Phylogenetic tree of CV A10 isolates from this study (Indicated by




Figure 10: Phylogenetic analysis of CV A13 isolates from this study

(Indicated by filled circle) and other reference strains. Scale bar indicates

nucleotide substitutions per site


Figure 11: Phylogenetic tree of CV b3 isolates from this study (Indicated by




Figure 12: Phylogenetic tree of CV B6 isolates from this study (Indicated by filled

circle) and other reference strains. Scale bar indicates nucleotide substitutions per site.


Figure 13: Phylogenetic tree of ECV 3 isolates from this study (Indicated

by filled circle) and other reference strains. Scale bar indicates nucleotide



Figure 14: Phylogenetic tree of ECV 11 Phylogenetic tree of CV A10

isolates from this study (Indicated by filled circle) and other reference

strains. Scale bar indicates nucleotide substitutions per site.


Figure 15: Phylogenetic tree of ECV 19 isolates from this study (Indicated

by filled circle) and other reference strains. Scale bar indicates nucleotide



Figure 16: Phylogenetic tree of ECV 20 isolates from this study (Indicated by
















Figure 20: Phylogenetic tree of EV 75 isolates from this study (Indicated by




Figure 21: Phylogenetic tree of PV3 isolates from this study (Indicated by filled

circle) and other reference strains. Scale bar indicates nucleotide substitutions per

site.


Figure 22: Phylogenetic tree of CV A24 VP1 gene from this study (Indicated by




Figure 23: Phylogenetic analysis of CV A24 3C gene from this study (Indicated by filled

circle) and other reference strains. Scale bar indicates nucleotide substitutions per site.


5.5. Cytopathogenic properties of the isolated EV in cell line

All EV (n=76) isolates were inoculated in epithelial cell line (RD/HEp-2) and

neuronal cell line (SH-SY5Y). Out of 76 virus isolates, only 6 (CV B5/Deep 280, ECV

19/Deep 163, EV 76/Deep 660, WPV3/Deep 151, WPV3/Deep 157, WPV3/Deep 160)

were able to grow in neuronal origin cell line (Table 6).

5.5.1. Temperature sensitivity of EV isolates

The Rct marker assay is based on a comparison of the temperature-sensitive

multiplication of strains and the non-temperature-sensitive multiplication of virulent

strains. The wild strain of PV 3 (WPV3/Deep 151, WPV3/Deep 157, and WPV3/Deep

160) showed a non-ts phenotype with Rct values ranging from 0.0 to 0.1 units, while all

Sabin vaccine strains of PV3 exhibited, as expected, Rct values greater than 2.00 units.

ECV 11/Deep 23 showed partial reversion to non-ts phenotype with an Rct value of 1.9

units. All other isolate were temperature sensitive (Table 6).

Figure 24: Cytopathic effect of infection with virus isolates in SH-SY5Y cell line. The

cells were examined under a phase-contrast microscope at 200X magnification.


Table 6: Cytopathogenic and replication capacity of EV isolates from this study

EV serotype/strain % cell viability in cell line aEpithelium

bNeuronal

aVirus titre ∆ log Rct

37.0 40.0 40

CV B1/Deep 320 22 84 7.6 4.5 3.1

CV B3/Deep 284 18 82 7.8 4.9 2.9

CV B3/Deep 155 23 81 8.0 5.2 2.8

CV B3/Deep 556 22 86 7.9 4.8 2.9

CV B3/Deep 70 21 82 7.5 4.8 2.7

CV B3/Deep 311 26 89 7.7 4.5 3.2

CV B3/Deep 39 20 88 7.4 4.6 2.8

CV B3/Deep 140 22 82 8.0 5.1 2.9

CV B3/Deep 507 21 89 7.9 4.9 3.0

CV B5/Deep 172 18 88 8.1 5.5 2.6

CV B5/Deep 267 10 86 7.7 4.5 3.2

CV B5/Deep 80 17 82 7.8 4.9 2.9

CV B5/Deep 248 15 86 7.7 4.9 2.8

CV B5/Deep 251 23 79 7.9 5.2 2.7

CV B5/Deep 280 25 40 7.5 7.4 0.1

CV B6/Deep 303 21 84 7.9 4.8 3.1

CV B6/Deep 317 10 81 7.6 4.8 2.8

ECV 2/Deep 270 15 82 7.6 4.7 2.9

ECV 3/Deep 25 15 82 7.6 4.5 3.1

ECV 3/Deep 20 18 86 7.8 4.9 2.9

ECV 3/Deep 11 20 89 8.0 5.2 2.8

ECV 6/Deep 145 21 88 7.9 4.8 2.9

ECV 6/Deep 255 22 82 7.5 4.8 2.7

ECV 6/Deep 22 28 84 7.7 4.5 3.2

ECV 6/Deep 18 29 82 7.6 4.5 3.1

ECV 6/Deep 12 28 82 7.8 4.9 2.9

ECV 6/Deep 69 21 86 8.0 5.2 2.8

ECV 6/Deep 277 15 91 7.9 4.8 2.9

ECV 7/Deep 249 21 89 7.5 4.8 2.7

ECV 11/Deep 23 20 92 7.0 5.1 1.9

ECV 11/Deep 281 25 91 6.9 4.7 2.2

ECV 11/Deep 263 22 90 7.0 4.8 2.2

ECV 11/Deep 268 23 92 7.6 5.3 2.3

ECV 11/Deep 265 21 88 7.9 5.2 2.7

ECV 11/Deep 263 15 84 7.8 4.7 3.1

ECV 12/Deep 266 18 89 7.5 4.6 2.9

ECV 13/Deep 258 18 91 7.7 4.9 2.8

ECV 13/Deep 144 15 90 7.6 4.7 2.9

ECV 13/Deep 289 18 89 7.6 4.5 3.1

ECV 14/Deep 21 22 93 7.8 4.9 2.9

ECV 18/Deep 294 20 89 8.0 5.2 2.8

ECV 19/Deep 174 21 86 7.9 4.8 2.9


*Positive control (WPV 3/JF 896210 )

ECV 19/Deep 163 18 52 7.8 7.6 0.2

ECV 19/Deep 245 17 89 7.7 4.5 3.2

ECV 19/Deep 229 28 89 7.6 4.7 2.9

ECV 20/Deep 276 22 88 7.6 4.5 3.1

ECV 20/Deep 17 21 90 6.8 4.5 2.3

ECV 24/Deep 260 19 92 6.8 4.7 2.1

ECV 24/Deep 261 17 91 6.9 4.6 2.3

ECV 24/Deep 36 15 89 7.1 4.8 2.3

ECV 25/Deep 171 18 86 8.0 5.2 2.8

ECV 29/Deep 141 23 89 7.9 4.8 2.9

ECV 30/Deep 142 21 91 7.5 4.8 2.7

ECV 33/Deep 47 10 92 8.0 4.9 3.1

EV 75/Deep 66 15 94 7.0 4.7 2.3

EV 75/Deep 10 18 91 7.9 4.7 3.2

EV 76/Deep 660 20 55 7.4 7.3 0.1

EV 83/Deep 283 20 89 7.7 4.9 2.8

CV A13/Deep 301 20 86 7.6 4.7 2.9

CV A24/Deep 321 25 88 7.0 4.9 2.1

CV A24/Deep 322 18 82 6.7 4.6 2.1

CV A24/Deep 324 22 91 8.0 5.2 2.8

CV A24/Deep 360 21 90 7.9 4.8 2.9

CV A24/Deep 371 28 92 7.5 4.8 2.7

CV A24/Deep 375 22 89 7.0 4.9 2.1

CV A24/Deep 325 21 91 7.5 4.6 2.9

CV A24/Deep 326 24 90 7.7 4.9 2.8

CV A24/Deep 369 27 93 7.6 4.7 2.9

CV A24/Deep 378 25 94 7.8 4.7 3.1

CV A24/Deep 365 23 91 7.4 4.7 2.7

CV A24/Deep 323 21 90 7.5 4.6 2.9

WPV 3/Deep 157 18 28 8.5 8.4 0.1

WPV 3/Deep 160 16 24 8.3 8.3 0.0

WPV 3/Deep 151 19 26 8.4 8.4 0.0

VPV 3/Deep 130 20 91 7.5 4.6 2.9

VPV 3/Deep 139 18 92 7.2 4.2 3.0

*Positive control 18 34 8.6 8.6 0.0

Negative control 98 95 0.0 0.0 0.0


5.6. In vivo study of pathogenecity of predominant EV serotype in BALB/c mice

During this study CV A24v was the predominant EV serotype. Because this

serotype was detected only from clinical cases during an epidemic of AHC in 2010 and

there was not any environmental strain for comparison. So we carried out the

pathological characterization of CV B3 in BALB/c mice because this serotype was the

second most predominant serotype isolated from clinical and environmental strain

throughout the study. Two strain of CV B3 (Deep 39 isolated from stool specimen of

AFP patient and Deep 184 isolated from sewage specimen) were infected in BALB/c

mice through oral route and intracerebral route respectively to study their tissue tropism

properties. Both strains of CV B3 regardless of their isolation source were able to infect

mice and there was not any pathological difference between them but the route of

infection through oral route and intracereberal route show some differences, like when

viral dose given through oral route it firstly affect heart after 5th

day of postinfcetion. The

presence of virus in brain was earlier by intracerebral route in comparison to oral route.

Small and large intestine were infected later by intracerebral route in comparison to oral

route by both strains. No mortality was observed for mice inoculated with both strain or

in negative controls mock infected with culture medium.

5.6.1. Histopathological changes in selected organs:

In the study, mild infiltration and fibrosis were reported in heart tissue during the

acute phase of infection, occurring after both oral and IC infection. These findings were

confirmed and it was found that virus dose did not influence the outcome significantly. In

contrast, the route of infection clearly had a differential effect on histopathology in the


organs. There is no infection was observed after the histopathology of spleen, Thymus

and brain in oral route but some mild infection was observed in brain after IC infection.

Heart: During the study, mild infection was seen in mice after both oral and IC

infection. Dense cardiac muscle and occasionally inflammatory cells were observed.

Pancreas: Normal pancreatic duct acini was found in control, and mild infection was

seen in IC and oral route like islet cells present occasionally inflammatory cells and

pancreatic duct were also observed.

Small intestine: The villi architecture was maintained and mild infection was observed

in the lamina of small intestine after the both oral and IC infection. Mild inflammation

and inflammatory cells increases after the infection by both route.

Large intestine: The villi architecture was maintained and mild infection was observed

in the lamina of large intestine after the both oral and IC infection of both routes.

Table 7: Tissue tropism properties of CV B3 in BalB/c mice

Specimen Clinical Strain Environmental Strain

Oral I.C Control

5 10 15 20 5 10 15 20 5 10 15 20

Oral I.C Control

5 10 15 20 5 10 15 20 5 10 15 20

Blood - + + + - + + + - - - - - + + + - + + + - - - -

Brain - - + - - + + - - - - - - - + - - + + - - - - -

Thymus - - + - - - + - - - - - - - + - - - + - - - - -

Pancreas + + + + + + + + - - - - + + + + + + + + - - - -

S.Intestine - + + - - - + + - - - - - + + - - - + + - - - -

L.Intestine - + + - - - + + - - - - - + + - - - + + - - - -

Spleen - + - - - + - - - - - - - + - - - + - - - - - -

Heart + - - - - + - - - - - - + - - - - + - - - - - -

Each + and – symbol represents the virus titre in the tissues of a single mice, + indicates

that virus was detected in the tissue; - indicates that virus was not detected.


4.a

3.a 3.b 3.c

4.b 4.c

2.a 2.b 2.c

1.a 1.b 1.c


Figure 25: Histopathology of organs after infection of CV B3 in BalB/c mice.

1.a Heart(control), 1. b Heart(At 5th

day, oral route), 1.c Heart(At 5th

day, IC route)

2.a Pancreas(Control), 2.b Pancreas(At 20th

day, oral route), 2.c Pancreas(At 20th

day, IC route)

3.a Spleen(Control), 3.b Spleen(At 10th

day, oral route, 3.c Spleen(At 10th

day, IC route)

4.a Thymus(Control), 4.b Spleen(At 15th

day, oral route), 4.c Spleen(At 15th

day(IC route)

5.a L. Intestine(Control), 5.b L. Intestine(At 15th

day, oral route), 5.c L. Intestine(At 15th

day,

IC route)

6.a S. Intestine(Control), 6.b S. Intestine(At 15th

day, oral route) 6.c S. Intestine(At 15th

day, IC

route

7.a Brain(control), 7.b Brain(At 15th

day, oral route), 7.c Brain(At 15th

day, IC route)

`

7.a

6.b 6.c6.a

7.b 7.c

5.a 5.b 5.c

DiscussionDiscussionDiscussionDiscussion

6. Discussion

HEVs are ubiquitous pathogen causing asymptomatic infection to a variety of

acute and chronic diseases including mild upper respiratory illness, febrile rash, aseptic

meningitis, encephalitis, AHC, pleurodynia, AFP, diabetes, myocarditis and neonatal

sepsis-like disease (Pallansch 2001). However, identification of EV serotype does not

have a significant impact on the clinical management of infected individuals.

Nevertheless, it can contribute significantly to the identification of various epidemics and

to the subsequent effective surveillance of populations by determining the source of

infection, the correlation between EV serotype or strain and clinical symptoms, the

characteristics of particularly virulent viruses, the possible means of transmission, and the

emergence of new strains or the re-emergence of older strains.

In the present study, a total of 280 samples (256 clinical and 24 environmental

specimens) were collected between January 2009 and December 2010. Out of these 256

clinical specimens, 90 (35.1%) were positive for EV by molecular method in direct

clinical specimen; while 53 (20.7%) by virus isolation method. According to a previous

report stool has been found as the most suitable clinical specimen for EV detection due to

presence of virus for one month from the date of infection (Kupila et al. 2005). However

during the study, conjunctival swab (48.4%) was the main clinical specimen for EV

detection followed by stool specimen (35.5%). The higher detection rate of EV in

conjunctival swab specimen may be due to an epidemic of AHC associated with CV

A24v in this studied area (Shukla et al. 2013). Stool (28.8%) was the most suitable

clinical specimen for EV isolation followed by throat swab (21.6%), conjunctival swab


(18.2%), serum (6.6%) and CSF (4%) specimens. The low isolation rate of EV in CSF

specimens may be due to presence of virus in low titers (Jacques et al. 2003). All clinical

specimens who were positive by virus isolation for EV were also positive by molecular

method in the direct clinical specimen. The finding supports the usefulness of molecular

method in direct clinical specimen over conventional virus isolation method (Leitch et al.

2009).

Environmental surveillance of sewage is the method of choice in limited

resources to assess the extent or duration of EV circulation in specific populations

(Strikas et al. 1986, Khetsuriani et al. 2010). In the current study, conventional molecular

method was compared with modified shell vial culture. The current algorithm provides

results within 3 days and identification of six additional serotypes which remained

negative by conventional method. The finding supported the usefulness of this novel

ISVC- RT PCR approach for sensitive and rapid detection of non-cytopathogenic EV

serotypes. However, the detection rate of EVs is much higher in comparison to other

countries like Iran (57%), South Africa (59%), and USA (59-75%) (Chapron et al. 2000,

Ehlers et al. 2005, Kargar et al. 2009, Symonds et al. 2009) which may be due to the

following reasons: firstly, poor sanitary condition in the studied area can lead to an increased

level of excreted virus in the environment (Grassly et al. 2006). Secondly, adoption of new

shell vial culture (SVC) spin amplified absorption method for enhanced recovery of virus

(Oefinger et al. 1988, Van Doornum et al. 1998, Terletskaia-Ladwig et al. 2008, Dias et

al. 2009).

RD cell line was more susceptible in both shell vial and conventional tube culture

for EV detection in comparison to HEp2 and L20B cell line and the results were in


concordance with an earlier study done by She et al., 2006. Although, RD cell line is

more sensitive for poliovirus detection over L20B cell line, addition of L20B cell line in

the present study leads to the identification of additional poliovirus which may be missed

due to their presence in mixture (Table3).

In the current study we identified 32 different EV serotypes (CV A4, CV A8, CV

A10, CV A13, CV A21, CV A24, CV B1, CV B3, CV B5, CV B6, ECV 2, ECV 3, ECV

6, ECV 7, ECV 11, ECV 12, ECV 13, ECV 14, ECV 18, ECV 19, ECV 20, ECV 24,

ECV 25, ECV 29, ECV 30, ECV 33, EV 74, EV 75, EV 76, EV 80, EV 83 and PV 3).

High frequency of HEV serotype detection in this study may be due to high infection

pressure in these highly populated areas of India and adoption of molecular methods

directly to clinical specimen over conventional virus isolation method (Rahimi et al.

2009).

According to a previous study a seasonal pattern of EV infection was observed in

subtropical regions (Moore 1982). In our study most of the EV positive cases were

occurred during the rainy seasons both years which may be due to high population

density or poor hygienic condition that may leads to enlarged transmission of virus

among the population (Kogon et al. 1969, Lagercrantz et al. 1973).

In our study EV infections was detected more frequently in males (60%) than in

females (40%). The higher detection rate of EV infection in males may be due to

playgroup activity outside the home.

HEV B was the predominant species (57.5%) followed by HEV A (6.19%) and

HEV C (36.3%) in this study. Previous studies have reported that HEV B species are a

significant cause of infection in children (Trallero et al. 2000, Pallansch et al. 2006, Lee


et al. 2007). The high frequency of HEV B species in this region may be responsible for

high rate (62.74%) of clinical manifestations related to central nervous system (CNS)

(Mistchenko et al. 2006, Mirand et al. 2008).

Although, the present study detected a high frequency of EV serotypes, CV A24,

CV B3, CV B5, ECV 19, EV 75, PV 3 and CV A13 were of particular interests. During

the past 20 years, CV A24v has been reported mostly in the outbreaks of AHC

throughout the world. Loss of herd immunity to CV A24v has been suggested widespread

transmission because the immunity declines considerably within seven years after

infection (Goh et al. 2009). CV A24v is a common cause of AHC in India and has been

reported in several outbreaks of AHC (Huang et al. 2007). A major outbreak of AHC

occurred again in India between August and October 2010. To identify the causative

agents of this outbreak, molecular method was performed for adenovirus and EV

detection in conjunctival swab specimens collected from AHC patient. CV A24v was

identified in 32 (48.4%) samples by partial sequencing of a VP1 gene, while all

specimens were negative for adenovirus. These results conclude that CV A24v was the

etiologic agent occurred in this outbreak. To study the epidemiological link among Indian

CV A24v strains from this outbreak and previous outbreak in 2007 (unpublished data)

with worldwide isolates, we performed the phylogenetic analysis of a partial VP1 and 3C

protease gene. All Indian isolates from 2010 outbreak was clustered with CV A24v

strains associated with AHC outbreaks in China during 2010 (97-98% identity) (De et al.

2012), Brazil in 2009 (97% identity) (Taveras et al. 2011), Cuba between 2008 and 2009

(96-97% identity) (Fonseca et al. 2012) and recent outbreak in France in 2012 (97-99%

identity) (Abury et al. 2012). These finding suggest that CV A24v isolates from the 2010


outbreak in India were genetically similar to isolates from Brazil, China and France.

Because, Chinese strain isolated from the AHC outbreak in 2010 was clustering in the

same cluster with Indian isolates, phylogenetic analysis of Chinese strain was also

performed to study possible epidemiological link. Interestingly all the Chinese CVA24v

strains showed good identity with isolates from Brazil in 2009 outbreak (96-97%

identity) and Cuba between 2008 and 2009 outbreak (96-97% identity)(Fonseca et al.

2012) similar to Indian strain. These results suggest that a new lineage of CV A24v

appeared in Cuba and Brazil may be imported in Asia and is responsible for large

outbreak of AHC in 2010. Transmission of Indian CV A24v strain into European region

may be associated with the recent AHC outbreak in Marseille, France in 2012.

According to EV surveillance data from USA, CV B3 has an epidemic pattern of

circulation with consistent appearance among the 15 most commonly reported serotype

(Kumar et al. 2013). CV B3 has been commonly associated with myopericarditis, aseptic

meningitis, neonatal systemic illness, and meningoencephalitis in immunodeficient

persons, herpangina, and rash illnesses (Pallansch et al. 2010). During the study, CV B3

was the second predominant serotype isolated from clinical and environmental specimen

with clinical manifestation of CNS infection. Phylogenetic analysis of CV B3 revealed

that two genotype were circulating with no difference among their isolation source. The

closest match of CV B3 stains were from Bangladesh and Nigeria.

During this study CV B5 serotype was one of our particular interests because

recently we have reported an epidemic of encephalitis associated with CV B5 and ECV

19 from this study area (Kumar et al. 2011). There are previous reports that CV B5

involved in sporadic cases of neurological diseases with an epidemic pattern of incidence


(Pallansch et al. 1997, Pallansch et al. 1987). Phylogenetic analysis of CV B5 sequences

from this study showed that two genotypes were circulating during this study. CV B5

strain detected in 2009 were forming one genotypes which was clustering with isolates

from India associated with encephalitis in this region and from Georgia isolated during

2005 in sewage. Second genotype was originating from 2010 strains (Fig 1 b) and the

finding is comparable with earlier report of cyclic occurrence of a specific genotype of

CV B5 infections in the community (Kopecka et al. 1995). Most of the sequences from

this study were showing good similarity with strain from American (mainly Georgia

isolated during 2002-2005) and European countries in comparison to neighbouring Asian

country. It might be possible that these serotypes were circulating in different

geographical areas (Khetsuriani et al. 2010, Lukashev et al. 2005) but may have been

missed due to gap in surveillance from different part of the world.

According to most surveillance systems, ECV 19 has been a reported rarely EV

serotype after 1975 (Maguire et al. 1999, Saraswathy et al. 2004, Khetsuriani et al. 2006,

Antona et al. 2007) except in Georgia during 2002-2005 (Khetsuriani et al. 2010).

Recently, an epidemic of encephalitis associated with ECV 19 was reported from this

region (Kumar et al. 2011). It is likely that several genotypes of ECV 19 were circulating

in the different parts of the world (Lukashev 2005) or ECV 19 serotype circulating in this

region might be imported from Georgian country and evolved into a new genetic lineage

with increased virulence that is responsible for encephalitis epidemic. Genetic

characterization of EV from different parts of the world should be encouraged to study

their transmission in different geographical regions.


EV75 was proposed as a new serotype of the EV genus in 2004 as a result of

molecular typing methods (Oberste et al. 2004). Retrospective analysis showed that it had

circulated sporadically in Asia, the United States, and Africa since at least 1974 with

clinical manifestations of respiratory disease, acute flaccid paralysis, neonatal jaundice,

failure to thrive, or unspecified neurologic disease. In our study, we were unable to

isolate this strain from stool specimen, although throat swabs specimens were positive.

This finding is similar to a recent report of EV 75 isolation from throat specimen from

encephalitis patient (Lewthwaite et al. 2010). Phylogenetic analysis of EV 75 shows that

three genotype were circulating clustering with isolate from southern India and the

neighboring Asian country China.

According to AFP surveillance data from the Lucknow district, wild PV was not

detected in clinical cases after 2002. The VP1 sequence of the wild PV3 from this study

showed 97% identity with isolates from Nepal (GenBank accession no- HQ286299)

identified in 2008 (Fig. 20) which may be due to importation of the virus by migrants

from Nepal (CDC 2011). However, detection of the vaccine strain of PV in this study

might be due to live oral PV vaccination in the area studied. These findings suggest that

sensitive surveillance of sewage is necessary, especially during the last stage of wild PV

eradication program to prevent any poliomyelitis outbreaks in future.

The natural course of HEV transmission is by fecal-oral route, multiplies in the

gastrointestinal tract, and is finally excreted in large numbers into the environment

through feces. In the absence of proper surveillance system, environmental surveillance

of sewage is a suitable method for the detection of HEV serotypes circulating in the

community because infected human shed virus into environment through feces; this


provides an alternative approach that would complement the clinical data (Khetsuriani et

al. 2010). In this study, EV isolates from clinical specimens and environmental

specimens were investigated for their phenotypic characteristics such as thermosensitivity

at two different temperatures (37°C and 40°C) and CPE in epithelium (RD/HEp-2) and

neuronal (SHSY5Y) cell line. All wild PV 3 strains were able to replicate in neuronal cell

line and were temperature resistant similar to earlier reports (Savolainen et al. 2009).

However, CV B5/Deep 280, ECV 19/Deep 163, EV 76/660 was also able to infect

neuronal cell line but all these isolate were temperature sensitive. Interestingly ECV

11/Deep 23 isolate was partially temperature resistant (∆ log Rct 40 value=1.9), but was

unable to replicate in neuronal cell line. These findings suggest that isolation source does

not affect the phenotypic characteristics of EV isolates. It may be possible that presence

of virus receptor in cell line and genetic makeup of the EV strain affect their phenotypic

characteristics.

Although HEV are present everywhere, but some serotypes may be endemic at a


periodically or responsible for a particular disease (Zhu et al. 2013). In this study CV

A24v was the predominant serotype detected during an epidemic of AHC in 2010.

Phylogenetic analysis of CV A24v suggests a new lineage of CV A24v appeared in Cuba

and Brazil may be imported in Asia and is responsible for large outbreak of AHC in

2010. So we have studied the tissue tropism properties of CV B3 in BALB/c mice

because this serotype was the second most predominant serotype isolated from clinical

and environmental strain throughout the study. Both strains of CV B3 regardless of their

isolation source were able to infect mice and there was not any pathological difference


between them but the route of infection through oral route and intracereberal route

showed some differences, like when viral dose given through oral route it firstly affects

the heart. Both strains exhibited almost the same tropism properties.

In conclusions, a total of 32 different HEV serotypes were identified. To our

knowledge this is the first report of EV 74 and 80 associated with encephalitis

worldwide. A molecular method of HEV typing and phylogenetic analysis of partial VP1

gene allows timely detection of the emerging or re-emerging HEV strains and their

transmission in different geographical areas. Environmental surveillance of sewage is a

suitable method in limited resources countries.

SummarySummarySummarySummary

7. Summary

Human enteroviruses (HEVs) are non-enveloped, RNA viruses that belong to the genus

Enterovirus in the family Picornaviridae. HEVs were originally classified on the basis of

antigenic and pathogenic properties in humans and mice. Using molecular properties,

HEVs have been classified into four species, human enterovirus A (HEVA), HEV B,

HEV C, HEV D.

At any particular area, a range of different EV serotype circulates in human

population; some serotype cause disease frequently while other remain silent for long

time, and suddenly emerged into a new variant causing outbreaks at regular intervals.

Due to its RNA genome, EVs are prone to high mutation rates and recombination, which

can give rise to a new viral genotype exhibiting modified pathogenic properties.

Continuous monitoring of EV serotypes is necessary to study their circulation and clinical

manifestations.

Environmental surveillance of sewage is a suitable method for the detection of

HEV serotypes circulating in the community because infected humans shed virus into

environment through feces; this provides an alternative approach that would complement

the clinical data.

The pathogenicity of HEVs is a complex phenomenon, evidently due to variation

in the genetic and immunological background of host, and is difficult to investigate in

humans. In vivo study related to pathogenesis of predominant serotype of isolated EVs in

an animal model will be helpful in understanding the tissue tropism properties, virulence

properties for the development of the vaccine.


In the present study, a total of 280 samples (256 clinical and 24 environmental

specimens) were collected between January 2009 and December 2010. Out of these 256

clinical specimens, 90 (35.1%) were positive for EV by molecular method in direct

clinical specimen; while 53 (20.7%) by virus isolation method. According to a previous

report stool has been found as the most suitable clinical specimen for EV detection due to

presence of virus for one month from the date of infection. However during the study,

conjunctival swab (48.4%) was the main clinical specimen for EV detection followed by

stool specimen (35.5%). The higher detection rate of EV in conjunctival swab specimen

may be due to an epidemic of AHC associated with CV A24v in this studied area. Stool

(28.8%) was the most suitable clinical specimen for EV isolation followed by throat swab

(21.6%), conjunctival swab (18.2%), serum (6.6%) and CSF (4%) specimens. The low

isolation rate of EV in CSF specimens may be due to presence of virus in low titers. All

clinical specimens who were positive by virus isolation for EV were also positive by

molecular method in the direct clinical specimen. The finding supports the usefulness of

molecular method in direct clinical specimen over conventional virus isolation method.

Environmental surveillance of sewage is the method of choice in limited

resources to assess the extent or duration of EV circulation in specific populations. In the

current study, conventional molecular method was compared with modified shell vial

culture. The current algorithm provides results within 3 days and identification of six

additional serotypes which remained negative by conventional method. The finding

supported the usefulness of this novel ISVC- RT PCR approach for sensitive and rapid

detection of non-cytopathogenic EV serotypes. However, the detection rate of EVs is

much higher in comparison to other countries like Iran (57%), South Africa (59%), and


USA (59-75%) which may be due to the following reasons: firstly, poor sanitary condition

in the studied area can lead to an increased level of excreted virus in the environment. Secondly,

adoption of new shell vial culture (SVC) spin amplified absorption method for enhanced

recovery of virus.

RD cell line was more susceptible in both shell vial and conventional tube culture

for EV detection in comparison to HEp2 and L20B cell line and the results were in

concordance with an earlier study done by She et al., 2006. Although, RD cell line is

more sensitive for poliovirus detection over L20B cell line, addition of L20B cell line in

the present study leads to the identification of additional poliovirus which may be missed

due to their presence in mixture (Ref. Table4).

In the current study we identified 32 different EV serotypes (CV A4, CV A8, CV

A10, CV A13, CV A21, CV A24, CV B1, CV B3, CV B5, CV B6, ECV 2, ECV 3, ECV

6, ECV 7, ECV 11, ECV 12, ECV 13, ECV 14, ECV 18, ECV 19, ECV 20, ECV 24,

ECV 25, ECV 29, ECV 30, ECV 33, EV 74, EV 75, EV 76, EV 80, EV 83 and PV 3).

High frequency of HEV serotype detection in this study may be due to high infection

pressure in these highly populated areas of India and adoption of molecular methods

directly to clinical specimen over conventional virus isolation method.

According to a previous study a seasonal pattern of EV infection was observed in

subtropical regions. In our study most of the EV positive cases were occurred during the

rainy seasons both years which may be due to high population density or poor hygienic

condition that may leads to enlarged transmission of virus among the population.


In our study EV infections was detected more frequently in males (60%) than in

females (40%). The higher detection rate of EV infection in males may be due to

playgroup activity outside the home.

HEV B was the predominant species (57.5%) followed by HEV A (6.19%) and

HEV C (36.3%) in this study. Previous studies have reported that HEV B species are a

significant cause of infection in children. The high frequency of HEV B species in this

region may be responsible for high rate (62.74%) of clinical manifestations related to

central nervous system (CNS).

Although, the present study detected a high frequency of EV serotypes, CV A24,

CV B3, CV B5, ECV 19, EV 75, PV 3 and CV A13 were of particular interests. During

the past 20 years, CV A24v has been reported mostly in the outbreaks of AHC

throughout the world. Loss of herd immunity to CV A24v has been suggested widespread

transmission because the immunity declines considerably within seven years after

infection. A major outbreak of AHC occurred in India between August and October

2010. To identify the causative agents of this outbreak, molecular method was performed

for adenovirus and EV detection in conjunctival swab specimens collected from AHC

patient. CV A24v was identified in 32 (48.4%) samples by partial sequencing of a VP1

gene, while all specimens were negative for adenovirus. These results conclude that CV

A24v was the etiologic agent occurred in this outbreak. To study the epidemiological link

among Indian CV A24v strains from this outbreak and previous outbreak in 2007

(unpublished data) with worldwide isolates, we performed the phylogenetic analysis of a

partial VP1 and 3C protease gene. All Indian isolates from 2010 outbreak was clustered

with CV A24v strains associated with AHC outbreaks in China during 2010 (97-98%


identity), Brazil in 2009 (97% identity), Cuba between 2008 and 2009 (96-97% identity)

and recent outbreak in France in 2012 (97-99% identity). These finding suggest that CV

A24v isolates from the 2010 outbreak in India were genetically similar to isolates from

Brazil, China and France. Because, Chinese strain isolated from the AHC outbreak in

2010 was clustering in the same cluster with Indian isolates, phylogenetic analysis of

Chinese strain was also performed to study possible epidemiological link. Interestingly

all the Chinese CVA24v strains showed good identity with isolates from Brazil in 2009

outbreak (96-97% identity) and Cuba between 2008 and 2009 outbreak (96-97% identity)

similar to Indian strain. These results suggest that a new lineage of CV A24v appeared in

Cuba and Brazil may be imported in Asia and is responsible for large outbreak of AHC in

2010. Transmission of Indian CV A24v strain into European region may be associated

with the recent AHC outbreak in Marseille, France in 2012.

During the study, CV B3 was the second predominant serotype isolated from clinical and

environmental specimen with clinical manifestation of CNS infection. Phylogenetic

analysis of CV B3 revealed that two genotype were circulating with no difference among

their isolation source. The closest match of CV B3 stains were from Bangladesh and

Nigeria.

During this study CV B5 serotype was one of our particular interests because

recently we have reported an epidemic of encephalitis associated with CV B5 and ECV

19 from this study area. There are previous reports that CV B5 involved in sporadic cases

of neurological diseases with an epidemic pattern of incidence. Phylogenetic analysis of

CV B5 sequences from this study showed that two genotypes were circulating during this

study. CV B5 strain detected in 2009 were forming one genotypes which was clustering


with isolates from India associated with encephalitis in this region and from Georgia

isolated during 2005 in sewage. Second genotype was originating from 2010 strains (Fig

1 b) and the finding is comparable with earlier report of cyclic occurrence of a specific

genotype of CV B5 infections in the community. Most of the sequences from this study

were showing good similarity with strain from American (mainly Georgia isolated during

2002-2005) and European countries in comparison to neighbouring Asian country. It

might be possible that these serotypes were circulating in different geographical areas but

may have been missed due to gap in surveillance from different part of the world.

According to most surveillance systems, ECV 19 has been a reported rarely EV

serotype after 1975 except in Georgia during 2002-2005. Recently, an epidemic of

encephalitis associated with ECV 19 was reported from this region. It is likely that

several genotypes of ECV 19 were circulating in the different parts of the world or ECV

19 serotype circulating in this region might be imported from Georgian country and

evolved into a new genetic lineage with increased virulence that is responsible for

encephalitis epidemic. Genetic characterization of EV from different parts of the world

should be encouraged to study their transmission in different geographical regions.

EV75 was proposed as a new serotype of the EV genus in 2004 as a result of

molecular typing methods. Retrospective analysis showed that it had circulated

sporadically in Asia, the United States, and Africa since at least 1974 with clinical

manifestations of respiratory disease, acute flaccid paralysis, neonatal jaundice, failure to

thrive, or unspecified neurologic disease. In our study, we were unable to isolate this

strain from stool specimen, although throat swabs specimens were positive. This finding

is similar to a recent report of EV 75 isolation from throat specimen from encephalitis


patient. Phylogenetic analysis of EV 75 shows that three genotype were circulating

clustering with isolate from southern India and the neighboring Asian country China.

According to AFP surveillance data from the Lucknow district, wild PV was not

detected in clinical cases after 2002. The VP1 sequence of the wild PV3 from this study

showed 97% identity with isolates from Nepal (GenBank accession no- HQ286299)

identified in 2008 (Fig. 20) which may be due to importation of the virus by migrants

from Nepal (CDC 2011). However, detection of the vaccine strain of PV in this study

might be due to live oral PV vaccination in the area studied. These findings suggest that

sensitive surveillance of sewage is necessary, especially during the last stage of wild PV

eradication program to prevent any poliomyelitis outbreaks in future.

The natural course of HEV transmission is by fecal-oral route, multiplies in the

gastrointestinal tract, and is finally excreted in large numbers into the environment

through feces. In the absence of proper surveillance system, environmental surveillance

of sewage is a suitable method for the detection of HEV serotypes circulating in the

community because infected human shed virus into environment through feces; this

provides an alternative approach that would complement the clinical data. In this study,

EV isolates from clinical specimens and environmental specimens were investigated for

their phenotypic characteristics such as thermosensitivity at two different temperatures

(37°C and 40°C) and CPE in epithelium (RD/HEp-2) and neuronal (SHSY5Y) cell line.

All wild PV 3 strains were able to replicate in neuronal cell line and were temperature

resistant similar to earlier reports. However, CV B5/Deep 280, ECV 19/Deep 163, EV

76/660 was also able to infect neuronal cell line but all these isolate were temperature

sensitive. Interestingly ECV 11/Deep 23 isolate was partially temperature resistant (∆ log


Rct 40 value=1.9), but was unable to replicate in neuronal cell line. These findings

suggest that isolation source does not affect the phenotypic characteristics of EV isolates.

It may be possible that presence of virus receptor in cell line and genetic makeup of the

EV strain affect their phenotypic characteristics.

Although HEV are present everywhere, but some serotypes may be endemic at a


periodically or responsible for a particular disease. In this study CV A24v was the

predominant serotype detected during an epidemic of AHC in 2010. Phylogenetic

analysis of CV A24v suggests a new lineage of CV A24v appeared in Cuba and Brazil

may be imported in Asia and is responsible for large outbreak of AHC in 2010. So we

have studied the tissue tropism properties of CV B3 in BALB/c mice because this

serotype was the second most predominant serotype isolated from clinical and

environmental strain throughout the study. Both strains of CV B3 regardless of their

isolation source were able to infect mice and there was not any pathological difference

between them but the route of infection through oral route and intracereberal route

showed some differences, like when viral dose given through oral route it firstly affects

the heart. Both strains exhibited almost the same tropism properties.

ReferencesReferencesReferencesReferences

8. References

Abzug, M. J., M. J. Levin, and H. A. Rotbart. 1968. Profile of enterovirus disease in the first

two weeks of life. Pediatr. Infect. Dis. J. 12:1201-1206.

Abzug, M. M., and H. A. Rotbart. 1999. Enterovirus infections of neonates and infants. Semin.

Pediatr. Infect. Dis. 10:169-176.

Agol, V.I., A. Paul, and E. Wimmer. 1999. Paradoxes of the replication of picornaviral

genomes. Virus Res. 62: 129-47.

A-L. Bru. 2002. Enteroviruses: Polioviruses, Coxsackieviruses, Echoviruses, and Newer

Enteroviruses, p. 45-59. In Haaheim, L.R, Pattison, J.R. and R.J. Whitley. A practical

guide to clinical – virology. 2nd

ed. John Wiley and Sons, Ltd

Antona D, Lvque N, Chomel JJ, Dubrou S, Lvy-Bruhl D and Lina B. Surveillance of

enteroviruses in France, 2000–2004. Eur J Clin Microbiol Infect Dis. 2007; 26: 403–412.

Aubry C, Gautret P, Nougairede A, Dussouil AS, Botelho-Nevers E, Zandotti C, et al.

2012 outbreak of acute haemorrhagic conjunctivitis in Indian Ocean Islands:

identification of Coxsackievirus A24 in a returned traveller. Euro Surveill. 2012;

17(22): pii=20185Abzug MJ, Keyserling HL, Lee ML, Levin MJ, Rotbart HA. 1995.

Neonatal enterovirus infection: virology, serology, and effects of intravenous immune

globulin. Clin Infect Dis.20(5):1201-6

Auld. P. A., Kevy S. V., Eley R. C. 1960. Poliomyelitis in children. Experience with 956 cases

in the 1955 Massachusetts epidemic. N Engl J Med. 1;263:1093-100.

Badorff C, Lee GH, Lamphear BJ, Martone ME, Campbell KP, Rhoads RE, Knowlton KU.

1999. Enteroviral protease 2A cleaves dystrophin: evidence of cytoskeletal disruption in

an acquired cardiomyopathy. Nat Med. 5(3):320-6

Bergelson JM, Chan M, Solomon KR, St John NF, Lin H, Finberg RW. 1994. Decay-

accelerating factor (CD55), a glycosylphosphatidylinositol-anchored complement

regulatory protein, is a receptor for several echoviruses. Proc Natl Acad Sci U S A.

21;91(13):6245-8.

Bergelson JM, Cunningham JA, Droguett G, Kurt-Jones EA, Krithivas A, Hong JS, Horwitz

MS, Crowell RL, Finberg RW.1997 Isolation of a common receptor for Coxsackie B

viruses and adenoviruses 2 and 5. Science. 28;275(5304):1320-3.


Bergelson, j. M., M. P. Shepley, B. M. Chan, M. E. Hemler, and R. W. Finberg. 1992.

Identification of the integrin VLA-2 as a receptor for echovirus 1. Science 255: 1718-

1720.

Bergman I, Painter MJ, Wald ER, Chiponis D, Holland AL, Taylor HG. 1987. Outcome in

children with enteroviral meningitis during the first year of life. J Pediatr. 110(5):705-9.

Berlin LE, Rorabaugh ML, Heldrich F, Roberts K, Doran T, Modlin JF. 1993. Aseptic

meningitis in infants < 2 years of age: diagnosis and etiology. J Infect Dis. 168(4):888-92.

Bingjun T, Yoshida H, Yan W, Lin L, Tsuji T, Shimizu H, Miyamura T (2008) Molecular

typing and epidemiology of non-polio enteroviruses isolated from Yunnan Province, the

People's Republic of China. J Med Virol 80:670-679.

Bodian, D. 1955. Emerging concept of poliomyelitis infection. Science 122:105-108.

Bopegamage, S., M. Borsanyiova, A. Vargova, A. Petrovicova, M. Benkovicova, and P.

Gomolcak. 2003. Coxsackievirus infection of mice. I. Viral kinetics and histopathological

changes in mice experimentally infected with coxsackieviruses B3 and B4 by oral route.

Acta Virol 47:245–251.

Bouslama, L., D. Nasri, L. Chollet, K. Belguith, T. Bourlet, M. Aouni, B. Pozzetto, and S.

Pillet. 2007. Natural recombination event within the capsid genomic region leading to a

chimeric strain of human enterovirus B. J. Virol.81: 8944–8952.

Caggana M, Chan P, Ramsingh A. 1993. Identification of a single amino acid residue in the

capsid protein VP1 of coxsackievirus B4 that determines the virulent phenotype. J.

Virol. 67:4797-803.

Chapron CD, Ballester NA, Fontaine JH, Frades CN, Margolin AB. 2000. Detection of

astroviruses, enteroviruses, and adenovirus types 40 and 41 in surface waters collected

and evaluated by the information collection rule and an integrated cell culture-nested PCR

procedure. Appl Environ Microbiol 66:2520-2525.

Chemtob S, Reece ER, Mills EL. 1985. Syndrome of inappropriate secretion of antidiuretic

hormone in enteroviral meningitis. Am J Dis Child. 139(3):292-4.

Chen, G.W., J.H. Huang, Y.L. Lo, K.C. Tsao, and S.C. Chang. 2007. Mosaic genome structure

of echovirus type 30 that circulated in Taiwan in 2001. Arch. Virol. 152:1807–1817.

Cherry, J. D. 1992. Polioviruses (poliomyelitis), coxsackieviruses, echoviruses, and

enteroviruses, p. 1705-1753. In R. D. Feigin and J. D. Cherry (ed.), Textbook of pediatric

Infectious Diseases, 3rd ed. The W. B. Saunders Co., Philadelphia, Pa.

Cherry JD, Jahn CL. 1965. Herpangina: the etiologic spectrum. Pediatrics. 36(4):632-4.


Chowdhry R., A. Shukla, T. Datta, and T.N. Dhole. 2005. Rapid detection of sewage sample

polioviruses by integrated cell culture polymerase chain reaction. Arch Environ Occup

Health. 60: 223-8.

Clements GB, Galbraith DN, Taylor KW. 1995. Coxsackie B virus infection and onset of

childhood diabetes. Lancet. 22;346(8969):221-3.

Dagan R, Jenista JA, Menegus MA. 1988. Association of clinical presentation, laboratory

findings, and virus serotypes with the presence of meningitis in hospitalized infants with

enterovirus infection. J Pediatr. 113(6):975-8.

Dagan, R., and M. A. Menegus. 1992. Replication of enteroviruses in human mononuclear cells.

Isr. J. Med. Sci. 28:369-372.

Dagan, R., and M. A. Menegus. 1995. Nonpolio enteroviruses and the febrile infant, p. 239-254.

In H. A. Rotbart (ed.), Human Enterovirus Infections. ASM Press, Washington, D.C.

Dalakas, M. C. 1995. Enteroviruses and human neuromuscular diseases. P. 387-398. In H. A.

Rotbart (ed.), Human Enterovirus Infections. ASM Press, Washington, D.C.

Dalakas, M. C., H. Bartfield, and T. Kurland (ed.). 1995. The post-polio syndrome: advances in

the pathogenesis and treatment, vol. 753. Proceedings of the New York Academy of

Sciences. New York Academy of Sciences. New York, N.Y.

Dalakas MC, Sever JL, Madden DL, Papadopoulos NM, Shekarchi IC, Albrecht P, Krezlewicz

A. 1984. Late postpoliomyelitis muscular atrophy: clinical, virologic, and immunologic

studies. Rev Infect Dis. 6 Suppl 2:S562-7.

De W, Huanying Z, Hui L, Corina M, Xue G, Leng L, Hanri Z, Ling F, Yanling M, Huiqiong

Z, Huan Z, Jing K, Caiyun L, Yoshida H, Changwen K (2012) Phylogenetic and

molecular characterization of coxsackievirus A24 variant isolates from a 2010 acute

hemorrhagic conjunctivitis outbreak in Guangdong, China. Virol J 9:41.

Ehlers MM, Grabow WOK, Pavlov DN. 2005. Detection of enteroviruses in untreated and

treated drinking water supplies in South Africa. Water Research 39:2253–2258.

Eglin RP, Swann RA, Isaacs D, Moxon ER. 1984. Simultaneous bacterial and viral meningitis.

Lancet. 27;2(8409):984.

Etter CG, Wedgwood J, Schaad UB. 1991. Aseptic meningitis in pediatrics. Schweiz Med

Wochenschr. 6;121(31-32):1120-6.

Farmer K, MacArthur BA, Clay MM. 1975. A follow-up study of 15 cases of neonatal

meningoencephalitis due to Coxsackie virus B5. J Pediatr. 87(4):568-71.


Faulkner, R. S., Macleod, A. J., Van Rooyen, C. E., 1957. Virus meningitis-seven cases in one

family. Can Med Assoc J. 1;77(5):439-44.

Felsenstein, J. 1993. PHYLIP: Phylogeny inference package, version 3.5 c. Distributed by

Department of Genetics, University of Washington. Seattle, USA.

Fonseca MC, Sarmiento L, Resik S, Pereda N, Rodríguez H, Kourí V, Martínez PA, Piñón

A, Limonta D, Más P, Hung LH (2012) Isolation of Coxsackievirus A24 variant from

patients with hemorrhagic conjunctivitis in Cuba, 2008-2009. J Clin Virol 53:77-81.

Fox MP, McKinlay MA, Diana GD, Dutko FJ. 1991. Binding affinities of structurally related

human rhinovirus capsid-binding compounds are related to their activities against human

rhinovirus type 14. Antimicrob Agents Chemother. 35(6):1040-7.

Gatmaitan BG, Chason JL, Lerner AM. 1970. Augmentation of the virulence of murine

coxsackie-virus B-3 myocardiopathy by exercise. J Exp Med. 1;131(6):1121-36.

Gharbi, J., R. el Hiar, M. Ben M'hadheb, H. Jaïdane, L. Bouslama, S. N'saïbia, and M. Aouni.

2006. Nucleotide sequences of IRES domains IV and V of natural ECHO virus type 11

isolates with different replicative capacity phenotypes. Virus Genes. 2006. 32:269-76.

Goh KT, Ooi PL, Miyamura K, Ogino T, Yamazaki S (1990) Acute

haemorrhagic conjunctivitis: seroepidemiology of coxsackievirus A24 variant and

enterovirus 70 in Singapore. J Med Virol 31:245-7.

Gravanis MB, Sternby NH. 1991. Incidence of myocarditis. A 10-year autopsy study from

Malmö, Sweden. Arch Pathol Lab Med. 115(4):390-2.

Grist NR, Bell EJ. 1984. Paralytic poliomyelitis and nonpolio enteroviruses: studies in Scotland.

Rev Infect Dis. 6 Suppl 2:S385-6.

Grist, N. R., E. J. Bell, and F. Assaad. 1978. Enteroviruses in human disease. Prog. Med. Virol.

24:114-157.

Guttman N, Baltimore D. 1977 A plasma membrane component able to bind and alter virions of

poliovirus type 1: studies on cell-free alteration using a simplified assay. Virology.

1:82(1):25-36.

Haller, A. A., and B. L. Semier. 1995. Translation and host cell shutoff, p. 113-133. In H. A.


Hamby BB, Pallansch MA, Kew OM (1987) Reemergence of an epidemic coxsackievirus B5

genotype. J Infect Dis 156: 288–292.

Hellen, C. U. T., and E. Wimmer. 1995. Enterovirus genetics, p. 25-72. In H. A. Rotbart (ed.),

Human Enterovirus Infections. ASM Press, Washington, D.C.


Herrmann JE, Hendry RM, Collins MF. 1979. Factors involved in enzyme-linked immunoassay

of viruses and evaluation of the method for identification of enteroviruses. J Clin

Microbiol. 10(2):210-7.

Horstmann, D. M. 1949. Clinical aspects of acute poliomyelitis. Am. J. Med. 6:592.

Horstmann DM, Yamada N. 1968. Enterovirus infections of the central nervous system. Res

Publ Assoc Res Nerv Ment Dis. 44:236-53.

Howden CW, Lang WR, Laws J. 1966. An epidemic of Echo 9 virus meningitis in Auckland. N

Z Med J. 65(411):763-5

Hsiung, G. O. 1973. Enteroviruses, p. 25-36. In G. D. Hsiung (ed.), Diagnostic Virology. Yale

University Press, New Haven, Conn.

Huang CC, Liu CC, Chang YC, Chen CY, Wang ST, Yeh TF. 1999. Neurologic complications

in children with enterovirus 71 infection. N Engl J Med. 23;341(13):936-42.

Huber SA, Haisch C, Lodge PA. 1990. Functional diversity in vascular endothelial cells: role in

coxsackievirus tropism. J Virol. 64(9):4516-2.

Hyypiä, T., T. Hovi, N. J. Knowles and G. Stanway. 1997. Classification of enteroviruses based

on molecular and biological properties. J. Gen. Virol. 78, 1-11.

Ikeda RM, Kondracki SF, Drabkin PD, Birkhead GS, Morse DL. 1993. Pleurodynia among

football players at a high school. An outbreak associated with coxsackievirus B1.

JAMA. 10;270(18):2205-6.

Iwai, M., H. Yoshida, K. Matsuura, T. Fujimoto, H. Shimizu, T. Takizawa and Y. Nagai. 2006.

Molecular epidemiology of echoviruses 11 and 13, based on an environmental

surveillance conducted in Toyama Prefecture, 2002-2003. Appl Environ Microbiol.

72:6381-87.

Jacques J, Carquin J, Brodard V, Moret H, Lebrum D, Bouscambert M, Motte J, and

Andreoletti. New Reverse Transcription-PCR Assay for Rapid and sensitive detection of

enterovirus genomes in cerebrospinal fluid specimens of patients with aseptic

meningitis.2003. J Clin Microbiol 41(12): 5726-5728.

Jaffe M, Srugo I, Tirosh E, Colin AA, Tal Y. 1989. The ameliorating effect of lumbar puncture

in viral meningitis. Am J Dis Child. 143(6):682-5.

Jantausch BA, Luban NL, Duffy L, Rodriguez WJ. 1995. Maternal plasma transfusion in the

treatment of disseminated neonatal echovirus 11 infection. Pediatr Infect Dis

J. 14(2):154-5.

Jenista JA, Powell KR, Menegus MA. 1984. Epidemiology of neonatal enterovirus infection. J

Pediatr. 104(5):685-90.


Jeonghyun Ahn, Chul-Hyun Joo, Ilsun Seo, DongHou Kim, Hea Nam Hong, Yoo Kyum Kim,

and Heuiran Lee. 2003. Characteristics of Apoptotic Cell Death Induced by

coxsackievirus B in Permissive Vero Cells. Intervirology. 46:245–251.

Johnson GM, McAbee GA, Seaton ED, Lipson SM. 1992. Suspect value of non-CSF viral

cultures in the diagnosis of enteroviral CNS infection in young infants. Dev Med Child

Neurol. 34(10):876-84.

Joo, C.H., Jeonghyun Ahn, Ilsun Seo, Yoo Kyum Kim, DongHou Kim, HeaNam Hong, and

Heuiran Lee. 2005. Characterization of Non polio Enteroviruses Recovered from Patients

with Aseptic Meningitis in Korea. Intervirology. 48:97–103.

Johnston JM, Overall JC Jr. 1989. Intravenous immunoglobulin in disseminated neonatal

echovirus 11 infection. Pediatr Infect Dis J. 8(4):254-6.

Kantor, F. S., Hsiung, G.D., 1962. Pleurodynia associated with ECHO virus type 8. N Engl J

Med. 29;266:661-3.

Kargar M, Sadeghipour S, Nategh R. 2009. Environmental surveillance of Non-Polio

Enteroviruses in Iran. Virol J. 25:149.

Kearns GL, Abdel-Rahman SM, James LP, Blowey DL, Marshall JD, Wells TG, Jacobs RF.

1999.Single-dose pharmacokinetics of a pleconaril (VP63843) oral solution in children

and adolescents. Pediatric Pharmacology Research Unit Network. Antimicrob Agents

Chemother. 1999 Mar;43(3):634-8.

Khetsuriani N, Kutateladze T, Zangaladze E, Shutkova T, Peñaranda S, Nix WA, et al. High

degree of genetic diversity of non-polio enteroviruses identified in Georgia by

environmental and clinical surveillance, 2002-2005. J Med Microbiol. 2010; 59: 1340-

1347.

Khetsuriani N, Lamonte-Fowlkes A, Oberst S, Pallansch MA (2006). Centers for Disease

Control and Prevention. Enterovirus surveillance—United States, 1970–2005. MMWR

Surveill Summ 55:1–20.

Kimura, M. 1980. A simple method for estimating evolutionary rate of base substitutions

through comparative studies of nucleotide sequences. J. Mol. Evol 16:111-120.

King, D. L., and D. T. Karzon. 1975. An epidemic of aseptic meningitis syndrome due to echo

virus type 6. Pediatrics 53:432-437.

Kinnunen E, Hovi T, Stenvik M, Hellström O, Porras J, Kleemola M, Kantanen ML. 1987.

Localized outbreak of enteroviral meningitis in adults. Acta Neurol

Scand. 1987 May;75(5):346-51.


Kopecka H, Brown B, Pallansch MA (1995) Genotypic variation in Coxsackievirus B5 isolates

from three different outbreaks in the United States. Virus Res 38:125–136.

Kumar, S., K. Tamura, and M. Nei. 2004. MEGA 3: integrated software for molecular

evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5:150-163.

Kumar A, Shukla D, Kumar R, Idris MZ, Misra UK, Dhole TN (2011) An epidemic of

encephalitis associated with human enterovirus B in Uttar Pradesh, India, 2008. J Clin

Virol 51:142-145

Kung, C.M, C.C. King, C.N. Lee, L.M. Huang, P.I. Lee, and C.L. Kao. 2007. Differences in

replication capacity between enterovirus 71 isolates obtained from patients with

encephalitis and those obtained from patients with herpangina in Taiwan. J Med Virol.

79:60-8.

Kupila L, Vuorinen T, Vainionpa R, Marttila R.J., and Kotilainen P. Diagnosis of enteroviral

meningitis by use of polymerase chain reaction of cerebrospinal fluid, Stool, and Serum

specimens. 2005. Clin. Infect. Dis. 40: 982-987.

Lee B.E., Davies HD (2007). Aseptic meningitis. Curr Opin Infect Dis 20:272–277

Leitch EC, Harvala H, Robertson I, Ubillos I, Templeton K and Simmonds P. Direct

identification of human enterovirus serotypes in cerebrospinal fluid by amplification and

sequencing of the VP1 region. J Clin Virol. 2009; 44: 119–124.

Leveque N, Amine IL, Cartet G, Hammani AB, Khazraji YC, Lina B, et al (2006) Two

outbreaks of acute hemorrhagic conjunctivitis in Africa due to genotype III

coxsackievirus A24 variant. Eur J Clin Microbiol Infect Dis 26: 199–202.

Lewthwaite P, Perara D, Ooi M.H., Last A, Kumar R, Desai A, Begum A, ravi V, Shankar M.

V., Tio P. H., Cardosa M. J., Solomon T. 2010. Enterovirus 75 Encephalitis in

Children, Southern India. Emerg Infect Dis 16(11) 1780-1782.

Lipson SM, Walderman R, Costello P, Szabo K. 1988. Sensitivity of rhabdomyosarcoma and

guinea pig embryo cell cultures to field isolates of difficult-to-cultivate group A

coxsackieviruses. J Clin Microbiol. 26(7):1298-303. Erratum in: J Clin

Microbiol 1988 Sep;26(9):1916.

Lonberg-Holm K, Crowell RL, Philipson L. 1976 Unrelated animal viruses share receptors.

Nature. 26; 259(5545):679-81.

Lukashev, A.N. 2005. Role of recombination in evolution of enteroviruses. Rev. Med. Virol.

15: 157-167.

Lukashev, A.N., V.A. Lashkevich, O.E. Ivanova, G.A. Koroleva, A.E. Hinkkanen, and J.

Ilonen. 2003. Recombination in circulating enteroviruses. J. Virol. 77: 10423-10431.


Maguire HC, Atkinson P, Sharland M and Bendig J. Enterovirus infections in England and

Wales: laboratory surveillance data: 1975 to 1994. Commun Dis Public Health. 1999; 2:

122–125.

Marie L. Landry, Robin G, Ferguson D,.Rapid Enteroviaral RNA detection in clinical

specimens by using Nucleic Acid Sequence Based Amplification. J Clin Microbiol 2003

41(1): 346–350

Martino, T. A., P. Liu, M. Pediatric, and M. J. Sole. 1995. Enteroviral myocarditis and dilated

cardiomyopathy: a review of clinical and experimental studies, p. 291-351. In H. A.


Mateu MG. 1995. Antibody recognition of picornaviruses and escape from neutralization: a

structural view. Virus Res. 38:1-24.

McKinney, R. E., Jr., S. L. Katz, and C. M. Wilfert. 1987. Chronic enteroviral

meningoencephalitis in agammaglobulinemic patients. Rev. Infect. Dis. 9:334-356.

Melnick, J. L. 1990. Enteroviruses: polioviruses, coxsackieviruses, echoviruses, and newer

enteroviruses, p. 549-605. In B. N. Fields, D. M. Knipe, R. Chanock, M. Hirsch, J.

Melnick, T. Monath, and B. Roizman (ed.), Fields virology. Raven Ross, New York,

N.Y.

Melnick, J. L. 1996. Enteroviruses: polioviruses, coxsackieviruses, echoviruses, and newer

enteroviruses, p. 655-712. In B. N. Fields, D. M. Knipe, P. M. Howley, R. M. Chanock, J.

L. Melnick, T. P. Monath, B. Roizman, and S. E. Straus (ed.), Virology, 3rd ed.

Lippincott-Raven, Philadelphia, Pa.

Melnick JL, Proctor RO, Ocampo AR, Diwan AR, Ben-Porath E. Free and bound virus in

serum after administration of oral poliovirus vaccine. Am J Epidemiol. 84(2):329-42.

Minor, P. D., G. Dunn, A. Phillips, G. D. Westrop, K. Wareham, and J. W. Almond. 1989.

Attenuation and reversion of the Sabin type 3 vaccine strain, p. 307-318. In B. L. Semler

and E. Ehrenfeld(ed.), Molecular Aspects of Picornavirus Infection and Detection.

American Society for Microbiology, Washington, D.C.

Minor, P. D., G. Dunn, A. John, M. Ferguson, and J. P. Icenogle. 1986. Antigenic and molecular

evolution of the vaccine strain of type 3 poliovirus during the period of excretion by a

primary vaccine. J. Gen. Virol. 67:693-706.

Mirand A., C. Henquell, C. Archimbaud, H. Peigue-Lafeuille, and J.L. Bailly. 2007. Emergence

of recent echovirus 30 lineages is marked by serial genetic recombination events. J Gen

Virol. 88:166-76.


Mistchenko, A.S., M. Viegas, M.P. Latta, and P.R. Barrero. 2006. Molecular and epidemiologic

analysis of enterovirus B neurological infection in Argentine children. J Clin

Virol.37:293-9.

Modlin JF, Dagan R, Berlin LE, Virshup DM, Yolken RH, Menegus M. 1991. Focal

encephalitis with enterovirus infections. Pediatrics. 88(4):841-5.

Modlin JF, Polk BF, Horton P, Etkind P, Crane E, Spiliotes A. 1981. Perinatal echovirus

infection: risk of transmission during a community outbreak. N Engl J Med.

13;305(7):368-71.

Mosmann T. 1983. Rapid colorimetric assay for cellular growth and survival: application to

proliferation and cytotoxicity assay. J Immunol methods 65:55-63.

Moore, M. 1982. Enteroviral disease in the United States, 1970-1979. J. Infect. Dis. 146:103-

108.

Muir P, Nicholson F, Sharief MK, Thompson EJ, Cairns NJ, Lantos P, Spencer GT, Kaminski

HJ, Banatvala JE. 1995. Evidence for persistent enterovirus infection of the central

nervous system in patients with previous paralytic poliomyelitis. Ann N Y Acad Sci.

25;753:219-32.

Nix W.A., M.S. Oberste, and M.A. Pallansch. 2006. Sensitive, seminested PCR amplification of

VP1 sequences for direct identification of all enterovirus serotypes from original clinical

specimens. J Clin Microbiol. 44: 2698-704.

O'Neil KM, Pallansch MA, Winkelstein JA, Lock TM, Modlin JF. 1988. Chronic group A

coxsackievirus infection in agammaglobulinemia: demonstration of genomic variation of

serotypically identical isolates persistently excreted by the same patient. J Infect

Dis. 157(1):183-6.

Oberste, M.S., K. Maher, D.R. Kilpatrick, and M.A. Pallansch. 1999. Molecular evolution of the

human enteroviruses correlation of serotype with VP1 sequence and application to

picornavirus classification. J Virol. 73:1941-8.

Oberste M. S., Michele S. M., Maher K, Schnurr D, Cisterna D, Junttila N, Uddin M, Chomel J.

J., Lau C. S., Ridha W, Suleiman B, Norder H,. Magnius L. O., Pallansch M. A. 2004

Molecular identification and characterization of two proposed new enterovirus serotypes,

EV74 and EV75. J. Gen Virol 85: 3205-3212.

Pallansch MA (1997) Coxsackievirus B epidemiology and public health concerns. Curr Top

Microbiol Immunol 223: 13–30.


Pallansch MA, Oberste MS (2003) Coxsackieviruses, echoviruses and other enteroviruses. In:

Gorbach SL, Bartlett JG, Blacklow NR, editors. Infectious diseases. Philadelphia:

Lippincott Williams &Wilkins. pp 2047–2053.

Parrott, R. H., Ross, S, Burke, FG, and Rice E. 1951. Herpangina; clinical studies of a specific

infectious disease. N Engl J Med. 23;245(8):275-80.

Payment, P., R. Ayache, and M. Trudel. 1993. A survey of enteric viruses in domestic sewage.

Can. J. Microbiol. 1:111–119.

Pevear DC, Fancher MJ, Felock PJ, Rossmann MG, Miller MS, Diana G, Treasurywala AM,

McKinlay MA, Dutko FJ. 1989. Conformational change in the floor of the human

rhinovirus canyon blocks adsorption to HeLa cell receptors. J Virol. 63(5):2002-7.

Pevear DC, Tull TM, Seipel ME, Groarke JM. 1999. Activity of pleconaril against

enteroviruses. Antimicrob Agents Chemother. 43(9):2109-15.

Pichicherio, M. E., S. McLinn, H. A. Rotbart, M. A. Menegus, M. Cascino, and B. E.

Reidenberg. 1998. Clinical and economic impact of enterovirus illness in private practice.

Pediatrics 102:1126-1134.

Pilaka, V., Filliponi M.E., Kyriakopoulou, Z., Ruether I.G.A., Tsakogiannis, D.,Gartzonika C.,

Levidiotou Stefanou S., and Markoulatos P. 2011. Retrospective molecular and

phenotypic analysis of poliovirus vaccine strains isolated in Greece. Clinical

Microbiology and Infection Vol 17: 1554-1562.

Prather, S. L., R. Dagan, J. A. Jenista, and M. A. Menegus. 1984. The isolation of enteroviruses

from blood: a comparison of four processing methods. J. Med. Virol.14:221-227.

Racaniello, V. R. 1995. Early events in infection: receptor binding and cell entry, p. 73-93. In

H. A. Rotbart (ed.), Human Enterovirus Infections. ASM Press, Washington, D.C.

Rahimi P, Tabatabaie H, Gouya MM, Mahmudi M, Musavi T, Rad KS, Azad TM, Nategh R

(2009) Direct identification of non-polio enteroviruses in residual paralysis cases by

analysis of VP1 sequences. J Clin Virol 45:139-141.

Rakoto-Andrianarivelo, M., S. Guillot, J. Iber, J. Balanant, B. Blondel, F. Riquet, J. Martin, O.

Kew, B. Randriamanalina, L. Razafinimpiasa, D. Rousset, and F. Delpeyroux. 2007. Co-

circulation and evolution of polioviruses and species C enteroviruses in a district of

Madagascar. PLoS Pathog. 3:191.

Reimann BY, Zell R, Kandolf R. 1991. Mapping of a neutralizing antigenic site of

Coxsackievirus B4 by construction of an antigen chimera. J Virol. 65(7):3475-80


Ren, R., and V. R. Racaneillo. 1992. Human poliovirus receptor gene expression and poliovirus

tissue tropism in transgenic mice. J. Virol. 66:296-304.

Rewers, M.., and M. Atkinson. 1995. The possible role of enteroviruses in diabetes mellitus, p

353-395. In H. A. Rotbart (ed.), Human Enetroviruses infection. ASM Press, Washington,

D.C.

Roivainen M, Piirainen L, Hovi T, Virtanen I, Riikonen T, Heino J, Hyypiä T. 1994. Entry of

coxsackievirus A9 into host cells: specific interactions with alpha v beta 3 integrin, the

vitronectin receptor. Virology. 203(2):357-65.

Romero JR, Rotbart HA. 1995. Sequence analysis of the downstream 5' nontranslated region of

seven echoviruses with different neurovirulence phenotypes. J Virol. 69(2):1370-5.

Rotbart, H. A. 1984. Enteroviral infections of the central nervous system. Clin. Infect. Dis.

20:971-981.

Rotbart, H. A. 1995. Meningitis and encephalitis, p.271-289. In H. A. Rotbart (ed.), Human

Enterovirus Infections. ASM Press, Washington, D.C.

Rotbart, H. A. 1997. Viral meningitis and the aseptic meningitis syndrome, p. 23-47. In W. M.

Scheld, R. J. Whitley, and D. T. Durack (ed.), Infections of the Central Nervous System,

2nd

ed. Lippincott-Raven, Philadelphia, Pa.

Rotbart, H. A. 1999. Enteroviruses, p. 990-998. In P. R. Murray, E. J. Baron, M. A. Pfaller, F.

C. Tenover, and R. H. Yolken (ed.), Manual of Clinical Microbiology, 7th ed. ASM Press,

Washington, D.C.

Rotbart, H. A. 2000. Antiviral therapy for enteroviruses and rhinoviruses. Antiviral Chem.

Chemother. 11:261-271.

Rotbart HA, Brennan PJ, Fife KH, Romero JR, Griffin JA, McKinlay MA, Hayden FG. 1998.

Enterovirus meningitis in adults. Clin Infect Dis. 27(4):896-8.

Rotbart HA, Kinsella JP, Wasserman RL. Persistent enterovirus infection in culture-negative

meningoencephalitis: demonstration by enzymatic RNA amplification. J Infect

Dis. 161(4):787-91.

Rotbart, H. A., and K. kirkegard. 1992. Picornavirus pathogenesis: viral access, attachment, and

entry into susceptible cells. Semin. Virol. 3:483-499.

Rotbart HA, O'Connell JF, McKinlay MA. 1998. Treatment of human enterovirus infections.

Antiviral Res. 38(1):1-14.

Rotbart, H.A. 1995. Enteroviral infection of the central nervous system. Clin Infect Dis 20: 971-

81.


Rotbart HA, Webster AD; Pleconaril Treatment Registry Group. 2001. Treatment of potentially

life-threatening enterovirus infections with pleconaril. Clin Infect Dis. 15;32(2):228-35.

Epub 2001 Jan 15.

Rousset, D., M. Rakoto-Andrianarivelo, R. Razafindratsimandresy, B. Randriamanalina, S.

Guillot, J. Balanant, P. Mauclere, and F. Delpeyroux. 2003. Recombinant vaccine-derived

poliovirus in Madagascar. Emerg. Infect. Dis. 9:885-887.

Rueckert, R. R. 1990. Picornaviruses and their replication, p. 507-548. In B. N. Fields, D. M.

Knipe, R. Chanock, M. Hirsch, J. Melnick, T. Monath, and B. Roizman (ed.), Fields

Virology. Raven Press, New York N.Y.

Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method for reconstructing

phylogenetic trees. Mol. Biol. Evol. 4:406-425.

Saraswathy TS, Khairullah NS, Sinniah M, Fauziah MK, Apandi MY and Shamsuddin M.

Laboratory acute flaccid paralysis surveillance in Malaysia: a decade of commitment to

the WHO global polio eradication initiative. Southeast Asian J Trop Med Public Health.

2004; 35: 421–424.

Savolainen-Kopra C, Samoilovich E, Kahelin H, Hiekka A, Hovi T, and Roivainen M. 2009.

Comparison of poliovirus recombinants: accumulation of point mutations provides further

Advantages. J. Gen Virol 90 1859-1868.

Sawyer, M.H. 2001. Enterovirus infection: diagnosis and treatment. Curr Opin Pediatr. 13:65-

9.

Sedmak, G., D. Bina, and J. MacDonald. 2003. Assessment of an enterovirus sewage

surveillance system by comparison of clinical isolates with sewage isolates from

Milwaukee, Wisconsin, collected august 1994 to December 2002. Appl. Environ.

Microbiol. 69:7181-7187.

Sellwood, J., J. V. Dadswell, and J. S. Slade. 1981. Viruses in sewage as an indicator of their

presence in the community. J. Hyg. (London) 86:217-225.

Schiff GM, Sherwood JR. 2000. Clinical activity of pleconaril in an experimentally induced

coxsackievirus A21 respiratory infection. J Infect Dis181(1):20-6.

Sharief MK, Hentges R, Ciardi M. 1991. Intrathecal immune response in patients with the post-

polio syndrome. N Engl J Med. 12;325(11):749-55

Shukla D, Kumar A, Srivastava S, Dhole TN. 2013. Molecular identification and phylogenetic

study of coxsackievirus A24 variant isolated from an outbreak of acute hemorrhagic

conjunctivitis in india in 2010. Arch Virol. 158(3) :679-84.


Siciński P, Rowiński J, Warchoł JB, Jarzabek Z, Gut W, Szczygieł B, Bielecki K, Koch G.

1990. Poliovirus type 1 enters the human host through intestinal M cells.

Gastroenterology. 98(1):56-8.

Siddique T, McKinney R, Hung WY, Bartlett RJ, Bruns G, Mohandas TK, Ropers HH, Wilfert

C, Roses AD. 1988. The poliovirus sensitivity (PVS) gene is on chromosome 19q12----

q13.2. Genomics. 3(2):156-60.

Simmonds, P., and J. Welch. 2006. Frequency and dynamics of recombination within different

species of human enteroviruses. J. Virol. 80: 483–493.

Simoes, E. A. F. 1984. Poliomyelitis, p. 1141-1149. In P. D. Hoeprich, M. C. Jordan, and A. R.

Ronald (ed.), Infectious Diseases, 5th ed. J. B. Lippincott Co., Philadelphia, Pa.

Singer JI, Maur PR, Riley JP, Smith PB. 1980. Management of central nervous system

infections during an epidemic of enteroviral aseptic meningitis. J Pediatr. 96(3 Pt 2):559-

63.

Solomon P, Weinstein L, Chang T. W., Artenstein M. S., Ambrose C.T. 1959. Epidemiologic,

clinical, and laboratory features of an epidemic of type 9 ECHO virus meningitis. J

Pediatr. 55:609-19.

Strikas, R. A., L. J. Anderson, and R. A. Parker. 1986. Temporal and geographic patterns of

isolates of nonpolio enterovirus in the United States, 1970-1983. J. Infect. Dis. 153:346-

351.

Tavares FN, Campos Rde M, Burlandy FM, Fontella R, de Melo MM, da Costa EV, da Silva

EE (2011) Molecular characterization and phylogenetic study of coxsackievirus A24v

causing outbreaks of acute hemorrhagic conjunctivitis (AHC) in Brazil. PLoS One

6:e23206.

Thivierge B, Delage G., 1982. [Infections of the central nervous system caused by enterovirus:

223 cases seen at a pediatric hospital between 1973 and 1981]. Can Med Assoc J.

1;127(11):1097-102.

Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the

sensitivity of progressive multiple sequence alignment through sequence weighting,

position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-

4680.

Tracy, S., N. M. Chapman, R. J. Rubocki, and M. A. Beck. 1995. Host immune responses to

enterovirus infections, p. 175-191. In H. A. Rotbart (ed.), Human Enterovirus Infections.

ASM Press, Washington, D.C.


Trallero G, Casas I, Tenorio A, Echevarria JE, Castellanos A, Lozano A, Brena PP (2000)

Enteroviruses in Spain: Virological and epidemiological studies over 10 years (1988–97).

Epidemiol Infect 124:497–506.

Wadia NH, Katrak SM, Misra VP, Wadia PN, Miyamura K, Hashimoto K, Ogino T, Hikiji T,

Kono R. 1983. Polio-like motor paralysis associated with acute hemorrhagic

conjunctivitis in an outbreak in 1981 in Bombay, India: clinical and serologic studies. J

Infect Dis. 147(4):660-8.

Wadia NH, Wadia PN, Katrak SM, Misra VP. 1983. A study of the neurological disorder

associated with acute haemorrhagic conjunctivitis due to enterovirus 70. J Neurol

Neurosurg Psychiatry. 46(7):599-610

Wang, D. M., Zhao GC, Zhuang SM, Zhang YC. 1993. An epidemic of encephalitis and

meningoencephalitis in children caused by echovirus type 30 in Shanghai. Chin Med J

(Engl). 106(10):767-9.

Webster AD, Rotbart HA, Warner T, Rudge P, Hyman N. 1993. Diagnosis of enterovirus brain

disease in hypogammaglobulinemic patients by polymerase chain reaction. Clin Infect

Dis.17(4):657-61.

Weinstein, L., Shelokov, A, Seltser R, Winchell GD. 1952. A comparison of the clinical

features of poliomyelitis in adults and in children. N Engl J Med. 21;246(8):297-302.

Weller, T. H., Robbins, F. C., Enders, J. F., 1949. Cultivation of poliomyelitis virus in cultures

of human foreskin and embryonic tissues. Proc Soc Exp Biol Med. 72(1):153-5.

Wilfert CM, Thompson RJ Jr, Sunder TR, O'Quinn A, Zeller J, Blacharsh J. 1981. Longitudinal

assessment of children with enteroviral meningitis during the first three months of life.

Pediatrics. 1981 Jun;67(6):811-5.

Wilfert, C. M., Lehrman, S. N., and Katz, S. L., 1983. Enteroviruses and meningitis. Pediatr

Infect Dis. 2(4):333-41.

Whitley, R. J., Cobbs CG, Alford CA Jr, Soong SJ, Hirsch MS, Connor JD, Corey L, Hanley. 1

DF, Levin M, Powell D. A., 1989. Diseases that mimic herpes simplex encephalitis.

Diagnosis, presentation, and outcome. NIAD Collaborative Antiviral Study Group.

JAMA. 14;262(2):234-9.

World Health Organization. 2001. Manual for the virological investigation of polio

WHO/EPI/GEN/97.01.World Health Organization, Geneva, Switzerland.

Wong SN, Tam AY, Ng TH, Ng WF, Tong CY, Tang TS. 1989. Fatal Coxsackie B1 virus

infection in neonates. Pediatr Infect Dis J. 8(9):638-41.

Wu D, Ke CW, Mo YL, Sun LM, Li H, Chen QX, Zou LR, Fang L, Huang P, Zhen HY


(2008) Multiple outbreaks of acute hemorrhagic conjunctivitis due to a variant of

coxsackievirus A24: Guangdong, China 2007. J Med Virol 80:1762–1768.

Wyatt, H. V., 1976. Provocation poliomyelitis and entry of poliovirus to the CNS. Med

Hypotheses. 2(6):269-74.

Yoke-Fun, C., and S. AbuBakar. 2006. Phylogenetic evidence for inter-typic recombination in

the emergence of human enterovirus 71 subgenotypes. BMC Microbiol. 6:74-85.

Yousef GE, Brown IN, Mowbray JF. 1987. Derivation and biochemical characterization of an

enterovirus group-specific monoclonal antibody. Intervirology. 28(3):163-70.

Zhang, A., R. G. Nanni, D. A. Oren, E. J. Rozhon, and E. Arnold. 1992. Three dimensional

structure activity relationships for antiviral agents that interact with picornavirus capsids.

Semin. Virol. 3:453-471.

Zhu J, Luo Z, Wang J, Xu Z, Chen H, Fan D, Gao N, Ping G, Zhou Z, Zhang Y, An J.

Phylogenetic analysis of enterovirus 71 circulating in beijing, china from 2007 to

2009. PLoS One. 2013;8(2):e56318.

AppendicesAppendicesAppendicesAppendices

9. Appendices

Phosphate buffered saline (PBS) 1X [0.15M]

Sodium chloride (NaCl) 8.0 gm

Disodium hydrogen phosphate (Na2HPO4) 1.15 gm

Potassium dihydrogen phosphate (KH2PO4) 0.2 gm

Potassium Chloride (KCL) 0.2 gm

Dissolved in TDW to the final volume of 1 liter and pH was adjusted to 7.2. The

solution was autoclaved and stored at 40C.

Complete RPMI-1640 (c-RPMI)

RPMI-1640 (GibcoBRL) 10.4 gm

HEPES (SRL) 6.0 gm

L-glutamine (SIGMA) 0.258 gm

Sodium pyruvate (GibcoBRL) 0.11 gm

Sodium bicarbonate (SIGMA) 2.0 gm

Antibiotic-antimycotic (100X) 10.0 ml

Heat inactivated FBS 10%

Dissolved in 1 liter TDW final volume, pH was adjusted to 7.2, filtered through 0.2

millipore filter and stored at 40C.


Eagle's growth medium (GM) and Eagle's maintenance medium (MM)

Growth medium Maintenance medium

Eagle's minimum essential medium 83.3 ml 90.3 ml

L-glutamine 200 Mm 1.0 ml 1.0 ml

Fetal calf serum 10.0 ml 2.0 ml

NaHCO3 solution 7.5% 3.5 ml 4.5 ml

HEPES 1M 1.0 ml 1.0 ml

Penicillin/streptomycin solution 1.0 ml 1.0 ml

0.4% phenol red 0.2 ml 0.2 ml


10. Publication & Scientific presentations

Publications

� Deepti Shukla, Arvind Kumar, Shalini Srivastava, Mohammad Z Icris, Tapan N

Dhole. Environmental surveillance of enterovirusin northern india using an integrated

shell vial culture with a semi-nested RT-PCR and partial sequencing of the VP1 gene.

Journal of medical virology (2013).

� Deepti Shukla, Arvind Kumar, Shalini Srivastava, Tapan N Dhole. Molecular

identification and phylogenetic study of coxsackievirus A24 variant isolated from an

outbreak of acute hemorrhagic conjunctivitis in india in 2010. Archives of virology

(2013).

� Arvind Kumar, Deepti Shukla, Shalini Srivastava, Mohammad Z Idris, Tapan N

Dhole. High frequency of enterovirus serotype circulation of densly populated area of

india. Journal of infection in developing countries 2013.

� Arvind Kumar, Deepti Shukla, Rashmi Kumar, Mohammad Z Idris, Usha K Misra

and Tapan N Dhole. Molecular epidemiological study of enteroviruses associated

with encephalitis in children from India. J Clin Microbiol. 2012 .


and Tapan N Dhole. An epidemic of encephalitis associated with human enterovirus

B in Uttar Pradesh, India 2008. Journal of clinical virology.

� Arvind Kumar, Deepti Shukla, Rashmi Kumar, Mohammad Z Idris, Prashant Jauhari,

Shalini Srivastava, and Tapan N Dhole. Molecular identification of enteroviruses

associated with aseptic meningitis in children from India. Archive of Virology 2012.

Scientific presentations

� Deepti Shukla, Rashmi Kumar, Usha. K Mishra, Shalini Srivastava, and Tapan N

Dhole, Manju Ohri “Molecular epidemiology and clinical study of enteroviruses

associated with encephalitis in children from northern india.” in 28th

Annual Clinical

virology symposium held at Daytona Beach, Florida.

� Arvind Kumar, Deepti Shukla, Rashmi Kumar, Mohammad Z Idris, Tapan N Dhole

“Vaccine poliovirus associated encephalitis in OPV vaccinated children” in 22nd


European Society of Clinical Microbiology and Infectious disease (ECCMID) 2012,

held at London, UK.

� Tapan N Dhole, Arvind Kumar, Deepti Shukla, and Shalini Srivastava. “Molecular

epidemiology of non polio enterovirus circulating in highly endemic areas of central

nervous system disease” in 22nd

European Society of Clinical Microbiology and

Infectious disease (ECCMID) 2012, held at London, UK.

� *Arvind Kumar, Deepti Shukla, Mohammad Z Idris and Tapan N Dhole. “Molecular

identification and characterization of infectious enterovirus in sewage by using the

integrated shell vial culture with semi nested RT PCR” in International conference on

biotechnology and management-2011 organized by Barkatullah University, Bhopal.

� *Deepti Shukla, Arvind Kumar, Rashmi Kumar, Mohammad Z Idris, and Tapan N

Dhole. “Molecular epidemiology of enterovirus associated with encephalitis in India”

in NERVE-2011 organized by Haffkine Institute, Mumbai.

*Best paper award

� Arvind Kumar, Deepti Shukla, Rashmi Kumar, and Tapan N Dhole. “Molecular

detection of human Parechovirus by real time PCR in encephalitis children in eastern

Uttar Pradesh” presented in National Ensemble on Rabies & other Viral encephalitis-

NERVE 2011 held at Haffkine Institute, Mumbai-India, 27th

- 28th

September 2011.


and Tapan N Dhole. “Molecular characterization of recombinant Sabin poliovirus

isolated from children with acute flaccid paralysis” in UP MICROCON-2010

organized by Central JALMA, Agra.

� Arvind Kumar, Deepti Shukla, Mohammad Z Idris, and Tapan N Dhole. “Molecular

characterization of newer emerging non polio enterovirus ccirculating in Uttar

Pradesh, India” in UP MICROCON-2011, 7th annual conference of UP chapter of the

Indian Association of Medical Microbiologist (IAMM), at Sanjay Gandhi

Postgraduate Inst. of Medical Sciences, Lucknow, India.


and Tapan N Dhole. “Molecular detection and typing of enteroviruses associated with

encephalitis in Eastern Uttar Pradesh” in UP MICROCON-2010, 6th annual

conference of UP chapter of the Indian Association of Medical Microbiologist

(IAMM), at National JALMA Institute for Leprosy and other Mycobacterial

Disaeses, Agra, UP, India.


� *Arvind Kumar, Deepti Shukla, Rashmi Kumar, Sanjeev Kumar Tripathi, and Tapan

N Dhole. “Isolation of novel enterovirus in encephalitis patient from eastern Uttar

Pradesh” in UP MICROCON-2009, 5th annual conference of UP chapter of the

Indian Association of Medical Microbiologist (IAMM), at U.P. Rural Institute of

Medical Sciences & Resaerch, Saifai, Etawah, UP, India. *abstract award

Documents

Molecular and biological characterization of circulating ...shodhganga.inflibnet.ac.in/bitstream/10603/50803/1/deepti thesis.pdf · This is to certify that the present work entitled