Molecular Characterization of Glyphosate Degrading and/or

Sadiqa Firdous

2017

Department of Biotechnology

Pakistan Institute of Engineering and Applied Sciences

Nilore, Islamabad, Pakistan

Molecular Characterization of Glyphosate

Degrading and/or Resistant Bacterial

Strains

Thesis Approval Form

Student’s Name: Sadiqa Firdous Department: Biotechnology

Registration Number: 10-7-1-066-2011 Date of Registration: 25-05-2010

Thesis Title: Molecular Characterization of Glyphosate Degrading and/or Resistant Bacterial

Strains

RECOMMENDATION (if any) by:

General comments (attach additional sheet if required)

When the final thesis defense of the student has been concluded and all other requirements have been

met, I

a. Do Recommend that the candidate be certified to the faculty for the degree of

Doctor of Philosophy

b. Do Recommend that the candidate be certified to the faculty for the degree of

Doctor of Philosophy subject to the minor correction in the thesis.

c. Do Recommend that the candidate should reappear in the oral defense

d. Do NOTRecommend that the candidate be certified to the faculty for the degree

of Doctor of Philosophy

Examiners Signatures

1. Internal Examiner (Name & Affiliation):



4. Supervisor (Name & Affiliation):

5. Head of Department (Name):

6. Dean (Research) :

Approved by:

Head of the Department (Name) :___________________________ Signatures/Date ______________

Distribution:

1. Original to be placed in Student‟s Personal file in the office of Dean (Research)

2. Copy to be included in the thesis prior to final submission.

Thesis Submission Approval

This is to certify that the work contained in this thesis entitled Molecular

Characterization of Glyphosate Degrading and/or Resistant Bacterial Strains,

was carried out by Sadiqa Firdous, and in my opinion, it is fully adequate, in scope

and quality, for the degree of Ph.D. Furthermore, it is hereby approved for submission

for review and thesis defense.

Supervisor: _____________________

Name: Dr. Samina Iqbal

Date: 21 June, 2017

Place: NIBGE, Faisalabad.

Head, Department of Biotechnology: ___________________

Name: Dr. Shahid Mansoor

Date: 21 June, 2017

Place: NIBGE, Faisalabad.

Molecular Characterization of Glyphosate

Degrading and/or Resistant Bacterial

Strains

Sadiqa Firdous

Submitted in partial fulfillment of the requirements

for the degree of Ph.D.

2017

Department of Biotechnology

Pakistan Institute of Engineering and Applied Sciences

Nilore, Islamabad, Pakistan

ii

Dedicated to My beloved Parents and Sisters Without whom none of my success

would have been possible

iii

Declaration of Originality

I hereby declare that the work contained in this thesis and the intellectual content of

this thesis are the product of my own work. This thesis has not been previously

published in any form nor does it contain any verbatim of the published resources

which could be treated as infringement of the international copyright law. I also

declare that I do understand the terms „copyright‟ and „plagiarism,‟ and that in case of

any copyright violation or plagiarism found in this work, I will be held fully

responsible of the consequences of any such violation.

__________________

(Sadiqa Firdous)

21 June, 2017

NIBGE, Faisalabad.

iv

Copyrights Statement

The entire contents of this thesis entitled Molecular Characterization of Glyphosate

Degrading and/or Resistant Bacterial Strains by Sadiqa Firdous are an intellectual

property of Pakistan Institute of Engineering & Applied Sciences (PIEAS). No

portion of the thesis should be reproduced without obtaining explicit permission from

PIEAS.

v

Table of Contents

Dedication ...................................................................................................................... ii

Declaration of Originality .............................................................................................. iii

Copyrights Statement ..................................................................................................... iv

List of Figures ................................................................................................................ ix

List of Tables.................................................................................................................. xi

Abstract .........................................................................................................................xii

List of Publications ....................................................................................................... xiv

List of Abbreviations ..................................................................................................... xv

Acknowledgements ..................................................................................................... xvii

1. Introduction .............................................................................................................. 1

1.1 Xenobiotics in Environment .............................................................................. 1

1.2 Pesticides .......................................................................................................... 1

1.3 Classification of Pesticides ................................................................................ 2

1.4 Organophosphonate Pesticides........................................................................... 3

1.5 Herbicides ......................................................................................................... 5

1.5.1 Group 1: Acetyl CoA Carboxylase (ACCase) Inhibitors (Lipid

Biosynthesis Inhibitors) ................................................................................ 5

1.5.2 Group 2: Acetolactate Synthase (ALS) or Acetohydroxy Acid Synthase

(AHAS) Inhibitors ........................................................................................ 6

1.5.3 Group 3: Mitosis Inhibitors (Root Growth Inhibitors) ................................... 6

1.5.4 Group 4: Plant Growth Regulators (Synthetic Auxins) .................................. 6

1.5.5 Groups 5, 6, 7: Photosynthesis inhibitors (Photosystem II (PSII)

Inhibitors) ..................................................................................................... 7

1.5.6 Groups 8 and 15: Shoot Growth Inhibitors .................................................... 7

1.5.7 Group 9: Aromatic Amino Acid Inhibitors .................................................... 8

1.5.8 Group 10: Glutamine Synthesis Inhibitors ..................................................... 8

1.5.9 Groups 12, 13, and 27: Pigment Synthesis Inhibitors ..................................... 8

1.5.10 Group 14: Protoporphyrinogen Oxidase (PPO) Inhibitors.............................. 9

1.5.11 Group 22: Photosynthesis Inhibitors (Photosystem I (PSI) Inhibitors) ........... 9

1.6 Glyphosate ........................................................................................................ 9

1.6.1 Mode of Action of Glyphosate .................................................................... 10

1.6.2 Uptake and Translocation of Glyphosate ..................................................... 12

1.6.3 Fate of Glyphosate in Soil ........................................................................... 12

vi

1.6.4 Fate of Glyphosate in Water ........................................................................ 13

1.6.5 Global Use of Glyphosate ........................................................................... 14

1.6.6 Environmental Impact and Toxicity of Glyphosate ...................................... 15

1.7 Biodegradation ................................................................................................ 18

1.7.1 Biodegradation of Glyphosate ..................................................................... 19

2. Materials and Methods ........................................................................................... 21

2.1 Chemicals Used in This Study ......................................................................... 21

2.2 Bacterial Strains Used in This Study ................................................................ 21

2.3 Soil Sample Collection .................................................................................... 23

2.4 Growth Media ................................................................................................. 23

2.5 Maintenance and Preservation of the Isolated Bacterial Strains ........................ 23

2.6 Equipments Used in Current Study .................................................................. 23

2.7 Enrichment of Glyphosate Tolerant Bacterial Strains ....................................... 24

2.8 Isolation of Glyphosate Tolerant Bacterial Strains ........................................... 24

2.9 Glyphosate Tolerance of Bacterial Isolates ...................................................... 24

2.10 Morphological Characterization of the Bacterial Isolates ................................. 25

2.10.1 Morphological Characterization .................................................................. 25

2.10.2 Gram Staining Method ................................................................................ 25

2.11 Molecular Characterization of Isolated Bacterial Strains .................................. 26

2.11.1 DNA Isolation ............................................................................................ 26

2.11.2 Amplification of 16S rRNA Gene from Isolated Bacterial Strains ............... 27

2.11.3 Agarose Gel Electrophoresis ....................................................................... 27

2.11.4 Ligation and Cloning of 16S rRNA Gene .................................................... 27

2.11.5 Sequencing of 16S rRNA Gene and Bacterial Identification ........................ 27

2.12 Bacterial Diversity Assessment through PCR-DGGE ...................................... 28

2.12.1 DGGE Gel Casting and Running ................................................................. 28

2.12.2 DGGE Gel Staining .................................................................................... 29

2.12.3 Excision and Re-amplification of DGGE PCR Fragments ........................... 29

2.13 Inoculum Preparation of Bacterial Strains ........................................................ 29

2.14 Glyphosate Degradation Studies ...................................................................... 30

2.15 Detection of Glyphosate .................................................................................. 30

2.15.1 Detection Wavelength of Glyphosate .......................................................... 30

2.15.2 Derivatization of Glyphosate ....................................................................... 30

2.15.3 HPLC Conditions for Glyphosate Residual Analysis ................................... 31

2.16 Study of Potential Genes in Glyphosate Tolerant Bacterial Strains ................... 31

2.16.1 Amplification of Glyphosate Resistant and Degrading Genes ...................... 31

vii

2.16.2 Agarose Gel Electrophoresis, Cloning and Sequencing of the Amplified

Genes .......................................................................................................... 32

3. Isolation and Characterization of Glyphosate Resistant Bacterial Strains ................ 34

3.1 Introduction ..................................................................................................... 34

3.1.1 Glyphosate Resistance ................................................................................ 35

3.1.2 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS, EC 2.5.1.26) ........ 35

3.1.3 Classification of EPSP Synthase ................................................................. 37

3.1.4 History and Engineering of Glyphosate Resistant EPSPS ............................ 37

3.1.5 Glyphosate Detoxification........................................................................... 39

3.2 Materials and Methods .................................................................................... 39

3.2.1 Enrichment, Isolation and Screening of Glyphosate Tolerant Bacterial

Strains......................................................................................................... 39

3.2.2 Morphological and Taxonomic Analysis of Glyphosate Tolerant Bacterial

Isolates ....................................................................................................... 40

3.2.3 Amplification and Sequencing of aroAO.intermedium Sq20 Gene ......................... 40

3.2.4 Tolerance/ Degradation of Glyphosate by Sq20........................................... 40

3.2.5 HPLC Analysis of Glyphosate .................................................................... 41

3.2.6 Detection of Metabolites Produced During Glyphosate Degradation ........... 41

3.2.7 Bioinformatic Analysis of aroAO.intermedium Sq20 ............................................. 41

3.3 Results............................................................................................................. 43

3.3.1 Isolation and Identification of Glyphosate Tolerant Bacterial Strains .......... 43

3.3.2 Morphological and Taxonomic Characterization of Glyphosate Tolerant

Bacterial Strains .......................................................................................... 43

3.3.3 Glyphosate Resistance and Degradation by Ochrobactrum Intermedium

Sq20 ........................................................................................................... 51

3.3.4 Detection of Glyphosate Degradation Products ........................................... 52

3.3.5 Bioinformatic Analysis of aroAO.intermedium Sq20 ............................................. 52

3.4 Discussion ....................................................................................................... 64

4. Isolation and Characterization of Glyphosate Degrading Bacterial Strains .............. 69

4.1 Introduction ..................................................................................................... 69

4.1.1 Glyphosate Biodegradation ......................................................................... 70

4.1.2 Pathways of Glyphosate Biodegradation ..................................................... 74

4.1.3 Response Surface Methodology .................................................................. 76

4.2 Materials and Methods .................................................................................... 77

4.2.1 Enrichment and Isolation of Glyphosate Degrading Bacterial Strains .......... 77

4.2.2 Selection of Competent Glyphosate Degrading Bacterial Strain .................. 77

4.2.3 Identification and Characterization of Glyphosate Degrading Bacterial

Strains......................................................................................................... 78

viii

4.2.4 Denaturing Gradient Gel Electrophoresis (DGGE) Analysis of Glyphosate

Contaminated Soil ...................................................................................... 78

4.2.5 Biodegradation of Glyphosate by Isolated Bacterial Strains ........................ 78

4.2.6 HPLC Analysis of Glyphosate Residues ..................................................... 79

4.2.7 Optimization of Culture Conditions Using Response Surface

Methodology (RSM) ................................................................................... 79

4.2.8 Detection of Genes Conferring Glyphosate Degradation ............................. 80

4.3 Results............................................................................................................. 81

4.3.1 Selection and Identification of Glyphosate Degrading Bacterial Strain ........ 81

4.3.2 Identification and Characterization of Bacterial Isolates .............................. 83

4.3.3 DGGE Analysis of Enrichment Cultures ..................................................... 91

4.3.4 Optimization of Parameters for Glyphosate Degradation Using RSM .......... 95

4.3.5 Response Surface Plots for Glyphosate Degradation ................................... 98

4.3.6 Identification of Glyphosate Degrading Genes from Isolated Bacterial

Strains....................................................................................................... 103

4.4 Discussion ..................................................................................................... 105

5. Discussion ............................................................................................................ 109

5.1 Aim of Thesis ................................................................................................ 109

5.2 Major Findings .............................................................................................. 111

5.2.1 Ochrobactrum intermedium Sq20 ............................................................. 111

5.2.2 Comamonas odontotermitis P2 .................................................................. 111

5.2.3 Glyphosate Degrading Genes .................................................................... 112

5.3 Explicit Future Recommendations ................................................................. 112

6. References ............................................................................................................ 114

Appendices .................................................................................................................. 135

ix

List of Figures

Figure 1-1 General chemical structure of organophosphonate pesticides. ............. 4

Figure 1-2 Schematic illustration of mode of action of glyphosate. .................... 11

Figure 1-3 Accumulation and distribution of glyphosate in environment. ........... 16

Figure 1-4 Pathways of glyphosate biodegradation. ........................................... 20

Figure 3-1 Inhibition of penultimate step of shikimic acid pathway by glyphosate.

......................................................................................................... 36

Figure 3-2 Growth of the isolated bacterial strains in MSM. .............................. 44

Figure 3-3 Phylogenetic analysis of isolated bacterial strain Sq20. ..................... 48




Figure 3-7 Glyphosate degradation by Ochrobactrum intermedium Sq20 at 500

mg/L initial concentration, 37 °C and pH 7 in minimal salt media

(MSM). ............................................................................................ 53

Figure 3-8 Phylogenetic analysis of EPSPS O.intermedium Sq20. ................................ 54

Figure 3-9 Multiple sequence alignment of EPSPSO.intermedium Sq20. ...................... 55

Figure 3-10 Phylogenetic analysis of Ochrobactrum intermedium strain Sq20 with

Class I and class II enzymes. ............................................................ 56

Figure 3-11 Secondary structure of EPSPSO.intermedium Sq20. .................................... 59

Figure 3-12 Secondary structure (SS) and disorder prediction of EPSPSO.intermedium

Sq20 through Phyre2 representing three states α-helix, β-strand and coil.

......................................................................................................... 60

Figure 3-13 Ramachandran plot (created by PROCHECK) showing 91.8% of

amino acid residues in core region (red colour). ................................ 61

Figure 3-14 Structure validation of EPSPSO.intermedium Sq20. .................................... 62

Figure 3-15 3-D structure analysis of class II EPSPS(s). ...................................... 63

Figure 4-1 Utilization of glyphosate (500 mg/L) by isolated bacterial strains. .... 82

Figure 4-2 Degradation of glyphosate by bacterial isolates. ................................ 83

Figure 4-3 Phylogenetic tree of Pseudomonas straminea P1. ............................. 87

Figure 4-4 Neighbor joining tree illustrating the phylogenetic relationship of P2

strain. ............................................................................................... 88

Figure 4-5 Phylogenetic analysis of Ochrobactrum anthropi P3 using Mega 6

based on 16S rRNA sequence analysis. ............................................. 89

Figure 4-6 Phylogenetic tree based on homologous sequences of the

Achromobacter spanius P4. .............................................................. 90

x

Figure 4-7 Dendrogram exhibiting genetic relationships of P5 isolate. ............... 91

Figure 4-8 (a, b) 16S rDNA denaturing gradient gel electrophoresis (DGGE)

analysis of bacterial community in enrichment cultures of glyphosate

contaminated soils. ........................................................................... 93

Figure 4-9 RSM analysis of glyphosate degradation......................................... 102

Figure 4-10 GOX amplification from Comamonas odontotermitis P2. ............... 103

Figure 4-11 Phylogenetic analysis of Comamonas odontotermitis P2 GOX. ....... 104

Figure 4-12 Amplification of phnJ gene from glyphosate degrading bacterial

isolates. .......................................................................................... 104

Figure 4-13 Blast analysis of phnJ gene amplified Comamonas odontotermitis P2.

....................................................................................................... 105

xi

List of Tables

Table 2.1 Glyphosate tolerant/degrading bacterial strains isolated in current

study................................................................................................. 22

Table 2.2 Sequences of primers designed by aligning the already reported

glyphosate resistant and degrading genes. ......................................... 33

Table 3.1 Morphological characteristics of glyphosate resistant bacterial strains.

......................................................................................................... 45

Table 3.2 Characterization of the glyphosate resistant bacterial strains isolated in

current study from glyphosate contaminated soil .............................. 47

Table 3.3 Amino acid composition of EPSPSO.intermedium Sq20 representing amino

acid number as well as percentage composition. ............................... 57

Table 3.4 Physico-chemical characteristics of EPSPSO.intermedium Sq20 computed by

Expasy‟s Protparam software. ........................................................... 58

Table 3.5 Comparative analysis of Swiss Model and Geno 3D computed models

of EPSPSO.intermedium Sq20 done by Ramachandran plot calculations. .... 67

Table 4.1 Glyphosate degrading bacterial strains with type of metabolism. ...... 72

Table 4.2 Experimental ranges and coded levels of independent variables. ....... 80

Table 4.3 Characterization of the glyphosate degrading bacterial strains isolated

in current study from glyphosate contaminated soil .......................... 84

Table 4.4 Morphological characteristics of glyphosate degrading bacterial

strains. .............................................................................................. 85

Table 4.5 Sequence analysis of DGGE bands obtained from glyphosate enriched

culture .............................................................................................. 94

Table 4.6 Predicted and experimental values of glyphosate degradation by CCD

matrix ............................................................................................... 96

Table 4.7 Analysis of variance (ANOVA) for the glyphosate degradation

response (%) ..................................................................................... 97

Table 4.8 Regression analysis and model coefficients of variables for glyphosate

degradation response (%).................................................................. 98

xii

Abstract

Glyphosate is an important organophosphonate herbicide used to eliminate grasses

and herbaceous plants in many vegetation management situations. It is one of the

most widely used herbicides owing to its non selective and post emergent properties.

Glyphosate is involved in blockage of an enzyme, 5-enolpyruvylshikimate-3-

phosphate synthase (EPSPS), entailed in catalysis of an essential step in the

biosynthesis of aromatic amino acids. The objective of the current study was to isolate

glyphosate tolerant bacterial strains and to characterize the gene(s) encoding

glyphosate resistance in these bacteria. A glyphosate tolerant bacterium,

Ochrobactrum intermedium Sq20 was isolated from glyphosate contaminated

indigenous soil, capable of utilizing glyphosate as sole carbon and energy source. A

1353 bp open reading frame (ORF) representing aroAO.intermedium Sq20 was amplified

from Sq20 which showed 97% homology with aroA genes from other Ochrobactrum

spp. Sequence analysis revealed that EPSPSO.intermedium Sq20 belongs to class II EPSPS.

In silico analysis was used for identification and characterization of EPSPS gene

through physicochemical properties. Methodical optimization and validation of

protein structure helped to build a reliable protein model of EPSPSO.intermedium Sq20

which will provide strong basis for functional analysis of EPSPSO.intermedium Sq20. The

results indicated that cloning and characterization of EPSPSO.intermedium Sq20 will further

help to understand its role at molecular level and its plausible usage for production of

glyphosate resistant transgenic crops.

The extensive use of glyphosate is detrimental for flora and fauna regarding

current studies about its toxic effects, and most appropriate strategy to remove it from

environment is bioremediation. As a step to address this problem, a novel bacterial

strain Comamonas odontotermitis P2 capable to utilize glyphosate as carbon and

phosphorus source was isolated and characterized. The glyphosate degradation

potential of C. odontotermitis P2 was optimized using response surface methodology

under various culture conditions. The strain P2 was proficient to degrade 1.5 g/L

glyphosate completely within 104 h. Moreover, GOX (glyphosate oxidoreductase) and

phnJ (C-P lyase) genes were identified from C. odontotermitis P2 signifying the

xiii

degradation potential through AMPA and sarcosine metabolic pathways. These results

demonstrate the potential of C. odontotermitis P2 for efficient degradation of

glyphosate which can be exploited for remediation of glyphosate.

xiv

List of Publications

Journal Publications

S. Firdous, S. Iqbal, S. Anwar, and H. Jabeen, “Identification and analysis of

5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene from glyphosate

resistant Ochrobactrum intermedium Sq20,” Pest Manag Sci,

DOI:10.1002/ps.4624. 2017.

S. Firdous, S. Iqbal, and S. Anwar, “Optimization and modeling of

glyphosate biodegradation by a novel Comamonas odontotermitis P2 through

response surface methodology,” Pedosphere, Manuscript ID:

pedos201610546.R1, 2016. (In Press)

H. Jabeen, S. Iqbal, F. Ahmad, M. Afzal, and S. Firdous, “Enhanced

remediation of chlorpyrifos by ryegrass (Lolium multiflorum) and a

chlorpyrifos degrading bacterial endophyte Mezorhizobium sp. HN3,” Int. J.

Phytoremediation, vol. 1, no. 2, pp.126-133, 2016.

xv

List of Abbreviations

2,4D 2,4-Dichlorophenoxyacetic acid

2-AEP 2-Amino ethylphosphonic acid

AARI Ayub agricultural research institute

ACCase Acetyl CoA carboxylase

AHAS Acetohydroxy acid synthase

ALS Acetolactate synthase

AMPA Aminomethyl phosphonic acid

ANOVA Analysis of variance

ATPase Adenosine triphosphate

BHC Benzene hexachloride

BLAST Basic local alignment search tool

CCRD Central composite rotatable design

CFU Colony forming units

ChE Cholinesterase

CNBF 4-Chloro-3,5-dinitrobenzotrifluoride

CTAB Cetyl tri-methyl ammonium bromide

CYP Cytochrome P450

DAHP 3-Deoxy-D-arabinoheptulosonate-7-phosphate synthase

DCPA Dimethyl-2,3,5,6-tetrachloroterephthalate

DDT Dichlorodiphenyltrichloroethane

DENs Phenylpyrazolin

DF Degrees of freedom

DGGE Denaturing gradient gel electrophoresis

DHQase 3-Dehydroquinate synthase

DIMs Cyclohexanedione

E4P Phosphoenol pyruvate and erythrose-4-phosphate

EPSP 5-Enolpyruvylshikimate-3-phosphate synthase

EPSPS 5-Enolpyruvyl-shikimate-3-phosphate synthase

FOPs Aryloxyphenoxypropionate

xvi

GO Glycine oxidase

GOX Glyphosate oxidoreductase

GRAVY Grand average hydropathy

HPLC High performance liquid chromatography

HPPD 4-Hydroxyphenyl pyruvate dioxygenase

HRAC Herbicide resistance action committee

IAA Indole acetic acid

IARC International agency for research on cancer

LB Luria Bertani

MCL Maximum contaminant limit

MEGA Molecular evolutionary genetics analysis

MS Mean square

MSM Mineral salts medium

NADPH2 Nicotinamide adenine dinucleotide hydrogen phosphate

NHL Non-Hodgkin lymphoma

OCs Organochlorines

OPs Organophosphates

ORF Open reading frame

PEP Phosphoenolpyruvate

POEA Polyethoxylated tallow amine

POPs Persistent organic pollutants

PSI Photosystem I

PSII Photosystem II

RSM Response surface methodology

S3P Shikimate 3-phosphate

SAM s-Adenosyl-l-methionine

SOPMA Self optimized prediction method with alignment

SS Sum of squares

USGS U.S. geological survey

WHO World health organization

xvii

Acknowledgements

In the inception, all commendation and admiration is for the Almighty ALLAH,

whose blessings have been the main reason for the completion of my study, and His

Holy Prophet Mohammad (S.A.W.W.), who is forever torch of guidance and

knowledge for humanity as a whole.

It is my greatest pleasure to avail this opportunity to extend my gratitude to

Dr. Shahid Mansoor (DCS, SI), Director NIBGE for providing and facilitating a

competitive environment for research.

My cordial gratitude goes to my supervisor, Dr. Samina Iqbal (DCS), who

proficiently guided me during my PhD research work. She has been there to support

me in all circumstances throughout my PhD. She has always been passionate to create

an inimitable piece of research and her vital contribution to this thesis is beyond

description. In a nutshell, I would have never been able to complete my work without

her concerned involvement.

I am also indebted to Dr. Sajjad Mirza (DCS, HOD, SEBD) for his

encouragement and motivation. My humble thanks also goes out to Dr. Michael

Kertesz, my foreign supervisor for providing me a chance to utilize my research skills

and facilitating me with recourses at his lab during tenure of IRSIP fellowship

(International Research Support Initiative Program, HEC) at University of Sydney,

Australia.

I am strongly obliged to Samina Anwar (SS) for helping, encouraging and

guiding me throughout the research work. Her valuable help in experimental work

and sincere guidance was an inspiration. Without her help, I would have never been

able to conduct my research and reach its goal.

My amenable thanks go to my senior lab fellow and friend Dr. Hina Jabeen

for never refusing me whenever I approached her for seeking guidance. Her co-

operation genuinely helped to complete the journey of research.

xviii

I am highly thankful to my lab fellows Masooma Hammad, Fiaz Ahmed,

Salma Mughal, Sidra Gulnar, Muhammad Asif Nadeem and Abdul Qadeer

Wahla for their kind cooperation during my PhD research. The cooperation of my lab

fellows genuinely helped to complete the journey of research.

It fills me with immense gratitude to convey my thanks to my friends Mariam

Masood, Saima Majeed, Nida Iram, Maryam Zafar for always being there and

helping me at several places during the pace of my research.

I am highly indebted to my parents and sisters for their support, patience and

guidance. My words can never justify their role in this venture. I can never ever be

able to thank my parents Mr. and Mrs. Zafar Iqbal enough for all the love and

affection they generously poured on me; for all the tears they shed in front of ALLAH

to bless me with His innumerable blessings and for all the hardships they suffered to

comfort me. I wholeheartedly thank my sisters Amina, Ayesha and Quratulain for

their love, support and encouragement throughout my educational career.

Sadiqa Firdous

1

1. Introduction

1.1 Xenobiotics in Environment

Our environment encloses a wide-ranging variety of naturally occurring and synthetic

(biogenic or anthropogenic) chemical compounds [1]. Xenobiotic is a combination of

two Greek words xenos meaning foreign or eccentric and bios meaning life referring

to the substances foreign to the biosphere usually turn out due to industrial activities.

Some xenobiotic compounds are degraded by microorganisms (weak xenobiotics)

whereas some persist for longer time in environment and hardly degradable

(recalcitrant xenobiotics). Chief sources involved in the introduction of xenobiotic

compounds into the environment are pharmaceutical and chemical industries, pulp

and paper bleaching industries, agriculture and forestry (fertilizers, pesticides and

herbicides).

Xenobiotics were developed for the well-being of human beings in the last

century but their escalated use is disrupting the biosphere resulting in everlasting

contamination. Chemical industries are synthesizing 1,000 new chemicals every year

and about 60,000 to 95,000 chemicals are currently in commercial use subsequently

releasing more than one billion pounds in air and water. The environmentalists are

trying to raise the awareness about toxicity of these chemicals therefore numerous

persistent organic pollutants (POPs) have been banned around the world [2].

1.2 Pesticides

Pesticides are most commonly used amongst all the xenobiotics due to their

multipurpose applications in agriculture, forestry and domestic areas. A pesticide is

defined as any compound used for preventing, destroying, repelling or mitigating

any pest, covering a broad range of insecticides, fungicides, herbicides, rodenticides,

molluscicides, nematicides, plant growth regulators and others. Pesticides particularly

refer to chemical substances that modify biological processes of living organisms

reckoned to be pests (insects, mould, fungi, weeds or noxious plants) [3].

___ 1. Introduction

2

Pesticides are extensively used in different areas of agriculture to avoid yield

losses and low quality products. Crops are damaged by 9,000 species of insects and

mites, 50,000 species of plant pathogens and 8,000 species of weeds approximately.

Crop loss is minimized to 35% to 42% with use of pesticides [4]. The worldwide

consumption of pesticides was found to cost around 5.2 billion pounds in 2007 with

herbicides contributing major portion of total cost as compared to other classes of

pesticides. Agricultural countries rely on pesticides conspicuously to secure and

enhance crop yields and consequently strengthen economy. Pesticides are not newly

invented but deliberately used thousand years ago by Sumerians, Greeks, and Romans

who used a variety of compounds such as sulphur, mercury, arsenic, copper and plant

extracts to kill pests. But the results were not encouraging due to insufficient

knowledge about their chemistry and applications. Introduction of DDT

(dichlorodiphenyltrichloroethane), BHC (benzene hexachloride), aldrin, dieldrin,

endrin and 2, 4-D (2, 4-dichlorophenoxyacetic acid) augmented the use of pesticides

after World War II. These newly introduced chemicals were found to be efficient,

user-friendly and economical [5].

1.3 Classification of Pesticides

Classification of pesticides is done on the basis of their physical properties, chemical

structure, target organism and mode of action. Target organism based classification of

pesticides includes insecticides (kill the insect pests of crops, flies, mosquitoes and

insect vectors for human diseases), herbicides (alleviate the superfluous plants),

fungicides (kill fungus), avicides (kill bird pests) and acaricides (diminish tick and

mites). Although pesticide classification involves different grounds but chemical

structure based classification is more favoured by the scientists because it establishes

a correlation among structure, activity, toxicity and degradation mechanisms of

pesticide groups. Foremost pesticides according to chemical composition are

organophosphates (OPs), organochlorines (OCs), carbamates and pyrethroids.

Organochlorides (OCs) were used effectively to control different diseases such

as malaria and typhus, banned after 1960s in developed countries due to its

toxicological effects but still used in developing countries. Organochloride pesticides

are recalcitrant, hardly degradable and pretense chronic health effects including

___ 1. Introduction

3

cancer, neurological and teratogenic effects [6-9]. Most popular OC pesticides are

DDT, eldrin and endosulfan.

Other pesticides introduced in different decades as organophosphate (OPs) in

1960s, carbamates in 1970s, pyrethroids in 1980s and herbicides and fungicides in

1970s-1980s facilitated in controlling pests and boosting agricultural output.

Organophosphorus pesticides are esters of phosphoric acid and have adverse effects

on the nervous system of pests and human beings, influencing their reproductive

system as well [10, 11]. They inhibit the activity of cholinesterase (ChE) enzyme

accountable for the nerve impulse in living organisms [12]. Generally used OP

pesticides include chlorpyrifos, diazinon, profenofos, parathion, malathion and

triazophos.

Carbamate pesticides contain a wide variety of compounds including carbaryl,

carbofuran and aldicarb posing low toxicity to living organisms [13]. Although, they

inhibit the activity of enzyme acetylcholinesterase but inhibition is less severe and

reversible. Accumulation of acetylcholine due to inhibition of its hydrolysis reaction

causes various symptoms, such as sweating, lacrimation, hypersalivation and

convulsion of extremities [14].

Pyrethroids are classified as lipophilic esters containing an alcohol and an acid

moiety. Pyrethroid pesticides block neuronal activity by displaying high affinity and

binding to Na+ channels. Thus prolonged channel opening result in complete

depolarization of the cell membrane thus blocking neuronal activity. Even though less

toxic and persistent than other groups of insecticides but still poses harmful effects.

1.4 Organophosphonate Pesticides

Organophosphonates embodies a group of organic compounds distinguished by direct

carbon to phosphorus (C-P) covalent bond. These compounds are resistant to thermal

decomposition, chemical hydrolysis, enzymatic degradation and photolysis due to the

presence of stable C-P bond. Although there is no significant difference between

strength of C-P bond energy and other bond energies but former has higher activation

energy [15]. These compounds are extensively used as pesticides, lubricant additives,

flame retardants, plasticizers, corrosion inhibitors, drugs antibiotics, adhesives,

chelating agents etc. Some of the most discernible organophosphonates include

___ 1. Introduction

4

expansively used herbicides such as glyphosate and phosphinothricin [16]; insectides

such as ethylphosphonate and phenylphosphonate derivatives; flame retardant such as

Phyrol 76, an oligomer of vinylphosphonate-methylphosphonate; corrosion inhibitors

such as polyaminopolyphosphonic acids [17]; Aminotri (methylenephosphonic and

hydroxyethylidenediphosphonic acids) as chelative agents to household detergents

[18], bisphosphonates for the treatment of bone mineralization disorders;

alaphosphaline and phosphonomycin (biphosphonates) as antibiotics and cyclic esters

of aromatic bisphosphonates as polymer additives [19, 20].

In 1944, Pikl synthesized first organophosphonate compound

aminomethylphosphonic acid but later on Kosolapoff and Chavane produced diverse

amino and amino-substituted phosphonic acids [21]. First biogenic

organophosphonate 2-amino ethylphosphonic acid (2-AEP) was isolated by

Horiguchi in 1959 from acid hydrolysates of ether ethanol fraction of Protozoa [22].

Later on 2-AEP was also found in Tetrahymena pyriformis and Anthopleura

elegantissima (sea anemone) in the form of phosphonolipids.

Regarding the chemical structure, Organophosphonates are distinguished by

the presence of C-P bond which substitute one of the four C-O-P bonds commonly

found in most esters [23]. They contain C-PO(OH)2 or C-PO(OR)2 groups where R is

alkyl or aryl group, therefore R1 is directly bonded to the P atom while R2 is linked

either to an oxygen or sulphur atom (Figure 1-1).

Figure 1-1 General chemical structure of organophosphonate pesticides.

___ 1. Introduction

5

1.5 Herbicides

Since the existence of human race, its decisive enterprise has been the plant

production for food and fiber. Humans have battled to control weeds threatening

crop survival and productivity since the dawn of agriculture. Crops are greatly

affected by weeds every year therefore herbicides are extensively used for weed

management in agriculture sector [24]. They are used in industry, forestry and urban

areas as well. Herbicides are organophosphonate compounds that hinder or disrupt

the normal growth and development of plants resulting in their obliteration.

Contemporary agriculture practices greatly depend on herbicides for cost effective

weed control and soaring crop yield. Herbicides are classified in numerous ways

depending on their application method (soil, foliar, broadcast, spot or band),

application time (pre-plant incorporation, pre-emergent or post emergent), chemical

composition (organic or inorganic), general symptoms in plants (contact or

systemic), period of soil persistence (persistent, residual or long residual), response

among plants (nonselective or selective), formulation (liquid or dry) and mode of

action. Although different approaches are applied for herbicide classification but

classification hinged on herbicidal mode of action is relatively better and imperative

due to its significance in weed resistance management, exploring toxicological

problems and improving herbicide application techniques [25]. About 20 different

target sites for herbicides are reported [26] but herbicides with only 6 modes of

action embodies approximately 75% of herbicide sales [27].

Herbicides are classified into different groups on the basis of site of action. A

classification system was published by the International Herbicide Resistance Action

Committee (HRAC) based on letters for each group [28]. Classification was updated

by Mallory-Smith and Retzinger [29] afterwards and some herbicides listed in the

Weed Science Society of America 2002 Herbicide Handbook [30] were also added.

The modes of action of herbicides are discussed below:

1.5.1 Group 1: Acetyl CoA Carboxylase (ACCase) Inhibitors (Lipid

Biosynthesis Inhibitors)

Herbicides of this group obstruct the synthesis of fatty acids by suppressing acetyl

coenzyme A carboxylase (ACCase) enzyme activity. This blockage hinders the

production of phospholipids involved in synthesis of lipid bilayer, which plays an

___ 1. Introduction

6

important role in cell structure and function [31-33]. Aryloxyphenoxypropionate

(FOPs), cyclohexanedione (DIMs), and phenylpyrazolin (DENs) are ACCase

enzymes used for eliminating grass during the cultivation of broadleaf crop varieties

or crop rotation. Certain grasses and broadleaf crop varieties have natural resistance

to these herbicides due to their strong ACCase system [34].

1.5.2 Group 2: Acetolactate Synthase (ALS) or Acetohydroxy Acid

Synthase (AHAS) Inhibitors

This group includes imidazolinones, pyrimidinylthiobenzoates,

sulfonylaminocarbonyltriazolinones, sulfonylureas, and triazolopyrimidines which

hinders the activity of acetolactate synthase (ALS) also known as acetohydroxy acid

synthase (AHAS) involved in the formation of 2-acetolactate or 2-aceto-2-

hydroxybutyrate [35]. Therefore inhibition of AHAS results in obstruction of

branched-chain amino acids (leucine, isoleucine, and valine) synthesis [36] and this

amino acid deficiency halts the synthesis of proteins ultimately causing plant death.

1.5.3 Group 3: Mitosis Inhibitors (Root Growth Inhibitors)

They are used as preemergent or preplant herbicides in vegetables and ornamental

plants and their mode of action involves the inhibition of cell division. This group

includes benzamide, benzoic acid [dimethyl-2, 3, 5, 6-tetrachloroterephthalate

(DCPA)], dinitroaniline, phosphoramidate, and pyridine herbicides which binds to

major microtubule protein tubulin. This herbicide-protein complex hinders the

polymerization of microtubules during assembly but remains impervious during

depolymerization [37], resulting in loss of structure and function of the

microtubules. Therefore spindle apparatus is not formed and cell death occurs due to

inhibition of cell wall formation.

1.5.4 Group 4: Plant Growth Regulators (Synthetic Auxins)

Benzoic acid, phenoxycarboxylic acid, pyridine carboxylic acid and quinoline

carboxylic acid of this group halts the activity of indole acetic acid (IAA) [38]. They

are used to remove broadleaf weeds during the cultivation of corn, wheat, and

sorghum. Specific binding site involving activity of IAA and synthetic auxins is still

unknown however these herbicides disrupt the plasticity of cell wall and nucleic acid

metabolism. They activate the adenosine triphosphate (ATPase) proton pump which

results in increased enzymatic activity of cell wall [39]. Activity of IAA is mimicked

___ 1. Introduction

7

by these regulators and RNA, DNA, and protein biosynthesis is increased leading to

continuous vascular growth causing cell bursts and ultimate cell and plant death.

1.5.5 Groups 5, 6, 7: Photosynthesis inhibitors (Photosystem II

(PSII) Inhibitors)

These herbicides inhibit the Photosystem II (PSII), photosynthetic pathway. Group 5

exemplifies triazine, triazinone, phenylcarbamates, pyridazinones, and uracils.

Nitriles, benzothiadiazinones, and phenylpyridazines are included in Group 6.

Group 7 represents phenyl urea and amides. All groups of PSII inhibitors exhibit

different binding patterns among them except a few similarities. They binds with

QB binding site of D1 protein of photosystem II complex located in chloroplast

thylakoid membranes. This binding interrupts transport of electrons from QA to QB

and blocks the CO2 fixation, ATP generation and nicotinamide adenine dinucleotide

hydrogen phosphate (NADPH2) production essential for plant growth and

development [40, 41]. Failure of QA reoxidation leads to the formation of triplet

state chlorophyll which converts ground state oxygen to singlet oxygen. This leads

to the peroxidation of lipids with a release of lipid radical. Whole mechanism

results in the loss of chlorophyll and carotenoids from the cell membranes and

exposure of cell contents to ruthless environmental conditions ultimately causing

plant death [42].

1.5.6 Groups 8 and 15: Shoot Growth Inhibitors

Herbicides of both groups are applied in the soil prior to the emergence of grass and

broadleaf weeds to remove them effectively. The herbicides included in Group 8 are

phosphorodithioates and thiocarbamates which disturb the lipid synthesis

mechanism and halt the biosynthesis of lipids, fatty acids, proteins, isoprenoids,

flavonoids, and gibberellins [43]. Group 15 herbicides include chloroacetamide,

acetamide, oxyacetamide, and tetrazolinone which act on a very long chain fatty

acid present in the cell membrane [44]. They make a complex with acetyl COA and

some sulfhydryl-containing molecules via thiocarbamate sulfoxides and inhibit the

long chain fatty acids during the seedling shoot growth stage of the plant and

distress the weeds preemergence.

___ 1. Introduction

8

1.5.7 Group 9: Aromatic Amino Acid Inhibitors

This group of herbicides inhibits the synthesis of aromatic amino acids by disturbing

the shikimate pathway (aromatic amino acid synthesis pathway) [45]. They are non

specific herbicides which kills every plant they come in contact with therefore they

are suggested to be used in glyphosate resistant crops as cotton, canola, corn and

soybean. This group includes glyphosate which is available as ammonium salts,

diammonium salts, dimethylammonium salts, isopropylamine and potassium salts.

Due to their broad spectrum nature, they are most commonly used in the world in

agriculture and forestry.

1.5.8 Group 10: Glutamine Synthesis Inhibitors

Glufosinate and bialophos (phosphinic acids) of this group disrupts the nitrogen

metabolism in plants. Their site of action is glutamine synthase which converts

ammonia and glutamate to glutamine [46]. Glutamine synthase re-assimilate the

ammonia generated during respiration and these herbicides impair its activity. They

degrade the proteins leading to the accumulation of ammonia resulting in lower pH

in the cell. This leads to the shutting down of the PSI and PSII systems eventually

causing the uncoupling of photophosphorylation [47]. These herbicides are effectual

for managing weeds and other unwanted plants due to the presence of glutamine

synthase in chloroplast and cytoplasm. They can also be used as postemergent

herbicides in glufosinate resistant crops.

1.5.9 Groups 12, 13, and 27: Pigment Synthesis Inhibitors

These herbicides destroy the photosynthesis pigment in plants, the chlorophyll. They

are also recognized as carotenoid biosynthesis inhibitors or bleaches as they remove

the green color of the plant tissues, destroying the cells and ultimately plant death.

They also inhibit the catalysis of 4-hydroxyphenyl pyruvate dioxygenase (HPPD)

enzyme therefore also known as HPPD inhibitors.

Group 12 includes amides, anilidex, furanones, phenoxybutan-amides,

pyridiazinones, and pyridines which inhibits the activity of phytoene desaturase

enzyme and interrupt the carotenoid biosynthetic pathway [48]. Group 13 represents

the chemical family of Isoxazolidinone which disrupts the diterpene synthesis.

Group 27 includes Isoxazole which inhibits HPPD enzyme. The application of these

___ 1. Introduction

9

groups of herbicides reduces the carotenoid levels in cells and increases the number

of unbound lipid radicals. Lipid peroxidation caused by these lipid radicals leads to

the impaired function of chlorophyll and membrane lipids. The cell contents are

destroyed due to membrane leakage causing plant death.

1.5.10 Group 14: Protoporphyrinogen Oxidase (PPO) Inhibitors

These herbicides are also called cell membrane disrupters as they disrupt the cell

membrane. They inhibit the PPO enzyme which is involved in the biosynthesis of

chlorophyll and heme. The herbicides included in this group are diphenylether, aryl

triazolinone, N-phenylphthalimides, oxadiazoles, oxazolidinediones,

phenylpyrazoles, pyrimidindiones and thiadiazoles. Inhibition of PPO eventually

leads to lipid peroxidation, cell disintegration and ultimately plant death [49]. Group

14 chemicals are used preemergent as well as postemergent herbicides.

1.5.11 Group 22: Photosynthesis Inhibitors (Photosystem I (PSI)

Inhibitors)

They are also known as cell membrane disrupters as they penetrate through plant

foliage and disrupt the lipid bilayer of cell resulting in cell membrane disruption.

Bipyridilium chemical family represents this group which produces herbicide

radicals by accepting electrons from PSI. Therefore they are also called PSI electron

diverters. These herbicides interact with molecular oxygen and produce superoxide

radicals further converted to hydrogen peroxide and hydroxyl radicals in the

presence of superoxide dismutase enzyme [50]. These radicals interrupt the

unsaturated fatty acids, chlorophyll, lipids, and proteins in the cell membrane. The

cell membrane disruption leads to the cell cytoplasm leakage and ultimately death of

plant. Photosynthesis inhibitors are nonselective in nature therefore applied

generally before crop harvest.

1.6 Glyphosate

Glyphosate [N-(phosphonomethyl) glycine] is a systemic, broad spectrum, non-

selective and postemergent herbicide. It is recurrently used in agricultural, industrial,

silvicultural amenity and domestic areas to control weeds [51, 52]. It is found in the

form of white crystalline powder with a chemical formula of C3H8NO5P and

molecular weight of 169.07 g/mol. The solubility of glyphosate in water is about 1.01

___ 1. Introduction

10

g/100mL at 20 °C. Its melting temperature is 184.5 °C and boiling temperature is 187

°C. Glyphosate was formerly used as plant growth promoter to increase production of

sucrose in cane but later on introduced as herbicide by John E Franz of Monsanto in

1970 [53]. It is most commonly used herbicide applied to control annual and perennial

weeds. Glyphosate is usually formulated in the form of its isopropylamine salt and is

the active ingredient of more than 50 formulations sold under various trade names

such as Roundup Ultra®, Roundup Pro®, Accord

®, Honcho

®, Pondmaster

® and

Protocol® etc [54]. In agricultural areas glyphosate is generally applied in fields

before sowing, between the rows in row crops and around perennial crops. In non-

agricultural areas, it is used along irrigation channels, roadsides and around recreation

areas. Glyphosate use has significantly increased with the introduction of glyphosate

tolerant crops [55, 56].

1.6.1 Mode of Action of Glyphosate

Mode of action of glyphosate involves the inhibition of 5-enolpyruvoyl-shikimate-3-

phosphate synthase (EPSPS, E.C. 2.5.1.19). EPSPS is a plant enzyme that catalyzes

the formation of EPSP from phosphoenolpyruvate (PEP) and shikimate 3-phosphate

(S3P) (Figure 1-2).

___ 1. Introduction

11

Figure 1-2 Schematic illustration of mode of action of glyphosate.

Shikimate pathway involves an aldol condensation of phosphoenol pyruvate and

erythrose-4-phosphate (E4P) in the presence of 3-deoxy-D-arabinoheptulosonate-7-

phosphate synthase (DAHP synthase, aroG/F/H) resulting in the production of 3-

deoxy-D-arabino-heptulosonate-7-phosphate (DAHP). DAHP is further converted

into 3-dehydroquinate by 3-dehydroquinate synthase (DHQ synthase, aroB). 3-

dehydroshikimate is synthesized from DHQ by catalytic activity of 3-dehydroquinate

dehydratase (DHQase, aroD). Next step involves the synthesis of shikimate by

shikimate dehydrogenase (aroE). Then shikimate kinase (aroK) converts shikimate to

shikimate-3-phosphate and 5-enolpyruvylshikimate-3-phosphate synthase (EPSP,

aroA) give 5-enolpyruvylshikimate-3-phosphate. The last step is catalyzed by

chorismate synthase (aroC) affording chorismate.

When plants are treated with glyphosate, production of EPSP is obstructed

resulting in massive accretion of S3P (shikimate-3-phosphate) and further production

of essential aromatic amino acids [57]. X-ray crystallographic studies have shown that

glyphosate deactivates EPSPS by inhabiting the active site of EPSPS normally

occupied by PEP [58]. It is found that plant EPSPS has higher binding affinity for

glyphosate as compared to PEP [59] therefore small amounts of glyphosate can

efficiently halt shikimate pathway and ultimately plant death. Blockage of shikimate

___ 1. Introduction

12

pathway prevents the production of chorismate which is an important intermediate

involved in the synthesis of essential aromatic amino acids (phenylalanine, tyrosine

and tryptophan). These aromatic amino acids are further implicated in the production

of several secondary plant products such as anthocyanins, lignin, growth promoters,

growth inhibitors, phenolics and protein production as well. Aromatic amino acids

and their secondary products molecules resulting from shikimate pathway contribute

approximately 35% of the total plant dry weight [53]. After the application of

glyphosate, injury symptoms appear as wilting, chlorosis and finally death of plants

within two weeks [54]. Glyphosate also affects bacteria and fungi due to the presence

of shikimate pathway.

1.6.2 Uptake and Translocation of Glyphosate

Glyphosate due to its non-selective nature is used to control all types of weeds. It

systemically moves through the leaves and shoots up to the roots after foliar

application. Franz et al. has reported that glyphosate translocates through the phloem,

accumulates in the meristematic regions of the plants and inhibits shikimate pathway

[53]. Shikimate pathway is the source of about 20% of all fixed carbon in plants and

its inhibition interrupts this carbon flow ensuing in the accumulation of huge amounts

of shikimate and eventually plant death [60]. Uptake rate of glyphosate differ between

species due to its susceptibility in different species and environmental factors such as

temperature, light intensity, wind speed and humidity etc. Glyphosate is usually

applied in formulation with some surfactants to aid in tissue penetration and avoid

droplet formation on waxy cuticle of leaves [61].

1.6.3 Fate of Glyphosate in Soil

The soil is the final destination of glyphosate translocation after its application in

forestry and agriculture. Glyphosate is a small molecule with three polar functional

groups (carboxyl, amino and phosphonate groups) which binds readily with soil

particles [62]. The persistence and transportation of glyphosate in soil depends on

different factors such as composition of soil, climate conditions, microbial activity

and agricultural management [62, 63]. Glyphosate competes with inorganic phosphate

for binding sites due to the presence of same phosphonic acid moiety which may

influence its sorption and mobility in phosphate rich soil [64]. Phosphate has ability to

outcompete glyphosate for sorption depending on soil properties and environmental

___ 1. Introduction

13

conditions. Glyphosate sorption strongly depends on soil pH and declines with

decrease in pH while sorption of phosphate is not affected by soil pH [65]. Moreover

different glyphosate degradation pathways (AMPA pathway, sarcosine pathway) are

employed by soil microbes therefore presence or absence of glyphosate and phosphate

in soil creates selection pressure on soil biota [66, 67].

Although glyphosate binds tightly with soil particles but it is hard to

generalize the glyphosate sorption due to different soil types. It is found that

glyphosate binds efficiently with soils containing less inorganic phosphate, high Al3+

and Fe3+

concentrations, broad surface area and high pH. Binding pattern of

glyphosate with clay and organic matter depends upon the type of cations and as a

polyprotic acid it has high affinity for trivalent cations such as Al3+

and Fe3+

[68].

Glyphosate sorption is found to increase with increase in surface area and soil pH

[69]. Average half life of glyphosate in soil is reported between 2-197 days [70] and

therefore its typical field half life is suggested of 47 days [30].

1.6.4 Fate of Glyphosate in Water

Glyphosate is believed to have low probability of leaching due to its high soil sorption

property but it has been detected in surface waters of irrigation channel near

application site in agricultural fields [71]. The binding capacity of glyphosate in soil

depending on soil, climatic and spray conditions might contaminate groundwater

through leaching [63, 65, 72]. Glyphosate has an estimated half life of 7-14 days in

surface water [70]. Glyphosate leaching has been reported in gravelly materials with

less retention capacity [73]. Moreover unnecessary irrigation or rainfall

instantaneously after application, washing and cleaning the tanks of the fumigation

machines in streams and adjacent water can also result in contamination of aquatic

systems [74, 75].

About 3% of the total applied glyphosate has been found in aquatic

environments [76]. France has declared the distribution and leaching of glyphosate in

water bodies as an environmental risk [77]. The long term study of pesticides

including glyphosate, conducted by Danish government revealed that concentration of

glyphosate (4.7 µg/L) in water drainage waterways near glyphosate treated sites was

five times higher than maximum contaminant limit (MCL) for glyphosate (0.1 µg/L)

in European Union conducts long-term monitor of a variety of pesticides, including

___ 1. Introduction

14

glyphosate [78]. Battaglin et al. found glyphosate (0.1-8.7 µg/L) in 36% of tested

water samples collected from 51 streams of Midwestern United States during growing

season in 2002 [79]. The presence of glyphosate in runoff from fields with different

crops and tillage practices was examined by Shipitalo and Owens. They found

maximum concentration of glyphosate (887 µg/L higher than US MCL of 700 µg/L)

during rainfall [80]. Moreover, glyphosate and AMPA are found among the

recurrently reported pesticides detected in water pollution monitoring [81]. Therefore

glyphosate leaches from sites of application to nearby water ways resulting in aquatic

toxicity.

1.6.5 Global Use of Glyphosate

Atrazine and metolachlor were most profoundly used global herbicides in 1970s. In

1995 about 60 million kg of these herbicides was applied on maize crop in U.S. [82].

51.3 million kg (113 million pounds) of glyphosate was applied by farmers globally in

1995. Global use of glyphosate in agricultural sector heightened with the introduction

of glyphosate tolerant crops. Glyphosate tolerant soybean, maize, and cotton varieties

were approved for planting in the U.S. in 1996 whereas glyphosate resistant corn was

introduced in 1998. These roundup ready crops contribute about 93% of soybeans,

82% of cotton, and 85% of corn to planted crops. Genetically engineered glyphosate

tolerant alfalfa and sugar beets were approved in 2005 and commercialized in 2008.

This breakthrough led to 14.6 fold increase in glyphosate use from 51 million kg (113

million pounds) in 1995 to 747 million kg (1.65 billion pounds) in 2014 encasing

about 1.4 billion hectares of cropland worldwide. Non agricultural use of glyphosate

has also boosted globally up to five folds from 16 million kg in 1995 to 79 million kg

in 2014. Total global use of glyphosate in agricultural and non-agricultural sectors

ascended more than 12 folds from about 67 million kg in 1995 to 826 million kg in

2014. This trend of glyphosate use was found adequate to treat 22 and 30% of

globally cultivated cropland. No such widely used herbicide has been reported in

history so far [82].

Various factors are involved in the elevated use of glyphosate after its

commercialization in 1974. Introduction of glyphosate tolerant crops has mushroomed

the use of glyphosate not only by increasing treatment area but also one time

application rate per hectare. In soybean sector of U.S. the glyphosate application

___ 1. Introduction

15

number mounted from 1.1 per crop year in 1996 to 1.52 in 2014 whereas single rate of

application increased from 0.7 kg/hectare (0.63 pound/acre) to 1.1 kg/hectare (0.98

pound/acre) simultaneously [82]. Emergence of less sensitive and glyphosate resistant

weeds has elevated the use of glyphosate on glyphosate tolerant crops [83]. Other

factors involved in the increased use of glyphosate include steady expansion in the

number of crops registered for use on glyphosate product labels, short half life in soil,

low leaching and transport potential in rhizosphere, absence of shikimate pathway in

animals and humans hence low toxicity, the adoption of no-till and conservation

tillage systems, the declining price per pound of active ingredient, new application

method and timing options [84-87].

1.6.6 Environmental Impact and Toxicity of Glyphosate

Excessive and continuous use of glyphosate is drastically effecting environment.

Once applied on crops, glyphosate enters in ground water due to its water soluble

properties. U.S. Geological Survey (USGS) found glyphosate content in air and water

samples during two growing seasons in states of Iowa and Mississippi and its higher

levels were observed during rainfall than for any other previously monitored

pesticide. Glyphosate is also found to turn down the pollinator habitats. It removes

milkweeds from crop fields which are key source of food for butterflies. Glyphosate

resistant crops grown in close proximity of organic crops increase the risk of genetic

cross-contamination, as pollens from glyphosate resistant crops have the potential to

drift to non resistant crops and produce offspring. Glyphosate is converted into more

toxic and persistent metabolite aminomethyl phosphonic acid (AMPA) which is found

persistent in soil and also effects human health (Figure 1-3).

___ 1. Introduction

16

Figure 1-3 Accumulation and distribution of glyphosate in environment.

Glyphosate sprayed on plants may directly enter the soil or absorbed by plants

through foliage and transported systemically to roots through phloem. From roots it

enters in soil and adsorbed by soil or degraded by microbes to

aminomethylphosphonic acid (AMPA). Glyphosate is also found in different plant

parts and taken up by herbivores. Glyphosate may be taken up by non-target plants

affecting their growth and resistance against pathogens. Glyphosate fate in soil

depends on soil type and presence of sorption surfaces. Glyphosate residues may

become part of animal feed through manure or end up to human consumption.

Fertilizers added to soil and glyphosate residues may enter aquatic system through

erosion or leaching and causes hardening of water. This hard water disturbs aquatic

life as well as human beings through drinking water. Glyphosate residues in soil may

enhance virulence of disease borne organism and disturb soil microflora. Glyphosate

consumed by human beings through inhalation or dermal absorption during spray may

adversely affect human health.

Glyphosate herbicides contain glyphosate as an active ingredient along with

certain additives (mostly surfactants). Richard et al. reported that sole glyphosate is

not as much toxic to humans as glyphosate in the form of its formulations [88].

Glyphosate herbicides were reckoned to be the reason of for pregnancy problems in

some agricultural workers [89]. Glyphosate was found to affect endocrine and human

placental JEG3 cells at concentrations lower than those used for agricultural purposes

[88]. Watts showed that glyphosate can change the DNA of sister chromatids in

human lymphocytes. In glyphosate formulations, different surfactants are used to

enhance glyphosate solubility and diffusion in plants [90]. Polyethoxylated tallow

___ 1. Introduction

17

amine (POEA) is a surfactant commonly used in glyphosate herbicides. It is found to

have toxic effects on human peripheral blood mononuclear cells (56.4 µg/mL

concentration at lab scale) [91, 92]. Moreover 0.5 and 10 µg/mL of glyphosate

concentration has been found to be toxic for human liver Hep G2 cells and also

disrupts the endocrine system of human beings [93]. Kimmel et al. reviewed a 2002

finding describing the role of glyphosate in cardiovascular defects during pregnancy

and found that glyphosate exposure does not pose potential risks for cardiovascular

defects during pregnancy [94]. Furthermore glyphosate and its formulations were

found to pose no genotoxic effects on human beings under normal conditions of

humans or environmental exposures [95]. Glyphosate is found to disturb gut

microflora by killing beneficial microbes and enhancing growth of pathogenic

bacteria in animals [96]. It is also reported to bind with iron and cobalt resulting in

suppression of cytochrome P450 (CYP) enzymes [97]. Schinasi and Leon reported

that there is a momentous relationship between non-Hodgkin lymphoma (NHL) and

occupational exposure of glyphosate [98]. In March 2015 the International Agency for

Research on Cancer (IARC) of World Health Organization (WHO) has placed

glyphosate in category 2A and classified it as possibly carcinogenic to humans on the

basis of epidemiological, animal and in vitro studies [99].

Glyphosate was claimed to be non toxic for terrestrial and aquatic animals by

Monsanto [100]. But different studies proved that it is toxic to non target organisms.

Carcinogenic effects on non human mammals include renal tubule carcinoma and

haemangiosarcoma incidence in male mice and prevalence of pancreatic islet-cell

adenoma in male rats [101]. Glyphosate is found to perturb aquatic communities as

compared to 2,4-D. Biodiversity of more than 25 animal species and algae of aquatic

environment were found to decrease up to 22% due to glyphosate exposure [102].

Soil ecosystem upholds different biological and biochemical processes and

soil microbes play an important role in accomplishment of these processes

(xenobiotics degradation, transformation and release of nutrients from complex

organic compounds). Agricultural practices used to enhance crop yield are seriously

affecting the quality and health of soil [103]. Although different parameters can be

employed to study these effects on soil but microbes are found to be more proficient

indicators [104]. Glyphosate toxicity to soil biota varies among different species and

organisms. Life span of some soil invertebrates such as springtail, Onychiurus

___ 1. Introduction

18

quadriocellatus and beneficial predatory mite, Amblyseius fallacies was found to

decrease due to toxic effects of glyphosate [105]. Glyphosate also pose risk to

beneficial insects and earthworms in soil [106, 107]. Repeated use of glyphosate (1

µg/g) also reduces beneficial microorganisms from soil such as saprophytic,

mycorrhizal fungi and nitrogen-fixing bacteria [108]. Glyphosate formulations

stimulate the growth of fungal pathogens causing diseases in plants.

Taking into account all aforementioned ramifications of intemperate use of

glyphosate on environment, there is a dire need to identify effective methods for its

detoxification. Various conventional methods such as photolysis, thermal

decomposition, incineration, chemical degradation, dispersion, diffusion and

volatilization, landfill, sedimentation, adsorption etc are available to remove

contaminants from the environment. But the limitations of these methods involve

formation of toxic products [109] as well as their costly, lengthy and environment

unfriendly nature [110]. In case of glyphosate, it is highly resistant to these non

biological methods due to the presence of stable C-P linkage [111]. Therefore use of

microorganisms able to degrade phosphonate compounds seems to be the appropriate

way out of this problem.

1.7 Biodegradation

Biodegradation is a natural attenuation process which involves utilization of

pesticides by microorganisms such as bacteria, fungi etc. as energy source via

conversion of pesticides into less toxic compounds. Soil is reported to hold more than

one hundred million bacteria (5000-7000 different species) and more than ten

thousand fungal colonies [112]. Removal of pollutants by using microorganisms is

safer and economical as compared to physic-chemical processes [113].

Biodegradation competence rely on different factors such as reactivity of pesticides in

the environment; condition of rhizosphere including soil type, precipitation, existence

of degrading microorganism, temperature, nutrient availability and pH of field; time

and method of pesticide application in fields [114].

The microorganisms required for biodegradation must have high survival rate

in the environment, pathogenicity and toxicity deficient, high herbicide degradation

efficiency irrespective of external environmental conditions and herbicide

mineralization capability without accumulation of toxic metabolites [115]. But these

___ 1. Introduction

19

requirements are not fulfilled concurrently. However such types of bacterial strains

are required to remove herbicides from contaminated sites in order to avoid their

leaching into ground water bodies. Moreover bioremediation procedures can be used

to remove herbicides in case of their leakage at production, storage and application

sites.

1.7.1 Biodegradation of Glyphosate

When glyphosate comes in contact with soil, it is inactivated after strongly binding

with soil particles. However soil microorganisms use it as energy source (C, P and N)

after degradation. Rate of biodegradation of glyphosate depends upon its persistence

in soil and diversity of soil microbes. Glyphosate biodegradation through soil

microbes is mostly carried out by two metabolic pathways [67] (Figure 1-4). First

pathway involves the cleavage of C-N bond of glyphosate by glyphosate

oxidoreductase (GOX) enzyme resulting in the production of aminomethylphosphonic

acid (AMPA) and glyoxylate. Glyphosate oxidoreductase is a flavoprotein which

utilizes FAD as a cofactor and this cofactor is reduced by glyphosate at its active site.

Oxygen is used as a cofactor under aerobic conditions while phenazine methosulfate

and ubiquinone are used as electron acceptors under anaerobic conditions. Glyphosate

oxidoreductase enzyme has been used for production of glyphosate resistant crops

[116]. Glyoxylate is a glyphosate degradation product and endogenous metabolite of

plants as well also engaged in different metabolic pathways [117]. AMPA is further

converted to methylamine through C-P lyase activity which is eventually converted to

formaldehyde by methylamine dehydrogenase enzyme [118]. Formaldehyde further

reacts with water or hydroxyl radicals and converted to methanol. Therefore

glyphosate biodegradation ultimately yields carbon dioxide, phosphate, ammonia and

methanol [119].

___ 1. Introduction

20

C-P lyase Glyphosate

oxidoreductase

Sarcosine Phosphate Aminomethyl

Phosphonic

acid

Glyoxylate

Sarcosine

oxidase

Glycine Formaldehyde Formaldehyde Phosphate

Phosphonatase

C-P lyase pathway AMPA pathway

Glyphosate

Figure 1-4 Pathways of glyphosate biodegradation.

One pathway involves the conversion of glyphosate into sarcosine by the action of

microbial C-P lyase gene. Sarcosine is further converted to glycine and formaldehyde.

Other pathway of glyphosate biodegradation encompasses the cleavage of C-N bond

resulting in production of aminomethyl phosphonic acid (AMPA). AMPA is further

degraded to phosphonoformaldehyde and formaldehyde by action of aminotransferase

and phosphonatase respectively.

Second pathway involves the degradation of glyphosate to sarcosine (N-

methylglycine) through C-P lyase enzyme activity [120]. This reaction is thought to

be a radical based redox dependent dephosphorylation, involving the formation of a

phosphonyl radical [121]. The activity of phn genes is regulated by Pho regulon and

their expression is synchronized by exogenous phosphate. Therefore activity of C-P

lyase gene is stimulated under phosphate starvation and microorganisms utilize

phosphonates as an alternative phosphorus source. Sarcosine is further converted to

glycine and formaldehyde by sarcosine oxidase activity. Formaldehyde enters the

tetrahydrofolate directed pathway of single carbon transfers and glycine is

metabolized to carbon dioxide and ammonia [65].

21

2. Materials and Methods

2.1 Chemicals Used in This Study

Technical (95%) and analytical (99.5%) grade standards of glyphosate were

purchased from Pak China Chemicals, Lahore, Pakistan and Chem Service (West

Chester PA) respectively. 4-chloro 3,5 dinitrobenzo trifluoride (99%) , boric Acid

(99.5%), potassium dihydrogen phosphate (99%), HCl (32%), and sodium tetraborate

decahydrate (99%) were procured from Sigma-Aldrich USA. Acetonitrile of HPLC

grade was purchased from Merck Germany. Rest of the chemicals utilized in bacterial

growth media preparation was obtained from Merck. Enzymes, PCR and cloning kits

used in molecular analysis were acquired from Fermentas.

2.2 Bacterial Strains Used in This Study

Glyphosate tolerant/degrading bacterial strains were isolated from glyphosate

contaminated soil samples collected from Pakistan and Australia (Table 2.1).


22

Table 2.1 Glyphosate tolerant/degrading bacterial strains isolated in current

study.

Name of the Bacterial Strain Source Country of

Origin

Shinella granuli strain Sq11 Glyphosate contaminated

soil

Pakistan

Lysobacter sp. Sq12 Glyphosate contaminated

soil

Pakistan

Paracoccus sp. Sq13 Glyphosate contaminated

soil

Pakistan

Bacillus cereus strain Sq14 Glyphosate contaminated

soil

Pakistan

Lysinibacillus boronitolerans strain

Sq15

Glyphosate contaminated

soil

Pakistan

Pseudoxanthomonas indica strain

Sq16


soil

Pakistan

Micrococcus endophyticus strain

Sq17


soil

Pakistan

Alcaligenes sp. Sq18 Glyphosate contaminated

soil

Pakistan

Bacillus safensis strain Sq19 Glyphosate contaminated

soil

Pakistan

Ochrobactrum intermedium strain

Sq20


soil

Pakistan

Staphylococcus haemolyticus strain

Sq21


soil

Pakistan

Dokdonella ginsengisoli strain Sq22 Glyphosate contaminated

soil

Pakistan

Inquilinus limosus strain Sq23 Glyphosate contaminated

soil

Pakistan

Pseudomonas straminea strain P1 Glyphosate contaminated

soil

Australia

Comamonas odontotermitis strain

P2


soil

Australia

Ochrobactrum anthropi strain P3 Glyphosate contaminated

soil

Australia

Achromobacter spanius strain P4 Glyphosate contaminated

soil

Australia

Agrobacterium tumefaciens strain

P5


soil

Australia


23

2.3 Soil Sample Collection

Soil samples were collected from fields of Ayub Agricultural Research Institute

(AARI) Faisalabad, Pakistan and Plant Breeding Institute, University of Sydney at

Cobbitty, NSW Australia. The collected soil samples had a long history of exposure

to widely used herbicide glyphosate consequently making this soil a crucial source for

isolation of glyphosate tolerant/degrading bacterial strains.

2.4 Growth Media

Growth media used in this study were Luria Bertani (LB), Minimal Salt Medium

(MSM), Enrichment medium (C and P free medium), Minimal medium (P free

medium). The compositions of all growth media are given in appendices.

2.5 Maintenance and Preservation of the Isolated Bacterial

Strains

Glyphosate tolerant bacterial isolates were preserved as glycerol stocks and agar

slants. Glycerol stocks (50% v/v) were prepared by adding bacterial cultures grown in

LB broth in eppendorfs containing 50% glycerol under aseptic conditions. The stocks

were kept at -80 °C for months. Agar slants or stab stocks were prepared from LB

agar, inoculated with bacterial strains, incubated for 16 h at ambient temperature and

preserved at 4 °C.

2.6 Equipments Used in Current Study

The majority of the facilities and equipments used in current study were available at

NIBGE. These included Spectrophotometer; High Performance Liquid

Chromatography (HPLC) Varian Pro Star 325, UV VIS detector; Eppendorf

centrifuge machines (models 5424 and 5816); Biorad Thermocycler;

Stereomicroscope; Rotary shaker; Light microscope. DIONEX High Performance

Liquid Chromatography (HPLC) and NanoDrop 2000c spectrophotometer was

availed at University of Sydney, Australia. DNA sequencing was carried out using

commercial sequencing facility of Macrogen, South Korea, until otherwise

mentioned.


24

2.7 Enrichment of Glyphosate Tolerant Bacterial Strains

Soil samples were collected from the fields of Ayub Agriculture Research Institute

Faisalabad having prior history of extensive exposure to glyphosate. Samples were

collected at 10-15 cm depth from three different areas of same field, mixed together,

transferred to sterile plastic bags and stored at 4 °C. The soil was air dried and sieved

using a 2 mm mesh prior to its use. Enrichment culture technique was employed for

isolation of glyphosate tolerant bacteria under the selective pressure of herbicide

[122]. Soil (5 g) was added in 250 mL Erlenmeyer flask containing a mixture of 50

mL of mineral salts medium (MSM) and 1000 mg/L glyphosate and the flasks were

incubated on a rotary shaker at 100 rpm for one week at 37 °C. Same procedure was

repeated by taking 1 mL of supernatant from enrichment culture and transferred to

fresh MSM containing 1000 mg/L glyphosate and incubated under same conditions.

This process was repeated for four weeks.

2.8 Isolation of Glyphosate Tolerant Bacterial Strains

The enrichment culture obtained after four weeks was further used for isolation of

glyphosate tolerant strains. Enrichment cultures were serially diluted (10-1

to 10-7

) in

saline solution (0.9%) and selected dilutions 10-5

, 10-6

and 10-7

of each culture were

used to spread (100 µL) in triplicates on solid LB agar plates containing 100 mg/L

glyphosate. The plates were incubated at 37 °C for 2 days and colonies with different

morphologies were isolated and sub-cultured on nutrient agar plates and bacterial

colonies with distinct morphology were observed.

2.9 Glyphosate Tolerance of Bacterial Isolates

The growth and glyphosate tolerance of bacterial isolates was monitored in liquid

MSM supplemented with 100 mg/L glyphosate as carbon and energy source. To

evaluate the growth of isolated strains, they were added individually in sterile MSM

containing 500 mg/L glyphosate with 2% inoculum in 250 mL Erlenmeyer flasks

along with respective negative controls. The flasks were placed in a shaker incubator

at 37 °C and 100 rpm, and after 72 hours, their absorption was measured by the

spectrophotometer at 590 nm wavelength. The growth of isolates was measured after

5 days of incubation to select the best isolates in the presence of glyphosate.

Turbidometric method was employed for monitoring the growth of inoculated


25

bacterial strains [123]. Cell dry mass of the bacterial cultures having an OD (optical

density at 600 nm) of 1.0 was calculated and was used as standard for calculating cell

dry mass of all the culture samples.

After five days of incubation, bacterial cultures were harvested and herbicide

residues were derivatized and analyzed by quantifying its residual concentrations on

HPLC. Preeminent tolerant bacterial strains were characterized and employed for

further degradation studies.

2.10 Morphological Characterization of the Bacterial

Isolates

2.10.1 Morphological Characterization

Morphological characterization of bacterial isolates was carried out by studying their

morphological characteristics (size, margins, shape and surface texture) and

microscopic features (pigmentation, motility and gram stain) as per the standard

procedures [124].

2.10.2 Gram Staining Method

The concentrations and compositions of all reagents used in Gram‟s method of

staining e.g., crystal violet solution (staining reagent), iodine solution (mordant) and

safranin solution (counter stain) are illustrated in Appendix F.

Following procedure was used for gram staining of bacterial isolates:

Bacterial strains were streaked on LB agar plates and incubated at 37 C overnight.

Single colony of each bacterial strain was selected in sterile conditions and mixed

with a drop of saline (0.9%) to make a thin smear on a glass slide.

The slide was air dried, fixed through heat and flood with primary crystal violet

staining reagent for 1 minute.

The smear was washed with gentle and indirect stream of distilled water for 2

seconds.

Then slide was flooded with iodine solution for 1 minute.

The slide was exposed to distilled water for 2 seconds and decolorizing agent (70%

ethanol) was applied for 30 seconds.


26

The glass slide was again washed with distilled water for 2 seconds and counter

stain, safranin staining reagent was applied for 1 minute.

Glass slide was washed with gentle and indirect stream of distilled water until

effluent seemed colourless and then dried with absorbent paper.

The stained bacterial isolates were observed under oil immersion using a Bright

field microscope.

2.11 Molecular Characterization of Isolated Bacterial

Strains

2.11.1 DNA Isolation

CTAB (Cetyl Tri-methyl Ammonium Bromide) Method reported by Mateen [125]

was used for DNA isolation of bacterial isolates and procedure is described as

follows:

Bacterial isolates were inoculated in MSM containing glucose at 37 C overnight

and harvested by centrifugation at 8000 rpm for 10 minutes.

Cell pellet was resuspended in 5 mL T.E buffer and lysozyme (20 mg) was added

to this solution.

The resulting suspension was incubated at 37 C for 5 minutes in water bath.

After that 500 µL of 10% SDS, 25 µL proteinase K (25 mg/mL) and 3 µL RNAase

were added to the suspension.

It was thoroughly mixed and again incubated at 37 C for 10 min in water bath.

Then 0.9 mL 5 M NaCl and 0.75 mL NaCl/CTAB were added thoroughly mixed

and incubated at 65 C for 20 min.

The protein contents of the bacterial suspension were extracted (twice) with an

equal volume of phenol-chloroform-isoamyl alcohol (25:24:1) and centrifuged at

8000 rpm and 4 °C for 10 min in order to separate the organic and aqueous phase

(containing DNA).

Aqueous phase was separated in fresh falcon tube and 0.6 volume of isopropanol

was added and thoroughly mixed until a white DNA thread appeared in the

solution. The solution containing DNA was stored at -20 °C overnight.

The solution containing DNA was centrifuged at 8000 rpm for 5 min next day and

supernatant was discarded.


27

DNA pellet was washed with 70% ethanol two times and dried at room

temperature.

Dried DNA pellet was resuspended in 50 µL T.E and saved at -20 °C until used.

2.11.2 Amplification of 16S rRNA Gene from Isolated Bacterial

Strains

16S rRNA gene analysis was carried out by amplifying this gene from all bacterial

isolates using forward primer FD1, 5-AGAGTTTGATCCTGGCTCAG-3 (E. coli

bases 8-27) and reverse primer RP1, 5-ACGGHTACC TTGTTACGACTT-3 (E. coli

bases 1507-1492) [126]. PCR reactions were performed in 50 µL reaction volumes

containing 25 µL of 2X Dreamtaq PCR master mix, 2 µL of each of the primers (10

µM), 2 µL of bacterial DNA and 19 µL of sterile distilled water. Thermal cycler

(Biorad) was used for amplification and thermocycling conditions consisted of a

denaturation step at 94 °C for 10 min, 30 amplification cycles at 94 °C for 30 s, 55 °C

for 25 s and 72 °C for 90 s and a final extension at 72 °C for 10 min. QIAQuick spin

column (QIAGEN) kit was used for purification of PCR product.

2.11.3 Agarose Gel Electrophoresis

The amplified PCR products were examined on 1% agarose gel stained with ethidium

bromide (100 μg/mL). PCR products were mixed with 6X loading dye (bromophenol

blue), loaded on the agraose gel and electrophoresed in 0.5X TAE buffer at 80-100

volts for about 30 to 45 minutes. Then gel was visualized under UV transilluminator

for analyzing the PCR products.

2.11.4 Ligation and Cloning of 16S rRNA Gene

PCR products of 16S rRNA gene were ligated into TA cloning vector obtained from

PCR Product cloning Kit of Fermentas) and the ligation mixtures were kept at 16 °C

for 16 h. The competent cells of E. coli were used for transformation of ligation

mixtures following heat shock method next day. Mini prep kit (Fermentas) was used

to isolate plasmids from E. coli and restricted with EcoRI (restriction enzyme,

Fermentas) to authenticate the insert size.

2.11.5 Sequencing of 16S rRNA Gene and Bacterial Identification

The cloned PCR products were sequenced with M13 primers and resulting sequences

were submitted to BLAST software (version 2.2.12) for homology studies. By using


28

Molecular Evolutionary Genetics Analysis (MEGA) software, version 6.0 was used

for multiple alignments and distance matrix analyses and consensus neighbor joining

tree construction.

2.12 Bacterial Diversity Assessment through PCR-DGGE

For analysis of bacterial diversity PCR-DGGE was carried out as described by

Cunliffe and Kertesz [127]. The primers used for DGGE PCR were GC-341F (with

GC clamp at 5')

(CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGG

AGGCAGCAG) and 518R (ATTACCGCGGCTGCTGG) [128]. The PCR profile

includes the following steps.

1. 95 °C for 5 min

2. 95 °C for 30 sec

3. 60 °C for 30 sec (touchdown -1 °C/cycle)

4. 68 °C for 30 sec (10 cycles from step 2)

5. 95 °C for 30 sec

6. 50 °C for 30 sec

7. 68 °C for 30 sec (20 cycles from step 5)

8. 68 °C for 5 min

2.12.1 DGGE Gel Casting and Running

After the preparation and mixing of 0% denaturant solution and 100% denaturant

solution, the gel was casted immediately as it starts to polymerize due to the presence

of APS.

Glass plates (large & small) along with spacers was washed with 70% ethanol,

fixed with sandwich clamps and consigned on the casting stand.

Gel solution of both concentrations was filled in two 50 mL syringes and they

were fixed to gradient maker. It was kept in mind that there should be no air

bubbles in the syringes and the tubes.

A syringe needle was connected with the syringe tubes and fixed at the middle of

the gel chamber. The hand of gradient maker was constantly rotated during gel

casting.


29

The comb was washed with 70% ethanol and placed it into the gel chamber while

avoiding air bubbles. The gel was left to solidify for two hours.

After two hours, the comb was removed from gel and wells were washed with

deionized water.

The core was placed in the DGGE tank filled with 6 L of 1X TAE buffer and

circulation was started to warm the buffer up to 60 °C for 30 minutes.

After attaining the acquired temperature, core was removed from tank and gel was

attached to it.

The core was placed in tank and gel was washed with 1X TAE buffer.

The samples were loaded in the gel and tank was filled with 1X TAE buffer up to

the mark. The gel was run at 63 V for 16 hours.

2.12.2 DGGE Gel Staining

The gel was removed from core and placed on plastic tray.

20-40 mL of the SYBR Gold staining solution (light sensitive) was poured onto

the gel until it covered the whole gel. The tray was placed in dark room or covered

with aluminium foil and left for 30 minutes in the dark.

The gel was rinsed with deionized water for several times after 30 minutes and

deionized water was added to the tray. Left it for 10 minutes in the dark and then

visualized under transilluminator.

2.12.3 Excision and Re-amplification of DGGE PCR Fragments

Selected DGGE bands were excised from the gel and soaked in MilliQ H2O for 24

hours at 4 °C. The supernatant was used for re-amplification with same DGGE

primers without GC clamp. The PCR products were purified and sequenced from

Australian Genome Research Facility Ltd. DGGE sequences obtained were compared

with DNA database using NCBI BLAST and submitted in Genbank.

2.13 Inoculum Preparation of Bacterial Strains

The glyphosate tolerant bacterial strains were inoculated in MSM medium containing

500 mg/L of glyphosate in Erlenmeyer flasks at 37 °C on a rotary shaker for two days.

Then the grown bacterial culture was centrifuged at 4600×g for 8 to 10 minutes and

used as inoculum. The cell pellet was washed with saline solution (0.9%) and


30

resuspended to acquire an optical density (OD at 600 nm) of 0.8. The dilution plate

count method was used to determine colony forming units (CFU/mL). The suspension

(2% v/v) obtained was further used as inoculum in biodegradation experiments until

otherwise depicted.

2.14 Glyphosate Degradation Studies

Glyphosate degradation studies were done using 250 mL Erlenmeyer flasks

containing 100 mL of MSM enriched with 500 mg/L glyphosate and 2% inoculum of

degrading strains under different culture conditions as described in respective

sections. The flasks were incubated in rotary shaker of 100 rpm at 37 °C (or at other

temperatures according to the respective experiment conditions) for one week. For all

the treatments, uninoculated flasks were used as control and all the experiments were

executed in triplicates. Samples from flasks were collected from time to time for

investigating the growth rates of bacterial strains and residues of glyphosate.

2.15 Detection of Glyphosate

2.15.1 Detection Wavelength of Glyphosate

Although the chromatographic conditions were followed as described by Qian et al.

[129] but for further corroboration, optimum wavelength (λmax) of glyphosate

derivative was determined spectrophotometrically. λmax was measured by recording

wavelength of glyphosate derivative at maximum UV absorption and also estimated

using HPLC and comparing the absorbance of the derivative at about three different

wavelengths.

2.15.2 Derivatization of Glyphosate

Detection of glyphosate is difficult due to its low molecular weight, low volatility,

high water solubility and lack of chromophores or fluorophores that could facilitate its

detection therefore glyphosate was derivatized with 4-chloro-3, 5-

dinitrobenzotrifluoride (CNBF) and quantified by HPLC.

The bacterial cultures harvested after specific intervals were centrifuged for 10

minutes at 12,000 rpm and supernatant was used for derivatization. The derivatization

procedure was performed as described by Qian et al. [129]. Supernatant (200 µL)

containing glyphosate was added to a vial containing a mixture of 300 µL of H3BO3-


31

Na2B4O7 buffer (mixture of 0.2 mol/L H3BO3 solution with 0.05 mol/L Na2B4O7,

pH: 9.5) and 100 µL of CNBF methanol solution (2.5 mmol/L). Then the entire

solution was diluted to 1 mL with ddH2O and incubated at 60 °C for 30 min. HCl (2

M, 10 µL) was added to knock down the reaction. The resulting solutions were

filtered through 0.45 µm nylon filters and injected in the chromatographic system.

Each sample was analyzed in triplicate and all the assays were consummated at

ambient temperature.

2.15.3 HPLC Conditions for Glyphosate Residual Analysis

For HPLC analysis, Kromasil ODS C18 column was used and pre-equilibrated with

the mobile phase for 30 min. The mobile phases used in the analysis were phosphate

buffer (50 mM, pH: 2.5 with phosphoric acid) (eluent A) and acetonitrile:water (1:1,

v/v, eluent B). All the solvents were filtered through a 0.45 µm membrane filter and

the program was set for a linear gradient starting from 20% of eluent B to reach its

100% at 30 min. The detector used was Photodiode array detector and the sample

injection volume was 20 µL at flow rate 1 mL/min. The detection wavelength was

360 nm. Retention time of glyphosate was calculated by running its standards

solutions [122]. Unit method was employed to measure the concentrations of

glyphosate in inoculated and non-inoculated control samples.

2.16 Study of Potential Genes in Glyphosate Tolerant

Bacterial Strains

2.16.1 Amplification of Glyphosate Resistant and Degrading Genes

Degenerate primers were designed and synthesized to amplify the potential genes

involved in glyphosate degradation/resistance from glyphosate tolerant bacterial

isolates. Primers were designed by retrieving already reported sequences of 5-

Enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene, glyphosate

oxidoreductase gene (GOX), C-P lyase encoding gene (PhnJ) from NCBI GenBank.

The sequences were aligned through ClustalW software and conserved regions of the

sequences were utilized for primer designing. Furthermore degenerate bases were

added in case of mismatches between aligned gene sequences. The parameters of

primers were validated by using OligoDT software. The sequences of the designed

primers are given in Table 2.2.


32

PCR reactions were carried out in reaction volumes of 25 µL containing

Taq DNA polymerase (0.5 µL, 2.5 U/µL), 10X PCR reaction buffer (2.5 µL),

forward and reverse primers (0.75 µL each, 10 µM), bacterial genomic DNA (1

µL) and sterile PCR water (19.5 µL). The PCR protocol was: denaturation at 94 C

for 1 min, annealing at 52-65 C (on the basis of Tm of primer pairs) for 1 min,

extension at 72 C for 90 s, all steps were repeated for 35 cycles and a final

extension at 72 °C for 10 min.

2.16.2 Agarose Gel Electrophoresis, Cloning and Sequencing of the

Amplified Genes

The PCR products were analyzed on agarose gel (1%) on the basis of their size in

base pairs. Same protocol was followed as described in Section 2.11.3 for 16S rRNA

gene.

The purification of amplified PCR products was done by using PCR

purification kit (Fermentas), ligated to PTZ vector and transformed in E. coli DH5

through heat shock method. Plasmids were isolated from transformants by mini prep

kit (Fermentas). Isolated plasmids were digested with suitable restriction enzymes to

confirm the amplicon product size. The plasmids were sequenced and then analyzed

using the BLASTN search program of the GenBank database in National Center for

Biotechnology Information, NCBI.

33

2. M

aterials and M

etho

ds

Table 2.2 Sequences of primers designed by aligning the already reported glyphosate resistant and degrading genes.

Primer Sequence Product

size

Genes amplified by

primers

OBAro1-F

OBAro1-R

5' ACGCTCTAGAATGTCCCATTCTGCAYCCC 3'

5' TTAAGGATCCTCATYGCGCGTYGCTCARYTC 3'

1353 bp EPSPS gene

(glyphosate

resistance)

GOX209-F

GOX1180-R

5' TGCCKAAGTGGCTSCTYGAC 3'

5' ACGAGSGTTGCRGTSATCGG 3'

900 bp GOX gene

(glyphosate

degradation)

Gox445-F

Gox974-R

5' GCAGACTTCGCCAAGGAC 3'

5' CAGTTAGGAGCGGCTGTGAG 3'

529 bp

GOX gene

(glyphosate

degradation, Nested

primers)

phnJ208-F

phnJ1921-R

5' ATGCCRMTGCCYTAYGGHTG 3'

5' TWASGGCGGMAYSGCRTAGA 3'

580 bp phnJ gene

(glyphosate

degradation)

34

3. Isolation and Characterization of

Glyphosate Resistant Bacterial Strains

3.1 Introduction

Glyphosate is a glycine derivative and belongs to the group of amino acid inhibitor

herbicides. It is distinguished from organophosphorus compounds by the presence of

a stable covalent carbon to phosphorus (C-P) bond that is resistant against chemical

hydrolysis, thermal decomposition and photolysis [121]. Since 1970, it has been

widely used as weedicide and crop dessicant in the form of various formulations [53,

130]. Glyphosate exhibits its herbicidal activity by halting the penultimate step of

aromatic amino acid synthesis pathway (shikimate pathway) [131]. Phenylalanine,

tyrosine and tryptophan synthesized through this pathway are further involved in

protein synthesis as well as secondary metabolite production (phenolics, lignins,

tannins, and other phenylpropanoids). This pathway is present in bacteria, algae,

fungi, apicomplexan parasites and plants but absent in animals which attributes to the

effective use of glyphosate as herbicide. Glyphosate acts in systemic manner as it

permeates through the surface of plant leaves to the whole plant by dint of phloem

and amasses in meristematic cells [132]. Inhibition of shikimate pathway leads to the

obstruction of physiological processes inside the plant resulting in chlorosis, growth

stunting and consequent plant death [87]. Shikimate pathway works in cytosol of

fungi and bacteria whereas in case of plants it is also found in plastid organelles.

Microorganisms use more than 90% of their metabolic energy for protein synthesis

whereas plants use more energy on secondary metabolite production. About 30%

carbon fixed by plants flows through shikimate pathway at normal growth conditions.

The shikimate pathway is indispensable for plants as well as for pathogenic

microorganisms as Streptomyces pneumonia strains [133], Bordetella bronchiseptica

[134], Mycobacteria [135] , Thermotoga gondii [136] and Plasmodium falciparum

[137] which makes it a potential antimicrobial target.

3. Glyphosate Resistant Bacterial Strains

35

3.1.1 Glyphosate Resistance

The introduction of glyphosate resistant transgenic soybean in 1996 led to the colossal

use of glyphosate. Since glyphosate can be used as post emergent herbicide in case of

glyphosate resistant crops therefore they have been promptly adopted. More than 90%

of total soybean, >75% of total cotton and >70% of total maize cultivated in USA was

glyphosate resistant in 2010 [138]. Powles claimed that glyphosate is one in a century

herbicide encompassing the same importance in food production as possessed by

penicillin for combating diseases [139]. The efficiency of glyphosate to remove vast

variety of weeds, low price and less toxicity contributed to its extensive use [56, 140].

Additionally, cessation of glyphosate patent in 2000 escorted different manufacturing

companies to immense production of glyphosate resulting in lower price and

substantial adoption.

The possible mechanisms involved in glyphosate resistance are: (a) Evolution

of resistance due to selection pressure from extreme use of glyphosate without

modifying mode of action of glyphosate, (b) target site resistance through substitution

of amino acids which influence glyphosate interactions with target enzyme, (c)

metabolism of glyphosate either by conjugation or degradation, (d) non target

resistance through changes at molecular or physiological level. Target site resistance

and glyphosate detoxification has been found thriving for introduction of glyphosate

resistance in crops. EPSPS acquired from A. tumefaciens CP4 or double mutated

EPSPS (TIPS) insensitive to glyphosate have been effectively used for commercial

production of glyphosate resistant crops. The speculative shortcoming of this strategy

is that glyphosate pile up in growing points of plants thus impeding reproductive

growth and lowering crop yield [141]. The metabolic detoxification of glyphosate

through plant enzymes or transgene encoded enzymes may help in elimination of

glyphosate residues and robust glyphosate resistance.

3.1.2 5-Enolpyruvylshikimate-3-Phosphate Synthase (EPSPS, EC

2.5.1.26)

The unearthing of EPSPS as glyphosate target enzyme impelled scientists to study its

structure, function and catalytic mechanisms in detail [131]. EPSPS catalyzes the

reaction between phosphoenolpyruvate (PEP) and shikimate-3-phosphate (S3P)

resulting in production of enolpyruvyl shikimate-3-phosphate (EPSP) and inorganic


36

phosphate [142]. This reaction is sixth step of aromatic amino acid synthesis pathway,

shikimate pathway. Previously, only MurA bacterial enzyme (involved in bacterial

cell wall synthesis) has been reported to catalyze similar reaction. Glyphosate acts as

a competitive inhibitor of EPSPS binding adjoining to S3P in the PEP binding site

configuring a stable non-covalent ternary complex of EPSPS-S3P-glyphosate [143,

144]. The inhibition of EPSPS by glyphosate is uncompetitive with respect to S3P

[143] (Figure 3-1). Consequently, the shikimate pathway is hindered by either

reduced amounts of EPSPS or lacking of EPSPS functionality resulting in reduced

synthesis of aromatic amino acids and their derivatives [145].

Figure 3-1 Inhibition of penultimate step of shikimic acid pathway by

glyphosate.

Glyphosate hampers the conversion of S3P and PEP to EPSP resulting in scarcity of

aromatic amino acids [146].

First X-ray crystallography studies of EPSPS of E. coli demonstrated that it

has two globular domains each having three similar folding units tied to each other via

a two stranded hinge region [147]. Further studies showed that reaction of EPSPS

pursue induced fit mechanism, in which both globular domains move towards each

other in a screw like manner after S3P binding [58]. This changeover generates a

restrained and highly charged surroundings in the vicinity of hydroxyl group of S3P

where PEP or glyphosate bind. One more high resolution study revealed that

glyphosate and PEP share the identical binding site with similar binding interactions

[148]. Similar structural properties were also reported in EPSPS of S. pneumoniae

[149] and Agrobacterium sp. [150].


37

3.1.3 Classification of EPSP Synthase

EPSPS has been categorized into four distinctive classes: Class I [151], Class II [152],

Class III [153] and Class IV [154] depending on its sensitivity towards glyphosate

concentrations. Naturally glyphosate sensitive Class I EPSP synthases are found in

some bacteria such as Escherichia coli and Salmonella enterica serovar

Typhimurium, Pseudomonas putida and all green plants [155, 156]. They have been

expansively characterized for enzyme active site and kinetics [58]. Catalytic activity

of such enzymes is interrupted at low (micromolar) glyphosate concentrations. Class I

EPSP synthases have a conserved amino acid motif (LFLGNAGTAMRPL) inside the

PEP binding pocket [157-159]. In contrast, catalytic activity of class II EPSP

synthases found in some bacteria including Pseudomonas sp. PG2982, Agrobacterium

tumefaciens CP4, Achromobacter sp. strain LBAA, Bacillus subtilis, Ochrobactrum

anthropi, Streptococcus pneumonia, Staphylococcus aureus is retained even at high

glyphosate concentrations [160]. They also have high affinity for the substrate PEP

[161] and hence are significantly helpful in developing glyphosate tolerant crops; e.g.,

soybeans, maize, cotton, etc. Glyphosate tolerant crops thus facilitate effective weed

control through post emergent herbicide application on such crops. Class II EPSPS do

not cross react with the polyclonal antibodies against Class I EPSPS and have <50%

amino acid similarity to class I enzymes [162]. Following five conserved amino acid

motifs GDKX, SAQXK, RXHXE, NXTR and RPMXR (X represents non conserved

amino acids) have been reported to contribute in glyphosate resistance in class II

EPSPS [163].

3.1.4 History and Engineering of Glyphosate Resistant EPSPS

High specificity of glyphosate towards EPSPS has exceedingly augmented its

application as herbicide. Even MurA instead of encompassing similarities with

EPSPS is not considerably hindered by glyphosate. Therefore it is not just an analog

of PEP but imitate intermediate state of PEP. Many glyphosate analogs have been

synthesized but no one showed significant inhibition of EPSPS due to changes in

chemical structure [53]. Scientists have strived for identification of EPSPS resistant to

glyphosate for development of glyphosate resistant crops since 1980s [152, 158].

Various glyphosate resistant EPSPS were identified through microbial screening, site

directed mutagenesis and selective evolution [149, 155, 158, 160, 164-167].

Glyphosate and PEP shares same binding site therefore improved glyphosate


38

resistance most commonly results in reduced affinity of EPSPS towards PEP leading

to significant fitness cost.

Single Site Mutation

The first single mutations, P101S and G96A, conferring resistance to glyphosate were

reported in EPSPS from S. typhimurium [168] and K. Pneumonia [169] respectively.

The EPSPS from E. coli harbouring single mutation of G96A has been found highly

resistant to glyphosate owing to the overhanging of methyl group in binding site. But

this mutation has severely reduced affinity of EPSPS for PEP and its catalytic activity

[166]. In contradiction to G96A mutation, P101S is positioned away (about 9 Å) from

glyphosate binding site and its substitution results in slight changes in active site.

Therefore it exhibits low glyphosate resistance while sustaining high catalytic activity

and low fitness cost as compared to active site mutations. Naturally glyphosate

resistant plants have been found to contain single mutation consistently at site

analogous to Pro101 of EPSPS from E. coli [159, 170-173].

Multi Site Mutation

More than one mutation accompanying favourable characteristics were reported in

EPSPS from P. hybrid (G101A/G137D and G101A/P158S) [174], E. coli

(G96A/A183T) [175, 176] and Z. mays (T102I/P106S) [175, 177, 178]. The double

mutant (T102I/P106S analogous to T97I/P101S in E.coli), designated as TIPS EPSPS,

with favourable characteristics has been used for production of glyphosate resistant

maize (commercial field corn). The only glyphosate resistant class I EPSPS reported

so far is TIPS EPSPS from E. coli and has high affinity for PEP. X-ray

crystallography analysis revealed that double mutation in TIPS EPSPS moves G96

towards glyphosate whereas I97 reallocates away from binding site consequently

aiding in PEP utilization [157]. Agrobacterium sp. strain CP4 has been reported to

yield an efficient glyphosate resistant EPSPS designated as CP4 EPSPS. It has also

been utilized for production of glyphosate resistant crops (Roundup Ready, NK603)

[152]. The CP4 EPSPS belongs to the class II EPSPS and its catalytic activity

depends on monovalent cations (K+

and NH+4

). High resistance against glyphosate is

ascribed to the presence of A100 and L105 residues instead of G96 and P101 residues

found in plants and E. coli. Although binding of PEP is not affected by A100 but

glyphosate prefer to bind in high energy and non inhibitory conformation. By


39

replacing A100 with glycine, the sensitivity of glyphosate can be restored partially

[138].

3.1.5 Glyphosate Detoxification

Another approach used for introduction of glyphosate resistance is detoxification of

glyphosate compound. Two different pathways are employed by soil microbes for

metabolism of glyphosate. First pathway is C-P lyase pathway which involves

cleavage of the C-P bond present in glyphosate leading to the production of sarcosine

and inorganic phosphate. This pathway is catalyzed by C-P lyase. Second pathway is

AMPA pathway which involves the oxidative cleavage of C-N bond leading to the

production of aminomethylphosphonic acid (AMPA) and glyoxylate. This pathway is

catalyzed by glyphosate oxidoreductase (GOX). None of these pathways has been

found to transpire in higher plants to a considerable level. C-P lyase pathway needs

phn operon which consists of 14 genes rendering its regulation difficult in transgenic

plants. AMPA pathway has been found most predominant among soil microbes for

glyphosate degradation. Another enzyme, Glycine oxidase (GO) from B. subtilis has

been reported to utilize glyphosate yielding AMPA and glyoxylate [138].

The current study was premeditated to isolate and characterize glyphosate

tolerant strains from indigenous soil and screen for the presence of EPSPS encoding

gene(s). A glyphosate resistant strain Ochrobactrum intermedium Sq20 was isolated

from the soil obtained from agricultural fields where glyphosate had been frequently

applied. Moreover, in this strain, aroAO.intermedium Sq20 gene was sequenced and

EPSPSO.intermedium Sq20 was characterized thereafter by means of bioinformatics tools.

3.2 Materials and Methods

3.2.1 Enrichment, Isolation and Screening of Glyphosate Tolerant

Bacterial Strains

Soil was collected from the fields with a previous history of extensive glyphosate

exposure. Enrichment culture technique was employed for isolation of glyphosate

tolerant bacterial strains (chapter 2, section 2.7, 2.8) and 13 isolates were obtained.

The growth of isolated bacterial strains at high glyphosate concentrations (up to 2

g/L) in LB was monitored by using a turbidometric method [123]. Glyphosate

tolerance by these isolates was also checked on MSM agar plates supplemented with


40

2 g/L glyphosate as the sole carbon and energy source. Simultaneously, residual

glyphosate in MSM cultures containing glyphosate (500 mg/L) as sole

carbon/phosphorus source was measured to find the potential of the isolated bacteria

for glyphosate degradation. A glyphosate tolerant bacterial strain Sq20 was thereafter

selected for further studies.

3.2.2 Morphological and Taxonomic Analysis of Glyphosate

Tolerant Bacterial Isolates

The standard morphological and taxonomic methods were used for characterization of

glyphosate tolerant bacterial strains (chapter 2 Section 2.10).

3.2.3 Amplification and Sequencing of aroAO.intermedium Sq20 Gene

Degenerate primers OBAro1For 5′-ACGCTCTAGAATGTCCCATTCTGCAYCCC-

3′ (Y=C/T) and OBAro1Rev 5′-TTAAGGATCCTCATYGCGCGTYGCTCARYTC-

3′ (R=A/G) were designed through alignment of already known aroA gene sequences

of Ochrobactrum spp (GenBank accession No. GU992200, CP000758,

ACQA01000001). Using these primers, full length aroAO.intermedium Sq20 gene was

amplified whereby PCR conditions were, denaturation at 94 °C for 10 min, 30

amplification cycles at 94 °C for 1 min, 59 °C for 1 min and 72 °C for 90 s and a final

extension at 72 °C for 10 min. The PCR product (1.353 Kb) was purified through

PCR purification kit (Fermentas) and cloned in a pTZ57R/T vector under T7 promoter

by using specific restriction sites (XbaI and BamHI). Then plasmids were isolated

from clones using mini prep kit (Fermentas), and digested with XbaI and BamHI

restriction enzymes to confirm the insert size. The plasmids were sent to commercial

sequencing facility of Macrogen, South Korea for sequencing. The sequences

obtained were analyzed through BLASTN program of the GenBank database in NCBI

and submitted in Genbank.

3.2.4 Tolerance/ Degradation of Glyphosate by Sq20

Biodegradation studies of glyphosate were performed by incubating MSM augmented

with Sq20 inoculum (2%), glucose (1%) and 500 mg/L glyphosate for 5 days along

with negative and positive controls. Samples were collected at 8 h intervals for

analyzing the growth and biodegradation through BioTek Microplate Reader and

HPLC respectively. The bacterial cultures were centrifuged for 10 min at 12,000 rpm

and the supernatant was used for residual glyphosate analysis.


41

Kinetics of glyphosate degradation was determined by plotting ln[Ct/C0]

against time (h). A linear trend showed that rate of this degradation process is

following first order kinetics model. Degradation rate constant (k, 1/h) and half-life

(t1/2, h) were determined using Equations (3-1) and (3-2) respectively [179].

Ct = C0 × e-kt

(3-1)

t1/2 = ln(2)/k (3-2)

Where Ct and C0 are the concentrations of glyphosate (mg/L) at time t and at

time zero respectively, k is first order rate constant and t is the degradation period (h).

3.2.5 HPLC Analysis of Glyphosate

Detection of glyphosate is difficult due to lack of chromophores or fluorophores in

this molecule that could facilitate its detection therefore glyphosate was derivatized

with 4-chloro-3,5-dinitrobenzotrifluoride (CNBF) [129] and quantified by HPLC. A

Kromasil ODS C18 column was used and pre-equilibrated with the mobile phase i.e.,

phosphate buffer (50 mM, pH 2.5) (eluent A) and acetonitrile: water (1:1, v/v, eluent

B). A modified method of Qian et al. [129] was employed for more sensitivity by

adjusting a linear gradient starting from 20% of eluent B to reach its 100% at 30 min.

Photodiode array UV/VIS detector was used for detection and the sample injection

volume was 20 µL at 1 mL/min flow rate and detection wavelength at 360 nm. After a

35 minute complete run, three peaks of glyphosate-CNBF complex, CNBF and

CNBF-OH at 15.05, 24.7 and 25.4 minutes were detected, respectively.

3.2.6 Detection of Metabolites Produced During Glyphosate

Degradation

The metabolites (AMPA, sarcosine, and glycine) produced during glyphosate

degradation were analyzed using Silufol UV254 plates by thin-layer chromatography.

O. intermedium Sq20 was incubated with 500 mg/L glyphosate for 24 h and liquid

culture was used for detection of glyphosate degradation products. The plates were

developed with ninhydrin reagent (0.5%) in acetone [180].

3.2.7 Bioinformatic Analysis of aroAO.intermedium Sq20

Bioinformatic analysis of the aroAO.intermedium Sq20 gene sequence was performed by

using different tools. Nucleotide and deduced amino acid sequences of aroAO.intermedium


42

Sq20 gene were employed for sequence similarity searches using the Basic Local

Alignment Search Tool (BLAST) program. The multiple sequence alignment of

aroAO.intermedium Sq20 gene and EPSPS protein sequences with those of other species was

carried out by Clustal W with default parameters and phylogenetic trees that were

built using MEGA version 6 [181] by neighbor joining method.

Physicochemical Characterization

Physicochemical characterization of EPSPSO.intermedium Sq20 was carried out through

ProtParam server of Expasy [182]. Different physical and chemical parameters such

as theoretical isoelectric point (pI), molecular weight, total number of positive and

negative residues, extinction coefficient, instability index, aliphatic index and grand

average hydropathy (GRAVY) of EPSPSO.intermedium Sq20 were enumerated.

Secondary Structure Prediction

Secondary structure and disorder prediction of EPSPSO.intermedium Sq20 was carried out

by using Phyre2 (Protein Homology/AnalogY Recognition Engine). It modelled about

98% of the protein (440 residues) with 100% confidence and 98% query coverage by

the single highest scoring template [183]. Secondary structural features of

EPSPSO.intermedium Sq20 protein sequence were calculated with the help of Self

Optimized Prediction Method with Alignment (SOPMA) software [184] by applying

default parameters (window width: 17, similarity threshold: 8 and number of states:

4).

Homology Modeling and Quality Assessment

Three dimensional structure of EPSPSO.intermedium Sq20 was determined by using two

homology modeling softwares, Geno3D [185] and SWISS-MODEL [186]. The

modeled 3D structures of EPSPSO.intermedium Sq20 obtained from both software tools

were authenticated by PROCHECK [187] software by generating Ramachandran plot

of amino acid sequences in most favoured and disallowed regions [188]. The ProSA-

web server was further used to calculate energy profile and to validate the protein

structure in terms of Z score demonstrating overall quality of model and computing

the total energy deviation [189].


43

3.3 Results

3.3.1 Isolation and Identification of Glyphosate Tolerant Bacterial

Strains

Through repeated sub-culturing in MSM containing 500 mg/L glyphosate as sole

carbon and energy source, 13 bacterial strains were isolated from glyphosate

contaminated soil. To choose the best one, growth of isolates was evaluated in MSM

containing 500 mg/L glyphosate with and without added glucose after 72 hours

incubation. The bacterial isolates Sq13, Sq17, Sq20 and Sq21 showed significant

growth in the presence of glucose whereas Sq20 isolate proclaimed the highest growth

rate in the presence of glucose (Figure 3-2a, 3-2b). Therefore Sq20 was found

proficient at glyphosate utilization and consequently used in further studies.

3.3.2 Morphological and Taxonomic Characterization of Glyphosate

Tolerant Bacterial Strains

Morphological analysis revealed that all isolated bacterial strains have distinct cell

morphologies and pigmentation. Microbiological analysis showed that Sq13, Sq17,

Sq21, Sq22 and Sq23 were non-motile whereas other 8 bacterial strains were motile.

Moreover, gram staining results demonstrated high incidence of gram negative

bacteria among isolations and only Sq14, Sq15, Sq17, Sq19 and Sq21 bacterial strains

were found gram positive (Table 3.1). Bacterial strains can be identified and classified

into different taxonomic groups on the basis of their cultural characteristics. The 16S

rRNA gene analysis revealed the taxonomy of isolated bacterial strains and each

isolate exhibited maximum identity with different genera. The closest sequence

homologs of bacterial isolates, their codes, accession numbers, maximum identity and

accession numbers of hits are illustrated in Table 3.2. The 16S rRNA gene sequence

analysis of Sq20 demonstrated that Sq20 has 99% identity with Ochrobactrum

intermedium type strain CNS-275 and was clustered in a well-supported branch with

various Ochrobactrum spp. type strains (Figure 3-3). Phylogenetic analysis of

bacterial isolates Sq11, Sq14 and Sq16 carried out through Neighbor joining method

showed their maximum identity with Shinella sp., Bacillus sp. and

Pseudoxanthomonas sp. respectively. The phylogenetic trees of these bacterial strains

are represented in Figures 3-4, 3-5 and 3-6.


44

Figure 3-2 Growth of the isolated bacterial strains in MSM.

a. Growth potential of bacterial isolates in the presence of glyphosate (500 mg/L)

without added glucose (as a sole source of carbon). b. Growth potential of bacterial

isolates in the presence of glucose.jjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjj

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

Sq11 Sq12 Sq13 Sq14 Sq15 Sq16 Sq17 Sq18 Sq19 Sq20 Sq21 Sq22 Sq23

Bacterial Strains

Op

tic

al D

en

sit

y a

t 5

90

nm

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1

Sq11 Sq12 Sq13 Sq14 Sq15 Sq16 Sq17 Sq18 Sq19 Sq20 Sq21 Sq22 Sq23

Bacterial Strains

Op

tic

al D

en

sit

y a

t 5

90

nm

a

b

45

3. G

lyp

hosate R

esistant B

acterial Strain

s

Table 3.1 Morphological characteristics of glyphosate resistant bacterial strains.

Sr. No. Bacterial Isolates Form Margin Elevation Shape Pigmentation Motility Staining

1 Shinella granuli

strain Sq11

Circular Entire Raised Rod Pale yellow Motile Gram

negative

2 Lysobacter sp. Sq12 Cicular Entire Convex Rod Cream colour Motile Gram

negative

3 Paracoccus sp.

Sq13

Circular Entire Raised Small

rods

White Non-

motile

Gram

negative

4 Bacillus cereus

strain Sq14

Irregular Undulate Flat Rod White Motile Gram

positive

5 Lysinibacillus

boronitolerans

strain Sq15

Circular Entire Raised Rod Off white Motile Gram

positive

6 Pseudoxanthomonas

indica strain Sq16

Circular Entire Convex Rod Light yellow Motile Gram

negative

7 Micrococcus

endophyticus strain

Sq17

Circular Entire Convex Spherical Yellow Non-

motile

Gram

positive

8 Alcaligenes sp.

Sq18

Irregular Lobate Convex Rod Light yellow Motile Gram

negative

9 Bacillus safensis

strain Sq19

Irregular Undulate Flat Rod Off white Motile Gram

positive

10 Ochrobactrum

intermedium strain

Sq20

Circular Entire Pulvinate Short

rods

Cream colour Motile Gram

negative

46

3. G

lypho

sate Resistan

t Bacterial S

trains

11 Staphylococcus

haemolyticus strain

Sq21

Circular Entire Raised Spherical Light yellow Non-

motile

Gram

positive

12 Dokdonella

ginsengisoli strain

Sq22

Circular Entire Convex Rod Light yellow Non-

motile

Gram

negative

13 Inquilinus limosus

strain Sq23

Irregular Undulate Raised Rod Cream colour Non-

motile

Gram

negative


47

3

Table 3.2 Characterization of the glyphosate resistant bacterial strains isolated

in current study from glyphosate contaminated soil.

Sr.

No.

Isolates

Codes

Closest Sequence

Homologs of Bacterial

Isolates

Accession

No.

Accession

No. of Hits

Identity

(%)

1 Sq11 Shinella granuli KX255009 NR_041239.1 99%

2 Sq12 Lysobacter sp. KX255010 JN585697.1 99%

3 Sq13 Paracoccus sp. KC195786 KM603073.1 99%

4 Sq14 Bacillus cereus KX255011 HQ143564.1 99%

5 Sq15 Lysinibacillus

boronitolerans

KX255012 NR_114207.1 98%

6 Sq16 Pseudoxanthomonas indica KX255013 JQ659945 99%

7 Sq17 Micrococcus endophyticus KX255014 NR_044365.1 99%

8 Sq18 Alcaligenes sp. KX255015 KP876586.1 99%

9 Sq19 Bacillus safensis KX255016 NR_113945.1 99%

10 Sq20 Ochrobactrum

intermedium

KC195785 NR_113812.1 99%

11 Sq21 Staphylococcus

haemolyticus

KX255017 NR_113345.1 99%

12 Sq22 Dokdonella ginsengisoli KX255018 KF378756.1 99%

13 Sq23 Inquilinus limosus KX255019 NR_029046.1 99%


48

Figure 3-3 Phylogenetic analysis of isolated bacterial strain Sq20.

Neighbor-joining tree constructed on the basis of 16S rRNA gene sequences

represents the phylogenetic relationship of bacterial isolate Sq20 with other related

species. The nodes of the branches signify the bootstrap values expressed as the

percentages of 1000 replications. Accession numbers are represented in parentheses.

WG represents whole genome sequences whereas T represents type strain sequences.

Ochrobactrum anthropi str. ATCC 49188_(NR_074243.1)T

Ochrobactrum lupini str. LUP21_(NR_042911.1)T

Ochrobactrum anthropi str. NBRC 15819_(NR_113811.1)T

Ochrobactrum anthropi str. LMG 3331_(NR_114979.1)T

Ochrobactrum cytisi str. ESC1_(NR_043184.1)T

Ochrobactrum tritici str. NBRC 102585-(NR_114148.1)T

Ochrobactrum grignonense str. NBRC 102586_(NR_114149.1)T

Ochrobactrum haematophilum str. CCUG 38531_(NR_042588.1)T

Brucella melitensis biovar Abortus 2308_(NR_074149.1)T

Brucella canis str. RM-666_(NR_044652.1)T

Brucella abortus str. 544_(NR_042460.1)T

Brucella microti str. CCM 4915_(NR_042549.1)T

Brucella papionis str. F8/08/60_(NR_133990.1)T

Brucella ovis strain 63/290_(NR_036772.1)T

Ochrobactrum oryzae str. NBRC 102588_(NR_114151.1)T

Ochrobactrum oryzae str. MTCC 4195_(NR_042417.1)T

Ochrobactrum pseudintermedium str. ADV31_(NR_043756.1)T

Sq20 16S ribosomal RNA gene

Ochrobactrum intermedium str. CNS 2-75_(NR_042447.1)T

Ochrobactrum intermedium str. NBRC 15820_(NR_113812.1)T

Ochrobactrum sp. EGD-AQ16_(NZ_AWEU01000033.1)WG

Ochrobactrum intermedium 2745-2_(NZ_JFHY01000039.1)T

Ochrobactrum intermedium M86_(NZ_AOGE01000127.1)WG

Ochrobactrum intermedium LMG 3301_(NZ_ACQA01000001.1)WG

66

75

100

100

99

98

64

63

67

78

83

87

87

94

93


49






Shinella sp.NJUST26(KP890249.1)

Shinella granuli UA-STP-6(KR011316.1)

Shinella granuli Sq11(KX255009.1)

Shinella granuli Ch06(NR_041239.1)

Shinella sp.HZN7(NZ_CP015736.1)

Shinella granuli(EU308118.1)

Shinella granuli R1-702 (JQ659575.1)

Shinella zoogloeoides(KP979556.1)

Shinella sp.C72(KT361091.1)

Shinella sp.SUS2(NZ_KQ410739.1)

Shinella sp.HW-35(KP152652.1)

Shinella fusca DC-196(NR_116889.1)

Shinella yambaruensis NBRC 102122(NR_114035.1)

Shinella yambaruensis MS4(NR_041554.1)

Shinella zoogloeoides ATCC 1962(NR_119062.1)

Shinella zoogloeoides NBRC 102405(NR_114067.1)

Shinella zoogloeoides IAM 12669(NR_041341.1)

Shinella kummerowiae CCBAU 25048(NR_044066.1)

Shinella sp.GWS1(NZ_KQ434168.1)

99

80

65

62

59

60

47

45

31

94

47

61

54

94

16

49


50






Bacillus cereus Sq14(KX255011.1)

Bacillus cereus 03BB108(CP009641.1)

Bacillus cereus DZ4(HQ143564.1)

Bacillus cereus BFE 5392(GU250443.1)

Bacillus cereus 165PP(KM349191.1)

Bacillus thuringiensis HD1011(CP009335.1)

Bacillus sp.A52(KF479557.1)

Bacillus anthracis Vollum 1B(CP009328.1)

Bacillus cereus 03BB102(CP009318.1)

Bacillus cereus 9_julio(KM349186.1)

Bacillus cereus XX2010(JX993816.1)

Bacillus cereus L12(KU551157.1)

Bacillus sp.190Cu-As(KM349198.1)

Bacillus cereus ATCC 14579(NR_114582.1)

Bacillus cereus IAM 12605(NR_115526.1)

Bacillus cereus ATCC 14579(NR_074540.1)

Bacillus cereus CCM 2010(NR_115714.1)

Bacillus cereus JCM 2152(NR_113266.1)

Bacillus cereus NBRC 15305(NR_112630.1)

Bacillus pseudomycoides NBRC 101232(NR_113991.1)

Bacillus thuringiensis ATCC 10792(NR_114581.1)

Bacillus thuringiensis NBRC 101235(NR_112780.1)

Bacillus mycoides 273(NR_036880.1)

Bacillus cereus S2-8(CP009605.1)

Bacillus thuringiensis HD682(CP009720.1)100

84

59

53


51






3.3.3 Glyphosate Resistance and Degradation by Ochrobactrum

Intermedium Sq20

To explore glyphosate resistance potential of strain Sq20, it was inoculated into LB

media containing 0.5-3.0 g/L glyphosate and growth was monitored until 24 h of

incubation. In this media, up to 2.5 g/L initial concentration of glyphosate, growth of

Ochrobactrum intermedium Sq20 was comparable to that of the control without

glyphosate indicating that the strain Sq20 is resistant to high glyphosate

concentration. Moreover, Ochrobactrum intermedium Sq20 was able to degrade

glyphosate at 500 mg/L initial concentration in MSM within three days at ambient

temperature and neutral pH. After 88h of incubation, 80% of the added glyphosate

was degraded and an increase in cell mass was observed (Figure 3-7a). Complete

degradation of glyphosate was attained after 104 h of incubation.

Experimental data of glyphosate degradation was interpreted statistically for

the calculation of first order reaction parameters and regression equation (Figure 3-

7b). Results showed rate constant (k) of 0.0464/h and half life (t1/2) of 14.9 h.

Regression coefficient (R2) value of 0.998 indicated a good fit of this model.

Pseudoxanthomonas indica Sq16(KX255013.1)

Pseudoxanthomonas indica C18(LN827737.1)

Pseudoxanthomonas sp.TMX-24(JN867356.1)

Pseudoxanthomonas sp.RD_MAAMIA_15(KU597505.1)

Pseudoxanthomonas indica S9-676(JQ660316.1)

Pseudoxanthomonas mexicana RA58(JN585700.1)

Pseudoxanthomonas indica R8-542(JQ659945.1)

Pseudoxanthomonas indica R4-389-1(JQ659701.1)

Pseudoxanthomonas mexicana L2(GQ480839.1)

Pseudoxanthomonas mexicana(EU119264.1)

Pseudoxanthomonas mexicana(AB246798.1)

Pseudoxanthomonas indica P15(NR_116019.1)

Pseudoxanthomonas indica R5-337(JQ659735.1)

Pseudoxanthomonas wuyuanensis XC21-2(NR_126229.1)

Pseudoxanthomonas jiangsuensis(NR_132712.1)

Pseudoxanthomonas japonensis NBRC 101033(NR_113972.1)

Pseudoxanthomonas japonensis 12-3(NR_024660.1)

Pseudoxanthomonas mexicana NBRC 101034(NR_113973.1)

Pseudoxanthomonas mexicana AMX 26B(NR_025105.1)

98

95

98

81

100

74

70

63

94

60


52

3.3.4 Detection of Glyphosate Degradation Products

To study the route of glyphosate degradation followed by O. intermedium

Sq20, thin layer chromatography was used. The liquid culture of O. intermedium

Sq20 incubated with glyphosate was used for detection of major metabolites (AMPA,

glycine, and sarcosine). AMPA was not detected in the test samples confirming the

absence of glyphosate oxidoreductase (GOX) degradation pathway involving

breakdown of C-N bond. However, sarcosine (Rf = 0.53) and glycine (Rf = 0.65) were

detected by comparing their Rf values with those obtained for the standard substances,

affirming the breakdown of glyphosate through C-P lyase pathway. The control

samples containing O. intermedium Sq20 incubated with KH2PO4 showed no

sarcosine or glycine. These results indicate that O. intermedium Sq20 has C-P lyase

activity and cleaves the C-P bond of glyphosate resulting in the formation of sarcosine

which is further oxidized to glycine.

3.3.5 Bioinformatic Analysis of aroAO.intermedium Sq20

Sequencing of aroAO.intermedium insert indicated a 1353 bp open reading frame (ORF)

(Genbank Accession No. KU873038) with 63.8% GC contents encoding a peptide of

450 amino acids and was named aroAO.intermedium Sq20. The NCBI blast results and

phylogenetic analysis of aroAO.intermedium Sq20 revealed high homology with aroA genes

from other Ochrobactrum spp. Furthermore, BlastP and phylogenetic analysis of

translated EPSPSO.intermedium Sq20 sequence (Genbank Accession No. ANN25048)

revealed that this protein has 97-98% amino acid sequence identities to EPSPS

proteins from other Ochrobactrum spp. (Figure 3-8).


53

Figure 3-7 Glyphosate degradation by Ochrobactrum intermedium Sq20 at 500

mg/L initial concentration, 37 °C and pH 7 in minimal salt media (MSM).

a. Results indicate an increase in dry cell mass of Ochrobactrum intermedium Sq20

with subsequent decrease in initial concentration of glyphosate. Complete degradation

of glyphosate was achieved after 4 days of incubation. b. Semi logarithmic plot of

final concentration/initial concentration (Ct/C0) of glyphosate representing

biodegradation of glyphosate by Ochrobactrum intermedium Sq20 over time. Dots

show the experimental data of glyphosate degradation whereas line depicts the first

order fit.

0

50

100

150

200

250

300

350

400

450

500

0

50

100

150

200

250

300

350

400

450

500

0 8 16 24 32 40 48 56 64 72 80 88 96 104

Glyphosate Conc. (mg/L) dry cell mass (mg/L)

Uninoculated Control (mg/L)

Time (h)

Dry

Cel

l Mas

s (m

g/L)

Gly

ph

osa

teC

on

cen

trat

ion

(m

g/L)

R² = 0.998

-4

-3.5

-3

-2.5

-2

-1.5

-1

-0.5

0

0 8 16 24 32 40 48 56 64 72 80 88 96 104

ln Ct/C0

Linear (ln Ct/C0)

Time (h)

lnC

t/C

0

a

b


54

Figure 3-8 Phylogenetic analysis of EPSPS O.intermedium Sq20.

Neighbor-joining tree represents the phylogenetic relationship between

EPSPSO.intermedium Sq20 and EPSPS proteins of other related species. The percentage

values of the tree greater than 50 calculated from 1000 bootstrap resamples supporting

the topology are shown in phylogram. Accession numbers are indicated in

parentheses. The scale bar represents 0.01 substitutions per position.

It is reported that XLGNAGTAXRXL (X represents a variable amino acid

residue) is a highly conserved region of EPSPS(s) involved in the binding of substrate

PEP with EPSP synthases [190]. Clustal alignment showed that this region present in

the EPSPSO.intermedium Sq20 shows more sequence identity with that of the class II EPSPS

proteins than with class I analogs (Figure 3-9). Five other conserved regions GDKX,

SAQXK, RXHXE, NXTR and RPMXR reported in the class II EPSP synthases

including EPSPSA.tumefaciens CP4 and EPSPSO.anthropi were also found in EPSPSO.intermedium

Ochrobactrum sp. EGD-AQ16(WP_021587681.1)

Ochrobactrum intermedium(WP_006465745.1)

Ochrobactrum intermedium 229E(ERM02521.1)

Ochrobactrum intermedium(WP_025090682.1)

Ochrobactrum intermedium Sq20 EPSPS

Ochrobactrum anthropi(WP_043062739.1)

Ochrobactrum sp.(WP_029926097.1)


Ochrobactrum anthropi(ADG03677.1)


Brucella sp.BO2(WP_009364909.1)

Brucella inopinata(WP_008503805.1)

Brucella ceti str.Cudo(EEH15273.1)

Brucella microti(WP_012783809.1)

Brucella suis(WP_006206089.1)

Brucella sp.NVSL 07-0026(WP_008933634.1)

Brucella abortus NCTC 8038(EEW80290.1)

Brucella abortus str.2308(AEEP63548.1)

Brucella abortus 78/32(ENR88457.1)

Brucella abortus(WP_011265281.1)

Ochrobactrum rhizosphaerae(WP_024898290.1)

Ochrobactrum sp.CDB2(WP_007872980.1)

Pseudochrobactrum sp.(WP_022710242.1)

Phyllobacterium sp.(WP_027230834.1)

Phyllobacterium sp.YR531(WP_008127565.1)

Shinella sp.DD12(EYR84130.1)

Ensifer sp. USDA 6670(WP_029961663.1)

65

92

63

100

98

96

75

90

74

79

93

62

93

100

0.000.010.020.030.040.05


55

Sq20. These regions have been revealed to impart glyphosate tolerance in class II EPSP

synthases. Moreover, phylogenetic analysis of EPSPSO.intermedium Sq20 protein with

already reported class I and II EPSPS(s) demonstrated that it belongs to class II

EPSPS (Figure 3-10).

Motif 1

Motif 2

Motif 3 Motif 4

Motif 5

Motif 6

Figure 3-9 Multiple sequence alignment of EPSPSO.intermedium Sq20.

With a typical class I enzyme EPSPSE.coli and typical class II enzymes

EPSPSA.tumefaciens CP4 and EPSPSO.anthropi, done by using ClustalW. The motif

important for interaction with PEP conserved in class I EPSPS enzymes is

boxed as motif 1 and the other five motifs involved in destabilizing glyphosate

binding in class II EPSPSs are boxed as motif 2, motif 3, motif 4, motif 5 and

motif 6.


56

Figure 3-10 Phylogenetic analysis of Ochrobactrum intermedium strain Sq20 with

Class I and class II enzymes.

Phylogram bootstrapped with 1000 replicates constructed from Clustal W and

MEGA5 representing relationship of Sq20 EPSPS protein with reported class I and II

EPSPSs. Class I species are represented by (▲) and class II species are symbolized

by (■). Tree suggests that Ochrobactrum intermedium strain Sq20 (●) belongs to class

II EPSPS proteins.

Physicochemical Characterization

The amino acid composition and other physicochemical parameters of

EPSPSO.intermedium Sq20 calculated by ProtParam software are represented in Table 3.3

and Table 3.4 respectively. The amino acid content suggests that this protein contains

high concentration of polar (hydrophilic) amino acid residues (54.5%) as compared to

the nonpolar (hydrophobic) amino acid residues (45.5%) and hence can be described

as hydrophilic. Low extinction coefficient exhibited by EPSPSO.intermedium Sq20 indicates

low concentrations of these Tyr, Trp and Cys amino acids residues in the protein.

Generally, a protein with an instability index smaller than 40 is considered as stable.

On this account, EPSPSO.intermedium Sq20 is stable since its instability index is 32.06.

High aliphatic index further suggested that this protein is thermally stable. The Grand

Pseudomonas sp.(P0A2Y4.1)

Achromobacter sp.(P0A2Y5.1)

Ochrobactrum intermedium strain Sq20

Ochrobactrum anthropi(ADG03677.1)

A. tumefaciens strain CP4(Q9R4E4.2)

Bradyrhizobium diazoefficiens(NP_767378.1)

Dichelobacter nodosus(Q46550.1)

Staphylococcus aureus(Q05615.2)

Halothermothrix orenii(WP_012635978.1)

Pseudomonas fluorescens(ABM21481.1)

E.coli(P0A6D3.1)

Pantoea ananatis(WP_014593322.1)

Serratia odorifera(WP_004964814.1)

Zea mays(CAA44974.1)

Oryza sativa(AAL07437.1)

Arabidopsis thaliana(P05466.3)

Nicotiana tabacum(P23981.1)

87

100

100

100

93

60

100

59

100

100

100

100

0.00.10.20.30.40.50.6


57

Average hydropathy (GRAVY) value is low which indicates that EPSPSO.intermedium

Sq20 is hydrophilic in nature.

Table 3.3 Amino acid composition of EPSPSO.intermedium Sq20 representing amino

acid number as well as percentage composition.

Amino Acid

(AA)

No. of AA Composition

(%)

Hydrophilic

(%)

Hydrophobic

(%)

Ala(A) 45 10 10

Arg(R) 29 6.4 6.4

Asn(N) 12 2.7 2.7

Asp(D) 31 6.9 6.9

Cys(C) 2 0.4 0.4

Gln(Q) 8 1.8 1.8

Glu(E) 26 5.8 5.8

Gly(G) 52 11.6 11.6

His(H) 6 1.3 1.3

Ile(I) 23 5.1 5.1

Leu(L) 43 9.6 9.6

Lys(K) 17 3.8 3.8

Met(M) 23 5.1 5.1

Phe(F) 10 2.2 2.2

Pro(P) 24 5.3 5.3

Ser(S) 26 5.8 5.8

Thr(T) 33 7.3 7.3

Trp(W) 1 0.2 0.2

Tyr(Y) 3 0.7 0.7

Val(V) 36 8.0 8.0

Pyl(O) 0 0.0

Sec(U) 0 0.0


58

Table 3.4 Physico-chemical characteristics of EPSPSO.intermedium Sq20 computed by

Expasy’s Protparam software.

No. Parameters Results

1 No. of amino acids 450

2 Molecular weight 47.3733 kDa

3 Isoelectrical point 5.21

4 Total number of negatively charged residues

(Asp + Glu)

57

5 Total number of positively charged residues

(Arg + Lys)

46

7 Chemical Formula C2048H3373N587O647S25

8 Extinction coefficient assuming all pairs of Cys

residues form cystines

10095 M-1

cm-1

9 Extinction coefficient assuming all Cys residues

are reduced

9970 M-1

cm-1

10 Instability index 32.06

11 Aliphatic index 90.4

12 Grand average of hydropathicity (GRAVY) -0.039


59

Secondary Structure Prediction

The secondary structure of EPSPSO.intermedium Sq20 exhibits higher percentage of random

coils (33.56%) and alpha helices (30.44%) as compared to other secondary structure

elements (extended strands 24.44%, beta turns 11.56%). The positions of secondary

structure elements are presented in Figure 3-11. Disorder value (18%) showed that

EPSPSO.intermedium Sq20 has low incidence of disordered regions (Figure 3-12).

Figure 3-11 Secondary structure of EPSPSO.intermedium Sq20.

Secondary structure of EPSPSO.intermedium Sq20 protein indicating the positions of α

helices (h), extended strands (e), β turns (t) and random coils (c) computed by

SOPMA software. EPSPSO.intermedium Sq20 shows higher percentage of random coils as

compared to α helices, β turns and extended strands.


60

Figure 3-12 Secondary structure (SS) and disorder prediction of

EPSPSO.intermedium Sq20 through Phyre2 representing three states α-helix, β-strand

and coil.

Green helices indicate α-helices, blue arrows represent β-strands and faint lines shows

coils. SS confidence indicates the confidence in the prediction with red being high

confidence and blue low confidence. Disorder line indicated by question marks (?)

represents the prediction of disordered regions in EPSPSO.intermedium Sq20.


61

Homology Modeling

Homology modeling of EPSPSO.intermedium Sq20 was carried out by using two softwares

Geno3D and Swiss Model. The assessment of both models was done by creating

Ramachandran plots using PROCHECK software whereby model generated by Swiss

model proved better than the model generated by Geno3D. The Ramachandran plot of

Swiss Model indicated that more than 99% of residue φ–ψ angles in EPSPSO.intermedium

Sq20 are in the most favoured and additional allowed regions (Figure 3-13). The plot

statistics indicated that the most favoured regions comprising core right handed alpha

helices (A) and beta sheets (B) and left-handed alpha helices (L) possess 91.8% of

amino acid residues. Additional allowed regions, including right handed alpha helix

(a) and beta sheets (b), left handed alpha helices (l) and epsilon (p) regions comprised

8.0% of the residues. Generously allowed regions consisting of alpha helices (~a),

beta sheets (~b), left handed alpha helices (~l) and epsilon (~p) regions) and

disallowed regions had 0.3% and 0.0% amino acid residues respectively.

Figure 3-13 Ramachandran plot (created by PROCHECK) showing 91.8% of

amino acid residues in core region (red colour).


62

Figure 3-14 Structure validation of EPSPSO.intermedium Sq20.

a Z score plot (created by ProSA) representing Z scores of all protein chains as

determined by X-ray crystallography (light blue) or NMR spectroscopy (dark blue)

with respect to their length. The Z score for EPSPSO.intermedium Sq20 is represented as a

large dot and its value calculated as -9.82. b Energy plot created by ProSA-web server

as a function of amino acid sequence position for EPSPSO.intermedium Sq20 represents the

negative energy values which describes the stable nature of EPSPSO.intermedium Sq20.

a

b

3. G

lyphosate R

esistant B

acterial Strain

s

63

Figure 3-15 3-D structure analysis of class II EPSPS(s).

a Predicted 3D structure of EPSPSO.intermediumSq20 protein by Swiss model workspace structure prediction tool representing motifs (green)

involved in glyphosate resistance. α-helices are shown in cyan colour whereas β-strands in magenta colour. b 3D overlapping structures of

EPSPSO.intermedium Sq20 (light blue) and EPSPSA.tumefaciens CP4 (purple). Their root mean square deviation (RMSD) value was 3.782 Å.

a b


64

3

The Z score, a measure of model quality that predicts the total energy of the

structure [189] was predicted using the ProSA-web server. Z value of -9.82 was

obtained for EPSPSO.intermedium Sq20 protein model represents its good quality. It is

indicated with a dark black dot in the plot (Figure 3-14a). The ProSA-web server also

assesses model quality by plotting energies as a function of amino acid residues and

negative values of energy accounts for the stability of protein structure. In case of

EPSPSO.intermedium Sq20, most of the energy values of amino acid residues were found to

be in negative region further confirming that EPSPSO.intermedium Sq20 is a stable protein

(Figure 3-14b). Three dimensional structure of the EPSPSO.intermedium Sq20 was

generated by Swiss Model and the final model containing 6-448 amino acid residues

was visualized by PyMOL (Figure 3-15a). The EPSPSO.intermedium Sq20 model was

superimposed separately on the structure of EPSPSA.tumefaciens CP4 (Figure 3-15b) and

the results proclaimed that the allocation of α helices and β sheets in the

EPSPSO.intermedium Sq20 was similar to that of EPSPSA.tumefaciens CP4. In addition, all the

amino acid residues facilitating glyphosate binding in EPSPSA.tumefaciens CP4 were

present in the corresponding regions of EPSPSO.intermedium Sq20.

3.4 Discussion

The focal goal of our research was to isolate a bacterial strain from indigenous soil

competent to tolerate high glyphosate concentration, and thus characterize the gene(s)

involved. In this regard, a glyphosate resistant bacterial strain Ochrobactrum

intermedium Sq20 was isolated. Sq20 was found capable of degrading glyphosate as

well. The genus Ochrobactrum belongs to the family Brucellaceae and Ochrobactrum

intermedium is deemed as an emerging human environmental opportunistic pathogen

with mild virulence [191]. Ochrobactrum strains are studied as potential

bioremediation agents and plant growth-promoting rhizobacteria [192-196]. They are

involved in the degradation of organophosphorus pesticides such as parathion and

methylparathion [197], phenol [198], dimethylformamide (DMF, toxic organic

solvent) [199], petroleum waste [200] and chlorothalonil [201]. Ochrobactrum spp.

also plays an important role in removal of toxic metals such as chromium, cadmium

and copper from the environment [202]. In recent years, O. intermedium is of

particular interest due to its biocatalyst properties. The biosurfactant produced by

O. intermedium can potentially and successfully be used for the remediation of PAHs

contaminated soil in industrial areas [203]. These properties of O. intermedium have


65

generated considerable interest for its use in bioremediation. Moreover,

O. intermedium Sq20 is indigenously isolated from glyphosate contaminated soil

therefore its degrading properties can be exploited for decontamination of glyphosate

at point sources.

Glyphosate biodegradation data by O. intermedium Sq20 showed that linear

regression equation can be used for its approximation. Furthermore, implication of

first order kinetics illustrated that time required for biodegradation of glyphosate

depends upon initial concentration of glyphosate. The rational of this research work

was to study glyphosate resistant genes therefore a glyphosate resistant gene (aroA)

was amplified from O. intermedium Sq20 in this context. Sequence analysis of this

putative aroA gene showed that it shares 97% sequence identity with other reported

Ochrobactrum spp. aroA genes. Moreover, EPSPSO.intermedium Sq20 belongs to class II

EPSP synthases and contains conserved domains identical to ones found in proteins

that impart natural glyphosate resistance in some bacteria. Particularly five already

reported motifs characteristic of class II EPSP synthases have been identified in

EPSPSO.intermedium Sq20 as: GDKX in which K28 residue is involved in PEP binding;

SAQXK in which S173 and Q175 residues facilitates S3P binding; RPMXR, RXHXE

and NXTR in which the positive charges of the guanidine groups of R128, R200 and

R274 destabilizes the glyphosate binding respectively [53].

Although researchers have discovered mutant EPSPS genes from different

resistant microbes [150, 161, 165], there is only one report of resistant EPSPS from

Ochrobactrum sp. having potential for tolerating 200 mM glyphosate [204]. In order

to comprehend molecular profile and physicochemical properties of EPSPSO.intermedium

Sq20 protein, Expasy‟s ProtParam tools were employed by measuring different

parameters. It is already reported that protein stability is predicted by computing its

instability index. Occurrence of certain dipeptides in stable proteins is different in

contrast with unstable ones. Weight values of instability are allocated to the proteins

on the basis of incidence of certain dipeptides. Proteins exhibiting an instability index

smaller than 40 are considered as stable, therefore the instability index of

EPSPSO.intermedium Sq20 protein calculated as 32.06 signifies the stable nature of EPSPS

protein. The extinction coefficient demonstrates about light absorbed by a protein

depending on concentrations of Cys, Trp and Tyr at a certain wavelength. It is also

helpful in the quantitative study of protein-protein and protein-ligand interactions in


66

solution. Low extinction coefficient (10095, 9970) indicates less concentration of

Cys, Trp and Tyr in EPSPSO.intermedium Sq20 and therefore this protein cannot be

scrutinized by using UV spectral methods. Thermal stability of a protein is predicted

by its aliphatic index calculated on the basis of relative volume of that protein

occupied by its aliphatic side chains (alanine, valine, isoleucine, and leucine).

Aliphatic index is also considered as a positive factor in thermostability of globular

proteins and low thermal stability value of EPSPSO.intermedium Sq20 indicates flexible

structure of this protein [182]. High aliphatic index (90.4) of EPSPSO.intermedium Sq20

proposes that this protein has stable behaviour for a broad range of temperatures. The

Grand Average hydropathy (GRAVY) value for a protein is calculated as the sum of

hydropathy values of all the amino acids divided by the number of residues in the

protein sequence. High negative value of GRAVY (-0.039) demonstrates that

EPSPSO.intermedium Sq20 is hydrophilic in nature. Isoelectric point (pI) is described as the

pH upon which protein surface is covered with charge but has zero net electrical

charge. pI calculation is helpful in developing buffer systems for purification of

proteins by isoelectric focusing method [205]. The pI computed to be 5.21 indicates

EPSPSO.intermedium Sq20 as moderately acidic. Generally it is perceived that GRAVY

decreases with decrease in pI.

The secondary structure of EPSPSO.intermedium Sq20 protein revealed that random

coils were the most copious followed by alpha helix and other secondary structure

elements (extended strand and beta turns). Random coils are indispensable in the

context of protein flexibility and conformational changes as well as enzymatic

turnover [206]. Secondary structure and disorder prediction by using Phyre2 showed

that EPSPSO.intermedium Sq20 holds 8% disorder therefore indicating the absence of weak

regions in this protein. Phyre2 uses a folding simulation method to model regions of a

query with no detectable similarities to known structures and indicates the disordered

regions. The homology modeling of the protein was accomplished using two

programs Geno3D and Swiss Model. The results acquired from these programs are

compared in Table 3.5. In order to rationalize predicted models, Ramchandran map

calculations computed by using PROCHECK software were employed to create

Ramachandran plots illustrating the φ and ψ angles distribution in the models. The

results of Swiss Model showed that 91.8% of amino acid residues were found to be

localized in most favoured regions. Additional allowed regions hold 8.0% of amino


67

acid residues. 0.2% of amino acid residues were found in generously allowed regions.

It is reported that a model having more than 90% residues in the most favoured

regions is expected as a good quality model so above results affirm the good quality

of EPSPSO.intermedium Sq20 predicted model. This comparison also suggests that the

model generated by Swiss model is better than the model generated by Geno3D.

Model reliability was further confirmed by Z score calculated by ProSA-web server

found to be -9.82. The black spot in optimum range represents that protein has valid

structure. Z score is found to depend on the protein length and negative Z scores are

excellent for a reliable model. Z score also embodies the overall quality of model and

calculates the total energy deviation of the protein structure with respect to energy

distribution acquired from random conformations. Local model quality was

determined by plotting energies as a function of amino acid sequence positions.

Positive values indicate the problematic or flawed parts of the input structure. Usually

a plot based on energies of single residues contains large fluctuations. Therefore, it is

not reliable for model evaluation. For that reason the plot is smoothed by plotting

average energies of 40 amino acid residues [189]. The calculated Z score and energy

plot revealed that Swiss Model of EPSPSO.intermedium Sq20 is reliable.

Table 3.5 Comparative analysis of Swiss Model and Geno 3D computed models

of EPSPSO.intermedium Sq20 done by Ramachandran plot calculations.

Software Parameters Value (%)

Swiss Model Residues in most favoured regions 91.8

Residues in additional allowed regions 8.0

Residues in generously allowed regions 0.3

Residues in disallowed regions 0.0

Geno 3D Residues in most favoured regions 63.9

Residues in additional allowed regions 24.9

Residues in generously allowed regions 4.9

Residues in disallowed regions 0.8


68

This study demonstrates the isolation and identification of a glyphosate

resistant bacterial strain Ochrobactrum intermedium Sq20 that that can utilize

glyphosate as an energy source. Therefore the competence of this isolate to survive

and reproduce at high concentrations of the glyphosate in indigenous soil marks it as a

good candidate for the remediation of glyphosate contaminated environments. The

characterization of class II EPSPS encoded by the aroAO.intermedium Sq20 gene was

carried out and a computational 3-D model was predicted. 3-D model further

corroborated through various parameters of validation and authenticity was found

significant and reliable for investigating the molecular features that result in

glyphosate resistance.

69

4. Isolation and Characterization of

Glyphosate Degrading Bacterial Strains

4.1 Introduction

Glyphosate is a broad spectrum herbicide differentiated by a direct carbon to

phosphorus (C-P) bond, thermally and chemically inert to non-biological degradation

processes [207, 208]. Glyphosate belongs to the amino acid herbicide family and its

mode of action involves inhibition of shikimic acid pathway enzyme, 5-

enolpyruvylshikimic acid-3-phosphate synthase (EPSPS), activity resulting in plant

death [209].

It has been used on crop and non crop areas in multifarious practices for many

years [65, 210]. Agricultural use of this herbicide increased drastically by the

introduction and commercial launch of genetically modified glyphosate resistant

crops [211]. Glyphosate is mostly used for weed management purposes in glyphosate

resistant crops in developed countries. Currently glyphosate resistant crops such as

maize, cotton, soybean, sugar beet, canola and wheat etc have covered more than 80%

of the planted area. The production of these crops has surpassed 500,000 tons per year

and is approximated to go beyond 10,00000 tons in next few years [67, 212].

Indiscriminate use of glyphosate in agriculture, horticulture and at amenity areas is

leading to accumulation of its residues in soil, food and water due to its mobility and

water solubility properties. Contamination of terrestrial and aquatic ecosystems has

detrimental effects on different biota and biogeochemical cycles as well. Weed

resistance is also an emanation of extensive use of glyphosate [213]. Glyphosate has

been reported to disturb the balance between beneficial and pathogenic soil micro

flora resulting in curtailed nutrient availability and disease severity owing to

weakened plant defense system [214]. The chelation property of glyphosate may

hinder the uptake and translocation of micronutrients within plant tissues through

formation of poorly soluble glyphosate metal complexes [215]. Glyphosate has been

reported to cause oxidative stress and genotoxicity in aquatic organisms [216].

Daphnia magna showed ~100% abortion rate of eggs and embryonic stages at 1.35

4. Glyphosate Degrading Bacterial Strains

70

mg a.i./L of Roundup [217]. Moreover, reproduction of soil dwelling earthworms was

found to reduce by 56% within three months after glyphosate application [218]. As

Acidobacteria plays an important role in biogeochemical processes, therefore their

low abundance in response to glyphosate exposure may hamper natural processes.

Furthermore, about 40% reduction of mycorrhization was observed in soils that had

been amended with the mycorrhizal fungi, Glomus mosseae after the application of

glyphosate [219].

Toxicology studies of glyphosate showed that glyphosate can change the DNA

of sister chromatids in human lymphocytes. Moreover occupational exposure of

glyphosate causes non-Hodgkin lymphoma (NHL) [98]. Glyphosate is reported to

have tumorigenic, hepatorenal and teratogenic effects which can be expounded on the

basis of oxidative stress and endocrine disruption resulting in metabolic alterations

[220]. International Agency for Research on Cancer (IARC) of World Health

Organization (WHO) has classified glyphosate as possibly carcinogenic (category 2A)

to humans on the basis of epidemiological, animal and in vitro studies [221].

Therefore its removal from environment is a priority and needs to be addressed

promptly. The easy, eco-friendly and cost effective way to decontaminate polluted

environment is bioremediation.

4.1.1 Glyphosate Biodegradation

Regarding glyphosate biodegradation certain potential glyphosate degrading micro

organisms have been isolated from organophosphonates contaminated soils [222].

Different glyphosate degrading bacteria and their metabolic products are given in

Table 4.1. Bacterial consortia were reported to involve in biodegradation of

glyphosate yielding AMPA [223, 224]. Pseudomonas sp. PG2982 was first bacterial

strain found proficient to utilize glyphosate as P source. This degradation mechanism

involved cleavage of C-P bond yielding sarcosine instead of AMPA [225]. Same

mechanism was reported in Alcaligenes sp. [118], Arthrobacter sp. [226],

Pseudomonas sp. GLC11 [227], Pseudomonas sp. 4ASW [66] and Achromobacter sp.

[228]. Certain bacterial strains were found capable of utilizing glyphosate as P source

while yielding AMPA such as Pseudomonas sp. SG-1 [229], Flavobacterium sp.

[223], Pseudomonas sp. LBr [230], Achromobacter sp. LW9 [231], O. anthropi

LBAA [116], O. anthropi GPK3 [228] and Ochrobactrum sp. GDOS [232]. The

number of bacterial strains capable of utilizing glyphosate other than P source is very


71

limited. Arthrobacter sp. GLP-1 was found able to utilize glyphsate as N source

[233]. Streptomyces sp. StC [234] and Achromobacter sp. LW9 [231] were found to

use glyphosate as C and N source. The reasons may involve slow glyphosate

degradation in cytoplasm or inhibition of degrading enzymes by resultant P [77, 235].

72

4. G

lyp

hosate D

egrad

ing B

acterial Strain

s

Table 4.1 Glyphosate degrading bacterial strains with type of metabolism.

No. Glyphosate Degrading Bacteria Glyphosate Metabolite Reported year

1 Achromobacter sp. LW9 AMPA McAuliffe et al. (1990) [231]

2 Achromobacter sp. MPS

12A

Sarcosine Sviridov et al. (2012) [228]

3 Agrobacterium radiobacter Sarcosine

(most probably)

Wackett et al. (1987) [236]

4 Alcaligenes sp. GL Sarcosine (95 %),

AMPA (5 %)

Lerbs et al. (1990) [118]

5 Arthrobacter atrocyaneus

ATCC 13752

AMPA Pipke and Amrhein (1988) [237]

6 Arthrobacter sp. GLP-1 Sarcosine Pipke et al. (1987) [226]

7 Flavobacterium sp. GD1 AMPA Balthazor and Hallas (1986) [223]

8 Geobacillus

Caldoxylosilyticus T20

AMPA Obojska et al. (2002) [238]

9 Ochrobactrum anthropi

GDOS

AMPA Hadi et al. (2013) [232]

10 O. anthropi GPK 3 AMPA Sviridov et al. (2012) [228]

11 O. anthropi LBAA AMPA Kishore and Barry (1992), Gard et

al. (1997) [116, 239]

12 O. anthropi S5 AMPA Gard et al. (1997) [239]

73

4. G

lypho

sate Deg

radin

g B

acterial Strain

s

13 P. pseudomallei 22 AMPA (most probably) Penaloza-Vasquez et al. (1995)

[240]

14 Pseudomonas sp. 4ASW Sarcosine Dick and Quinn (1995) [66]

15 Pseudomonas sp. GLC11 Sarcosine

Selvapandiyan and Bhatnagar

(1994) [227]

16 Pseudomonas sp. LBr AMPA (95 %),

Sarcosine (5 %)

Jacob et al. (1988) [230]

17 Pseudomonas sp. PG2982 Sarcosine Moore et al. (1983) [241]

18 Rhizobium meliloti 1021 Sarcosine Liu et al. (1991) [235]

19 Streptomyces sp. StC Sarcosine Obojska et al. (1999) [234]

20 Stenotrophomonas

Maltophilia, Providencia alcalifaciens

AMPA Nourouzi et al. 2011[242]

21 Pseudomonas aeroginosa AMPA, Sarcosine (most

probably)

Hoodaji et al. 2012[243]

22 Enterobacter cloacae K7 Sarcosine Kryuchkova et al. 2014[244]

23 P. putida, E. colacae, R. aquatilis, S.

marcescens

Sarcosine (most probably) Benslama and Boulahrouf, 2013

[245]


74

4.1.2 Pathways of Glyphosate Biodegradation

Two major pathways of glyphosate biodegradation have been reported. One pathway

involves glyphosate utilization as C source resulting in aminomethylphosphonic acid

(AMPA) production involving glyphosate oxidoreductase (GOX) gene. Second

pathway utilizes glyphosate as P source with production of sarcosine and glycine via

C-P lyase [130].

AMPA Pathway of Glyphosate Biodegradation

This pathway involves glyphosate oxidoreductase (GOX) which cleaves C-N bond of

glyphosate yielding AMPA and glyoxylate in the presence of magnesium and flavin

adenine dinucleotide (FAD) [116]. Glyoxylate enters the Krebs cycle and metabolizes

to its intermediates. GOX gene was isolated from Ochrobactrum antrophi strain

LBAA previously known as Achromobacter sp. and transformed in maize and canola

to augment glyphosate resistance [116]. The glyphosate oxidoreductase (GOX) of

flavin monooxygenase superfamily has been recently purified from O. anthropi GPK

3. It shows maximum activity under alkaline conditions with relatively low affinity

for glyphosate and holds single noncovalently bound FAD molecule per subunit. The

activity of purified enzyme is influenced by oncotic and osmotic pressure with

relative low stability at normal conditions and is hindered by Cu2+

, Ag+, Mn

2+ and p-

chloromercurybenzoic acid. GOX has wide range of substrates including

iminodiacetic acid and phosphonomethyliminodiacetic acid and have ability to

transform glycine, sarcosine and D-alanine to some extent [228]. The thermostable

form of GOX is presumed to exist in thermophilic Geobacillus caldoxylosilyticus T20

isolated from central heating system [238]. C-P lyase pathway was exclusively

considered for glyphosate biodegradation before the discovery of phosphonatase

pathway in O. anthropi GPK 3 [228]. Phosphonatase pathway is involved in

metabolism of phosphonates and consists of two steps. First steps involves

transamination of 2-aminoethylphosphonate (2-AEP, a natural phosphonate ciliatine)

by 2-AEP pyruvate aminotransferase (EC 2.6.1.37, a 80 kDa homodimer with pH

optimum of 8.5) [246]. Second step involves hydrolysis of C-P bond of resulting

phosphonoacetaldehyde by phosphonoacetaldehyde hydrolase (EC 3.11.1.1, a 62 kDa

Mg2+

dependent homodimer with optimal pH of 7.5) [247]. Although these two

enzymes are highly substrate specific and no reports about their involvement in

glyphosate mineralization exist [248-250] however some reports showed likelihood of


75

phosphonatase involvement in AMPA degradation [223, 229]. O. anthropi GPK 3

showed two distinctive activities of transaminase. First activity is related to ordinary

2-AEP pyruvate aminotransferase while the second one is related to AMPA

metabolism resulting in production of phosphonoformaldehyde. It is further

metabolized by phosphonatase to formaldehyde and inorganic phosphate [228].

Sarcosine Pathway of Glyphosate Biodegradation

C-P lyase pathway is most prevalent route used by microorganisms for phosphonates

utilization. C-P bond is cleaved by two types of enzymes, first one are substrate

specific hydrolases while second one are non specific C-P lyases. Glyphosate does not

have active C-P bond (destabilized by nearby oxygen of carboxyl, carbonyl, or epoxy

group) which is required by organophosphonate degrading hydrolases [249, 251].

Inactive C-P bond is highly resistant to enzymatic and chemical hydrolysis therefore

its cleavage needs a multienzyme complex activity such as C-P lyase capable of

converting phosphonates into inorganic phosphonate and corresponding metabolite.

C-P lyase studies in E. coli revealed that this complex have 14 gene which

collectively catalyzes the breakdown of phosphonates [252]. C-P lyases composition

in both gram negative and gram positive bacteria is assumed to be alike [249]. The

phn operon is a part of Pho regulon and induced by phosphorus starvation only. Of

this complex of 14 genes, phnCDE are considered to encode an ATP binding cassette

transporter, phnF acts as a repressor protein and phnNOP have regulatory or some

auxiliary roles [253, 254]. PhnGHIJKLM embodies the core components of the C-P

lyase pathway and mutation or deletion in any one of these genes components put an

end to C-P lyase activity [255]. phnJ is found to catalyze the main C-P cleavage and

this reaction involves the conversion of 5-phosphoribosyl-1-phosphonate to 5-

phosphoribosyl-1,2-cyclic phosphate in the presence of S-adenosyl-l-methionine

(SAM) [254]. PhnI deglycosylates GTP and ATP to ribose-5-triphosphate [256]. The

proposed pathway of phosphonate metabolism revealed that core component of C-P

lyase complex performs two major functions: PhnGHI facilitate the coupling of

phosphonate and ATP whereas PhnJ aids in cleavage of C-P bond.

Glyphosate mineralization through C-P lyase activity leads to the production

of sarcosine which is then metabolized into formaldehyde and glycine by sarcosine

oxidase. Formaldehyde is further oxidized to carbon dioxide and water whereas


76

glycine enters in various biosynthesis processes as a substrate [225, 257]. Such type

of glyphosate degradation pathway is exhibited by those bacterial strains only which

have glyphosate as sole P source. But there are many easily available P sources in

natural environment affecting glyphosate utilization. The activity of C-P lyase is

down regulated by extracellular P which is commonly found in environment [66, 77,

237]. Certain bacterial strains such as mutant form of Arthrobacter sp. GLP-1/Nit

[233] and Alcaligenes sp. GL [118] metabolize glyphosate to sarcosine even in

presence of extracellular P.

4.1.3 Response Surface Methodology

Different parameters are involved in biodegradation process so their optimization is

required for acquisition of highest process efficiency [258]. Usually one factor at a

time approach is used for optimization studies but this method is tiresome and neglect

mutual interaction of parameters leading to misapprehension of results. Conversely,

statistical methods are well planned, economical and lessen the tendency of

ambiguous results [259]. Response Surface Methodology (RSM) is one of the

statistical designs used to optimize experimental procedures in a cost effective manner

by reducing their numerical noise. RSM is a multivariate statistical method that

determines the mutual effect of different variables on response of an experimental

design and has been used effectively for optimization of xenobiotics degradation. It is

very effective design which involves multiple factor experiments, investigate the

relationships among factors, unearth the best fit experimental conditions and predict

the response [260]. A response under the influence of different independent variables

can be optimized through careful designing of experiments. This leads to the model

with complete depiction of variables, their mutual interaction and effect on response.

RSM uses different experimental designs but central composite rotatable design

(CCRD) was used in current study. A comparison between CCRD and other RSM

designs has demonstrated that CCRD has better prediction than other designs because

it include a situation when all variables are in their boundary value simultaneously

[261].

The current work was aimed to study the biodegradation of glyphosate by

indigenously isolated bacterial strains and identification of potential genes involved in

degradation process. Therefore, an isolate found to be effective in glyphosate


77

biodegradation, Comamonas odontotermitis P2, was then subjected to central

composite design (CCD) through RSM for optimization of different growth

parameters for biodegradation of glyphosate.

4.2 Materials and Methods

4.2.1 Enrichment and Isolation of Glyphosate Degrading Bacterial

Strains

Soil was collected from 3 different locations in an experimental field (-34.018°,

150.67°) at cobbitty site, Plant Breeding Institute, University of Sydney, NSW

Australia with a prior history of glyphosate spray. The field was again sprayed with

glyphosate, soil samples were collected at intervals of 4, 7 and 14 days after spraying

at a depth of 5-10 cm of A horizon and saved at 4 °C in sterile zip lock plastic bags.

These samples were dried, sieved and then used for isolation of glyphosate degrading

bacterial strains through enrichment culture technique. Soil samples (10 g each) were

added separately in 250 mL Erlenmeyer flasks containing 100 mL enrichment

medium (EM) (Appendix C) and 1 g/L glyphosate and incubated at 25 °C on rotary

shaker at 150 rpm. After 7 days, 5 mL culture was transferred to fresh EM with same

glyphosate concentration and this sub-culturing was repeated for four weeks. After

four weeks, serial dilutions of enrichment culture were plated on minimal medium

(MM) (Appendix D) agarose plates containing glyphosate and incubated at 30 °C.

Morphologically different bacterial strains were isolated and purified through

repeated streaking. Nutrient agar slants were prepared for preservation of stock

cultures and kept at 4 °C.

4.2.2 Selection of Competent Glyphosate Degrading Bacterial Strain

Growth and glyphosate degradation potential of the bacterial isolates were observed

in 250 mL Erlenmeyer flasks containing 100 mL phosphate free EM medium

supplemented with 500 mg/L glyphosate as sole source of carbon and phosphorus,

incubated in a rotary shaker at 150 rpm and 30 °C for 4 days. The absorption of these

cultures was measured by the spectrophotometer at 590 nm wavelengths. To

investigate utilization of glyphosate as sole carbon source EM medium was used,

whereas for glyphosate utilization as sole P source MM medium was employed

whereas other conditions remained same. All experiments were performed in

triplicates and uninoculated flasks were used as controls. The residual concentration


78

of glyphosate was quantified to determine the degradation potential of all the bacterial

isolates.

4.2.3 Identification and Characterization of Glyphosate Degrading

Bacterial Strains

Genomic DNA of isolated bacterial strains was extracted and 16S rRNA gene analysis

was performed for their molecular characterization (chapter 2, section 2.9). The 16S

rRNA gene sequences of the isolated bacterial strains were submitted in GenBank.

Morphological characterization was carried out by inspecting form, margin and

elevation of isolates on nutrient agar through stereoscope. Shape, pigmentation and

motility were also studied [124]. Differentiation of isolates on the basis of their cell

wall composition was done through Gram staining (chapter 2, section 2.10.2).

Moreover, phylogenetic analysis was carried out as described in chapter 2, section

2.11.5.

4.2.4 Denaturing Gradient Gel Electrophoresis (DGGE) Analysis of

Glyphosate Contaminated Soil

DNA of enrichment cultures was extracted by using InvitrogenTM

genomic DNA

extraction kit according to the instructions provided with kit. The quality and quantity

of extracted DNA was measured by agarose gel electrophoresis and NanoDrop 2000c

spectrophotometer respectively and used for PCR amplification accordingly. PCR-

DGGE of partial eubacterial 16S rRNA gene fragments was carried out as described

in chapter 2 section 2.12. DGGE sequences were submitted in Genbank.

4.2.5 Biodegradation of Glyphosate by Isolated Bacterial Strains

Isolated bacterial strains (P1, P2, P3, P4 and P5) were grown in MM containing 500

mg/L of glyphosate, The cultures were harvested and centrifuged at 6000 rpm for 10

min. The cell pellets were washed with 0.9% saline solution and suspended in the

same solution to obtain an OD of 1. Colony forming units (CFU/mL) of the

suspensions were determined through dilution plate count method and used as

inoculum (2%) for glyphosate biodegradation experiments.

Glyphosate degradation potential of isolated bacterial strains as carbon and

phosphorus source was measured in Erlenmeyer flasks containing 50 mL MM (pH

7.0) supplemented with the 500 mg/L glyphosate. 2% inoculum was added to MM


79

and flasks were incubated at 25 °C in a rotary shaker at 150 rpm. All experiments

were carried out in triplicates and uninoculated flasks were used as controls.

4.2.6 HPLC Analysis of Glyphosate Residues

For HPLC analysis, glyphosate was derivatized with 4-chloro-3,5-

dinitrobenzotrifluoride (CNBF) [129] and analyzed as described in chapter 2 section

2.15.

4.2.7 Optimization of Culture Conditions Using Response Surface

Methodology (RSM)

To optimize the combined effects of pH, temperature and inoculum size on

glyphosate degradation and determination of their optimum combinations, response

surface methodology (RSM) was used. Degradation of glyphosate (500 mg/L) was

monitored in MM as analyzed response after three days of incubation. A three

factor/five level central composite design (CCD) of 23 full factorial with 20 runs was

employed by using Design Expert software (trial version 10, Stat-Ease, Inc., MN,

USA).

Quadratic polynomial equation used to approximate the mathematical

relationship of the response (glyphosate % degradation) of these three variables is

given below:

Y= a0 + a1A + a2 B+ a3C + a12AB + a13AC +

a23BC + a11A2 + a22B

2 + a33C

2 (4-1)

Where Y is the predicted response value, a0 is the value of the fitted response

at the centre point of the design, a1, a2 and a3 are the linear coefficients; a12, a13 and a23

are the cross product coefficients; a11, a22 and a33 are the quadratic coefficients. Based

on the best results of the one-at-a-time method, the ranges and coded levels of three

variables viz. pH (A), temperature (B), and inoculum density (C) are listed in Table

4.2. The design matrix with three variables (pH, temperature, and inoculum

density)×five levels (−1.68, −1, 0, +1, +1.68) is presented in Table 4.2. All the

variables were taken at the coded values.

F test and R2 (correlative coefficient value) was employed to check statistical

significance and quality fit of model respectively. The general experimental setup of


80

three variables generated by RSM for glyphosate degradation was used to validate

model predictions.

Table 4.2 Experimental ranges and coded levels of independent variables.

Independent variables Symbols Coded levels/Range of

variables Mean Std.

Dev.

-1.68 -1 0 +1 1.68

pH of medium (A) 5.32 6.0 7.0 8.0 8.68 7 0.918

Incubation temperature

(°C)

(B) 20.9 25 30 37 41.0 31 5.068

Inoculum size (g/L) (C) 0.06 0.2 0.4 0.6 0.74 0.399 0.165

4.2.8 Detection of Genes Conferring Glyphosate Degradation

To ensure the incidence of genes involved in glyphosate degradation, (GOX, phn

genes) in all isolated bacterial strains, putative GOX and phnJ genes were amplified

using their genomic DNA as template. Degenerate primers were designed using

bacterial GOX and phnJ sequences from NCBI GenBank and further validated

through OligoAnalyzer 3.1.

AMPA Pathway GOX Gene

The primers for amplification of GOX gene comprised of GOX209F-5'

TGCCKAAGTGGCTSCTYGAC 3' and GOX1180R-5'

ACGAGSGTTGCRGTSATCGG 3' resulting in ~900 bp PCR product. Internal

primers (GOX445F-5' GCAGACTTCGCCAAGGAC 3' and GOX974R-5'

CAGTTAGGAGCGGCTGTGAG 3') yielding PCR product of ~530 bp were also

designed to confirm GOX gene and nested PCR was performed. They were designed

by aligning already reported GOX genes from NCBI database (Genbank accession

Nos. GU214711.1, CP000389.1, HQ110097.1). PCR conditions used were:

denaturation at 95 °C for 5 min, 40 cycles at 95 °C for 30 s, 64 °C for 30 s and 72 °C

for 45 s each and final extension at 72 °C for 5 min.


81

Sarcosine Pathway PhnJ Gene

The primers designed for amplification of phnJ were phnJ208F-5'

ATGCCRMTGCCYTAYGGHTG 3' and phnJ1921R-5'

TWASGGCGGMAYSGCRTAGA 3' yielding a PCR product of ~600 bp. These

primers were designed through multiple sequence alignment of previously reported

phnJ genes (Genbank accession Nos. CP015005.1, CP006581.1, AP017605.1). PCR

conditions were: denaturation at 95 °C for 5 min, 35 amplification cycles at 95 °C for

1 min, 56 °C for 1 min and 72 °C for 1 min and final extension at 72 °C for 10 min.

All PCR products were sequenced from Australian Genome Research Facility Ltd.

and these partial gene sequences were submitted to Genbank.

4.3 Results

4.3.1 Selection and Identification of Glyphosate Degrading Bacterial

Strain

Through enrichment culture technique, five bacterial strains were isolated. All the five

bacterial isolates were found capable to utilize glyphosate as a sole C source (in EM

medium) and as sole P source (in MM medium) separately (Figure 4-1a, 4-1b).

Significantly higher growth and glyphosate utilization was observed by the isolate P2

in both cases. For this isolate, culture ODs of 0.29 and 0.24 were obtained

respectively when glyphosate was used as sole C and P sources as compared to ≤ 0.12

OD for all other isolates after 4 days of incubation. Moreover, these isolates were

capable to grow in EM medium (without KP) containing 500 mg/L glyphosate whilst

utilizing it as sole sources of phosphorus and carbon simultaneously. However, after 4

days of incubation, complete degradation of glyphosate was observed only by the

isolate P2 (Figure 4-2). Additionally, 100% glyphosate utilization was observed by P2

as compared to ≤ 50% utilization by the remaining four isolates.


82

Figure 4-1 Utilization of glyphosate (500 mg/L) by isolated bacterial strains.

a Utilization of glyphosate (500 mg/L) as sole carbon source in EM with increase in

optical density was observed after 4 days of incubation b. All bacterial isolates

showed an increase in optical density with utilization of glyphosate (500 mg/L) as P

source in MM after 4 days of incubation.

0

0.05

0.1

0.15

0.2

0.25

0.3

P1 P2 P3 P4 P5

Op

tica

l De

nsi

ty (

590n

m)

Bacterial Strains

0

0.05

0.1

0.15

0.2

0.25

0.3

P1 P2 P3 P4 P5

Op

tica

l Den

sity

(590

nm

)

Bacterial Strains

a

b


83

Figure 4-2 Degradation of glyphosate by bacterial isolates.

All bacterial isolates have potential to degrade 500 mg/L glyphosate but Comamonas

odontotermitis P2 exhibit complete degradation in 104 hours at 30 °C and 7.0 pH.

Graph values are the means of three replicates and error bars represent the standard

error.

4.3.2 Identification and Characterization of Bacterial Isolates

Partial 16S rRNA gene analysis showed that all bacterial strains belong to different

genera found in rhizosphere and exhibit 99% similarity with their respective matches.

Sequences of all bacterial isolates were submitted in Genbank (Table 4.3).

Morphological analysis revealed that all bacterial isolates are motile and gram

negative with different pigmentation, shape, form, margin and elevation (Table 4.4).

0

100

200

300

400

500

600

0 8 16 24 32 40 48 56 64 72 80 88 96 104

Pseudomonas P1

Comamonas P2

Ochrobactrum P3

Achromobacter P4

Agrobacterium P5

Gly

ph

osa

teC

on

cen

trat

ion

(m

g/L)

Time (h)

84

4. G

lyph

osate D

egrad

ing

Bacterial S

trains

Table 4.3 Characterization of the glyphosate degrading bacterial strains isolated in current study

from glyphosate contaminated soil.

Sr.

No.

Isolates

Codes

Closest Sequence Homologs of

Bacterial Isolates

Accession

No.

Accession

No. of Hits

Identity

(%)

1 P1 Pseudomonas straminea KX255004 LC015565.1 99%

2 P2 Comamonas odontotermitis KX255005 NR_043859.1 99%

3 P3 Ochrobactrum anthropi KX255006 KM894190.1 99%

4 P4 Achromobacter spanius KX255007 NR_025686.1 99%

5 P5 Agrobacterium tumefaciens KX255008 KC196477.1 99%

85

4. G

lyph

osate D

egrad

ing

Bacterial S

trains

Table 4.4 Morphological characteristics of glyphosate degrading bacterial strains.

Sr.

No.

Bacterial

Isolates

Form Margin Elevation Shape Pigmentation Motility Gram

nature

1 Pseudomonas

straminea strain

P1

Circular Entire Raised Rod Light yellow Motile Gram

negative

2 Comamonas

odontotermitis

strain P2

Cicular Entire Raised Rod Cream colour Motile Gram

negative

3 Ochrobactrum

anthropi strain

P3

Circular Entire Convex Short

rods

Cream colour Motile Gram

negative

4 Achromobacter

spanius strain

P4

Circular Entire Flat Spherical White Motile Gram

negative

5 Agrobacterium

tumefaciens

strain P5

Circular Entire Convex Rod Yellowish

brown

Motile Gram

negative


86

Through partial 16S rRNA gene (900 bp) analysis using (BLASTn) of the

NCBI, sequences with maximum identity were retrieved for each isolate, aligned and

phylogenetic trees were constructed. P1 isolate showed 99% identity with

Pseudomonas straminea AF95 (LC015565.1) and clustered among type strains of

Pseudomonas straminea and other Pseudomonas spp. indicated in phlogenetic tree

(Figure 4-3). Isolate P2 was found in the lineage of genus Comamonas and showed

maximum sequence identity (99%) with C. odontotermitis strain Dant 3-8

(NR_043859.1). Homologous 16S rRNA gene sequences obtained from the NCBI

were aligned with P2 to generate a phylogenetic tree (Figure 4-4) showing that P2

falls in the same cluster with the type strains of C. odontotermitis and other

Comamonas sp. The approximate phylogenetic affiliations of P3 determined through

nucleotide BLAST analysis of 16S rRNA gene sequence exhibited 99% identity with

Ochrobactrum anthropi E46b (KM894190.1). Phylogenetic tree constructed by

Neighbor joining algorithm showed maximum similarity of P3 with nearest database

entries of other ochrobactrum spp (Figure 4-5). Similarly BLAST analysis of P4

showed maximum sequence similarity with Achromobacter spanius (NR_025686.1)

and phylogenetic analysis demonstrated distribution of this isolate among closely

related Achromobacter spp. (Figure 4-6). Isolate P5 illustrated 99% identity with

Agrobacterium tumefaciens A46 (KC196477.1) and dendrogram constructed through

MEGA 6 showed distribution of this isolate among Agrobacterium sp. on the basis of

sequence similarity (Figure 4-7).


87

Figure 4-3 Phylogenetic tree of Pseudomonas straminea P1.

Based on similarity of 16S rRNA gene sequences with closely related Pseudomonas

spp. Neigbor joining method was used to construct this dendrogram with 1000

iterations. Accession numbers of related sequences are given in brackets.

Pseudomonas sp.Acj 106(AB480754.1)

Pseudomonas fulva ATY63(HQ219982.1)

Pseudomonas putida F29(EF204245.1)

Pseudomonas fulva MRC41(KU672374.1)

Pseudomonas sp.Fa27(AY131221.1)

Pseudomonas parafulva AJ 2130(AB060133.1)

Pseudomonas argentinensis NWP3(KJ875601.1)

Pseudomonas straminea P1(KX255004.1)

Pseudomonas straminea AF95(LC015565.1)

Pseudomonas putida GG59(KJ850210.1)

Pseudomonas argentinensis HDDMM04(EU723826.1)

Pseudomonas sp.EK-I1(GU935266.1)

Pseudomonas sp.M549(AB461834.1)


Pseudomonas straminea IAM 1587(AB060135.1)

Pseudomonas sp.Bg-8(HQ916748.1)

Pseudomonas straminea NBRC 16665(AB681101.1)



Pseudomonas straminea(D84023.1)

Pseudomonas fulva ALEB41(KF460530.1)

Pseudomonas sp.MG-2011-7-BJ(FR872475.1)


88

Figure 4-4 Neighbor joining tree illustrating the phylogenetic relationship of P2

strain.

With other type strains based on the 16S rRNA gene sequences. Bootstrap values

expressed in percentages of 1000 replications are represented at the nodes of the

branches.

Comamonas odontotermitis(DQ453128.1)

Comamonas odontotermitis strain Dant 3-8(NR_043859.1)

Comamonas odontotermitis P2(KX255005.1)

Comamonas odontotermitis strain RJ40(KP701358.1)

Comamonas sp. NT2B(GU458274.1)

Comamonas sp. HM1(GU458261.1 )

Comamonas sp. JL4(JF740040.1)

Comamonas terrigena strain NBRC 13299(NR_113613.1)

Comamonas nitrativorans strain 2331(NR_025376.1)

Comamonas granuli NBRC 101663(NZ_BBJX01000025.1)

Comamonas serinivorans strain SP-35(NR_134010.1)

Comamonas testosteroni strain RCB266(KT260478.1)

Comamonas sp. KBB4(JX997984.1)

Comamonas thiooxydans strain S23(NR_115741.1)

Comamonas testosteroni strain KS 0043(NR_029161.1)

Comamonas testosteroni strain NBRC 14951(NR_113709.1)

Comamonas thiooxydans strain PHE2-6(NZ_LKFB01000041.1)

Comamonas testosteroni(NZ_BBQP01000035.1)

Comamonas sp. E6(NZ_BBXH01000054.1)

Comamonas testosteroni(NZ_JWJW01000032.1)

Comamonas kerstersii(NZ_LFYP01000018.1)

Comamonas testosteroni strain WDL7(NZ_LMXT01000002.1)

Comamonas thiooxydans(NZ_LIOM01000035.1)

Comamonas thiooxydans(NZ_BBVD01000034.1)

Comamonas testosteroni NBRC 14951(NZ_BBJZ01000028.1)

98

75

58

53

55

99

79

85

100

58

82

56


89

Figure 4-5 Phylogenetic analysis of Ochrobactrum anthropi P3 using Mega 6

based on 16S rRNA sequence analysis.

The tree suggests that P3 isolate clades with other Ochrobactrum spp on the basis of

maximum sequence identity.

Ochrobactrum sp.G2(KR052826.1)

Ochrobactrum sp.CCBAU(EF377300.1)

Ochrobactrum anthropi LMG 3331(NR_114979.1)

Ochrobactrum sp.PP-2(KX549468.1)

Ochrobactrum anthropi NBRC 15819(NR_113811.1)

Ochrobactrum anthropi SH23C(KT337526.1)

Ochrobactrum sp.DX2(KC462882.1)

Ochrobactrum sp.n-9(KF010632.1)

Ochrobactrum sp.X-16(EU187496.1)

Ochrobactrum anthropi S4(KT380595.1)

Ochrobactrum anthropi TCC-1(KT820194.1)

Ochrobactrum sp.DS4(KJ817211.1)

Ochrobactrum anthropi ATCC 49188(NR_074243.1)

Ochrobactrum anthropi P3(KX255006.1)

Ochrobactrum anthropi E46b(KM894190.1)

Ochrobactrum anthropi XH02(KU999381.1)

Ochrobactrum sp.A9(KF958486.1)

Ochrobactrum anthropi S180b(KM894186.1)

Ochrobactrum anthropi W-7(EU187487.1)

Ochrobactrum sp.LC498(JN863520.1)

Ochrobactrum anthropi R058(KC252888.1)


90

Figure 4-6 Phylogenetic tree based on homologous sequences of the

Achromobacter spanius P4.

The neighbor joining methods employed through MEGA 6. Topology of dendrogram

supported by bootstrap values of 1000 iterations is represented as percentage values

when >50. Accession numbers are shown in parentheses.

Achromobacter spanius 2P2A1(HF936998.1)

Achromobacter spanius 2P1F8(HF936970.1)

Achromobacter sp.G3Dc4(KF465936.1)

Achromobacter sp.G3Dc11(KF465937.1)

Achromobacter sp.5_24(HF954413.1)

Achromobacter sp.LMG 3441(HG324052.1)

Achromobacter sp. EA_R_2(KJ642225.1)

Achromobacter spanius DUCC3703(KP318450.1)

Achromobacter xylosoxidans C2(KP967463.1)

Achromobacter sp.TY3-4(KP410738.1)

Achromobacter sp.255B4_12AESBL(KU644204.1)

Achromobacter sp.OMC7(KP728242.1)

Achromobacter spanius CCUG 47062(NR_118402.1)

Achromobacter spanius P4(KX255007.1)

Achromobacter spanius LMG 5911(NR_025686.1)

Achromobacter spanius Nr_39(KT714140.1)

Achromobacter spanius B1(KP860309.1)

Achromobacter marplatensis CCUG 56371(NR_118400.1)

Achromobacter xylosoxidans LMG 1863(NR_118403.1)

Achromobacter denitrificans CCUG 407(NR_118398.1)99

70

63


91

Figure 4-7 Dendrogram exhibiting genetic relationships of P5 isolate.

With closely related Agrobacterium spp. based on 16SrRNA gene sequences

submitted in NCBI Genbank. P5 showed 99% similarity with Agrobacterium

tumefaciens A46.

4.3.3 DGGE Analysis of Enrichment Cultures

DGGE analysis of glyphosate enrichment cultures was carried out to monitor the

persistence of bacterial community under glyphosate stress. DGGE profile analysis

revealed the selection of limited number of bacterial strains through enrichment steps.

The cultures enriched with glyphosate in the first week had higher number of bands as

compared to the fingerprints from later weeks signifying a selection for glyphosate

tolerant microorganisms. Two groups of DGGE bands were observed in gel. First

group of bands indicated the organisms that were present in soil at initial enrichment

step but became very weak or disappeared by the final enrichment steps. Second

group of bands were present in fingerprints of all enrichment steps. Those bands

represented dominant bacterial strains in glyphosate treated soil capable to utilize

glyphosate as C and P sources (Fig 4-8a, 4-8b). Sequence analysis showed their

affiliation with Pseudomonas sp. (DG1), Comamonas sp. (DG2), uncultured

phyllobacterium sp. (DG3), mesorhizobium sp. (DG4), uncultured chryseobacterium

Agrobacterium tumefaciens P5(KX255008.1)

Agrobacterium tumefaciens A46(KC196477.1)

Agrobacterium sp.AN16(KR051019.1)

Agrobacterium tumefaciens NFM2(KP410821.1)

Agrobacterium tumefaciens(KT825747.1)

Agrobacterium tumefaciens LM-1(KM884891.1)

Agrobacterium tumefaciens AF114(LC015594.1)

Agrobacterium tumefaciens SQ3-38-1(KM252932.1)

Agrobacterium sp.SAUBS3-4(KC243285.1)

Agrobacterium tumefaciens A14(KC196473.1)

Agrobacterium sp.AN17(KR051020.1)

Agrobacterium tumefaciens DD260(KR822276.1)

Agrobacterium tumefaciens MLS-1-10(KT997434.1)

Agrobacterium tumefaciens DSR11(JQ342861.1)

Agrobacterium tumefaciens NFM10(KP410823.1)

Agrobacterium tumefaciens DSS5(JQ342845.1)

Agrobacterium tumefaciens AF47(LC015593.1)

Agrobacterium tumefaciens NSBm.28(CFS1)(JF708879.1)

Agrobacterium tumefaciens(KP875541.1)

Agrobacterium sp.(KR081269.1)

Agrobacterium tumefaciens LM6-1(KM884893.1)


92

sp. (DG5), ochrobactrum sp. (DG6), Uncultured bacteriodetes bacterium (DG7),

uncultured bacterium (DG8), uncultured gamma proteobacterium (DG9) uncultured

flavobacterium sp. (DG10), uncultured brucella sp. (DG11), uncultured

bradyrhizobium sp. (DG12). As indicated by sequencing of bands obtained from

DGGE gel P2 strain was quite persistent among the replicates of enrichment cultures

till the end of enrichment experiment (Table 4.5).

93

4. G

lypho

sate Deg

radin

g B

acterial Strain

s

Figure 4-8 (a, b) 16S rDNA denaturing gradient gel electrophoresis (DGGE) analysis of bacterial community in enrichment

cultures of glyphosate contaminated soils.

Lanes T1 to T3 represent triplicates of enrichment cultures respectively. Cultures were enriched in triplicates (T1, T2, and T3) and

selected bands were eluted from the gel and sequenced.jjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjj

a b


94

Table 4.5 Sequence analysis of DGGE bands obtained from glyphosate enriched

culture.

Sr.

No.

Gel

Band

Codes

Closest Sequence

Homologs of DGGE Bands

Accession

No.

Accession

No. of Hits

Identity

(%)

1 DG1 Pseudomonas sp. KC195786.1 HQ437167.1 99%

2 DG2 Comamonas sp. KC195784.1 KX225362.1 99%

3 DG3 Uncultured phyllobacterium

sp. KC195787.1 KJ767758.1 94%

4 DG4 Mesorhizobium sp. KC195788.1 FJ544254.1 92%

5 DG5 Uncultured

Chryseobacterium sp. KC195789.1 HF678230.1 95%

6 DG6 Ochrobactrum sp. KC195790.1 HQ871878.1 100%

7 DG7 Uncultured bacteriodetes

bacterium KC195791.1 JQ400915.1 90%

8 DG8 Uncultured bacterium KC195783.1 KF482425.1 82%

9 DG9 Uncultured beta

proteobacterium KC195782.1 EF127786.1 85%

10 DG10 Uncultured Flexibacteraceae

bacterium KC195785.1 AY878333.1 94%

11 DG11 Uncultured Phyllobacterium

sp. KC195781.1 KF559227 95%

12 DG12 Uncultured bradyrhizobium

sp. KC195780.1 KJ767756.1 94%


95

4.3.4 Optimization of Parameters for Glyphosate Degradation Using

RSM

Contrary to the conventional “single factor at a time experiments”, interaction and

concurrent effect of different factors; temperature, pH and initial inoculum size on

glyphosate degradation was studied using RSM. On the basis of central composite

design, 20 experimental setups were carried out consisting of 8 full factorial points, 6

central and 6 axial points located at the central and the extreme levels (Table 4.6).

Analysis of variance (ANOVA) values calculated by quadratic response surface

model are given in Table 4.7. The efficacy of model was demonstrated by

determination coefficient (R2

= 0.969) which corroborated that independent variables

ascribe 96.9% variability to glyphosate degradation. High value of the adjusted

determination coefficient (Adj. R2

= 0.9428) also showed the best fit of the model.

Furthermore high F-value (35.83) and low p-value showed that quadratic model was

significant. The non-significant value of lack of fit showed that degree of fitting is

fine. The p-value of individual variables exhibited that all factors significantly

influenced glyphosate degradation but effect of inoculum density was promising.


96

Table 4.6 Predicted and experimental values of glyphosate degradation by CCD

matrix.

Standard

No.

Variables in coded levels Response

(glyphosate degradation %)

A B C Actual Predicted

1 -1 -1 -1 54.00 53.19

2 1 -1 -1 66.00 67.32

3 -1 1 -1 38.00 33.32

4 1 1 -1 68.00 65.94

5 -1 -1 1 88.00 89.83

6 1 -1 1 72.10 76.45

7 -1 1 1 72.00 70.45

8 1 1 1 75.00 75.58

9 -1.68 0 0 60.00 62.49

10 1.68 0 0 84.00 81.74

11 0 -1.68 0 76.00 71.81

12 0 1.68 0 50.00 54.52

13 0 0 -1.68 42.00 45.50

14 0 0 1.68 90.00 86.17

15 0 0 0 90.00 88.95

16 0 0 0 87.00 88.95

17 0 0 0 88.00 88.95

18 0 0 0 91.00 88.95

19 0 0 0 92.00 88.95

20 0 0 0 85.00 88.95


97

Table 4.7 Analysis of variance (ANOVA) for the glyphosate degradation

response (%).

Source Degrees of

freedom

(DF)

Sum of squares

(SS)

Mean square

(MS)

F-value p-value

Model 9 5339.22 593.25 35.83 <0.0001*

Residual

error

10 165.58 16.56

Lack of fit 5 130.75 26.15 3.75 0.0865**

Pure Error 5 34.83 6.97

Total error 19 5504.80

R2 = 0.969

Adjusted R2 = 0.9428

Predicted R2 = 0.8139

Adeqate precision= 19.640

* Significant at p<0.05

** Non-significant at p>0.05

Multiple linear regression analysis was applied on experimental data by using

linear (A, B, C), quadratic (A2, B

2, C

2) and interactive (AB, AC, BC) effects of all

independent variables (Table 4.8). A polynomial quadratic equation illustrating the

degradation of glyphosate (%) is represented by the following mathematical

expression:

Y= 88.95 + 4.81A − 5.19B + 11.57C + 4.63AB

− 6.87AC+ 0.13BC − 4.21A2 – 9.28B

2 − 8.95C

2 (4-2)

A, B and C represent three independent variables i.e. pH, incubation

temperature and inoculums size respectively. The positive and negative values of

regression coefficients signify the synergistic and antagonistic effects of every

variable respectively. In this instance regression equation demonstrates an

antagonistic effect shown by B, AC, A2, B

2and C

2 while a synergistic effect depicted

by A, C, AB and BC (Table 4.8).


98

Table 4.8 Regression analysis and model coefficients of variables for glyphosate

degradation response (%)

Source Coefficients Standard error coefficients p-value

Constant 88.95 1.66 < 0.0001*

A 4.81 1.02 0.0008*

B −5.19 1.11 0.0008*

C 11.57 1.13 <0.0001*

AB 4.63 1.44 0.0093*

AC −6.87 1.44 0.0007*

BC 0.13 1.44 0.9325**

A2 −4.21 0.80 0.0004*

B2 −9.28 1.09 <0.0001*

C3 −8.95 1.19 <0.0001*

* Significant at p<0.05

** Non-significant at p>0.05

4.3.5 Response Surface Plots for Glyphosate Degradation

Three dimensional response surface and contour plots were plotted to comprehend the

relationship between experimental variables (A, B & C) and the response (%

degradation of glyphosate) on the basis of second order model. The effect of these

experimental factors was studied by varying two factors over experimental range

while keeping third variable constant. The contour plot shape shows the significance

of mutual effects of experimental variables. A circular contour plot demonstrate non-

significant interaction between variables whereas an elliptical or saddle contour plot

exhibit significant mutual interaction of experimental variables [262, 263]. Figure 4-

9a and 4-9b) shows the interaction of pH and temperature and a slightly elliptical

contour plot indicate that % degradation of glyphosate is significantly affected by

variation in these two factors. 3-D surface graph shows that glyphosate degradation

increases with increase in temperature and pH up to an optimum point but further

increase has an adverse effect on glyphosate degradation. Maximum degradation of


99

glyphosate was found at 31 °C. Figure 4-9c and 4-9d indicates that the interaction

between inoculum density and temperature is non-significant. Both high and low

values of inoculum size and temperature do not show effective glyphosate

degradation. An increase in temperature reduces glyphosate degradation. Moreover

glyphosate degradation increases with an increase in inoculum density and

temperature up to a certain limit. The elliptical contour plot shows that pH and

inoculum density significantly affect glyphosate degradation (Figure 4-9e and 4-9f).

Glyphosate degradation increases with increase in inoculum density up to an optimal

pH level.

The optimized % degradation of glyphosate predicted by software was found

to be 92.2% based on optimized values of variables i.e. temperature 29.9 °C, pH 7.4

and inoculum size 0.45 g/L after 3 days. Validity of the applied model was confirmed

by performing experiments with the optimized values predicted by RSM and 90%

degradation was attained. This experimental value is close to the predicted value of

glyphosate degradation (92.2%) signifying the sufficiency of the acquired model for

glyphosate degradation.

10

0

4. G

lypho

sate Deg

radin

g B

acterial Strain

s

a b

10

1

4. G

lyph

osate D

egrad

ing

Bacterial S

trains

c d

10

2

4. G

lyph

osate D

egrad

ing

Bacterial S

trains

Figure 4-9 RSM analysis of glyphosate degradation.

Contour plot a and Response surface plot b depicting effect of mutual interaction of temperature and pH on glyphosate degradation (%) at

constant inoculum size (0.54 g/L) and 500 mg/L initial concentration of glyphosate. Contour plot c and response surface plot d depicting effect

of mutual interaction of inoculum size and temperature on glyphosate degradation (%) at constant pH (7.4) and 500 mg/L initial concentration of

glyphosate. Contour plot e and response surface plot f depicting effect of mutual interaction of pH and inoculums size on glyphosate at constant

temperature (29.9 °C) and 500 mg/L initial concentration of glyphosate.jjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjj

f e

e f


103

4.3.6 Identification of Glyphosate Degrading Genes from Isolated

Bacterial Strains

GOX Gene

Partial GOX gene sequence (~900 bp) was successfully amplified and further

confirmed by nested PCR (~530 bp amplicons) from C. odontotermitis P2 whereas no

other bacterial strain showed amplification (Figure 4-10a, 4-10b). Blast analysis of C.

odontotermitis GOX gene showed 99% similarity with already reported GOX gene of

Ochrobactrum sp. G1 (GU214711.1) and synthetic construct GOX gene

(HQ110097.1). Phylogenetic analysis was done to study evolutionary relationship of

amplified GOX gene with already reported ones (Fig 4-11).

Figure 4-10 GOX amplification from Comamonas odontotermitis P2.

a Amplification of GOX gene of ~900 bp from Comamonas odontotermitis P2 using

degenerate primers b Amplification of GOX gene (~530 bp) from Comamonas

odontotermitis P2 using nested primers.

a b


104

Figure 4-11 Phylogenetic analysis of Comamonas odontotermitis P2 GOX.

Phylogenetic tree constructed on the basis of BLAST analysis of Comamonas

odontotermitis P2 GOX gene showing maximum identity with already reported GOX

genes.

PhnJ Gene

A ~580 bp putative phnJ (encodes a catalytic component of C-P lyase) fragment was

also successfully amplified from C. odontotermitis P2, O. anthropi P3, A. spanius P4

and A. tumefaciens P5 whereas no amplification was observed in P. straminea P1

(Figure 4-12). Blast analysis of phnJ sequence obtained from strain P2 revealed 93%

and 88% identity with already reported phnJ genes of Aminobacter aminovorans

strain KCTC 2477 (CP015005.1) and Mesorhizobium loti (AP017605.1) respectively

(Figure 4-13).

Figure 4-12 Amplification of phnJ gene from glyphosate degrading bacterial

isolates.

P2, P3, P4 and P5 showed an amplification of ~530 bp where no PCR product was

obtained in case of P1.

Ochrobactrum sp.G-1 Gox gene(GU214711.1)

Uncultured bacterium clone pGOXA(GU479462.1)

Chelativorans sp.BNC1 GOX gene(CP000389.1)

Comamonas odontotermitis P2 GOX gene

Synthetic construct GOX gene(HQ110097.1)

Uncultured bacterium clone pGOXB(GU479463.1)

99

29

30


105

Figure 4-13 Blast analysis of phnJ gene amplified Comamonas odontotermitis P2.

Analysis revealed 90% identity with already reported phnJ genes. Phylogenetic tree

was constructed on the basis of PhnJ sequence identity.

4.4 Discussion

Herbicides have long been used for weed control in agriculture sector. Addition of

herbicides in soil is deterimental for soil biota thus their removal is essential to

prevent their accretion. Biodegradation is an eco-friendly and cost effective

technology to combat this problem. Generally biological ways of herbicide removal

are quite effective as compared to chemical ways especially in case of glyphosate

which has a strong C-P bond [264]. Biodegradation involves the conversion of

harmful substances into non toxic or less toxic substances. This methodology needs

the isolation of potential degrading microorganisms and their recruitment for

metabolizing toxic organic pollutants. Therefore bacterial strains acclimatized to high

concentrations of glyphosate were isolated and used for glyphosate biodegradation.

Different bacterial strains have been isolated and investigated for their glyphosate

degradation potential in this context [65]. Certain bacterial isolates have potential to

use glyphosate as C, P or N source [265]. Although certain Comamonas spp. has been

reported to degrade different recalcitrant pollutants [266-270] but there is no report

about C. odontotermitis as glyphosate degrader. C. odontotermitis P2 isolated in

current study has potential to utilize glyphosate as C and P source. Therefore this

finding is new addition to the list of glyphosate degrading bacteria that can be

exploited for decontaminating glyphosate polluted environment. Glyphosate

degradation potential of C. odontotermitis P2 may be attributed to its adaptation for

Sinorhizobium meliloti 2011 Phnj(CP004139.1)

Rhizobium meliloti phnj(M96263.1)

Ensifer adhaerens Casida A Phnj(CP015881.1)

Comamonas odontotermitis P2 Phnj gene

Mesorhizobium amorphae CCNWGS0123 Phnj(CP015318.1)

Mesorhizobium ciceri WSM1284 Phnj(CP015064.1)

Mesorhizobium huakuii 7653R Phnj(CP006581.1)

Mesorhizobium loti TONO Phnj(AP017605.1)

Aminobacter aminovorans KCTC 2477 Phnj(CP015005.1)

Mesorhizobium australicum WSM2073 Phnj(CP003358.1)

Agrobacterium sp. RAC06 Phnj(CP016499.1)

Sinorhizobium fredii HH103 Phnj(HE616899.1)

Sinorhizobium meliloti RMO17 Phnj(CP009146.1)

100

99

97

70

74

69

64

74

100

58


106

glyphosate as energy source or genetic mutation leading to activation of enzymes

involved in degradation.

Bacterial cells require certain nutrients (C, N and P) for their growth and

metabolic activities and acclimatize themselves to the environment in case of

nutrients unavailability [121]. Therefore isolated bacteria were cultivated preliminary

in carbon and phosphate free media containing glyphosate to enhance their glyphosate

utilization efficiency. The adapted cells utilized glyphosate as carbon and phosphorus

source possibly due to the induction of glyphosate metabolic enzyme system. C.

odontotermitis P2 is found to utilize glyphosate as P source more efficiently rather

than as C source. Moneke et al. has also reported that Acetobacter sp. has better

ability to use glyphosate as P source than C source [271].

DGGE analysis revealed significant shifts in bacterial community structure

which may be attributed to the changed environment in laboratory conditions.

Bacterial strains showing glyphosate utilization under natural environmental

conditions might lose their activity due to change in required ratios of C, P or N.

Moreover, bands existing in the fingerprints of later enrichment cultures might be

consequence of constant selection pressure resulting in propagation of potential

glyphosate degrading bacteria. The bands present in initial enrichment steps but

disappeared in fingerprints of final enrichments steps may be due to their intolerance

to glyphosate, removal of bacteria that want to use soil particles as a solid substratum

to attach to or their replacement by bacteria with improved glyphosate degrading

abilities.

Certain growth parameters such as pH, inoculums size and temperature have

significant impact on biodegradation of organic pollutants [9, 272, 273].

Biodegradation process is regulated through variations in these parameters therefore

their optimization is crucial. Contrary to the conventional method involving single

factor at a time experiments, response surface methodology (RSM) was employed in

current study. Through RSM, more than one factor and their mutual interaction can be

studied simultaneously. The effect of three factors: temperature, pH and inoculums

density on glyphosate biodegradation was analyzed. Although C. odontotermitis P2

was found capable of degrading glyphosate at all experimental temperature, pH and

inoculums size but RSM provided set of conditions for maximum degradation. An


107

increase in inoculum density enhances glyphosate degradation depending on pH and

temperature. Glyphosate degradation increased with increase in pH and inoculums

density which may be attributed to the activation of degrading enzymes at higher pH.

pH and temperature also affect glyphosate degradation at optimum inoculum density

however decreases at high temperature. RSM gave a set of optimized conditions to

achieve maximum glyphosate degradation (92.2%) based on optimized values of

variables i.e. temperature 29.9 °C, pH 7.4 and inoculum size 0.45 g/L within 3 days of

incubation.

C-P lyase encoding gene has been identified in Pseudomonas sp., Rhizobium

spp. and Streptomcyces sp. whereas GOX gene has been reported in Arthrobacter

atrocyaneus, Pseudomonas sp. and Ochrobactrum sp. [67]. Although C-P lyase

encoding genes have been identified in many bacterial strains but there are only few

reports on glyphosate oxidoreductase encoding GOX gene as found in Ochrobactrum

sp. G-1 (GenBank accession no. GU214711.1) and Chelativorans sp. BNC1

(CP000389.1) [116]. There is no data available in literature about GOX identification

in C. odontotermitis and a limited number of studies have addressed GOX activity by

which glyphosate is converted to AMPA and glyoxylic acid through C-N bond

cleavage within specific bacteria such as from industrial activated sludge that has

been exposed to glyphosate and byproducts of its production. The results of

glyphosate degradation showed that C. odontotermitis could utilize glyphosate as C

and P source. These findings are in agreement with previous reports which indicated

that C and P starvation results in glyphosate uptake as source of C and P leading to

the activation of glyphosate degradation pathways [121]. GOX involves cleavage of

C-N bond of glyphosate with formation of AMPA and provides available carbon to

bacteria whereas C-P lyase cleaves C-P bond of glyphosate and microorganisms can

therefore use it as alternative phosphorus source.

Current study shows the isolation and identification of C. odontotermitis P2 on

the basis its potential to metabolize glyphosate. This work has added a new species to

the list of already reported glyphosate degrading bacteria. Identification of potential

GOX and C-P lyase genes indicates the incidence of two glyphosate degradation

pathways in C. odontotermitis P2. This finding signifies that GOX and C-P lyase

pathways are potentially encoded by a single strain. Moreover, response surface

methodology (RSM) provides imperative information about optimization of various


108

growth parameters and their mutual effects for maximum degradation of glyphosate.

DGGE analysis shows the dominance of strain C. odontotermitis P2 in enrichment

culture. Capability of C. odontotermitis P2 to degrade glyphosate under diverse

conditions demonstrates that it would be a good candidate for decontamination of

glyphosate affected environment.

109

5. Discussion

5.1 Aim of Thesis

The decisive venture of human beings has been growing crops to fulfill food and fiber

requirements since their existence. Currently more than 6 billion people uphold major

crops worldwide and any intimidation to agricultural sector has detrimental upshots.

Crops are mainly affected by pests and herbs (weeds) every year. Different strategies

are used for pest and weed management to augment productivity and survival of

crops. Mechanical methods such as removal of weeds with hands or some primal tools

e.g., hoe were used for controlling weeds in ancient times. Nowadays different

herbicides have been developed and employed for this purpose thus making

noteworthy contribution to enhanced agricultural productivity. However, excessive

production and utilization of such xenobiotic compounds have engendered mayhem in

natural environment through contaminating air, water and soil resulting in commotion

of biogeochemical cycle and different biota.

Glyphosate is an active ingredient of most widely used herbicides such as

Roundup. Nonselective nature of glyphosate makes this compound ominous even for

desired plants. It performs its function by hampering protein synthesis through

inhibition of aromatic amino acid pathway. It has become indispensable in agriculture

and silviculture particularly after the preamble of glyphosate resistant crops. Since

biotechnology proffer economically beneficial approaches in the areas of industry,

agriculture, health and environment. Different bacterial strains isolated from

contaminated areas and bearing novel genes and proteins have been employed for

industrial, agricultural and environmental applications. Glyphosate resistant crops are

genetically engineered by using glyphosate resistant genes from such bacterial isolates

(Reviewed in chapter 1). Presently substantial attention has been given to the

identification of bacterial strains conferring high resistance to glyphosate. Keeping in

view the current scenario, glyphosate resistant bacterial strains were isolated and

assessed for their tolerance potential in this study (Reviewed in chapter 3).

5. Discussion

110

Toxicity of glyphosate has been misapprehended since its discovery owing to

the absence of shikimate pathway in animals and human beings. Duke and Powles,

2008 reported that glyphosate has low toxicity as compared to aspirin or sodium

chloride [56]. However later studies invalidated this customary dogma and divulged

toxic effects of glyphosate on living organisms. Glyphosate has detrimental effects on

soil biota as well as on human beings. Various diseases have been found mounting in

agricultural communities exposed to glyphosate such as Alzheimer's disease,

Parkinson's disease, autism, AD, PD, anxiety disorder, inflammatory bowel disease,

cholestasis, renal lithiasis, anxiety syndrome, osteoporosis, infertility and thyroid

dysfunction [274]. Consequently excessive use of glyphosate is leading to the

contamination of ecosystem and its repercussions are under consideration by scientific

community these days. The endeavor of glyphosate decontamination can be achieved

by employing microorganisms through a cost effective and environmentally safe

technology called bioremediation.

Bioremediation technology involves exploitation of microorganisms to

diminish, remove or transform toxic xenobiotics found in soil or water to less toxic

compounds. Microorganisms can endure variations in environmental conditions

therefore their metabolic competence is very important. Bioremediation upholds the

intensification of particular indigenous microbiota capable of executing desired

activities at contaminated sites [275]. Such type of microbiota can be established by

certain ways involving growth promotion through addition of terminal electron

acceptors and nutrients, and by controlling growth parameters [276, 277].

Microorganisms utilize the toxic compounds as nutrient or energy sources in

bioremediation process [276, 278]. Therefore this aptitude of the microorganism has

been used for the welfare of humanity, flora and fauna and also for tapering the stress

of toxic xenobiotic compounds on ecosystem. Hence, different bacterial strains

capable of degrading glyphosate were isolated in current study (Reviewed in chapter

4).

The bacterial isolates were scrutinized for their degradation potential

regarding glyphosate. Different growth parameters were optimized to attain maximum

degradation of glyphosate. The genes reported to involve in glyphosate degradation

were identified from isolates in order to make an attempt for elucidation of

biodegradation pathway. The major rationale of this study was to attain methodical

5. Discussion

111

insight of glyphosate utilization by bacteria to facilitate bioremediation of

contaminated water and soil.

5.2 Major Findings

5.2.1 Ochrobactrum intermedium Sq20

Screening for glyphosate tolerant bacterial strains led to the isolation of bacteria from

different genera. Among all the isolates Ochrobactrum intermedium Sq20 was found

capable to tolerate >2 g/L of glyphosate. Moreover, its degradation potential was also

assessed and Ochrobactrum intermedium Sq20 showed complete degradation of

glyphosate at 500 mg/L initial concentration as sole carbon and energy source within

4 days. Glyphosate resistance gene, aroA gene (designated as aroAO.intermedium Sq20) was

amplified from this indigenous isolate Sq20. An open reading frame (ORF) of 1353

bp representing aroAO.intermedium Sq20 was amplified from Sq20 which showed 97%

homology with aroA genes from other Ochrobactrum spp. The sequence and

phylogenetic analysis revealed that aroAO.intermedium Sq20 encodes a polypeptide of 450

amino acids designated as EPSPSO.intermedium Sq20 and belongs to class II EPSPS

enzymes. The glyphosate resistant microbes identified hitherto include Agrobacterium

sp. strain CP4, Achromobacter sp. strain LBAA, Ochrobactrum anthropi and

Pseudomonas sp. strain PG2982. The EPSPS enzymes of these bacteria are classified

as class II EPSP synthases on the basis of their catalytic efficiency in the presence of

glyphosate and their substantial sequence variation [149]. Physicochemical

characterization demonstrated the validation and authenticity of 3-D model of

EPSPSO.intermedium Sq20 and was found significant and reliable for investigating the

mechanisms underlying the glyphosate tolerance. Furthermore, it was surmised that

EPSPSO.intermedium Sq20 has auspicious aptitude for production of glyphosate resistant

transgenic crops.

5.2.2 Comamonas odontotermitis P2

While investigating for glyphosate degrading bacterial strains, five bacterial strains

capable to utilize glyphosate as carbon and phosphorus source under different

environmental conditions were isolated. One novel bacterial strain unearthed as

Comamonas odontotermitis P2 through biochemical features and 16S rRNA sequence

analysis exhibited significant glyphosate degrading activity. The strain P2 was found

proficient to degrade 1.5 g/L glyphosate completely within 104 h. Consequently this

5. Discussion

112

strain can be potentially exploited for decontamination of glyphosate polluted areas.

Comamonas sp. has been reported as metal resistant bacteria able to degrade different

aromatic compounds [238]. Growth parameters of strain P2 were optimized through

response surface methodology (RSM) for glyphosate degradation. RSM has been

found useful for elucidation of growth parameters as it allows to study more than one

parameters at a time. In present study, three parameters were studied with changing

two parameters while keeping one constant resulting in polynomial equation helpful

in prediction of glyphosate degradation (%). Three dimensional graphical

representation of RSM helped to develop an immediate understanding of the

biodegradation trend. Likewise this methodology has revolutionized the earlier trend

of lengthy and tiresome one factor at a time approach. Therefore RSM is a time

saving approach supporting the investigation of mutual interaction between multiple

factors and response.

5.2.3 Glyphosate Degrading Genes

With the intention of investigating fate of glyphosate during biodegradation process,

an attempt was made to identify potential genes involved in glyphosate degradation.

Therefore, primers were designed on the basis of formerly reported glyphosate

degrading genes and amplification was carried out under respective conditions. Two

imperative potentially encoding genes, glyphosate oxidoreductase (GOX) and phnJ

(C-P lyase encoding gene) genes were successfully amplified from Comamonas

odontotermitis P2. Sequencing of GOX and phnJ from C. odontotermitis P2 revealed

99 and 93% identity to already reported bacterial GOX and phnJ genes respectively.

Identification of these two genes in strain P2 correlates the findings with cleavage of

C-N and C-P bonds of glyphosate indicating its potential to degrade glyphosate

through GOX and C-P lyase metabolic pathways. This potential of Comamonas

odontotermitis P2 can be employed for efficient degradation of glyphosate which can

be exploited for reduction in soil pollution.

5.3 Explicit Future Recommendations

1. Functional characterization of EPSPSO.intermedium Sq20 from Ochrobactrum

intermedium Sq20 will help in understanding its role at molecular level and also

plausible usage for production of glyphosate resistant transgenic crops. In

addition, the competence of Ochrobactrum intermedium Sq20 to survive and

5. Discussion

113

reproduce at high concentrations of the glyphosate in indigenous soil will help in

the remediation of glyphosate contaminated environments.

2. In situ remediation of glyphosate can be done by using Comamonas

odontotermitis P2 at glyphosate exposed sites. This strategy will help to improve

soil quality and diminish health risks related to glyphosate accumulation in fields.

This technology will also help to improve quality standards and boost agricultural

export through curtailing pesticide residues in export products.

3. The identification of metabolites produced during glyphosate degradation through

LCMS or MS/MS analysis will help in prediction of metabolic pathways.

Furthermore, detection of unknown metabolites may escort to the prediction of

new metabolic pathways.

4. The protein expression analysis of glyphosate degrading genes amplified from

bacterial isolates from induced and un-induced cultures will help in establishing

enhanced bioremediation.

114

6. References

[1] T. Leisinger, R. Hutter, and A. M. Cook, "Microbial degradation of

xenobiotics and recalcitrant compounds," FEMS Symp, 1981.

[2] K. P. Shukla, N. K. Singh, and S. Sharma, "Bioremediation: developments,

current practices and perspectives," Genet. Eng. Biotechnol. J., vol. 3, pp. 1-

20, 2010.

[3] W. Zhang, F. Jiang, and J. Ou, "Global pesticide consumption and pollution:

with China as a focus," Proc. Intl. Acad. Ecol. Environ. Sci. U.S.A., vol. 1, p.

125, 2011.

[4] D. Pimentel, "Environmental and economic costs of the application of

pesticides primarily in the United States," Environ. Dev. Sustainability, vol. 7,

pp. 229-252, 2005.

[5] C. A. Damalas, "Understanding benefits and risks of pesticide use," Sci. Res.

Essays,, vol. 4, pp. 945-949, 2009.

[6] M. Dua, A. Singh, N. Sethunathan, and A. Johri, "Biotechnology and

bioremediation: successes and limitations," Appl. Microbiol. Biotechnol., vol.

59, pp. 143-152, 2002.

[7] G. R. Chaudhry and S. Chapalamadugu, "Biodegradation of halogenated

organic compounds," Microbiol. Rev., vol. 55, pp. 59-79, 1991.

[8] D. A. Vaccari, P. F. Strom, and J. E. Alleman, Environmental Biology for

Engineers and Scientists: John Wiley & Sons, 2005.

[9] M. Diez, "Biological aspects involved in the degradation of organic

pollutants," J. Soil Sci.Plant Nutr., vol. 10, pp. 244-267, 2010.

[10] C. Colosio, M. Tiramani, G. Brambilla, A. Colombi, and A. Moretto,

"Neurobehavioural effects of pesticides with special focus on

organophosphorus compounds: which is the real size of the problem?,"

Neurotoxicology, vol. 30, pp. 1155-1161, 2009.

[11] M. Jokanovic and M. Prostran, "Pyridinium oximes as cholinesterase

reactivators. Structure-activity relationship and efficacy in the treatment of

poisoning with organophosphorus compounds," Curr. Med. Chem., vol. 16,

pp. 2177-2188, 2009.

[12] S. Yair, B. Ofer, E. Arik, S. Shai, R. Yossi, D. Tzvika,and K. Amir,

"Organophosphate degrading microorganisms and enzymes as biocatalysts in

environmental and personal decontamination applications," Crit. Rev.

Biotechnol., vol. 28, pp. 265-275, 2008.

[13] N. L. Wolfe, R. G. Zepp, and D. F. Paris, "Use of structure-reactivity

relationships to estimate hydrolytic persistence of carbamate pesticides,"

Water Res., vol. 12, pp. 561-563, 1978.

6. References

115

[14] B. Eskenazi, A. Bradman, and R. Castorina, "Exposures of children to

organophosphate pesticides and their potential adverse health effects,"

Environ. Health Perspect., vol. 107, p. 409, 1999.

[15] N. G. Ternan, J. W. Mc Grath, G. Mc Mullan, and J. P. Quinn, "Review:

organophosphonates: occurrence, synthesis and biodegradation by

microorganisms," World J. Microbiol. Biotechnol., vol. 14, pp. 635-647, 1998.

[16] E. G. Jaworski, "Mode of action of N-phosphonomethylglycine. Inhibition of

aromatic amino acid biosynthsis," J. Agric. Food Chem., vol. 20, pp. 1195-

1198, 1972.

[17] R. L. Hilderbrand and T. Henderson, "The Effects of Phosphonates on Living

Systems," The Role of Phosphonates in Living Systems.ed Hilderbrand, R. L.

Boca Raton, Florida, USA. C.R.C. Press, Inc., pp. 139-170, 1983.

[18] T. Egli, "(An) aerobic breakdown of chelating agents used in household

detergents," Microbiol. Sci., vol. 5, pp. 36-41, 1988.

[19] R. J. Tyhach, R. Engel, and B. Tropp, "Metabolic fate of 3, 4-dihydroxybutyl-

1-phosphonate in Escherichia coli," J. Biol. Chem., vol. 251, pp. 6717-6723,

1976.

[20] H. Fleisch, "Bisphosphonates," Drugs, vol. 42, pp. 919-944, 1991.

[21] A. Lacoste, C. Dumora, and A. Cassaigne, "Cleavage of the carbon to

phosphorus bond of organophosphonates by bacterial systems," Biochemistry

(Life Sci. Adv.), vol. 8, pp. 97-111, 1989.

[22] M. Horiguchi and M. Kandatstu, "Isolation of 2-aminoethane phosphonic acid

from rumen protozoa," Nature, pp. 97-111, 1959.

[23] B. L. Wanner and W. W. Metcalf, "Molecular genetic studies of a 10.9-kb

operon in Escherichia coli for phosphonate uptake and biodegradation,"

FEMS Microbiol. Lett., vol. 100, pp. 133-139, 1992.

[24] S. B. Powles and Q. Yu, "Evolution in action: plants resistant to herbicides,"

Annu. Rev. Plant Biol., vol. 61, pp. 317-347, 2010.

[25] S. Vats, "Herbicides: History, Classification and Genetic Manipulation of

Plants for Herbicide Resistance,"Sustain. Agr. Rev., pp. 153-192, 2015.

[26] D. L. Shaner, "Herbicide safety relative to common targets in plants and

mammals," Pest Manag. Sci., vol. 60, pp. 17-24, 2004.

[27] H. Ohkawa, H. Miyagawa, and P. W. Lee, Pesticide Chemistry: Crop

Protection, Public Health, Environmental Safety, Wiley-VCH, Weinheim,

Germany, pp. 29-42, 2007.

[28] R. Schmidt, "HRAC classification of herbicides according to mode of action,"

in 1997 Brighton crop protection conference: weeds. Proceedings of an

international conference, Brighton, UK, 1997, pp. 1133-1140.

[29] C. A. Mallory-Smith and E. J. Retzinger Jr, "Revised Classification of

Herbicides by Site of Action for Weed Resistance Management Strategies 1,"

Weed Technol., vol. 17, pp. 605-619, 2003.

[30] W. K. Vencill, Herbicide Handbook, 8th edition. Weed Science Society of

America, 2002.

6. References

116

[31] T. Konishi and Y. Sasaki, "Compartmentalization of two forms of acetyl-CoA

carboxylase in plants and the origin of their tolerance toward herbicides,"

Proc. Natl. Acad. Sci. U.S.A., vol. 91, pp. 3598-3601, 1994.

[32] T. Nikolskaya, O. Zagnitko, G. Tevzadze, R. Haselkorn, and P. Gornicki,

"Herbicide sensitivity determinant of wheat plastid acetyl-CoA carboxylase is

located in a 400-amino acid fragment of the carboxyltransferase domain,"

Proc. Natl. Acad. Sci. U.S.A., vol. 96, pp. 14647-14651, 1999.

[33] X. Yang, I. A. Guschina, S. Hurst, S. Wood, M. Langford, T. Hawkes, and J.

L. Harwood, "The action of herbicides on fatty acid biosynthesis and

elongation in barley and cucumber," Pest Manag. Sci., vol. 66, pp. 794-800,

2010.

[34] O. Zagnitko, J. Jelenska, G. Tevzadze, R. Haselkorn, and P. Gornicki, "An

isoleucine/leucine residue in the carboxyltransferase domain of acetyl-CoA

carboxylase is critical for interaction with aryloxyphenoxypropionate and

cyclohexanedione inhibitors," Proc. Natl. Acad. Sci. U.S.A., vol. 98, pp. 6617-

6622, 2001.

[35] R. G. Duggleby and S. S. Pang, "Acetohydroxyacid synthase," J. Biochem.

Mol. Biol., vol. 33, pp. 1-36, 2000.

[36] C. E. Whitcomb, "An introduction to ALS-inhibiting herbicides," Toxicol. Ind.

Health, vol. 15, pp. 232-240, 1999.

[37] D. Wloga and J. Gaertig, "Post-translational modifications of microtubules," J.

Cell Sci., vol. 123, pp. 3447-3455, 2010.

[38] K. Grossmann, "Auxin herbicides: current status of mechanism and mode of

action," Pest Manag. Sci., vol. 66, pp. 113-120, 2010.

[39] N. P. Mira, M. C. Teixeira, and I. Sá-Correia, "Adaptive response and

tolerance to weak acids in Saccharomyces cerevisiae: a genome-wide view,"

OMICS: J. Integrative Biol., vol. 14, pp. 525-540, 2010.

[40] M. D Lambreva, D. Russo, F. Polticelli, V. Scognamiglio, A. Antonacci, V.

Zobnina, G. Campi, and G. Rea, "Structure/function/dynamics of photosystem

II plastoquinone binding sites," Curr. Protein Pept. Sci., vol. 15, pp. 285-295,

2014.

[41] T. Roach and A. Krieger-Liszkay, "Regulation of photosynthetic electron

transport and photoinhibition," Curr. Protein Pept. Sci., vol. 15, pp. 351-362,

2014.

[42] S. Santabarbara, "Limited sensitivity of pigment photo-oxidation in isolated

thylakoids to singlet excited state quenching in photosystem II antenna," Arch.

Biochem. Biophys., vol. 455, pp. 77-88, 2006.

[43] M. B. Colovic, D. Z. Krstic, T. D. Lazarevic-Pasti, A. M. Bondzic, and V. M.

Vasic, "Acetylcholinesterase inhibitors: pharmacology and toxicology," Curr.

Neuropharmacol., vol. 11, pp. 315-335, 2013.

[44] Y.-M. Qin, C.-Y. Hu, Y. Pang, A. J. Kastaniotis, J. K. Hiltunen, and Y.-X.

Zhu, "Saturated very-long-chain fatty acids promote cotton fiber and

Arabidopsis cell elongation by activating ethylene biosynthesis," Plant Cell,

vol. 19, pp. 3692-3704, 2007.

6. References

117

[45] H. Maeda and N. Dudareva, "The shikimate pathway and aromatic amino acid

biosynthesis in plants," Annu. Rev. Plant Biol., vol. 63, pp. 73-105, 2012.

[46] W. W. Metcalf and W. A. van der Donk, "Biosynthesis of phosphonic and

phosphinic acid natural products," Annu. Rev. Biochem., vol. 78, p. 65, 2009.

[47] J. J. van Rensen and W. J. Vredenberg, "Adaptation of photosystem II to high

and low light in wild-type and triazine-resistant Canola plants: analysis by a

fluorescence induction algorithm," Photosynth. Res., vol. 108, pp. 191-200,

2011.

[48] G. Qin, H. Gu, L. Ma, Y. Peng, X. W. Deng, Z. Chen, L. J. Qu, "Disruption of

phytoene desaturase gene results in albino and dwarf phenotypes in

Arabidopsis by impairing chlorophyll, carotenoid, and gibberellin

biosynthesis," Cell Res., vol. 17, pp. 471-482, 2007.

[49] C. D. Nwani, W. S. Lakra, N. S. Nagpure, R. Kumar, B. Kushwaha, and S. K.

Srivastava, "Toxicity of the herbicide atrazine: effects on lipid peroxidation

and activities of antioxidant enzymes in the freshwater fish Channa punctatus

(Bloch)," Int. J. Env. Res. Public Health, vol. 7, pp. 3298-3312, 2010.

[50] K. Oracz, H. El-Maarouf-Bouteau, I. Kranner, R. Bogatek, F. Corbineau, and

C. Bailly, "The mechanisms involved in seed dormancy alleviation by

hydrogen cyanide unravel the role of reactive oxygen species as key factors of

cellular signaling during germination," Plant Physiol., vol. 150, pp. 494-505,

2009.

[51] B. Walpola, S. Wanniarachchi, and J. Liyanage, "Responses of the soil

microbial biomass carbon to the herbicides propanil and glyphosate," J. Agric.

Sci, vol. 3, pp. 122-130, 2007.

[52] J. Lipok, H. Studnik, and S. Gruyaert, "The toxicity of Roundup® 360 SL

formulation and its main constituents: glyphosate and isopropylamine towards

non-target water photoautotrophs," Ecotoxicol. Environ. Saf., vol. 73, pp.

1681-1688, 2010.

[53] J. E. Franz, M. K. Mao, and J. A. Sikorski, Glyphosate's Molecular Mode of

Action in Glyphosate: A Unique Global Herbicide: American Chemical

Society, Washington, DC, pp. 521-642, 1997.

[54] Monsanto, "Backgrounder. History of Monsanto‟s Glyphosate Herbicides,"

Internet: www.monsanto.com/products/Documents/glyphosate-background-

materials/back_history.pdf. [Apr 15, 2014].

[55] S. B. Powles and C. Preston, "Evolved glyphosate resistance in plants:

biochemical and genetic basis of resistance 1," Weed Technol., vol. 20, pp.

282-289, 2006.

[56] S. O. Duke and S. B. Powles, "Glyphosate: a once‐in‐a‐century herbicide,"

Pest Manag. Sci., vol. 64, pp. 319-325, 2008.

[57] L. Artim, L. Schouten, B. V. Berg, and N. Carozzi, "Athenix." Internet:

http://www.fda.gov/downloads/Food/FoodScienceResearch/Biotechnology/Su

bmissions/UCM233624.pdf. [June 29, 2013].

[58] E. Schönbrunn, S. Eschenburg, W. A. Shuttleworth, J. V. Schloss, N.

Amrhein, J. N. Evans, and W. Kabsch, "Interaction of the herbicide glyphosate

6. References

118

with its target enzyme 5-enolpyruvylshikimate 3-phosphate synthase in atomic

detail," Proc. Natl. Acad. Sci. U.S.A., vol. 98, pp. 1376-1380, 2001.

[59] B. J. Vande Berg, P. E. Hammer, B. L. Chun, L. C. Schouten, B. Carr, R. Guo,

C. Peters, T. K. Hinson, V. Beilinson, A. Shekita, and R. Deter,

"Characterization and plant expression of a glyphosate‐tolerant

enolpyruvylshikimate phosphate synthase," Pest Manag. Sci., vol. 64, pp. 340-

345, 2008.

[60] J. A. Sikorski and K. J. Gruys, "Understanding glyphosate's molecular mode

of action with EPSP synthase: evidence favoring an allosteric inhibitor

model," Acc. Chem. Res., vol. 30, pp. 2-8, 1997.

[61] R. C. Kirkwood, R. Hetherington, T. L. Reynolds, and G. Marshall,

"Absorption, localisation, translocation and activity of glyphosate in

barnyardgrass (Echinochloa crus‐galli (L) Beauv): influence of herbicide and

surfactant concentration," Pest Manag. Sci., vol. 56, pp. 359-367, 2000.

[62] A. Gimsing, O. Borggaard, and M. Bang, "Influence of soil composition on

adsorption of glyphosate and phosphate by contrasting Danish surface soils,"

Eur. J. Soil Sci., vol. 55, pp. 183-191, 2004.

[63] P. Laitinen, K. Siimes, L. Eronen, S. Rämö, L. Welling, S. Oinonen, L.

Mattsoff, and M. Ruohonen‐Lehto, "Fate of the herbicides glyphosate,

glufosinate‐ammonium, phenmedipham, ethofumesate and metamitron in two

Finnish arable soils," Pest Manag. Sci., vol. 62, pp. 473-491, 2006.

[64] H. de Jonge, L. W. de Jonge, O. H. Jacobsen, T. Yamaguchi, and P. Moldrup,

"Glyphosate sorption in soils of different pH and phosphorus content," Soil

Sci., vol. 166, pp. 230-238, 2001.

[65] O. K. Borggaard and A. L. Gimsing, "Fate of glyphosate in soil and the

possibility of leaching to ground and surface waters: a review," Pest Manag.

Sci., vol. 64, pp. 441-456, 2008.

[66] R. E. Dick and J. P. Quinn, "Control of glyphosate uptake and metabolism in

Pseudomonas sp. 4ASW," FEMS Microbiol. Lett., vol. 134, pp. 177-182,

1995.

[67] S. O. Duke, "Glyphosate degradation in glyphosate-resistant and-susceptible

crops and weeds," J. Agric. Food Chem., vol. 59, pp. 5835-5841, 2010.

[68] A. L. Gimsing and O. K. Borggaard, "Phosphate and glyphosate adsorption by

hematite and ferrihydrite and comparison with other variable-charge

minerals," Clays Clay Miner., vol. 55, pp. 108-114, 2007.

[69] J. S. McConnell and L. R. Hossner, "pH-dependent adsorption isotherms of

glyphosate," J. Agric. Food Chem., vol. 33, pp. 1075-1078, 1985.

[70] J. P. Giesy, S. Dobson, and K. R. Solomon, "Ecotoxicological risk assessment

for Roundup® herbicide," in Rev. Environ. Contam. Toxicol., pp. 35-120,

2000.

[71] W. Edwards, G. Triplett, and R. Kramer, "A watershed study of glyphosate

transport in runoff," J. Environ. Qual., vol. 9, pp. 661-665, 1980.

[72] H. Vereecken, "Mobility and leaching of glyphosate: a review," Pest Manag.

Sci., vol. 61, pp. 1139-1151, 2005.

6. References

119

[73] L. Torstensson, E. Börjesson, and J. Stenström, "Efficacy and fate of

glyphosate on Swedish railway embankments," Pest Manag. Sci., vol. 61, pp.

881-886, 2005.

[74] J. Kjær, P. Olsen, M. Ullum, and R. Grant, "Leaching of glyphosate and

amino-methylphosphonic acid from Danish agricultural field sites," J.

Environ. Qual., vol. 34, pp. 608-620, 2005.

[75] L. Candela, J. Caballero, and D. Ronen, "Glyphosate transport through

weathered granite soils under irrigated and non-irrigated conditions-Barcelona,

Spain," Sci. Total Environ., vol. 408, pp. 2509-2516, 2010.

[76] R. Lajmanovich, M. Sandoval, and P. Peltzer, "Induction of mortality and

malformation in Scinax nasicus tadpoles exposed to glyphosate formulations,"

Bull. Environ. Contam. Toxicol., vol. 70, pp. 0612-0618, 2003.

[77] S. Bazot and T. Lebeau, "Simultaneous mineralization of glyphosate and

diuron by a consortium of three bacteria as free-and/or immobilized-cells

formulations," Appl. Microbiol. Biotechnol., vol. 77, pp. 1351-1358, 2008.

[78] J. Kjær, A. E. Rosenbom, W. Brüsch, R. K. Juhler, L. Gudmundsson, F.

Plauborg, R. Grant, and P. Olsen, "The Danish Pesticide Leaching Assessment

Programme: Monitoring Results May 1999-June 2010," Geological Survey of

Denmark and Greenland, Copenhagen, 2011.

[79] W. A. Battaglin, D. W. Kolpin, E. A. Scribner, K. M. Kuivila, and M. W.

Sandstrom, "Glyphosate, its transformation product AMPA, and other

herbicides in midwestern streams, 2002," J. Am. Water. Resour. As., vol. 41,

pp. 323-332, 2005.

[80] M. J. Shipitalo and L. B. Owens, "Comparative losses of glyphosate and

selected residual herbicides in surface runoff from conservation-tilled

watersheds planted with corn or soybean," J. Environ. Qual., vol. 40, pp.

1281-1289, 2011.

[81] E. A. Scribner, W. A. Battaglin, R. J. Gilliom, and M. T. Meyer,

"Concentrations of glyphosate, its degradation product,

aminomethylphosphonic acid, and glufosinate in ground- and surface-water,

rainfall, and soil samples collected in the United States, 2001-06," US

Geological Survey Scientific Investigations Report 2007-5122, p.111, 2007.

[82] C. M. Benbrook, "Trends in glyphosate herbicide use in the United States and

globally," Env. Sci. Eur., vol. 28, p. 1, 2016.

[83] S. B. Powles, "Evolved glyphosate‐resistant weeds around the world: lessons

to be learnt," Pest Manag. Sci., vol. 64, pp. 360-365, 2008.

[84] J. Kjær, V. Ernstsen, O. H. Jacobsen, N. Hansen, L. W. de Jonge, and P.

Olsen, "Transport modes and pathways of the strongly sorbing pesticides

glyphosate and pendimethalin through structured drained soils," Chemosphere,

vol. 84, pp. 471-479, 2011.

[85] R. H. Coupe, S. J. Kalkhoff, P. D. Capel, and C. Gregoire, "Fate and transport

of glyphosate and aminomethylphosphonic acid in surface waters of

agricultural basins," Pest Manag. Sci., vol. 68, pp. 16-30, 2012.

6. References

120

[86] A. A. Shehata, W. Schrödl, A. A. Aldin, H. M. Hafez, and M. Krüger, "The

effect of glyphosate on potential pathogens and beneficial members of poultry

microbiota in vitro," Curr. Microbiol., vol. 66, pp. 350-358, 2013.

[87] A. D. Baylis, "Why glyphosate is a global herbicide: strengths, weaknesses

and prospects," Pest Manag. Sci., vol. 56, pp. 299-308, 2000.

[88] S. Richard, S. Moslemi, H. Sipahutar, N. Benachour, and G.-E. Seralini,

"Differential effects of glyphosate and roundup on human placental cells and

aromatase," Environ. Health Perspect., pp. 716-720, 2005.

[89] D. A. Savitz, T. Arbuckle, D. Kaczor, and K. M. Curtis, "Male pesticide

exposure and pregnancy outcome," Am. J. Epidemiol., vol. 146, pp. 1025-

1036, 1997.

[90] M. Watts, "Glyphosate: Addendum 2012. Pesticide Action Network Asia and

the Pacific 2012." Internet:

http://library.ipamglobal.org/jspui/handle/ipamlibrary/789. [Oct 12, 2014].

[91] A. Martínez, I. Reyes, and N. Reyes, "Cytotoxicity of the herbicide glyphosate

in human peripheral blood mononuclear cells," Biomedica, vol. 27, pp. 594-

604, 2007.

[92] N. Benachour and G.-E. Séralini, "Glyphosate formulations induce apoptosis

and necrosis in human umbilical, embryonic, and placental cells," Chem. Res.

Toxicol., vol. 22, pp. 97-105, 2008.

[93] C. Gasnier, C. Dumont, N. Benachour, E. Clair, M.-C. Chagnon, and G. E.

Séralini, "Glyphosate-based herbicides are toxic and endocrine disruptors in

human cell lines," Toxicology, vol. 262, pp. 184-191, 2009.

[94] G. L. Kimmel, C. A. Kimmel, A. L. Williams, and J. M. DeSesso, "Evaluation

of developmental toxicity studies of glyphosate with attention to

cardiovascular development," Crit. Rev. Toxicol., vol. 43, pp. 79-95, 2013.

[95] L. D. Kier and D. J. Kirkland, "Review of genotoxicity studies of glyphosate

and glyphosate-based formulations," Crit. Rev. Toxicol., vol. 43, pp. 283-315,

2013.

[96] M. Kruger, W. Schrodl, J. Neuhaus, and A. A. Shehata, "Field investigations

of glyphosate in urine of Danish dairy cows," J. Environ. Anal. Toxicol., vol.

2013, 2013.

[97] A. Samsel and S. Seneff, "Glyphosate‟s suppression of cytochrome P450

enzymes and amino acid biosynthesis by the gut microbiome: Pathways to

modern diseases," Entropy, vol. 15, pp. 1416-1463, 2013.

[98] L. Schinasi and M. E. Leon, "Non-Hodgkin lymphoma and occupational

exposure to agricultural pesticide chemical groups and active ingredients: a

systematic review and meta-analysis," Int. J. Env. Res. Public Health, vol. 11,

pp. 4449-4527, 2014.

[99] International Agency for Research on Cancer, "Evaluation of five

organophosphate insecticides and herbicides," World Health Organization

(Ed.), Lyon, France, IARC Monographs, 2015.

[100] D. Buffin and T. Jewell, Health and environmental impacts of glyphosate: the

implications of increased use of glyphosate in association with genetically

http://library.ipamglobal.org/jspui/handle/ipamlibrary/789

6. References

121

modified crops: Friends of the earth, London, 2001.

(http://www.foe.co.uk/resource/reports/impacts_glyphosate.pdf).

[101] L. Fritschi, J. McLaughlin, C. Sergi, G. Calaf, F. Le Curieux, F. Forastiere, H.

Kromhout, P. Egeghy, G. D. Jahnke, C. W. Jameson, and M. T. Martin,

"Carcinogenicity of tetrachlorvinphos, parathion, malathion, diazinon, and

glyphosate," Red, vol. 114, 2015.

[102] M. A. Marin-Morales, B. de Campos Ventura-Camargo, and M. M. Hoshina,

"Toxicity of herbicides: impact on aquatic and soil biota and human health," in

Herbicides–Current Research and Case Studies in Use, ed. A. J. Price, and J.

A. Kelton, Rijeka, Croatia, pp. 399-443, 2013.

[103] Z. Filip, "International approach to assessing soil quality by ecologically-

related biological parameters," Agric., Ecosyst. Environ., vol. 88, pp. 169-174,

2002.

[104] L. Avidano, E. Gamalero, G. P. Cossa, and E. Carraro, "Characterization of

soil health in an Italian polluted site by using microorganisms as

bioindicators," Appl. Soil Ecol., vol. 30, pp. 21-33, 2005.

[105] S. Carlisle and J. Trevors, "Glyphosate in the environment," Water Air Soil

Pollut., vol. 39, pp. 409-420, 1988.

[106] S. Hassan, F. Bigler, H. Bogenschütz, E. Boller, J. Brun, J. Calis, P.

Chiverton, J. Coremans-Pelseneer, C. Duso, G. B. Lewis, and F. Mansour,

"Results of the fifth joint pesticide testing programme carried out by the

IOBC/WPRS-Working Group “Pesticides and Beneficial Organisms”,"

Entomophaga, vol. 36, pp. 55-67, 1991.

[107] J. Springett and R. Gray, "Effect of repeated low doses of biocides on the

earthworm Aporrectodea caliginosa in laboratory culture," Soil Biol.

Biochem., vol. 24, pp. 1739-1744, 1992.

[108] R. J. Kremer and N. E. Means, "Glyphosate and glyphosate-resistant crop

interactions with rhizosphere microorganisms," Eur. J. Agron., vol. 31, pp.

153-161, 2009.

[109] D. Paul, G. Pandey, J. Pandey, and R. K. Jain, "Accessing microbial diversity

for bioremediation and environmental restoration," Trends Biotechnol., vol.

23, pp. 135-142, 2005.

[110] R. K. Jain, M. Kapur, S. Labana, B. Lal, P. M. Sarma, D. Bhattacharya, and I.

S. Thakur, "Microbial diversity: Application of micro-organisms for the

biodegradation of xenobiotics," Curr. Sci., vol. 89, pp. 101-112, 2005.

[111] S. Le Borgne, D. Paniagua, and R. Vazquez-Duhalt, "Biodegradation of

organic pollutants by halophilic bacteria and archaea," J. Mol. Microbiol.


[112] D. L. Dindal, "Soil biology guide," Insecta: Coleóptera, vol. 5, p. 28, 1990.

[113] M. Vidali, "Bioremediation. an overview," Pure Appl. Chem., vol. 73, pp.

1163-1172, 2001.

[114] O. Tiryaki and C. Temur, "The fate of pesticide in the environment," J. Biol.

Environ. Sci., vol. 4, 2010.

6. References

122

[115] A. Sviridov, T. Shushkova, I. Ermakova, E. Ivanova, D. Epiktetov, and A.

Leontievsky, "Microbial degradation of glyphosate herbicides (Review),"

Appl. Biochem. Microbiol., vol. 51, pp. 188-195, 2015.

[116] G. F. Barry and G. M. Kishore, "Glyphosate tolerant plants," U. S. Patent No.

5,463,175, 1995.

[117] A. M. Rojano‐Delgado, J. Ruiz‐Jiménez, M. D. L. de Castro, and R. De Prado,

"Determination of glyphosate and its metabolites in plant material by

reversed‐polarity CE with indirect absorptiometric detection," Electrophoresis,

vol. 31, pp. 1423-1430, 2010.

[118] W. Lerbs, M. Stock, and B. Parthier, "Physiological aspects of glyphosate

degradation in Alcaligenes spec. strain GL," Arch. Microbiol., vol. 153, pp.

146-150, 1990.

[119] A. d. Araújo, R. Monteiro, and R. Abarkeli, "Effect of glyphosate on the

microbial activity of two Brazilian soils," Chemosphere, vol. 52, pp. 799-804,

2003.

[120] P. Kafarski, B. Lejczak, and G. Forlani, "Biodegradation of pesticides

containing carbon-to-phosphorus bond," ACS Symp. Ser., Vol. 777, pp. 145-

163, 2001.

[121] S. Kononova and M. Nesmeyanova, "Phosphonates and their degradation by

microorganisms," Biochemistry (Moscow), vol. 67, pp. 184-195, 2002.

[122] S. Anwar, F. Liaquat, Q. M. Khan, Z. M. Khalid, and S. Iqbal,

"Biodegradation of chlorpyrifos and its hydrolysis product 3, 5, 6-trichloro-2-

pyridinol by Bacillus pumilus strain C2A1," J. Hazard. Mater., vol. 168, pp.

400-405, 2009.

[123] K. Jyothi, K. S. Babu, N. Clara, and A. Kashyap, "Identification and isolation

of hydrocarbon degrading bacteria by molecular characterization," Helix, vol.

2, pp. 105-111, 2012.

[124] W. Koneman, D. Allen, M. Janda, C. Schreckenberger, and J. Winn, "Atlas

and textbook of diagonistic microbiology," 5th edition. Philadelphia, USA.

Lippincott Williams & Wilkins, 1997.

[125] A. Mateen, "Purification of the enzyme and cloning of the gene involved in

hydrolysis of carbofuran from Pseudomonas sp. 50432," PhD diss., University

of the Punjab, Lahore, 1998.

[126] K. H. Wilson, R. Blitchington, and R. Greene, "Amplification of bacterial 16S

ribosomal DNA with polymerase chain reaction," J. Clin. Microbiol., vol. 28,

pp. 1942-1946, 1990.

[127] M. Cunliffe and M. A. Kertesz, "Effect of Sphingobium yanoikuyae B1

inoculation on bacterial community dynamics and polycyclic aromatic

hydrocarbon degradation in aged and freshly PAH-contaminated soils,"

Environ. Pollut., vol. 144, pp. 228-237, 2006.

[128] G. Muyzer, E. C. De Waal, and A. G. Uitterlinden, "Profiling of complex

microbial populations by denaturing gradient gel electrophoresis analysis of

polymerase chain reaction-amplified genes coding for 16S rRNA," Appl.

Environ. Microbiol., vol. 59, pp. 695-700, 1993.

6. References

123

[129] K. Qian, T. Tang, T. Shi, F. Wang, J. Li, and Y. Cao, "Residue determination

of glyphosate in environmental water samples with high-performance liquid

chromatography and UV detection after derivatization with 4-chloro-3, 5-

dinitrobenzotrifluoride," Anal. Chim. Acta, vol. 635, pp. 222-226, 2009.

[130] I. T. Ermakova, N. I. Kiseleva, T. Shushkova, M. Zharikov, G. A. Zharikov,

and A. A. Leontievsky, "Bioremediation of glyphosate-contaminated soils,"

Appl. Microbiol. Biotechnol., vol. 88, pp. 585-594, 2010.

[131] H. Steinrücken and N. Amrhein, "The herbicide glyphosate is a potent

inhibitor of 5-enolpyruvylshikimic acid-3-phosphate synthase," Biochem.

Biophys. Res. Commun., vol. 94, pp. 1207-1212, 1980.

[132] L. Arnaud, F. Nurit, P. Ravanel, and M. Tissut, "Distribution of glyphosate

and of its target enzyme inside wheat plants," Pestic. Sci., vol. 40, pp. 217-

223, 1994.

[133] D. McDevitt, D. Payne, D. Holmes, and M. Rosenberg, "Novel targets for the

future development of antibacterial agents," J. Appl. Microbiol., vol. 92, 2002.

[134] J. D. McArthur, N. P. West, J. N. Cole, H. Jungnitz, C. A. Guzmán, J. Chin, P.

R. Lehrbach, S. P. Djordjevic, and M. J. Walker, "An aromatic amino acid

auxotrophic mutant of Bordetella bronchiseptica is attenuated and

immunogenic in a mouse model of infection," FEMS Microbiol. Lett., vol.

221, pp. 7-16, 2003.

[135] T. Parish and N. G. Stoker, "The common aromatic amino acid biosynthesis

pathway is essential in Mycobacterium tuberculosis," Microbiology, vol. 148,

pp. 3069-3077, 2002.

[136] F. Roberts, C. W. Roberts, J. J. Johnson, D. E. Kyle, T. Krell, J. R. Coggins,

G. H. Coombs, W. K. Milhous, S. Tzipori, D. J. Ferguson, and D. Chakrabarti,

"Evidence for the shikimate pathway in apicomplexan parasites," Nature, vol.

393, pp. 801-805, 1998.

[137] G. A. McConkey, "Targeting the shikimate pathway in the malaria parasite

Plasmodium falciparum," Antimicrob. Agents Chemother., vol. 43, pp. 175-

177, 1999.

[138] L. Pollegioni, E. Schonbrunn, and D. Siehl, "Molecular basis of glyphosate

resistance–different approaches through protein engineering," FEBS J., vol.

278, pp. 2753-2766, 2011.

[139] S. B. Powles, "Gene amplification delivers glyphosate-resistant weed

evolution," Proc. Natl. Acad. Sci. U.S.A., vol. 107, pp. 955-956, 2010.

[140] G. M. Dill, C. A. CaJacob, and S. R. Padgette, "Glyphosate‐resistant crops:

adoption, use and future considerations," Pest Manag. Sci., vol. 64, pp. 326-

331, 2008.

[141] W. A. Pline, J. W. Wilcut, S. O. Duke, K. L. Edmisten, and R. Wells,

"Tolerance and accumulation of shikimic acid in response to glyphosate

applications in glyphosate-resistant and nonglyphosate-resistant cotton

(Gossypium hirsutum L.)," J. Agric. Food Chem., vol. 50, pp. 506-512, 2002.

6. References

124

[142] J. Levin and D. Sprinson, "The enzymatic formation and isolation of 3-

enolpyruvylshikimate 5-phosphate," J. Biol. Chem., vol. 239, pp. 1142-1150,

1964.

[143] M. R. Boocock and J. R. Coggins, "Kinetics of 5-enolpyruvylshikimate-3-

phosphate synthase inhibition by glyphosate," FEBS Lett., vol. 154, pp. 127-

133, 1983.

[144] S. Castellino, G. C. Leo, R. D. Sammons, and J. A. Sikorski, "Phosphorus-31,

sup 15 N, and sup 13 C NMR of glyphosate: Comparison of pH titrations to

the herbicidal dead-end complex with 5-enolpyruvoylshikimate-3-phosphate

synthase," Biochemistry;(USA), vol. 28, 1989.

[145] W. Wang, H. Xia, X. Yang, T. Xu, H. J. Si, X. X. Cai, F. Wang, J. Su, A. A.

Snow and B. R. Lu, "A novel 5‐enolpyruvoylshikimate‐3‐phosphate (EPSP)

synthase transgene for glyphosate resistance stimulates growth and fecundity

in weedy rice (Oryza sativa) without herbicide," New Phytol., vol. 202, pp.

679-688, 2014.

[146] A. Oikawa, Y. Nakamura, T. Ogura, A. Kimura, H. Suzuki, N. Sakurai, Y.

Shinbo, D. Shibata, S. Kanaya, and D. Ohta, "Clarification of pathway-

specific inhibition by Fourier transform ion cyclotron resonance/mass

spectrometry-based metabolic phenotyping studies," Plant Physiol., vol. 142,

pp. 398-413, 2006.

[147] W. C. Stallings, S. S. Abdel-Meguid, L. W. Lim, H.-S. Shieh, H. E. Dayringer,

N. K. Leimgruber, R. A. Stegeman, K. S. Anderson, J. A. Sikorski, S. R.

Padgette, and G. M. Kishore, "Structure and topological symmetry of the

glyphosate target 5-enolpyruvylshikimate-3-phosphate synthase: a distinctive

protein fold," Proc. Natl. Acad. Sci. U.S.A., vol. 88, pp. 5046-5050, 1991.

[148] S. Eschenburg, W. Kabsch, M. L. Healy, and E. Schönbrunn, "A new view of

the mechanisms of UDP-N-acetylglucosamine enolpyruvyl transferase (MurA)

and 5-enolpyruvylshikimate-3-phosphate synthase (AroA) derived from X-ray

structures of their tetrahedral reaction intermediate states," J. Biol. Chem., vol.

278, pp. 49215-49222, 2003.

[149] H. Park, J. L. Hilsenbeck, H. J. Kim, W. A. Shuttleworth, Y. H. Park, J. N.

Evans, and C. Kang, "Structural studies of Streptococcus pneumoniae EPSP

synthase in unliganded state, tetrahedral intermediate‐bound state and

S3P‐GLP‐bound state," Mol. Microbiol., vol. 51, pp. 963-971, 2004.

[150] T. Funke, H. Han, M. L. Healy-Fried, M. Fischer, and E. Schönbrunn,

"Molecular basis for the herbicide resistance of Roundup Ready crops," Proc.

Natl. Acad. Sci. U.S.A., vol. 103, pp. 13010-13015, 2006.

[151] M. F. Alibhai, C. Cajacob, P. C. C. Feng, G. R. Heck, Y. Qi, S. Flasinski, W.

C. Stallings, "Glyphosate resistant class I 5-enolpyruvylshikimate-3-phosphate

synthase (epsps)," U. S. Patent No. 7 723 575, 2004.

[152] G. F. Barry, G. M. Kishore, S. R. Padgette, and W. C. Stallings, "Glyphosate-

tolerant 5-enolpyruvylshikimate-3-phosphate synthases," U. S. Patent No. 5

633 435, 1997.

[153] N. Carozzi, B. Carr, and P. E. Hammer, "Identification of a new class of epsp

synthases," U. S. Patent No. 7 700 842, 2010.

6. References

125

[154] J. M. Lira, R. M. CICCHILLO, and S. K. NAIR, "Novel class of glyphosate

resistance genes," U. S. Patent Application No. 15/152 305, 2013.

[155] W. Du, N. G. Wallis, M. J. Mazzulla, A. F. Chalker, L. Zhang, W. S. Liu, H.

Kallender, and D. J. Payne, "Characterization of Streptococcus pneumoniae

5‐enolpyruvylshikimate 3‐phosphate synthase and its activation by univalent

cations," Eur. J. Biochem., vol. 267, pp. 222-227, 2000.

[156] Y.-S. Tian, J. Xu, A.-S. Xiong, W. Zhao, X.-Y. Fu, R.-H. Peng, and Q. H.

Yao, "Improvement of glyphosate resistance through concurrent mutations in

three amino acids of the Ochrobactrum 5-enopyruvylshikimate-3-phosphate

synthase," Appl. Environ. Microbiol., vol. 77, pp. 8409-8414, 2011.

[157] T. Funke, Y. Yang, H. Han, M. Healy-Fried, S. Olesen, A. Becker, and E.

Schönbrunn, "Structural basis of glyphosate resistance resulting from the

double mutation Thr97→ Ile and Pro101→ Ser in 5-enolpyruvylshikimate-3-

phosphate synthase from Escherichia coli," J. Biol. Chem., vol. 284, pp. 9854-

9860, 2009.

[158] S. Padgette, D. B. Re, C. Gasser, D. A. Eichholtz, R. Frazier, C. M. Hironaka,

E. B. Levine, D. M. Shah, R. T. Fraley, and G. M. Kishore, "Site-directed

mutagenesis of a conserved region of the 5-enolpyruvylshikimate-3-phosphate

synthase active site," J. Biol. Chem., vol. 266, pp. 22364-22369, 1991.

[159] S. R. Baerson, D. J. Rodriguez, M. Tran, Y. Feng, N. A. Biest, and G. M. Dill,

"Glyphosate-resistant goosegrass. Identification of a mutation in the target

enzyme 5-enolpyruvylshikimate-3-phosphate synthase," Plant Physiol., vol.

129, pp. 1265-1275, 2002.

[160] M. He, Y.-F. Nie, and P. Xu, "A T42M substitution in bacterial 5-

enolpyruvylshikimate-3-phosphate synthase (EPSPS) generates enzymes with

increased resistance to glyphosate," Biosci., Biotechnol., Biochem., vol. 67, pp.

1405-1409, 2003.

[161] D. Jin, W. Lu, S. Ping, W. Zhang, J. Chen, B. Dun, R. Ma, Z. Zhao, J. Sha, L.

Li, and Z. Yang, "Identification of a new gene encoding EPSPS with high

glyphosate resistance from the metagenomic library," Curr. Microbiol., vol.

55, pp. 350-355, 2007.

[162] J. Fitzgibbon and H. Braymer, "Cloning of a gene from Pseudomonas sp.

strain PG2982 conferring increased glyphosate resistance," Appl. Environ.

Microbiol., vol. 56, pp. 3382-3388, 1990.

[163] L. Li, W. Lu, Y. Han, S. Ping, W. Zhang, M. Chen, Z. Zhao, Y. Yan, Y. Jiang,

and M. Lin, "A novel RPMXR motif among class II 5-enolpyruvylshikimate-

3-phosphate synthases is required for enzymatic activity and glyphosate

resistance," J. Biotechnol., vol. 144, pp. 330-336, 2009.

[164] P. Vaithanomsat and K. A. Brown, "Isolation and mutation of recombinant

EPSP synthase from pathogenic bacteria Pseudomonas aeruginosa," Process

Biochem., vol. 42, pp. 592-598, 2007.

[165] Y.-C. Sun, Y.-C. Chen, Z.-X. Tian, F.-M. Li, X.-Y. Wang, J. Zhang, Z. L.

Xiao, M. Lin, N. Gilmartin, D. N. Dowling, and Y. P. Wang, "Novel AroA

with high tolerance to glyphosate, encoded by a gene of Pseudomonas putida

6. References

126

4G-1 isolated from an extremely polluted environment in China," Appl.


[166] S. Eschenburg, M. L. Healy, M. A. Priestman, G. H. Lushington, and E.

Schönbrunn, "How the mutation glycine96 to alanine confers glyphosate

insensitivity to 5-enolpyruvyl shikimate-3-phosphate synthase from

Escherichia coli," Planta, vol. 216, pp. 129-135, 2002.

[167] L. Wang, R. Peng, Y. Tian, J. Han, W. Zhao, B. Wang, M. Liu, and Q. Yao,

"Characterization of a class II 5-enopyruvylshikimate-3-phosphate synthase

with high tolerance to glyphosate from Sinorhizobium fredii," World J.

Microbiol. Biotechnol., vol. 30, pp. 2967-2973, 2014.

[168] L. Comai, L. C. Sen, and D. M. Stalker, "An altered aroA gene product

confers resistance to the herbicide glyphosate," Science, vol. 221, pp. 370-371,

1983.

[169] D. Sost and N. Amrhein, "Substitution of Gly-96 to Ala in the 5-

enolpyruvylshikimate 3-phosphate synthase of Klebsiella pneumoniae results

in a greatly reduced affinity for the herbicide glyphosate," Arch. Biochem.

Biophys., vol. 282, pp. 433-436, 1990.

[170] C. Ng, R. Wickneswari, S. Salmijah, Y. Teng, and B. Ismail, "Gene

polymorphisms in glyphosate‐resistant and‐susceptible biotypes of Eleusine

indica from Malaysia," Weed Res., vol. 43, pp. 108-115, 2003.

[171] A. Perez-Jones, K.-W. Park, N. Polge, J. Colquhoun, and C. A. Mallory-

Smith, "Investigating the mechanisms of glyphosate resistance in Lolium

multiflorum," Planta, vol. 226, pp. 395-404, 2007.

[172] A. Wakelin, D. Lorraine‐Colwill, and C. Preston, "Glyphosate resistance in

four different populations of Lolium rigidum is associated with reduced

translocation of glyphosate to meristematic zones," Weed Res., vol. 44, pp.

453-459, 2004.

[173] Q. Yu, A. Cairns, and S. Powles, "Glyphosate, paraquat and ACCase multiple

herbicide resistance evolved in a Lolium rigidum biotype," Planta, vol. 225,

pp. 499-513, 2007.

[174] S. Duke, "Herbicide Resistant Crops: Agricultural," Environmental,

Economic, Regulatory, and Technical Aspects, CRC Press, Boca Raton, FL,

420pp, 1996.

[175] D. A. Eichholtz, C. S. Gasser, and G. M. Kishore, "Modified gene encoding

glyphosate-tolerant 5-enolpruvyl-3-phosphoshikimate synthase," U. S. Patent

No. 6,225,114, 2001.

[176] D. Kahrizi, A. H. Salmanian, A. Afshari, A. Moieni, and A. Mousavi,

"Simultaneous substitution of Gly96 to Ala and Ala183 to Thr in 5-

enolpyruvylshikimate-3-phosphate synthase gene of E. coli (k12) and

transformation of rapeseed (Brassica napus L.) in order to make tolerance to

glyphosate," Plant Cell Rep., vol. 26, pp. 95-104, 2007.

[177] M. Lebrun, A. Sailland, G. Freyssinet, and E. DeGryse, "Mutated 5-

enolpyruvylshikimate-3-phosphate synthase, gene coding for said protein and

transformed plants containing said gene," U.S. Patent No. 6,566,587, 2003.

6. References

127

[178] M. Spencer, R. Mumm, and J. Gwyn, "Glyphosate resistant maize lines," U.S.

Patent No. 6,040,497, 2000.

[179] S. Beulke and C. D. Brown, "Evaluation of methods to derive pesticide

degradation parameters for regulatory modelling," Biol. Fertility Soils, vol. 33,

pp. 558-564, 2001.

[180] P. Sprankle, C. Sandberg, W. Meggitt, and D. Penner, "Separation of

glyphosate and possible metabolities by thin-layer chromatography," Weed

Sci., vol. 26, pp. 673-674, 1978.

[181] K. Tamura, G. Stecher, D. Peterson, A. Filipski, and S. Kumar, "MEGA6:

molecular evolutionary genetics analysis version 6.0," Mol. Biol. Evol., vol.

30, pp. 2725-2729, 2013.

[182] E. Gasteiger, C. Hoogland, A. Gattiker, S. e. Duvaud, M. R. Wilkins, R. D.

Appel, and A. Bairoch, Protein identification and analysis tools on the

ExPASy server, The Proteomics Protocols Handbook. Eds J. M. Walker,

Totowa, N.J., Humana Press, 2005.

[183] L. A. Kelley, S. Mezulis, C. M. Yates, M. N. Wass, and M. J. Sternberg, "The

Phyre2 web portal for protein modeling, prediction and analysis," Nat.

Protoc., vol. 10, pp. 845-858, 2015.

[184] C. Geourjon and G. Deleage, "SOPMA: significant improvements in protein

secondary structure prediction by consensus prediction from multiple

alignments," Computer applications in the biosciences: CABIOS, vol. 11, pp.

681-684, 1995.

[185] C. Combet, M. Jambon, G. Deleage, and C. Geourjon, "Geno3D: automatic

comparative molecular modelling of protein," Bioinformatics, vol. 18, pp.

213-214, 2002.

[186] K. Arnold, L. Bordoli, J. Kopp, and T. Schwede, "The SWISS-MODEL

workspace: a web-based environment for protein structure homology

modelling," Bioinformatics, vol. 22, pp. 195-201, 2006.

[187] R. A. Laskowski, J. A. C. Rullmann, M. W. MacArthur, R. Kaptein, and J. M.

Thornton, "AQUA and PROCHECK-NMR: programs for checking the quality

of protein structures solved by NMR," J. Biomol. NMR, vol. 8, pp. 477-486,

1996.

[188] S. A. Hollingsworth and P. A. Karplus, "A fresh look at the Ramachandran

plot and the occurrence of standard structures in proteins," Biomol. Concepts,

vol. 1, pp. 271-283, 2010.

[189] M. Wiederstein and M. J. Sippl, "ProSA-web: interactive web service for the

recognition of errors in three-dimensional structures of proteins," Nucleic

Acids Res., vol. 35, pp. W407-W410, 2007.

[190] S.-y. Yi, Y. Cui, Y. Zhao, Z.-d. Liu, Y.-j. Lin, and F. Zhou, "A Novel

Naturally Occurring Class I 5-Enolpyruvylshikimate-3-Phosphate Synthase

from Janibacter sp. Confers High Glyphosate Tolerance to Rice," Sci. Rep.,

vol. 6, 2016.

[191] F. Aujoulat, S. Romano-Bertrand, A. Masnou, H. Marchandin, and E. Jumas-

Bilak, "Niches, population structure and genome reduction in Ochrobactrum

6. References

128

intermedium: clues to technology-driven emergence of pathogens," PLoS One,

vol. 9, p. e83376, 2014.

[192] S. Pandey, P. K. Ghosh, S. Ghosh, T. K. De, and T. K. Maiti, "Role of heavy

metal resistant Ochrobactrum sp. and Bacillus spp. strains in bioremediation of

a rice cultivar and their PGPR like activities," J. Microbiol., vol. 51, p. 11,

2013.

[193] N. Wackerow-Kouzova, "Ochrobactrum intermedium ANKI, a nitrogen-fixing

bacterium able to decolorize azobenzene," Appl. Biochem. Microbiol., vol. 43,

p. 403, 2007.

[194] P. Waranusantigul, H. Lee, M. Kruatrachue, P. Pokethitiyook, and C.

Auesukaree, "Isolation and characterization of lead-tolerant Ochrobactrum

intermedium and its role in enhancing lead accumulation by Eucalyptus

camaldulensis," Chemosphere, vol. 85, pp. 584-590, 2011.

[195] B. Kavita and H. Keharia, "Reduction of hexavalent chromium by

Ochrobactrum intermedium BCR400 isolated from a chromium-contaminated

soil," 3 Biotech, vol. 2, pp. 79-87, 2012.

[196] Z. F. Boukhatem, O. Domergue, A. Bekki, C. Merabet, S. Sekkour, F.

Bouazza, R. Duponnois, P. De Lajudie, and A. Galiana, "Symbiotic

characterization and diversity of rhizobia associated with native and

introduced acacias in arid and semi-arid regions in Algeria," FEMS Microbiol.

Ecol., vol. 80, pp. 534-547, 2012.

[197] R. Zhang, Z. Cui, J. Jiang, J. He, X. Gu, and S. Li, "Diversity of

organophosphorus pesticide-degrading bacteria in a polluted soil and

conservation of their organophosphorus hydrolase genes," Can. J. Microbiol.,

vol. 51, pp. 337-343, 2005.

[198] W. S. El-Sayed, M. K. Ibrahim, M. Abu-Shady, F. El-Beih, N. Ohmura, H.

Saiki, and A. Ando,"Isolation and identification of a novel strain of the genus

Ochrobactrum with phenol-degrading activity," J. Biosci. Bioeng., vol. 96, pp.

310-312, 2003.

[199] Y. Veeranagouda, P. E. Paul, P. Gorla, D. Siddavattam, and T. Karegoudar,

"Complete mineralisation of dimethylformamide by Ochrobactrum sp.

DGVK1 isolated from the soil samples collected from the coalmine leftovers,"

Appl. Microbiol. Biotechnol., vol. 71, pp. 369-375, 2006.

[200] E. Katsivela, E. R. Moore, D. Maroukli, C. Strömpl, D. Pieper, and N.

Kalogerakis, "Bacterial community dynamics during in-situ bioremediation of

petroleum waste sludge in landfarming sites," Biodegradation, vol. 16, pp.

169-180, 2005.

[201] Y.-M. Kim, K. Park, G.-J. Joo, E.-M. Jeong, J.-E. Kim, and I.-K. Rhee,

"Glutathione-dependent biotransformation of the fungicide chlorothalonil," J.

Agric. Food Chem., vol. 52, pp. 4192-4196, 2004.

[202] G. Ozdemir, T. Ozturk, N. Ceyhan, R. Isler, and T. Cosar, "Heavy metal

biosorption by biomass of Ochrobactrum anthropi producing

exopolysaccharide in activated sludge," Bioresour. Technol., vol. 90, pp. 71-

74, 2003.

6. References

129

[203] S. Ferhat, R. Alouaoui, A. Badis, and N. Moulai-Mostefa, "Production and

characterization of biosurfactant by free and immobilized cells from

Ochrobactrum intermedium isolated from the soil of southern Algeria with a

view to environmental application," Biotechnol. Biotechnol. Equip., pp. 1-10,

2017.

[204] Y.-S. Tian, A.-S. Xiong, J. Xu, W. Zhao, F. Gao, X.-Y. Fu, H. Xu, J. L.

Zheng, R. H. Peng, and Q. H. Yao, "Isolation from Ochrobactrum anthropi of

a novel class II 5-enopyruvylshikimate-3-phosphate synthase with high

tolerance to glyphosate," Appl. Environ. Microbiol., vol. 76, pp. 6001-6005,

2010.

[205] K. Sivakumar and S. Balaji, "In silico characterization of antifreeze proteins

using computational tools and servers," J. Chem. Sci., vol. 119, pp. 571-579,

2007.

[206] A.-F. Miller, "Superoxide dismutases: active sites that save, but a protein that

kills," Curr. Opin. Chem. Biol., vol. 8, pp. 162-168, 2004.

[207] V. E. Hayes, N. G. Ternan, and G. McMullan, "Organophosphonate

metabolism by a moderately halophilic bacterial isolate," FEMS Microbiol.

Lett., vol. 186, pp. 171-175, 2000.

[208] B. K. Singh and A. Walker, "Microbial degradation of organophosphorus

compounds," FEMS Microbiol. Rev., vol. 30, pp. 428-471, 2006.

[209] A. L. Cerdeira and S. O. Duke, "The current status and environmental impacts

of glyphosate-resistant crops," J. Environ. Qual., vol. 35, pp. 1633-1658,

2006.

[210] V. Joseph P, S. Nader, R. Darren E, T. Francois J, L. Mark B, and S. Peter H,

"Glyphosate-resistant giant ragweed (Ambrosia trifida L.) in Ontario: dose

response and control with postemergence herbicides," Am. J. Plant Sci., vol.

2012, 2012.

[211] Y. Sharifi, A. A. Pourbabaei, A. Javadi, M. H. Abdolmohammad, M. Saffari,

and A. Morovvati, "Biodegradation of glyphosate herbicide by Salinicoccus

spp isolated from Qom Hoze-soltan lake, Iran," Environ. Health Eng. Manag.

J., vol. 2, pp. 31-36, 2015.

[212] G. M. Dill, R. D. Sammons, P. C. Feng, F. Kohn, K. Kretzmer, A.

Mehrsheikh, M. Bleeke, J. L. Honegger, D. Farmer, D. Wright, and E. A.

Haupfear, "Glyphosate: Discovery, Development, Applications, and

Properties," Glyphosate Resistance in Crops and Weeds: History,

Development, and Management, Hoboken, John Wiley and Sons, Inc., pp. 1-

33, 2010.

[213] T. Yamada, R. J. Kremer, P. R. d. C. e Castro, and B. W. Wood, "Glyphosate

interactions with physiology, nutrition, and diseases of plants: Threat to

agricultural sustainability?," Eur. J. Agron., vol. 31, pp. 111-113, 2009.

[214] G. Johal and D. Huber, "Glyphosate effects on diseases of plants," Eur. J.

Agron., vol. 31, pp. 144-152, 2009.

[215] S. Eker, L. Ozturk, A. Yazici, B. Erenoglu, V. Romheld, and I. Cakmak,

"Foliar-applied glyphosate substantially reduced uptake and transport of iron

6. References

130

and manganese in sunflower (Helianthus annuus L.) plants," J. Agric. Food

Chem., vol. 54, pp. 10019-10025, 2006.

[216] R. Annett, H. R. Habibi, and A. Hontela, "Impact of glyphosate and

glyphosate‐based herbicides on the freshwater environment," J. Appl. Toxicol.,

vol. 34, pp. 458-479, 2014.

[217] M. Cuhra, T. Traavik, and T. Bøhn, "Clone-and age-dependent toxicity of a

glyphosate commercial formulation and its active ingredient in Daphnia

magna," Ecotoxicology, vol. 22, pp. 251-262, 2013.

[218] M. Gaupp-Berghausen, M. Hofer, B. Rewald, and J. G. Zaller, "Glyphosate-

based herbicides reduce the activity and reproduction of earthworms and lead

to increased soil nutrient concentrations," Sci. Rep., vol. 5, 2015.

[219] J. G. Zaller, F. Heigl, L. Ruess, and A. Grabmaier, "Glyphosate herbicide

affects belowground interactions between earthworms and symbiotic

mycorrhizal fungi in a model ecosystem," Sci. Rep., vol. 4, 2014.

[220] R. Mesnage, N. Defarge, J. S. de Vendomois, and G. Seralini, "Potential toxic

effects of glyphosate and its commercial formulations below regulatory

limits," Food Chem. Toxicol., vol. 84, pp. 133-153, 2015.

[221] International Agency for Research on Cancer and World Health Organization,

"IARC Monographs Volume 112: Evaluation of Five Organophosphate

Insecticides and Herbicides," ed Lyon France, 2015.

[222] T. Shushkova, I. Ermakova, and A. Leontievsky, "Glyphosate bioavailability

in soil," Biodegradation, vol. 21, pp. 403-410, 2010.

[223] T. M. Balthazor and L. E. Hallas, "Glyphosate-degrading microorganisms

from industrial activated sludge," Appl. Environ. Microbiol., vol. 51, pp. 432-

434, 1986.

[224] L. Hallas, W. Adams, and M. Heitkamp, "Glyphosate degradation by

immobilized bacteria: field studies with industrial wastewater effluent," Appl.


[225] D. L. Shinabarger and H. D. Braymer, "Glyphosate catabolism by

Pseudomonas sp. strain PG2982," J. Bacteriol., vol. 168, pp. 702-707, 1986.

[226] R. Pipke, N. Amrhein, G. S. Jacob, J. Schaefer, and G. M. Kishore,

"Metabolism of glyphosate in an Arthrobacter sp. GLP‐1," Europ. J.

Biochem., vol. 165, pp. 267-273, 1987.

[227] A. Selvapandiyan and R. K. Bhatnagar, "Isolation of a glyphosate-

metabolising Pseudomonas: detection, partial purification and localisation of

carbon-phosphorus lyase," Appl. Microbiol. Biotechnol., vol. 40, pp. 876-882,

1994.

[228] A. V. Sviridov, T. V. Shushkova, N. F. Zelenkova, N. G. Vinokurova, I. G.

Morgunov, I. T. Ermakova, and A. A. Leontievsky, "Distribution of

glyphosate and methylphosphonate catabolism systems in soil bacteria

Ochrobactrum anthropi and Achromobacter sp," Appl. Microbiol. Biotechnol.,

vol. 93, pp. 787-796, 2012.

6. References

131

[229] H. W. Talbot, L. M. Johnson, and D. M. Munnecke, "Glyphosate utilization by

Pseudomonas sp. and Alcaligenes sp. isolated from environmental sources,"

Curr. Microbiol., vol. 10, pp. 255-259, 1984.

[230] G. Jacob, J. Garbow, L. Hallas, N. Kimack, G. Kishore, and J. Schaefer,

"Metabolism of glyphosate in Pseudomonas sp. strain LBr," Appl. Environ.

Microbiol., vol. 54, pp. 2953-2958, 1988.

[231] K. S. McAuliffe, L. E. Hallas, and C. F. Kulpa, "Glyphosate degradation by

Agrobacterium radiobacter isolated from activated sludge," J. Ind. Microbiol.,

vol. 6, pp. 219-221, 1990.

[232] F. Hadi, A. Mousavi, K. A. Noghabi, H. G. Tabar, and A. H. Salmanian, "New

bacterial strain of the genus Ochrobactrum with glyphosate-degrading

activity," J. Environ. Sci. Health, Part B, vol. 48, pp. 208-213, 2013.

[233] R. Pipke and N. Amrhein, "Isolation and characterization of a mutant of

Arthrobacter sp. strain GLP-1 which utilizes the herbicide glyphosate as its

sole source of phosphorus and nitrogen," Appl. Environ. Microbiol., vol. 54,

pp. 2868-2870, 1988.

[234] A. Obojska, B. Lejczak, and M. Kubrak, "Degradation of phosphonates by

streptomycete isolates," Appl. Microbiol. Biotechnol., vol. 51, pp. 872-876,

1999.

[235] C.-M. Liu, P. McLean, C. Sookdeo, and F. Cannon, "Degradation of the

herbicide glyphosate by members of the family Rhizobiaceae," Appl. Environ.

Microbiol., vol. 57, pp. 1799-1804, 1991.

[236] L. P. Wackett, S. L. Shames, C. P. Venditti, and C. T. Walsh, "Bacterial

carbon-phosphorus lyase: products, rates, and regulation of phosphonic and

phosphinic acid metabolism," J. Bacteriol., vol. 169, pp. 710-717, 1987.

[237] R. Pipke and N. Amrhein, "Degradation of the phosphonate herbicide

glyphosate by Arthrobacter atrocyaneus ATCC 13752," Appl. Environ.

Microbiol., vol. 54, pp. 1293-1296, 1988.

[238] A. Obojska, N. G. Ternan, B. Lejczak, P. Kafarski, and G. McMullan,

"Organophosphonate utilization by the thermophile Geobacillus

caldoxylosilyticus T20," Appl. Environ. Microbiol., vol. 68, pp. 2081-2084,

2002.

[239] J. Gard, P. Feng, and W. Hutton, "Nuclear magnetic resonance tim ecourse

studies of glyphosate metabolism by microbial soil isolates," Xenobiotica, vol.

27, pp. 633-644, 1997.

[240] A. Peñaloza-Vazquez, G. L. Mena, L. Herrera-Estrella, and A. M. Bailey,

"Cloning and sequencing of the genes involved in glyphosate utilization by

Pseudomonas pseudomallei," Appl. Environ. Microbiol., vol. 61, pp. 538-543,

1995.

[241] J. K. Moore, H. D. Braymer, and A. D. Larson, "Isolation of a Pseudomonas

sp. which utilizes the phosphonate herbicide glyphosate," Appl. Environ.

Microbiol., vol. 46, pp. 316-320, 1983.

6. References

132

[242] M. M. Nourouzi, T. G. Chuah, T. S. Choong, and C. J. Lim, "Glyphosate

utilization as the source of carbon: isolation and identification of new

bacteria," J. Chem., vol. 8, pp. 1582-1587, 2011.

[243] M. Hoodaji, A. Tahmourespour, and M. Partoazar, "The Efficiency of

Glyphosate Biodegradation by Pseudomonas (aeruginosa)," Microbes in

Applied Research: Current Advances and Challenges: Malaga, Spain, 14-16

September 2011, p. 183, 2012.

[244] Y. V. Kryuchkova, G. L. Burygin, N. E. Gogoleva, Y. V. Gogolev, M. P.

Chernyshova, O. E. Makarov, E. E. Fedorov, and O. V. Turkovskaya,

"Isolation and characterization of a glyphosate-degrading rhizosphere strain,

Enterobacter cloacae K7," Microbiol. Res. vol. 169, pp. 99-105, 2014.

[245] O. Benslama and A. Boulahrouf, "Isolation and characterization of

glyphosate-degrading bacteria from different soils of Algeria," Afr. J.

Microbiol. Res., vol. 7, pp. 5587-5595, 2013.

[246] A. D. Kim, A. S. Baker, D. Dunaway-Mariano, W. Metcalf, B. Wanner, and

B. M. Martin, "The 2-aminoethylphosphonate-specific transaminase of the 2-

aminoethylphosphonate degradation pathway," J. Bacteriol., vol. 184, pp.

4134-4140, 2002.

[247] M. C. Morais, G. Zhang, W. Zhang, D. B. Olsen, D. Dunaway-Mariano, and

K. N. Allen, "X-ray crystallographic and site-directed mutagenesis analysis of

the mechanism of Schiff-base formation in phosphonoacetaldehyde hydrolase

catalysis," J. Biol. Chem., vol. 279, pp. 9353-9361, 2004.

[248] J. P. Quinn, A. N. Kulakova, N. A. Cooley, and J. W. McGrath, "New ways to

break an old bond: the bacterial carbon-phosphorus hydrolases and their role

in biogeochemical phosphorus cycling," Environ. Microbiol., vol. 9, pp. 2392-

2400, 2007.

[249] A. K. White and W. W. Metcalf, "Microbial metabolism of reduced

phosphorus compounds," Annu. Rev. Microbiol., vol. 61, pp. 379-400, 2007.

[250] J. W. McGrath, J. P. Chin, and J. P. Quinn, "Organophosphonates revealed:

new insights into the microbial metabolism of ancient molecules," Nat. Rev.

Microbiol., vol. 11, pp. 412-419, 2013.

[251] S. L. Shames, L. P. Wackett, M. S. LaBarge, R. L. Kuczkowski, and C. T.

Walsh, "Fragmentative and stereochemical isomerization probes for homolytic

carbon to phosphorus bond scission catalyzed by bacterial carbon-phosphorus

lyase," Bioorg. Chem., vol. 15, pp. 366-373, 1987.

[252] G. Yakovleva, S.-K. Kim, and B. Wanner, "Phosphate-independent expression

of the carbon-phosphorus lyase activity of Escherichia coli," Appl. Microbiol.


[253] B. Hove-Jensen, T. J. Rosenkrantz, D. L. Zechel, and M. Willemoës,

"Accumulation of intermediates of the carbon-phosphorus lyase pathway for

phosphonate degradation in phn mutants of Escherichia coli," J. Bacteriol.,

vol. 192, pp. 370-374, 2010.

[254] B. Hove-Jensen, F. R. McSorley, and D. L. Zechel, "Physiological role of

PhnP-specified phosphoribosyl cyclic phosphodiesterase in catabolism of

6. References

133

organophosphonic acids by the carbon-phosphorus lyase pathway," J. Am.

Chem. Soc., vol. 133, pp. 3617-3624, 2011.

[255] W. W. Metcalf and B. L. Wanner, "Mutational analysis of an Escherichia coli

fourteen-gene operon for phosphonate degradation, using TnphoA'elements,"

J. Bacteriol., vol. 175, pp. 3430-3442, 1993.

[256] S. S. Kamat, H. J. Williams, and F. M. Raushel, "Intermediates in the

transformation of phosphonates to phosphate by bacteria," Nature, vol. 480,

pp. 570-573, 2011.

[257] G. Kishore and G. S. Jacob, "Degradation of glyphosate by Pseudomonas sp.

PG2982 via a sarcosine intermediate," J. Biol. Chem., vol. 262, pp. 12164-

12168, 1987.

[258] D. Hamsaveni, S. Prapulla, and S. Divakar, "Response surface methodological

approach for the synthesis of isobutyl isobutyrate," Process Biochem., vol. 36,

pp. 1103-1109, 2001.

[259] Y. R. Abdel-Fattah, E. R. El-Helow, K. M. Ghanem, and W. A. Lotfy,

"Application of factorial designs for optimization of avicelase production by a

thermophilic Geobacillus isolate," Res. J. Microbiol., vol. 2, pp. 13-23, 2007.

[260] M. Seth and S. Chand, "Biosynthesis of tannase and hydrolysis of tannins to

gallic acid by Aspergillus awamori-optimisation of process parameters,"

Process Biochem., vol. 36, pp. 39-44, 2000.

[261] J. Zolgharnein, A. Shahmoradi, and J. B. Ghasemi, "Comparative study of

Box–Behnken, central composite, and Doehlert matrix for multivariate

optimization of Pb (II) adsorption onto Robinia tree leaves," J. Chemometrics,

vol. 27, pp. 12-20, 2013.

[262] Z.-W. Wang and X.-L. Liu, "Medium optimization for antifungal active

substances production from a newly isolated Paenibacillus sp. using response

surface methodology," Bioresour. Technol., vol. 99, pp. 8245-8251, 2008.

[263] J. Xu, G.-P. Sheng, H.-W. Luo, F. Fang, W.-W. Li, R. J. Zeng, Z. H. Tong,

and H. Q. Yu, "Evaluating the influence of process parameters on soluble

microbial products formation using response surface methodology coupled

with grey relational analysis," Water Res., vol. 45, pp. 674-680, 2011.

[264] E. Alexa, M. Hafner, M. Negrea, and A. Lazureanu, "HPLC and GC

determination of glyphosate and aminomethylphosphonic acid (AMPA) in

water samples," in 43rd Croatian and 3rd International Symposium on

Agriculture. Opatija, Croatia, pp. 100-105. 2008.

[265] A. Sviridov, T. Shushkova, I. Ermakova, E. Ivanova, and A. Leontievsky,

"Glyphosate: safety risks, biodegradation, and bioremediation," in Current

Environmental Issues and Challenges, ed: Springer, 2014, pp. 183-195.

[266] S. F. Nishino and J. C. Spain, "Oxidative athway for the biodegradation of

nitrobenzene by Comamonas sp. strain JS765," Appl. Environ. Microbiol., vol.

61, pp. 2308-2313, 1995.

[267] U. U. Jadhav, V. V. Dawkar, G. S. Ghodake, and S. P. Govindwar,

"Biodegradation of direct red 5B, a textile dye by newly isolated Comamonas

sp. UVS," J. Hazard. Mater., vol. 158, pp. 507-516, 2008.

6. References

134

[268] H. S. Bae, J. M. Lee, Y. B. Kim, and S.-T. Lee, "Biodegradation of the

mixtures of 4-chlorophenol and phenol by Comamonas testosteroni CPW301,"

Biodegradation, vol. 7, pp. 463-469, 1996.

[269] B. Zhao, X. Hua, F. Wang, W. Dong, Z. Li, Y. Yang, Z. Cui, and M. Wang,

"Biodegradation of propyzamide by Comamonas testosteroni W1 and cloning

of the propyzamide hydrolase gene camH," Bioresource Technol., vol. 179,

pp. 144-149, 2015.

[270] Y. Chen, L. Chai, Y. Zhu, Z. Yang, Y. Zheng, and H. Zhang, "Biodegradation

of kraft lignin by a bacterial strain Comamonas sp. B‐9 isolated from eroded

bamboo slips," J. Appl. Microbiol., vol. 112, pp. 900-906, 2012.

[271] A. Moneke, G. Okpala, and C. Anyanwu, "Biodegradation of glyphosate

herbicide in vitro using bacterial isolates from four rice fields," African J.


[272] N. Awasthi, R. Ahuja, and A. Kumar, "Factors influencing the degradation of

soil-applied endosulfan isomers," Soil Biol. Biochem., vol. 32, pp. 1697-1705,

2000.

[273] E. A. Wolski, S. E. Murialdo, and J. F. Gonzalez, "Effect of pH and inoculum

size on pentachlorophenol degradation by Pseudomonas sp.," Water SA, vol.

32, pp. 93-98, 2006.

[274] A. Samsel and S. Seneff, "Glyphosate, pathways to modern diseases III:

Manganese, neurological diseases, and associated pathologies," Surg. Neurol.

Int., vol. 6, p. 45, 2015.

[275] A. Kumar, B. Bisht, V. Joshi, and T. Dhewa, "Review on bioremediation of

polluted environment: a management tool," Int. J. Environ. Sci., vol. 1, p.

1079, 2011.

[276] A. Hess, B. Zarda, D. Hahn, A. Häner, D. Stax, P. Höhener, and J. Zeyer, "In

situ analysis of denitrifying toluene-and m-xylene-degrading bacteria in a

diesel fuel-contaminated laboratory aquifer column," Appl. Environ.

Microbiol., vol. 63, pp. 2136-2141, 1997.

[277] V. H. Smith, D. W. Graham, and D. D. Cleland, "Application of resource-ratio

theory to hydrocarbon biodegradation," Environ. Sci. Technol., vol. 32, pp.

3386-3395, 1998.

[278] C. Y. Tang, Q. S. Fu, C. S. Criddle, and J. O. Leckie, "Effect of flux

(transmembrane pressure) and membrane properties on fouling and rejection

of reverse osmosis and nanofiltration membranes treating perfluorooctane

sulfonate containing wastewater," Environ. Sci. Technol., vol. 41, pp. 2008-

2014, 2007.

135

Appendices

Appendix - A

Minimal Salt Media (MSM)

Chemical Concentration

Distilled water 1 L

Na2 H PO4 5.8 g/L

KH2PO4 3.0 g/L

NaCl 0.5 g/L

NH4Cl 1.0 g/L

MgSO4.7H2O 0.25 g/L

pH 6.8-7.00

Appendix - B

Lauria Bertani Medium


Distilled water 1 L

Trypton 10 g/L

Yeast extract 5 g/L

NaCl 5 g/L

pH 7.2±0.2

Appendices

136

Appendix - C

Enrichment Media

Appendix - D

Minimal Media


NH4Cl 20 mM

NaCl/KCl 20 mM

MgCl2 0.5 mM

KP 25 mM

Na2SO4 0.5 mM

Trace element

solutions

(100X)

10 mL

pH 7.0


Tris base 50 mM

NH4Cl 20 mM

Nasuccinate 25 mM

NaCl/KCl 20 mM

KP 10 mM

Na2SO4 1 mM

Trace element

solutions

(100X)

10 mL

pH 7.0

Appendices

137

Appendix - E

100X Trace Element Solution

Appendix - F

Solutions for Gram’s reaction

Crystal violet solution


Distilled water 400 mL

Crystal violet 10 g

Ammonium oxalate 4 g

Ethanol 100 mL

Iodine solution



Iodine 1 g

Potassium iodide 2 g

Ethanol 10 mL


Na2-EDTA.2H2O 500 mg/L

FeCl2.4H2O 143 mg/L

ZnCl2 4.7 mg/L

MnCl2.4H2O 3.0 mg/L

H3BO3 30 mg/L

CoCl2.6H2O 20 mg/L

CuCl2.2H2O 1.0 mg/L

NiCl2.6H2O 2.0 mg/L

Na2MoO4.2H2O 3.0 mg/L

CaCl2.2H2O 100 mg/L

Appendices

138

Safranin solution



Safranin 2.5 g

Ethanol 10 mL

Appendix - G

Saline solution (0.9%)

Appendix - H

Phosphate Free Media



NaCl 0.9 g


NH4Cl 20 mM

NaCl/KCl 20 mM

MgCl2 0.5 mM

Nasuccinate 25 mM

Na2SO4 0.5 mM

Trace element

solutions

(100X)

10 mL

pH 7.0

Appendices

139

Appendix – I

Carbon Free Media

Appendix - J

Solutions for standard Miniprep protocol

Solution 1 (Suspension Buffer)


Tris (pH 8.0) 50 mM

EDTA 10 mM

RNAase A 100 mM

Solution 2


NaOH 200 mM

(SDS) 10%

Solution 3 (pH 4.8-5.0)


Potassium acetate 3.0 mM

Glacial acetic acid 11.5 mL/1000 mL


NH4Cl 20 mM

NaCl/KCl 20 mM

MgCl2 0.5 mM

KP 25 mM

Na2SO4 0.5 mM

Trace element

solutions

(100X)

10 mL

pH 7.0