Molecular Characterization of Global Regulatory RNA Species … · Ecc and, like the latter, function as negative regulators by affecting the transcript stability of the target gene

JOURNAL OF BACTERIOLOGY,0021-9193/01/$04.0010 DOI: 10.1128/JB.183.6.1870–1880.2001

Mar. 2001, p. 1870–1880 Vol. 183, No. 6

Copyright © 2001, American Society for Microbiology. All Rights Reserved.

Molecular Characterization of Global Regulatory RNA SpeciesThat Control Pathogenicity Factors in Erwinia amylovora and

Erwinia herbicola pv. gypsophilae†‡WEILEI MA, YAYA CUI, YANG LIU, C. KORSI DUMENYO, ASITA MUKHERJEE,

AND ARUN K. CHATTERJEE*

Department of Plant Microbiology and Pathology, Plant Sciences Unit, University of Missouri,Columbia, Missouri 65211

Received 21 August 2000/Accepted 12 December 2000

rsmBEcc specifies a nontranslatable RNA regulator that controls exoprotein production and pathogenicity insoft rot-causing Erwinia carotovora subsp. carotovora. This effect of rsmBEcc RNA is mediated mostly byneutralizing the function of RsmAEcc, an RNA-binding protein of E. carotovora subsp. carotovora, which acts asa global negative regulator. To determine the occurrence of functional homologs of rsmBEcc in non-soft-rot-causing Erwinia species, we cloned the rsmB genes of E. amylovora (rsmBEa) and E. herbicola pv. gypsophilae(rsmBEhg). We show that rsmBEa in E. amylovora positively regulates extracellular polysaccharide (EPS)production, motility, and pathogenicity. In E. herbicola pv. gypsophilae, rsmBEhg elevates the levels of tran-scripts of a cytokinin (etz) gene and stimulates the production of EPS and yellow pigment as well as motility.RsmAEa and RsmAEhg have more than 93% identity to RsmAEcc and, like the latter, function as negativeregulators by affecting the transcript stability of the target gene. The rsmB genes reverse the negative effects ofRsmAEa, RsmAEhg, and RsmAEcc, but the extent of reversal is highest with homologous combinations of rsmgenes. These observations and findings that rsmBEa and rsmBEhg RNA bind RsmAEcc indicate that the rsmBeffect is channeled via RsmA. Additional support for this conclusion comes from the observation that the rsmBgenes are much more effective as positive regulators in a RsmA1 strain of E. carotovora subsp. carotovora thanin its RsmA2 derivative. E. herbicola pv. gypsophilae produces a 290-base rsmB transcript that is not subjectto processing. By contrast, E. amylovora produces 430- and 300-base rsmB transcripts, the latter presumablyderived by processing of the primary transcript as previously noted with the transcripts of rsmBEcc. Southernblot hybridizations revealed the presence of rsmB homologs in E. carotovora, E. chrysanthemi, E. amylovora, E.herbicola, E. stewartii and E. rhapontici, as well as in other enterobacteria such as Escherichia coli, Salmonellaenterica serovar Typhimurium, Serratia marcescens, Shigella flexneri, Enterobacter aerogenes, Klebsiella pneu-moniae, Yersinia enterocolitica, and Y. pseudotuberculosis. A comparison of rsmB sequences from several of theseenterobacterial species revealed a highly conserved 34-mer region which is predicted to play a role in positiveregulation by rsmB RNA.

In many host-pathogen systems, disease development re-quires coordinate expression of sets of genes in response tovarious signals and environmental cues (9, 13). Regulation ofthese genes, like that of the housekeeping genes, is subject toboth transcriptional and posttranscriptional control. We havedetermined that posttranscriptional regulation mediated bythe RsmA-rsmB pair is the most critical factor in soft-rot-causing Erwinia. RsmA is a small RNA binding protein, whichacts by reducing the half-life of mRNA species (21, 33). rsmBspecifies an untranslated regulatory RNA (21) and neutralizesthe effect of RsmA. RsmA and rsmB RNA control many phe-notypes in soft-rot-causing Erwinia, including the productionof pectate lyase, polygalacturonase, cellulase, protease, harpin,

motility, flagellum formation, antibiotic, pigment, elicitation ofthe HR (hypersensitive reaction), and pathogenicity (10, 26).Erwinia carotovora subsp. carotovora strain 71 produces tworsmB RNA species: a primary RNA of 479 bases which isprocessed to yield a 259-base RNA, designated rsmB’ RNA(21). The rsmB’ RNA has the regulatory functions attributed torsmB. Romeo and associates have identified a 360-base csrBRNA in Escherichia coli which is functionally very similar torsmB RNA, except that there is no evidence that csrB RNA isprocessed (33).

Preliminary trials with the cloned E. carotovora subsp. caro-tovora genes revealed transdominant regulatory effects of rsmAand rsmB genes in non-soft-rot-causing Erwinia species such asE. amylovora, the representative of the Amylovora group (31),and E. stewartii and E. herbicola pv. gypsophilae, the represen-tatives of the Herbicola group (31) (now members of the genusPantoea [14]). Furthermore, homologs of rsmA exist in thesebacteria and in all other Erwinia species tested (10). Theseobservations prompted the hypothesis that the regulatory paircontrols the production of pathogenicity factors in these non-soft-rot-causing Erwinia species as well. We should note thatpathogenicity of the Amylovora and Herbicola (Pantoea)groups of bacteria is determined not by extracellular enzymes,

* Corresponding author. Mailing address: Department of Plant Mi-crobiology and Pathology, Plant Sciences Unit, University of Missouri,108 Waters Hall, Columbia, MO 65211. Phone: (573) 882 1892. Fax:(573) 882 0588. E-mail: [email protected].

† We affectionately dedicate this paper to the memory of Robert N.Goodman, whose insight and numerous contributions have led to abetter understanding of the biology of these and other plant-patho-genic bacteria.

‡ Journal series 13,022 of the Missouri Agriculture Experiment Sta-tion.

1870

on Decem

ber 20, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

as in soft-rot-causing Erwinia, but by factors such as extracel-lular polysaccharide (EPS) or growth hormones (4, 23). SincersmB homologs of these bacteria have not been examined, itwas of interest to compare the structural and functional char-acteristics of rsmB genes of the three groups of bacteria. Wereport here (i) cloning of rsmA and rsmB genes of E. amylovora(rsmAEa and rsmBEa) and E. herbicola pv. gypsophilae (rsmAEhg

and rsmBEhg), (ii) nucleotide sequence or deduced amino acidsequence homologies of these genes, (iii) effects of rsmA andrsmB in homologous and heterologous bacterial species, and(iv) reversal of the RsmA effect by rsmB. We also show that E.amylovora strain E9 produces two rsmB RNA species whereasE. herbicola pv. gypsophilae possesses a single rsmB transcript

species. Our findings and the physical evidence for the occur-rence of RsmA homologs (10) suggest that the RsmA-rsmBregulatory system has been conserved in enterobacterial spe-cies. Moreover, we have identified a region of rsmB RNAwhich has been conserved in enterobacterial species.

MATERIALS AND METHODS

Bacterial strains, plasmids, and media. The bacterial strains and plasmidsused in this study are described in Table 1. The strains carrying drug markerswere maintained on Luria-Bertani (LB) agar containing appropriate antibiotics.The wild-type strains were maintained on LB agar. The composition of LBmedium, minimal salts medium, KB medium, nutrient gelatin (NG) agar, andpolygalacturonate-yeast extract agar (PYA) have been described previously (2,8). When required, antibiotics were supplemented as follows (in micrograms per

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Relative characteristics Reference or source

StrainsE. carotovora subsp. carotovora

Ecc71 Wild type 39AC5071 RsmA of Ecc71 25

E. amylovora E9 Wild type 32E. herbicola pv. gypsophilae PD713 Wild type 17E. carotovora subsp. atroseptica Eca12 Wild type 39E. carotovora subsp. betavasculorum

Ecb11129Wild type J. E. Loper

E. chrysanthemi EC16 Wild type 7E. rhapontici Er1 Wild type 24E. herbicola EH105 Wild type 10E. stewartii Es1 Wild type 10S. enterica serovar Typhimurium LT2 Wild type 10Serratia marcescens Sm1 Wild type 10Yersinia pseudotuberculosis Yp1 Wild type 7Yersinia enterocolitica 8081V Wild type S. A. MunnichShigella flexneri Sf1 Wild type 10Enterobacter aerogenes Ena1 Wild type 10Klebsiella pneumoniae KP1 Wild type 10E. coli

DH5a F80lacZ M15 (lacZYA-argF)U169 hsdR17 recA1 endA1 thi-1 Gibco BRLK-12 Wild type 37

PlasmidspCL1920 Spcr Smr 16pCL1921 Spcr Smr 16pRK415 Tcr 15pBluescript SK(1) Apr StratagenepSF6 Mob1 Spcr Smr 36pMBL-R.73 Apr, 0.73-kb EcoRI fragment containing pre-etz plus etz in pBluescript SK(1) 17pAKC781 Apr, peh-11 19pAKC783 Apr, pel-11 19pAKC891 Spcr, 3.0-kb EcoRI-SacI fragment containing rsmAEhg in pCL1921 This workpAKC892 Tcr, 3.0-kb EcoRI-HindIII fragment of pAKC891 containing rsmAEhg in pRK415 This workpAKC120 Spcr, pSF6 cosmid containing rsmAEa This workpAKC893 Spcr, 4.5-kb HindIII fragment containing rsmAEa in pCL1920 This workpAKC894 Tcr, 4.5-kb HindIII fragment containing rsmAEa in pRK415 This workpAKC878 Tcr, 9.0-kb EcoRI fragment containing rsmAEcc in pRK415 21pAKC679 AepH1 (rsmBEcc), Spcr 28pAKC1004 Spcr, plac-rsmB9Ecc, nt 1220 to 1540 of rsmBEcc DNA in pCL1920 21pAKC1042 Spcr, 1.7-kb HincII fragment containing rsmBEhg in pCL1920 This workpAKC1043 Spcr, 1.7-kb BamHI fragment containing rsmBEa in pCL1920 This workpAKC1044 Apr, nt-62 to 1193 of rsmBEa DNA in pBluescript SK(1) This workpAKC1045 Apr, nt 11 to 1455 of rsmBEa DNA in pBluescript SK(1) This workpAKC1046 Apr, at 11 to 1310 rsmBEhg of DNA in pBluescript SK(1) This workPAKC1049 Spcr, plac-rsmBEcc, nt 11 to 1540 of rsmBEcc DNA in pCL1920 This workpAKC1061 Spcr, plac-rsmBEhg, nt 126 to 1761 of rsmBEhg DNA in pCL1920 This workpAKC1062 Spcr, plac-rsmBEa, nt 11 to 1455 of rsmBEa DNA in pCL1920 This workpAKC1063 Spcr, plac-rsmB9Ea, nt 1135 to 1455 of rsmBEa DNA in pCL1920 This work

VOL. 183, 2001 RNA REGULATORS OF PATHOGENICITY FACTORS 1871

on Decem


.org/D

ownloaded from

http://jb.asm.org/

milliliter): ampicillin, 100; kanamycin, 50; spectinomycin, 50; tetracycline, 10.Media were solidified by the addition of 1.5% (wt/vol) agar.

Extracellular enzyme assays. Growth conditions, preparation of culture su-pernatant, quantitative assay conditions for pectate lyase (Pel) and semiquanti-tative assay conditions for pectate lyase (Pel), polygalacturonase (Peh), cellulase(Cel), and protease (Prt) have been previously described (5, 29).

EPS production and motility assays. Cultures of E. herbicola pv. gypsophilaeor E. amylovora were patched or streaked on minimal salts medium plus sucrose(1%, wt/vol) and spectinomycin for EPS detection and stab inoculated into KBsoft agar (0.4%, wt/vol) plus spectinomycin with a needle for examination ofmotility. Bacteria were incubated at 28°C for 24 h. Motility and EPS productionof the bacteria were visually examined.

Pathogenicity assays on apple shoots. Pathogenicity assays on apple shootswere carried out essentially as previously described (26), cell suspensions (30 mlcontaining 2 3 108 CFU) of E. amylovora strain E9 carrying the rsmAEa

1

plasmid, rsmBEa1 plasmid, or the cloning vector, pCL1920, were applied to the

cut surface of each petiole. Inoculated plants were incubated at 28°C with a 14-hlight/10-h dark regime until disease symptoms appeared.

DNA techniques. Standard procedures were used in the isolation of plasmidand chromosomal DNAs, transformation, restriction endonuclease digests, gelelectrophoresis, and DNA ligation (34). Southern hybridizations were carriedout as previously described (10). Restriction and modifying enzymes were ob-tained from Promega Biotec (Madison, Wis.). The Prime-a-Gene DNA labelingsystem of Promega Biotec was used for labeling DNA probes. PCR was per-formed as described by Liu et al. (21). By using the degenerate primers, DB1(59-YMADGGACACCTCCAGG-39) and DB2 (59-WCTGYRCYCCCGGTTCG-39) (Y 5 C or T; M 5 A or C; D 5 A, G, or T; W 5 A or T; R 5 A or G),in the rsmB sequence, we amplified the rsmB DNA in the following bacterialspecies: Pseudomonas fluorescens, Serratia marcescens, Shigella flexneri, Enter-obactor arogenes, Salmonella enterica serovar Typhimurium, and Klebsiella pneu-moniae (Table 1).

The plac-rsmB transcription fusions were constructed as follows. The 0.7-kbHincII-EcoRV fragment from pAKC1042 was cloned into the SmaI site ofpCL1920 to produce pAKC1061, which contains plac-rsmBEhg. The 473-bp DNAfragment was amplified by PCR using the KpnI-tagged primer AGGGTACCGTTGCGAAGGAACAGCATG and HindIII-tagged primer AGAAGCTTAAAGGGGGCACTGTATAAACA and template DNA pAKC1043. After digestionwith endonucleases, the DNA fragment was cloned into pCL1920 to producepAKC1062 which carries plac-rsmBEa. Similarly, pAKC1063, which containsplac-rsmB’Ea was constructed by cloning the 326-bp DNA fragment intopCL1920. The DNA fragment was amplified by PCR using the KpnI-taggedprimer AGGGTACCTCTCCAGGATGGAGAAACG and the HindIII-taggedprimer AGAAGCTTAAAGGGGGCACTGTATAAACA and template DNApAKC1043 and digested with endonucleases KpnI and HindIII. To constructpAKC1049 containing plac-rsmBEcc the KpnI-tagged primer AGGGTACCAAGTTAGTAACCGGTTACA and P7 primer GCAAGCTTCTTCACAACGTGGCGCTACAT (21) and template DNA pAKC679 were used for PCR. The 558-bpPCR product was digested with HindIII and KpnI and cloned into pCL1920.

RNA preparation and Northern hybridization. Bacteria were grown in 20 mlof LB or minimal salts medium supplemented with sucrose (0.5%, wt/vol) andappropriate antibiotics at 28°C to a turbidity of ca. 200 Klett units. Total RNAwas then extracted by the method of Aiba et al. (1). The procedure used forNorthern blot analysis was previously described (6, 22).

A 730-bp EcoRI fragment containing pre-etz and etz from pMBL-R.73 (17)was used as a probe. A 695-bp HincII-EcoRV fragment from pAKC1042 wasused as the rsmBEhg probe. A 310-bp PstI-BglII fragment from pAKC1043 wasused as the rsmBEa probe. A 314-bp EcoRV-KpnI fragment from pAKC783 wasused as the pel-1 probe (19). A 743-bp HindIII fragment from pAKC781 wasused as the peh-1 probe (19).

Primer extension analysis and RNase protection assay. Primer extension wasperformed as specified by the manufacturer (Promega Biotec). An aliquot (10pmol) of primer EhgB1 (59-TGCTCAATCCTGAGCGATCCTG-39) (nucleo-tides [nt] 1103 to 1125) or EaP6 (59-CTTCATCCTGAAGCCTGTCCCTG-39)(nt 1214 to 1236) was end labeled with T4 polynucleotide kinase and[g-32P]ATP. A 20-mg portion of total RNA from E. herbicola pv. gypsophilae orE. amylovora and 100 fmol of 32P-labeled primer in 11 ml of primer extensionbuffer were incubated at 58°C for 20 min and cooled for 10 min at roomtemperature for annealing. Reverse transcription reaction was carried out withavian myeloblastosis virus reverse transcriptase at 42°C for 30 min.

The RNase protection assay was carried out as described by Liu et al. (20). The272-bp rsmBEa DNA fragment (corresponding to at 262 to 1194) amplifiedfrom pAKC1043 by PCR using BamHI-tagged primer EaP13 (59-AGGGATCCAATAGCCTAAATAGCCGCTC-39) and XbaI-tagged primer EaP15 (59-AGT

CTAGAATCCTGTTATCATCCATGAACTGCCG-39) was cloned into pBlue-script SK(1) to produce pAKC1044. XbaI-digested pAKC1044 was used as thetemplate for in vitro transcription. The in vitro-synthesized RNA probes werelabeled with [g-32P]UTP by using T7 polymerase as specified by the manufac-turer instructions (Promega Biotec). The DNA template was then removed fromthe RNA probes by DNase treatment. A 20-mg RNA sample from E. amylovorastrain E9 and 105 cpm of RNA probe were incubated in 30 ml of hybridizationbuffer (80% formamide, 40 mM PIPES [pH 6.7], 400 mM NaCl, 1 mM EDTA)overnight at 45°C and then digested with 300 ml of RNase solution (10 mM Tris[pH 7.5], 5 mM EDTA, 300 mM NaCl, 40 mg of RNase A per ml, 2 mg of RNaseT1 per ml) at 30°C for 1 h.

RNA stability assays. Cultures were grown at 28°C in minimal salts mediumplus sucrose (0.5%, wt/vol) and spectinomycin to a turbidity of ca. 160 Klett units,and rifampicin was added to a final concentration of 200 mg/ml. Aliquots (10 ml)were collected at 0, 2.5, 5, 7.5, 10, and 15 min in tubes containing 5 ml ofdiethylpyrocarbonate-treated ice-cold water. Total RNA was extracted by themethod of Aiba et al. (1), and Northern blot analysis was performed by theprocedures described by Chatterjee et al. (6) and Liu et al. (22). After beingwashed, the blots were exposed to X-ray film. The Metamorph imaging system(Universal Imaging Corp.) was used for the densitometric analysis of the auto-radiograms. All experiments were performed three times or more, and the resultswere reproducible.

RNA mobility shift assays. Using primers KpnI-tagged EaP10 (59-AGGGTACCGTTGCGAAGGAACAGCATG-39) and HindIII-tagged EaP12 (59-AGAAGCTTAAAGGGGGCACTGTATAAACA-39) or KpnI-tagged EhgB11 (59-AGGGTACCACTGCAGGAGGCTCAGGAA-39) and HindIII-tagged EhgB12(59-AGAAGCTTAAAGGGAGCACTGTATAAACA-39), the PCR-amplifiedDNA fragment corresponding to nt 11 to 1455 of rsmBEa or nt 11 to 1310 ofrsmBEhg was cloned in pBluescript SK(1) to produce pAKC1045 andpAKC1046. The rsmBEa and rsmBEhg RNA probes were synthesized in vitro fromthe HindIII-digested pAKC1045 and pAKC1046 DNAs by T7 RNA polymerasein the presence of [a-32P]UTP. The RNA-protein interaction was assayed in 20ml of binding buffer (10 mM Tris-acetate [pH 7.5], 10 mM MgCl2, 50 mM NaCl,50 mM KCl, 10 mM dithiothreitol, 5% [wt/vol] glycerol) containing 4000 cpm oflabeled RNA (0.1 ng), with or without purified His6-tagged RsmAEcc and a50-fold excess of unlabeled RNAs or yeast tRNA (Gibco BRL). After incubationfor 30 min at room temperature, the reaction mixtures were loaded on a prerun5% (wt/vol) polyacrylamide gel containing 5% (wt/vol) glycerol at 4°C. Electro-phoresis was continued in 0.53 Tris-borate-EDTA (TBE) running buffer foranother 4 h at 4°C. The gel was dried and exposed to X-ray film.

RESULTS AND DISCUSSION

As stated above, physical evidence has established the pres-ence of rsmA homologs in various enterobacterial species (10).Furthermore, several studies have revealed that rsmA-rsmBand csrA-csrB work together to modulate gene expression in E.carotovora subsp. carotovora and Escherichia coli, respectively(18, 21). However, prior to this work, there was no evidence forRsmA-plus-rsmB-mediated gene regulation beyond these bac-terial species. To alleviate this deficiency, we cloned and char-acterized rsmB genes from two Erwinia species that do notcause soft rot disease, i.e., E. amylovora and E. herbicola pv.gypsophylae, and obtained physical evidence for the occur-rence of rsmB homologs in Erwinia and other enterobacterialspecies.

Cloning of rsmB from E. herbicola pv. gypsophilae strainPD713 and E. amylovora strain E9. To clone the rsmB genes,genomic libraries of E. herbicola pv. gypsophilae strain PD713and E. amylovora strain E9 were transferred by triparentalmatings into E. carotovora subsp. carotovora strain Ecc71 orstrain AC5071 carrying the E9 rsmA1 plasmid, pAKC120 (Ta-ble 1). Transconjugants were screened for protease productionon nutrient gelatin agar medium, and colonies showing higherprotease activity were tested for their levels of pectinase andcellulase activities. The clones showing higher levels of allthese enzymes were presumed to carry rsmB1 plasmids. In this

1872 MA ET AL. J. BACTERIOL.

on Decem


.org/D

ownloaded from

http://jb.asm.org/

manner, we obtained several E9 and PD713 clones which pro-duced elevated levels of enzymatic activities. Plasmid DNAsisolated from these colonies were subsequently analyzed bySouthern blot hybridization under low-stringency conditionsusing the transcribed region of rsmBEcc as the probe. One E9clone and two clones from PD713 hybridized with the probe.By a subcloning and functional assay, the rsmBEhg gene waslocalized in a 1.7-kb HincII DNA fragment and the rsmBEa

gene was localized in a 1.7-kb BamHI DNA fragment.Characterization of the rsmB genes of E. amylovora and E.

herbicola pv. gypsophilae. To gain a better understanding ofthe structure and function of the rsmB genes of E. amylovoraand E. herbicola pv. gypsophilae, we determined the nucleotidesequences of the 1.7-kb BamHI fragment and the 1.7-kb HincIIfragment that contain the E. amylovora rsmB gene (rsmBEa)and the E. herbicola pv. gypsophilae rsmB gene (rsmBEhg),respectively. A homology search revealed that the nucleotidesequences of rsmBEa and rsmBEhg have high similarities tothose of rsmBEcc of E. carotovora subsp. carotovora (21) andcsrB of Escherichia coli (see below and Fig. 1A). Like csrB (18)and rsmBEcc (21), the rsmBEa and rsmBEhg genes contain noapparent open reading frames, suggesting that they encodeRNA regulators rather than protein products.

To characterize rsmB RNAs, we performed Northern blotanalyses. As shown in Fig. 2A, the E. herbicola pv. gypsophilaeprobe hybridized to a 290-base transcript. By contrast, with E9total RNA, we detected two bands of about 300 and 430 bases.To further characterize the transcripts, we performed primerextension analysis (Fig. 2B) and RNase protection assays (datanot shown). Using appropriate oligonucleotide primers, wedetected that the 59 end of rsmBEhg was positioned at a singleadenosine residue and that two 59 ends of the rsmBEa tran-scripts, separated by 133 nt, were localized at the guanosineand thymidine residues, respectively (Fig. 2B). Analysis of the39 sequence revealed that each rsmB RNA species contains astrong stem-loop structure (Fig. 1A), which can function asrho-independent transcription terminators as defined forrsmBEcc (21). Therefore, the sizes of rsmB RNA species,stretching from the 59 ends identified by primer extension orRNase protection assays to their 39 rho-independent termina-tors, are 310 nt for rsmBEhg and 317 and 451 nt for the rsmBEa

RNA species. These observations confirm that E. amylovoraproduces two rsmB transcripts, the shorter one spanning the 39end and the larger one extending further upstream of theshorter one (Fig. 2). We do not know the mechanism under-lying the production of these two rsmB RNA species by E.amylovora. However, extrapolating from the findings withrsmBEcc (21), we consider it most likely that the 451-nt tran-script represents the primary transcript whereas the 317-nttranscript is the processed product of the primary transcript.Since we have not detected sequences resembling typical en-terobacterial promoters upstream of the 59 end of the 317-basetranscript, we consider it unlikely that the 451- and the 317-nttranscripts result from initiation of transcription from differentstart sites.

To determine the minimal size of rsmB required for itsbiological function, we constructed several plac-rsmB plasmids.In these constructs, the rsmB DNA fragments that do not carrythe promoter regions were subcloned into the pCL1920 vector.Similar to the positive control pAKC1049 and pAKC1004 plas-

mids, which contain plac-rsmBEcc and plac-rsmB’Ecc, respec-tively, all of these constructs were able to not only stimulateextracellular Pel production in E. carotovora subsp. carotovorastrain 71 and its RsmA-deficient derivative AC5071 but alsoreverse the negative effect of RsmA on extracellular Pel pro-duction (see Tables 2 and 3). These data allow several conclu-sions; (i) the rsmBEa and rsmBEhg RNA species are biologicallyactive and are responsible for the activation of extracellularenzyme production; (ii) these RNA species specifically actagainst the negative effect of RsmA; and (iii) the putativeprocessed rsmB’Ea RNA species is still active, although it is lessactive than the primary rsmBEa RNA.

Our findings reported here and elsewhere (21) reveal twoclasses of rsmB genes. In one class, the larger primary tran-script presumably is processed to yield a smaller and relativelystable RNA species. The other class comprises the rsmB genesthat yield a small and stable RNA species not subject to pro-cessing. Moreover, based on our findings with strain Ecc71rsmB transcripts (21), we postulate that the primary transcriptbinds more RsmA molecules than the processed rsmB RNAdoes, thereby more effectively lowering the pool of free RsmA.In fact, the analysis of primary and secondary structures ofRNA species (data not shown) clearly shows the availability ofmore putative RsmA binding sites in the primary transcriptthan in the processed RNA.

Analysis of rsmB and csrB RNA sequences. A databasesearch revealed that rsmBEa and rsmBEhg RNA sequences arehomologs of rsmBEcc of E. carotovora subsp. carotovora (21)and csrB of Escherichia coli (18). Alignment of the ribonucle-otide sequences of rsmB from E. carotovora subsp. carotovora,E. herbicola pv. gypsophilae, and E. amylovora, as well as csrB,is shown in Fig. 1A. In addition, phylogram analysis shows thatthe rsmB RNAs of E. amylovora and E. herbicola pv. gyp-sophilae fall into a subgroup, suggesting that rsmBEa andrsmBEhg may be evolutionarily and functionally closer. It alsowas evident that the rsmBEa and rsmBEhg RNAs are geneticallycloser to the csrB RNA than to the rsmBEcc RNA (data notshown). A noteworthy feature is that the homologies amongthese RNAs are higher at their 39 ends than at the 59 ends.While the last 100-base sequence of rsmBEcc is critical for RNAstability, this sequence is not involved in regulating gene ex-pression (21; Y. Liu and A. K. Chatterjee, unpublished data).Therefore, we propose that the 100-base sequence at the 39end, the most highly conserved sequence in the rsmB and csrBRNAs, plays roles in the transcription termination and RNAstability due to its extremely stable stem-loop structure. More-over, this RNA region does not possess the putative sequencesthat can be bound by RsmA and CsrA proteins (see below).

Liu et al. (18) proposed that CsrA binds csrB RNA, mostprobably to the 7-base repeats in the RNA molecules. Therepeats contain the consensus sequence 59-CAGGA(U/C)G-39. Repeats carrying the identical consensus sequence alsohave been found within the rsmBEcc RNA as well as in rsmBEa

RNA and rsmBEhg RNA (Fig. 1A), and there is evidence tosuggest that these can be bound in vitro by purified RsmAEcc

protein (18, 21). However, whether these sequences representthe specific recognition site for CsrA and RsmAEcc proteins isnot known. Also, the significance of the sequences flanking the7-base core sequence is unknown. A comparison of the rsmBand csrB RNA sequences reveals a 34-mer consensus sequence


on Decem


.org/D

ownloaded from

http://jb.asm.org/

FIG. 1.


on Decem


.org/D

ownloaded from

http://jb.asm.org/

in each RNA species (Fig. 3). The 34-mer sequence has thefollowing specific characteristics in addition to the presence ofthe 59-CAGGA(U/C)G-39 sequence in the middle. (i) The34-mer sequence is much longer than the previously deter-mined 7-base 59-CAGGA(U/C)G-39 sequence. (ii) In eachrsmB RNA species, only one copy of this 34-mer sequenceexists, whereas additional 59-CAGGA(U/C)G-39 sequences

are present as multiple modules in every RNA species, i.e., fivecopies in rsmBEhg, eight copies in rsmBEa, and nine copies inrsmBEcc and csrB. (iii) In instances where there is evidence forRNA processing, the 34-mer consensus sequence occurs in thersmB9 RNA species, the 39-end processed product of the pri-mary transcripts. In Ecc71, the rsmB9 RNA, rather than the 59region, is responsible for the regulatory role of rsmB RNA, i.e.,the activation of exoprotein production (21). (iv) The 34-merconsensus sequence is predicted to carry a conserved second-ary structure consisting of a 4-nt stem and a 5-nt [59-AGGAA(U/C)-39] loop (Fig. 3). Based on the specific features of the34-mer consensus sequence, we propose this motif as the sig-nature sequence for the growing rsmB/csrB regulatory RNAfamily. Indeed, a database search using the 34-mer consensus

FIG. 2. (A) Northern blot analysis of rsmB transcripts of E. herbi-cola pv. gypsophilae strain PD713 (lane 1) and E. amylovora strain E9(lane 2). The positions of two rsmB transcripts of E9 are indicated byarrows. (B) Primer extension analysis of the 59 ends of rsmB transcriptsfrom E. herbicola pv. gypsophilae strain PD713 (a) and E. amylovorastrain E9 (b). The portions of sequences pertinent to the 59 ends areshown. The A residue in lane P1 is identified as the 59 end of rsmBmRNA of PD713; the G and T residues in lane P2 are indicated as thetwo 59 ends of rsmB mRNA of E9.

FIG. 3. Alignment of the 34-mer consensus sequences in the rsmBRNA species of E. amylovora strain E9 (Ea), E. carotovora subsp.carotovora strain Ecc71 (Ecc), E. herbicola pv. gypsophilae strainPD713 (Ehg), and csrB RNA of Escherichia coli (Eco), and S. entericaserovar Typhimurium (Sty). Positions refer to the nucleotide se-quences relative to the 59 of rsmB9 of E. amylovora and E. carotovorasubsp. carotovora and 59 of rsmB of E. herbicola pv. gypsophilae, Esch-erichia coli, and S. enterica serovar Typhimurium. Inverted arrowsindicate the 4-nt stems of the stem-loop structure. The identical nu-cleotides of the 7-base repeats are in boldface type.

FIG. 1. (A) Alignment of the ribonucleotide sequences of rsmB genes from E. amylovora strain E9 (Ea), E. herbicola pv. gypsophilae strainPD713 (Ehg), E. carotovora subsp. carotovora strain Ecc71(Ecc), and csrB from Escherichia coli. Asterisks indicate identical amino acids, and dotsindicate conserved substitutions. Arrows indicate the processed start sites of rsmBEa RNA and rsmBEcc RNA. The 34-mer consensus sequences inrsmB are shown against shaded backgrounds. The 7-base repeats are in boldface type. (B) Alignment of the deduced amino acid sequence of RsmAfrom E. herbicola pv. gypsophilae strain PD713, E. amylovora strain E9, E. carotovora subsp. carotovora strain Ecc71, and CsrA from Escherichiacoli.


on Decem


.org/D

ownloaded from

http://jb.asm.org/

sequence revealed a single motif in the putative rsmB/csrBhomolog of S. enterica serovar Typhimurium (accession num-ber, gi 5730336) (Fig. 3 csrBSty). Furthermore, to test the pro-posal that the 34-mer motif is present in every rsmB homolog,degenerate primers were designed to be complementary to thenucleotide sequences within the 34-mer motif and to the 39terminator region. PCR analysis revealed amplification ofrsmB DNA fragments from Serratia marcescens, Shigella flex-neri, and Enterobacter aerogenes; moreover, nucleotide se-quence analysis confirmed that each PCR product carried one34-mer motif (W. L. Ma and A. K. Chatterjee, unpublisheddata). These structural characteristics suggest that the 34-mersequence represents an ancient motif arising prior to the evo-lutionary separation of the genera tested and that this motif isimportant for the basic biological function of the rsmB/csrBRNA regulator.

Effects of rsmBEhg in E. herbicola pv. gypsophilae and E.carotovora subsp. carotovora. To determine the effects of mul-tiple copies of rsmBEhg, pAKC1042 containing the rsmB geneor the vector pCL1920 was transformed into E. herbicola pv.gypsophilae strain PD713 and E. carotovora subsp. carotovorastrain Ecc71. The E. herbicola pv. gypsophilae constructs weretested for extracellular polysaccharide production and motility.As shown in Fig. 4A, columns 1 and 2, multiple copies ofrsmBEhg activate EPS production and stimulate swarming mo-tility in E. herbicola pv. gypsophilae strain PD713. Previousstudies have shown that rsmBEcc activates pathogenicity factorproduction (21, 28). To ascertain if rsmBEhg would affectpathogenicity factors, such as phytohormones, we performedNorthern blot analysis of the cytokinin (etz) genes in the E.herbicola pv. gypsophilae constructs. Total RNA samples ofPD713 carrying pCL1920 or its rsmBEhg

1 derivative were hy-bridized with pre-etz plus etz (17) as the probe. The resultsshow that two RNA bands of 1.4 and 1.0 kb hybridized with theprobe, consistent with the previously reported pre-etz plus etzRNA profile of PD713 (17). Also, the levels of pre-etz and etztranscripts were higher with multiple copies of rsmBEhg thanwith the vector control (Fig. 4B).

E. carotovora subsp. carotovora strain Ecc71 carrying the

rsmBEhg1 plasmid or the cloning vector was tested for extra-

cellular enzyme production. The bacteria were grown in min-imal salts medium supplemented with sucrose (0.5%, wt/vol)and spectinomycin, and the culture supernatants were assayedfor Pel, polygalacturonase (Peh), protease (Prt) and cellulase(Cel) activities. Figure 5 (columns 1 and 2) shows that Ecc71carrying the rsmBEhg

1 plasmid produced higher levels of Pel,Peh, Prt, and Cel than did Ecc71 carrying the cloning vectorpCL1920. The effects of rsmBEhg in both homologous andheterologous systems indicate that rsmBEhg is functionally sim-ilar to rsmBEcc (21) (Table 3).

Effects of rsmBEa in E. amylovora and E. carotovora subsp.carotovora. In studies similar to that with rsmBEhg describedabove, we determined the effects of multiple copies of rsmBEa

gene in E. amylovora and E. carotovora subsp. carotovora. ThersmBEa

1 plasmid, pAKC1043, or the cloning vector, pCL1920,was transformed into E. amylovora strain E9 and E. carotovorasubsp. carotovora strain Ecc71. The E. amylovora constructswere tested for EPS production, motility, and pathogenicity onapple shoots. As shown in Fig. 6A (columns 1 and 2), E.amylovora E9 carrying multiple copies of rsmBEa producedcopious amounts of EPS compared to E9 carrying the vector.The bacteria carrying pAKC1043 also were more motile onsemisolid agar medium. Furthermore, compared to E9 carry-ing pCL1920, E9 carrying the rsmBEa

1 plasmid wilted appleshoots in a shorter time (data not shown). Like the rsmBEhg

gene, rsmBEa activated the production of Pel, Peh, Cel, and Prtin E. carotovora subsp. carotovora strain Ecc71 (data notshown).

Neutralization of RsmA by rsmB. Since rsmBEcc neutralizesthe effect of RsmA in E. carotovora subsp. carotovora (21) andcsrB neutralizes the effect of CsrA in Escherichia coli (18), itwas of interest to determine if the rsmB genes of E. amylovoraand E. herbicola pv. gypsophilae also antagonize their ownRsmA-like factors. For this propose, we cloned and sequencedthe rsmA genes from E. amylovora strain E9 and E. herbicolapv. gypsophilae strain PD713. Analysis of the nucleotide se-

FIG. 4. Effects of multiple copies of rsmBEhg and rsmAEhg in E.herbicola pv. gypsophilae strain PD713. (A) EPS production and mo-tility of E. herbicola pv. gypsophilae strain PD713 carrying pCL1920(cloning vector, column 1), pAKC1042 (rsmBEhg

1, column 2), orpAKC891 (RsmAEhg

1, column 3). (B) Northern blot analysis showingmultiple-copy effects of rsmAEhg and rsmBEhg on etz (cytokinin gene)transcripts in E. herbicola pv. gypsophilae strain PD713. Lanes: 1,PD713/pCL1920; 2, PD713/pAKC891; 3, PD713/pAKC1042. Eachlane contained 15 mg of total RNA.

FIG. 5. Effects of multiple copies of rsmBEhg and rsmAEhg on ex-tracellular enzyme production in E. carotovora subsp. carotovora strainEcc71. Ecc71 carrying the cloning vector pCL1920 (column 1),pAKC1042 (rsmBEhg

1, column 2), or pAKC891 (RsmAEhg1, column

3) were grown in minimal salts medium plus sucrose (0.5%, wt/vol) andspectinomycin to a turbidity of ca. 200 Klett units, and the culturesupernatant was used for an agarose plate assay of Pel, Peh, Prt, andCel activities. Each well contained 20 ml of culture supernatant.


on Decem


.org/D

ownloaded from

http://jb.asm.org/

quences of the two rsmA genes revealed that 183-bp openreading frames encode the putative RsmAEhg and RsmAEa

proteins, each consisting of 61 amino acid residues. A homol-ogy search disclosed that RsmAEhg and RsmAEa have 93 and95% identity to RsmAEcc, respectively (Fig. 1B). In E. caroto-vora subsp. carotovora strain Ecc71, the RsmAEhg

1 plasmidpAKC891 repressed extracellular enzyme (Pel, Peh, Cel, andPrt) production as determined by agarose plate assays (Fig. 5,column 3, shows the suppressive effect of rsmAEhg). In addi-tion, in E. herbicola pv. gypsophilae strain PD713, theRsmAEhg

1 plasmid pAKC891 repressed EPS production, mo-tility, and the levels of cytokinin transcripts (Fig. 4A, columns1 and 3, and Fig. 4B). Similarly, RsmAEa1 plasmid pAKC893suppressed motility on semisolid medium and suppressed EPSproduction (Fig. 6A, columns 1 and 3) in E. amylovora strainE9. Moreover, E. amylovora strain E9 carrying rsmAEa cosmidpAKC120 was nonpathogenic in apple shoots (Fig. 6B). SinceRsmAEhg and RsmAEa promote pel-1 and peh-1 mRNA deg-radation in E. carotovora subsp. carotovora RsmA strainAC5071 (Fig. 7), it is most likely that, like RsmAEcc and CsrA,these RsmA species also affect mRNA stability and conse-quently the cognate phenotypes.

The cloning of both the rsmA and rsmB genes of E. amylo-vora strain E9 and E. herbicola pv. gypsophilae strain PD713and the availability of a well-characterized RsmA2 strain of E.carotovora subsp. carotovora (AC5071) made it possible for usto test the interaction of these genes. Each of the AC5071derivatives carrying rsmAEcc, rsmAEa or rsmAEhg was trans-formed with pAKC1004 (plac-rsmB9Ecc), pAKC1049 (plac-rsmBEcc), pAKC1062 (plac-rsmBEa), pAKC1063 (plac-rsmB9Ea), pAKC1061 (plac-rsmBEhg), or vector pCL1920. Thebacterial constructs were assayed for extracellular Pel activity.The data in Table 2 show that the three rsmB genes couldreverse the repressive effects of all the rsmA species; i.e., thegenes are functional in heterologous systems. However, theefficiency of reversal of rsmB varies depending on the source ofthe rsmA species. While rsmBEcc RNA was most effective in

reversing the effect of RsmAEcc, it was least effective in neu-tralizing the effects of RsmAEa or RsmAEhg. On the otherhand, each of these RsmA species was more effectively neu-tralized by the cognate rsmB RNA species. These observationsimply a degree of specificity in RsmA-rsmB interaction. In thiscontext, it is perhaps significant that rsmBEa and rsmBEhg RNAspecies belong to the same subgroup whereas rsmBEcc RNAbelongs to another subgroup genetically distant from rsmBEa

and rsmBEhg RNAs. These observations raise the possibilitythat structural differences among the three rsmB RNA speciescould account for the differential effects of rsmB RNAs onRsmA species. Table 2 also shows that in the RsmAEcc2 back-ground, the suppressive effect on Pel production by the threersmA species varied: rsmAEcc was most suppressive, followedby rsmAEa and then rsmAEhg. However, genetic variationamong the three RsmA proteins is minor, with alterationsmostly occurring within the last 6 amino acid residues within

FIG. 6. Effects of multiple copies of rsmBEa and rsmAEa in E. amy-lovora strain E9. (A) EPS production and motility of E. amylovorastrain E9 carrying pCL1920 (cloning vector, column 1), pAKC1043(rsmBEa

1, column 2), or pAKC893 (RsmAEa1, column 3). (B) Patho-

genicity of E. amylovora strain E9 carrying the cloning vector pSF6(B1) and the rsmAEa

1 plasmid pAKC120 (B2). E. amylovora strain E9carrying the vector pSF6 caused the apple shoots to bent down andwilt, whereas E9 carrying the rsmAEa

1 plasmid pAKC120 was non-pathogenic in apple shoots.

FIG. 7. mRNA stability of pel-1 and peh-1 in E. carotovora subsp.carotovora strain AC5071 (RsmA2) carrying pCL1920 (cloning vector,row a), pAKC891 (RsmAEhg

1, row b), pAKC893 (RsmAEa1, row c),

or pAKC880 (RsmAEcc1, row d). Rifampin (200 mg/ml) was added to

the cultures at a turbidity of ca.160 Klett units, and RNA was extractedat 0 min (lane 1), 2.5 min (lane 2), 5 min (lane 3), 7.5 min (lane 4), 10min (lane 5), and 15 min (lane 6). Northern hybridization was per-formed at 65°C with [a-P32]dATP-labeled pel-1 and peh-1 probes. Eachlane in row a contained 5 mg of total RNA, and each lane in rows b, c,and d contained 30 mg of total RNA. The blots were exposed to X-rayfilm for 24 h and analyzed by densitometric scanning. The densitomet-ric results (percentage of remaining mRNA) were plotted against timeafter rifampin treatment. The circles, squares, triangles, and diamondsrepresent AC5071 carrying pCL1920, pAKC891, pAKC893, orpAKC880, respectively.


on Decem


.org/D

ownloaded from

http://jb.asm.org/

their C-terminal regions (Fig. 1B). It remains to be determinedif the variations in RsmA proteins affect the binding specificityof rsmB RNAs. However, we prefer the view that the differ-ences among these rsmB RNA species probably determine theefficiency of interactions with RsmA species and the conse-quent extracellular Pel production. In addition, these differ-ences in RNA may affect the RsmA-independent regulatorypathway(s) through which rsmB acts to regulate gene expres-sion (21).

To ascertain that the rsmB effects were mediated via RsmA,we compared the effects of plasmids carrying the rsmB genes inRsmA1 and RsmA2 strains of E. carotovora subsp. carotovora.The data (Table 3) show that rsmBEa and rsmBEhg better stim-ulated enzyme production in RsmA1 bacteria than in theRsmA2 strain. In RsmA2 bacteria, the degrees of stimulationof Pel production were three- and twofold, which contrasts

with six- and ninefold stimulation of Pel production in RsmA1

bacteria by the rsmBEa and rsmBEhg genes. Generally similareffects were seen with rsmBEcc, although the degree of stimu-lation in RsmA1 bacteria was much higher with this gene(80-fold stimulation) than with the rsmB genes from E. amy-lovora (6-fold stimulation) or E. herbicola pv. gypsophilae (9-fold stimulation). These differences notwithstanding, the dataallow the conclusion that rsmB activates gene expression byneutralizing the RsmA effect. However, these results also in-dicate that rsmB RNA species play an additional regulatoryrole in the activation of extracellular enzyme production, whichis RsmA independent.

rsmB RNAs bind RsmAEcc. Previous studies with Escherichiacoli and E. carotovora subsp. carotovora have shown thatRsmA/CsrA binds rsmB RNA/csrB RNA (18, 21). Subsequentstudies with E. carotovora subsp. carotovora have established

TABLE 2. Reversal of negative effects of rsmA on extracellular Pel production by rsmB in RsmA2 strain AC5071of E. carotovora subsp. carotovora

Bacterial constructa Relevant genotype Pel activityb (1022) Relative activity

AC5071/pAKC878 1 pCL1920 rsmAEcc 1 vector 0.32 6 0.01 1.01 pAKC1049 rsmAEcc 1 plac-rsmBEcc 14.4 6 1.19 45.01 pAKC1004 rsmAEcc 1 plac-rsmB9Ecc 2.46 6 0.06 7.61 pAKC1061 rsmAEcc 1 plac-rsmBEhg 2.38 6 0.013 7.41 pAKC1062 rsmAEcc 1 plac-rsmBEa 1.88 6 0.07 5.81 pAKC1063 rsmAEcc 1 plac-rsmB9Ea 1.63 6 0.04 5.0

AC5071/pAKC892 1 pCL1920 rsmAEhg 1 vector 8.63 6 0.45 1.01 pAKC1049 rsmAEhg 1 plac-rsmBEcc 14.8 6 0.4 1.71 pAKC1004 rsmAEhg 1 plac-rsmB9Ecc 11.03 6 0.25 1.21 pAKC1061 rsmAEhg 1 plac-rsmBEhg 196.33 6 6.6 22.71 pAKC1043 rsmAEhg 1 plac-rsmBEa 110.83 6 10.9 12.71 pAKC679 rsmAEhg 1 plac-rsmB9Ea 21.47 6 0.37 2.5

AC5071/pAKC894 1 pCL1920 rsmAEa 1 vector 12.67 6 0.57 1.01 pAKC1049 rsmAEa 1 plac-rsmBEcc 18.3 6 1.4 1.51 pAKC1004 rsmAEa 1 plac-rsmB9Ecc 16.06 6 0.4 1.21 pAKC1061 rsmAEa 1 plac-rsmBEhg 70.7 6 4.6 5.61 pAKC1043 rsmAEa 1 plac-rsmBEa 152.17 6 7.5 121 pAKC679 rsmAEa 1 plac-rsmB9Ea 99.42 6 4.8 7.8

a Strains were grown at 28°C in minimal salts medium plus sucrose (0.5%, wt/vol) to an absorbance at 600 nm of 2.3, and the culture supernatants were assayed forenzymatic activities.

b Pel activity is expressed as units per absorbance unit of culture at 600 nm.

TABLE 3. Multiple-copy effects of rsmB on extracellular Pel production in E. carotovora subsp. carotovora strains Ecc71 (RsmA1)and AC5071 (RsmA2)

Bacterial constructa Relevant phenotype Pel activityb (1022) Relative activity

Ecc71/pCL1920 RsmA1/vector 6.6 6 0.6 1.0Ecc71/pAKC1049 RsmA1/plac-rsmBEcc 532 6 6.5 80.6Ecc71/pAKC1004 RsmA1/plac-rsmB9Ecc 149.2 6 4.2 22.6Ecc71/pAKC1061 RsmA1/plac-rsmBEhg 64.3 6 1.6 9.7Ecc71/pAKC1062 RsmA1/plac-rsmB9Ea 41.9 6 1.5 6.3Ecc71/pAKC1063 RsmA1/plac-rsmB9Ea 17.9 6 0.2 2.7

AC5071/pCL1920 RsmA2/vector 212.2 6 4.3 1.0AC5071/pAKC1049 RsmA2/plac-rsmBEcc 903.6 6 3.5 4.2AC5071/pAKC1004 RsmA2/plac-rsmB9Ecc 764 6 12 4.0AC5071/pAKC1061 RsmA2/plac-rsmBEhg 502.6 6 11 2.4AC5071/pAKC1062 RsmA2/plac-rsmBEa 725.6 6 6.8 3.4AC5071/pAKC1063 RsmA2/plac-rsmB9Ea 562 6 5.5 2.7

a Strains were grown at 28°C in minimal salts medium plus sucrose (0.5%, wt/vol) and spectinomycin to an absorbance at 600 nm of 2.3, and the culture supernatantswere assayed for enzymatic activities.

b Pel activity is expressed as units per absorbance unit of culture at 600 nm.


on Decem


.org/D

ownloaded from

http://jb.asm.org/

that most of the regulatory effect of rsmB is channeled viaRsmA. In light of the effects of rsmBEa and rsmBEhg onRsmAEcc, we considered it important to determine if RsmAEcc

binds these rsmB RNA species. The results of gel mobility shiftassays (Fig. 8) show that the purified RsmAEcc protein bindseach of those two rsmB RNA species. The RsmAEcc-rsmBbinding was prevented by the addition of excess unlabeledRNA to the reaction mixture (Fig. 8, lanes 3 and 7). In addi-tion, in vitro studies suggest specificity in the binding ofRsmAEcc and these rsmB RNA species, since yeast tRNA hadno effect on this binding (lanes 4 and 8).

Occurrence of rsmB homologs in Erwinia species and otherenterobacteria. It has been established that rsmA occurs inenterobacteria and P. aeruginosa (38) and perhaps even inother bacteria such as Bacillus subtilis and Haemophilus influ-enzae (12, 35). Our previous findings (28) have revealed thatrsmBEcc (formerly aepH) occurs in E. carotovora subsp. caro-tovora and E. carotovora subsp. atroseptica strains. To examineif an rsmB homolog occurs in other Erwinia and enterobacte-rial species, we conducted Southern hybridizations with thersmB probe from E. herbicola pv. gypsophilae strain PD713.The data (Fig. 9) show that rsmBEhg hybridized to all Erwiniaand other enterobacterial species tested, indicating the pres-ence of rsmB homologs in these bacteria. To further strengthenthis physical evidence, we used E. coli csrB as the probe. Thesame size bands that hybridized with the rsmBEa probe alsohybridized with the csrB probe (data not shown). These datademonstrate that rsmB sequences have been conserved inthese bacteria. However, the differences in the sizes of thehybridizing fragments suggest that sequences of the rsmB-likegenes and the DNA flanking them may have diverged.

In conclusion, we have characterized the rsmB genes clonedfrom E. amylovora and E. herbicola pv. gypsophilae. Thesegenes have high levels of genetic, structural, and functionalhomology among themselves and to that of E. carotovorasubsp. carotovora. The suppression of EPS production andpathogenicity of E. amylovora by RsmAEa, the inhibition ofexpression of a cytokinin gene in E. herbicola pv. gypsophilaeby RsmAEhg, and the reversal of the negative effects of theRsmA species by the rsmB genes in E. carotovora subsp. ca-rotovora demonstrate that the rsmA-rsmB pairs play importantregulatory roles in these bacteria. The fully conserved KHmotifs in putative products of these rsmA genes strongly sug-gest that RsmAEa and RsmAEhg, like RsmAEcc, bind RNAspecies. Indeed, studies with the pel and peh genes suggest thatRsmAEhg and RsmAEa affect mRNA stability, most probablyby binding and promoting mRNA decay. rsmBEhg and rsmBEa

counteract the RsmA effects, probably by reducing the pool offree RsmA due to the formation of a biologically inactiveRsmA-rsmB ribonucleoprotein complex. The occurrence ofrsmB homologs in all enterobacterial species included in thisstudy strongly suggests that many more bacteria employ thisregulatory system to modulate their gene expression. This isclearly supported by the pleiotropic effect of RsmA of P.aeruginosa and P. fluorescens (3). Our work has also raisedseveral other issues that await clarification. For example, whatis the teleological significance of the processing of rsmB tran-scripts in some bacteria but not in others? Does RsmA bindingprime RNAs for degradation by nucleases? Does RsmA act inconjunction with other factors which are responsible for thedecay of specific transcripts? Since the RsmA-rsmB pair con-trols many factors important in bacterial ecology and in theproduction of useful metabolites, we expect that these andother issues will be resolved in the near future.

FIG. 8. RNA mobility shift assay for binding of RsmAEcc to thersmB RNAs. rsmB RNA probes of E. herbicola pv. gypsophilae and E.amylovora were synthesized from pAKC1046 and pAKC1045 in vitroby T7 RNA polymerase in the presence of [a-32P]-UTP. LabeledRNAs (0.1 ng, 4,000 cpm) were incubated without RsmA, with 5.0 ngof affinity-purified RsmA, with 5.0 ng of affinity-purified RsmA in thepresence of a 50-fold excess of unlabeled probes, or with 5.0 ng ofaffinity-purified RsmA in the presence of a 50-fold excess of yeasttRNA. Lanes: 1, labeled rsmBEa RNA; 2, labeled rsmBEa RNA plusRsmAEcc; 3, labeled rsmBEa RNA plus RsmAEcc plus 50-fold unla-beled rsmBEa RNA; 4, labeled rsmBEa RNA plus RsmAEcc plus 50-foldyeast tRNA; 5, labeled rsmBEhg RNA; 6, labeled rsmBEhg RNA plusRsmAEcc; 7, labeled rsmBEhg RNA plus RsmAEcc plus 50-fold unla-beled rsmBEhg RNA; 8, labeled rsmBEhg RNA plus RsmAEcc plus50-fold yeast tRNA.

FIG. 9. Southern hybridization of EcoRI-digested chromosomalDNAs of Erwinia and other enterobacterial strains with rsmB of E.herbicola pv. gypsophilae strain PD713. Lanes: 1, E. chrysanthemi strainEc16; 2, E. amylovora strain E9; 3, E. herbicola strain EH105; 4, E.herbicola pv. gypsophilae strain PD713; 5, E. rhapontici strain Erl; 6, E.stewartii strain DC283; 7, Escherichia coli strain K-12; 8, S. entericaserovar Typhimurium strain LT2; 9, Serratia marcescens strain Sm1; 10,Yersinia pseudotuberculosis strain Yp1; 11, Shigella flexneri strain Sf1;12, Enterobacter aerogenes strain Ena1; 13, Klebsiella pneumoniae strainKp1. Southern hybridization was performed at 65°C. The blot waswashed in 23 SSC (13 SSC is 0.15 M NaCl plus 0.015 M sodiumcitrate) for 15 min at room temperature followed by 30 min in 23SSC–0.1% sodium dodecyl sulfate at 65°C. A 500-bp HincII-EcoRVfragment from pAKC1042 was used as the rsmBEhg probe.


on Decem


.org/D

ownloaded from

http://jb.asm.org/

ACKNOWLEDGMENTS

Our work was supported by the National Science Foundation (grantMCB-9728505) and the Food for the 21st Century program of theUniversity of Missouri.

We thank S. Manulis for E. herbicola pv. gypsophilae strains and theetz plasmid, and we thank Jeanne Erickson and Judy D. Wall forreviewing the manuscript.

REFERENCES

1. Aiba, H., S. Adhya, and B. de Crombrugghe. 1981. Evidence for two func-tional gal promoters in intact Escherichia coli. J. Biol. Chem. 256:111905–11910.

2. Barras, F., K. K. Thurn, and A. K. Chatterjee. 1987. Resolution of fourpectate lyase structural genes of Erweinia chrysanthemi (EC16) and charac-terization of the enzymes produced in Escherichia coli. Mol. Gen. Genet.209:319–325.

3. Blumer, C., S. Heeb, G. Pessi, and D. Haas. 1999. Global GacA-steeredcontrol of cyanide and exoprotease production in Pseudomonas fluorescensinvolves specific ribosome binding sites. Proc. Natl. Acad. Aci. USA 96:14073–14078.

4. Bugert, P., and K. Geider. 1995. Molecular analysis of the ams operonrequired for exopolysaccharide synthesis of Erwinia amylovora. Mol. Micro-biol. 15:917–933.

5. Chatterjee, A., Y. Liu, C. K. Dumenyo, and A. K. Chatterjee. 1995. Inacti-vation of rsmA leads to overproduction of extracellular pectinases, cellulases,and proteases in Erwinia carotovora subsp. carotovora in the absence of thestarvation/cell density-sensing signal, N-(3-oxohexanoyl)-L-homoserine lac-tone. Appl. Environ. Microbiol. 61:1959–1967.

6. Chatterjee, A., J. L. McEvoy, J. P. Chambost, F. Blasco, and A. K. Chatter-jee. 1991. Nucleotide sequence and molecular characterization of pnlA, thestructural gene for damage-inducible pectin lyase of Erwinia carotovorasubsp. carotovora 71. J. Bacteriol. 173:1765–1769.

7. Chatterjee, A. K., G. E. Buchanan, M. K. Behrens, and M. P. Starr. 1979.Synthesis and excretion of polygalacturonic acid trans-eliminase in Erwinia,Yersinia, and Klebsiella species. Can. J. Microbiol. 25:94–102.

8. Chatterjee, A. K., K. K. Thurn, and D. J. Tyrell. 1985. Isolation and char-acterization of Tn5 insertion mutants of Erwinia chrysanthemi that are defi-cient in polygalacturonate catabolic enzymes oligogalacturonate lyase and3-deoxy-D-glycero-2,5-hexodiulosonate dehydrogenase. J. Bacteriol. 162:708–714.

9. Cotter, P. A., and J. F. Miller. 1998. In vivo and ex vivo regulation of bacterialvirulence gene expression. Curr. Opin. Microbiol. 1:17–26.

10. Cui, Y., A. Chatterjee, Y. Liu, C. K. Dumenyo, and A. K. Chatterjee. 1995.Identification of a global repressor gene, rsmA, of Erwinia carotovora subsp.carotovora that controls extracellular enzymes, N-(3-oxohexanoyl)-L-homo-serine lactone, and pathogenicity in soft-rotting Erwinia spp. J. Bacteriol.177:5108–5115.

11. Cui, Y., A. Mukherjee, C. K. Dumenyo, Y. Liu, and A. K. Chatterjee. 1999.rsmC of the soft-rotting bacterium Erwinia carotovora subsp. carotovoranegatively controls extracellular enzyme and harpinEcc production and vir-ulence by modulating levels of regulatory RNA (rsmB) and RNA-bindingprotein (RsmA). J. Bacteriol. 181:6042–6052.

12. Fleischmann, R. D., M. D. Adams, O. White, R. A. Clayton, E. F. Kirkness,A. R. Kerlavage, C. J. Bult, J.-F. Tomb, B. A. Dougherty, J. M. Merrick, K.McKenney, G. Sutton, W. Fitzhugh, C. A. Fields, J. D. Gocayne, J. D. Scott,R. Shirley, L.-I. Liu, A. Glodek, J. M. Kelley, J. F. Weidman, C. A. Phillips,T. Spriggs, E. Hedblom, M. D. Cotton, T. R. Utterback, M. C. Hanna, D. T.Nguyen, D. M. Saudek, R. C. Brandon, L. D. Fine, J. L. Fritchman, J. L.Fuhrmann, N. S. M. Geoghagen, C. L. Gnehm, L. A. McDonald, K. V. Small,C. M. Fraser, H. O. Smith, and J. C. Venter. 1995. Whole-genome randomsequencing and assembly of Haemophilus influenzae Rd. Science 269:496–512.

13. Grant, M., and J. Mansfield. 1999. Early events in host-pathogen interac-tions. Curr. Opin. Plant Biol. 2:312–319.

14. Hauben, L., E. R. B. Moore, L. Vauterin, M. Steenackers, J. Mergaert, L.Verdonck, and J. Swings. 1998. Phylogenetic position of phytopathogenswithin the Enterobacteriaceae. Syst. Appl. Microbiol. 21:384–397.

15. Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improvedbroad-host-range plasmids for DNA cloning in Gram negative bacteria.Gene. 70:191–197.

16. Lerner, C. G., and M. Inouye. 1990. Low copy number pasmids for regulatedlow-level expression of cloned genes in Escherichia coli with blue/white insetscreening capability. Gene 18:4631.

17. Lichter, A., I. Barash, L. Valinsky, and S. Manulis. 1995. The genes involvedin cytokinin biosynthesis in Erwinia herbicola pv. gypsophilae: characteriza-tion and role in gall formation. J. Bacteriol. 177:4457–4465.

18. Liu, M. Y., G. Gui, B. Wei, J. F. Preston III, L. Oakford, U. Yueksel, D. P.

Giedroc, and T. Romeo. 1997. The RNA molecule CsrB binds to the globalregulatory protein CsrA and antagonizes its activity in Escherichia coli.J. Biol. Chem. 272:17502–17510.

19. Liu, Y., A. Chatterjee, and A. K. Chatterjee. 1994. Nucleotide sequence andexpression of a novel pectate lyase gene (pel-3) and a closely linked endopo-lygalacturonase gene (peh-l) of Erwinia carotovora subsp. carotovora 71.Appl. Environ. Microbiol. 60:2545–2552.

20. Liu, Y., A. Chatterjee, and A. K. Chatterjee. 1994. Nucleotide sequence,organization and expression of rdgA and rdgB genes that regulate pectin lyaseproduction in the plant pathogenic bacterium Erwinia carotovora subsp.carotovora in response to DNA-damaging agents. Mol. Microbiol. 14:999–1010.

21. Liu, Y., Y. Cui, A. Mukherjee, and A. K. Chatterjee. 1998. Characterizationof a novel RNA regulator of Erwinia carotovora ssp. carotovora that controlsproduction of extracellular enzymes and secondary metabolites. Mol. Micro-biol. 29:219–234.

22. Liu, Y., H. Murata, A. Chatterjee, and A. K. Chatterjee. 1993. Character-ization of a novel regulatory gene aepA that controls extracellular enzymeproduction in the phytopathogenic bacterium Erwinia carotovora ssp caroto-vora. Mol. Plant-Microbe Interact. 6:299–308.

23. Manulis, S., A. Havivchesner, M. T. Brandl, S. E. Lindow, and I. Barash.1998. Differential involvement of indole-3-acetic acid biosynthetic pathwaysin pathogenicity and epiphytic fitness of Erwinia herbicola pv. gypsophilae.Mol. Plant-Microbe Interact. 11:634–642.

24. McEvoy, J. L., H. Murata, and A. K. Chatterjee. 1990. Molecular cloning andcharacterization of an Erwinia carotovora subsp. carotovora pectin lyase genethat responds to DNA-damaging agents. J. Bacteriol. 172:3284–3289.

25. Mukherjee, A., Y. Cui, Y. Liu, and A. K. Chatterjee. 1997. Molecular char-acterization and expression of the Erwinia carotovora hrpNEcc gene, whichencodes an elicitor of the hypersensitive reaction. Mol. Plant-Microbe In-teract. 10:462–71.

26. Mukherjee, A., Y. Cui, Y. Liu, C. K. Dumenyo, and A. K. Chatterjee. 1996.Global regulation in Erwinia species by Erwinia carotovora rsmA, a homo-logue of Escherichia coli csrA: repression of secondary metabolites, patho-genicity and hypersensitive reaction. Microbiology 142:427–434.

27. Mukherjee, A., Y. Cui, W. Ma, Y. Liu, and A. K. Chatterjee. 2000. hexA ofErwinia carotovora ssp. carotovora strain Ecc71 negatively regulates produc-tion of RpoS and rsmB RNA, a global regulator of extracellular proteins,plant virulence and the quorum sensing signal, N-(3-oxohexanoyl)-L-homo-serine lactone. Environ. Microbiol. 2:203–215.

28. Murata, H., A. Chatterjee, Y. Liu, and A. K. Chatterjee. 1994. Regulation ofthe production of extracellular pectinase, cellulase, and protease in the softrot bacterium Erwinia carotovora subsp. carotovora: evidence that aepH of E.carotovora subsp. carotovora 71 activates gene expression in E. carotovorasubsp. carotovora, E. carotovora subsp. atroseptica, and Escherichia coli. Appl.Environ. Microbiol. 60:3150–3159.

29. Murata, H., J. L. McEvoy, A. Chatterjee, A. Collmer, and A. K. Chatterjee.1991. Molecular cloning of an aepA gene that activates production of extra-cellular pectolytic, cellulolytic, and proteolytic enzymes in Erwinia carotovorasubsp. carotovora. Mol. Plant-Microbe Interact. 4:239–246.

30. Musco, G., G. Stier, C. Joseph, M. A. C. Morelli, M. Nilges, T. J. Gibson, andA. Pastore. 1996. Three-dimensional structure and stability of the KH do-main—molecular insights into the fragile X syndrome. Cell 85:237–245.

31. Perombelon, M. C. M. 1992. The genus Erwinia, p. 2899–2921. In A. Balows,H. G. Truper, M. Dworkin, and K.-H. Schleifer (ed.), The prokaryotes: ahandbook on the biology of bacteria. Ecophysiology, isolation, identification,applications. Springer-Verlag. New York, N.Y.

32. Politis, D., and R. N. Goodman. 1980. Fine structure of extracellular poly-saccharide of Erwinia amylovora. Appl. Environ. Microbiol. 40:596–607.

33. Romeo, T. 1998. Global regulation by the small RNA-binding protein CsrAand the non-coding RNA molecule CsrB. Mol. Microbiol. 29:1321–1330.

34. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Habor, N.Y.

35. Seldo, B., V. Lazarevic, C. Mauel, and D. Karamata. 1996. Sequence of the305 degrees-307 degrees region of the Bacillus subtilis chromosome. Micro-biology 142:3079–3088.

36. Selvaraj, G., Y. C. Fong, and V. N. Iyer. 1984. A portable DNA sequencecarrying the cohesive site (cos) of the bacteriophage lambda and the mob(mobilization) region of the broad-host-range plasmid RK2: a module forthe construction of new cosmids. Gene 32:235–241.

37. Thurn, K. K., and A. K. Chatterjee. 1982. Isolation and protein compositionof the outer membrane of Erwinia amylovora. Curr. Microbiol. 7:87–92.

38. White, D., M. E. Hart, and T. Romeo. 1996. Phylogenetic distribution of theglobal regulatory gene csrA among eubacteria. Gene 182:221–223.

39. Zink, R. T., R. J. Kemble, and A. K. Chatterjee. 1984. Transposon Tn5mutagenesis in Erwinia carotovora subsp. carotovora and E. carotovora subsp.atroseptica. J. Bacteriol. 157:809–814.


on Decem


.org/D

ownloaded from

http://jb.asm.org/

Documents

Molecular Characterization of Global Regulatory RNA Species … · Ecc and, like the latter, function as negative regulators by affecting the transcript stability of the target gene