M

QQa

b

a

ARRAA

KTGRSE

1

rpmesi

r

sT

0h

Molecular Immunology 52 (2012) 117– 124

Contents lists available at SciVerse ScienceDirect

Molecular Immunology

jo u rn al hom epa ge: www.elsev ier .com/ locate /mol imm

olecular cloning, characterization and expression of goose Toll-like receptor 5

iang Fanga,1, Zhiming Pana,b,1, Shizhong Genga, Xilong Kanga, Jinlin Huanga, Xiaolin Suna,iuchun Lia, Yinqiang Caia, Xinan Jiaoa,b,∗

Jiangsu Key Laboratory of Zoonosis, Yangzhou University, Yangzhou, Jiangsu 225009, ChinaMinistry of Education Key Lab for Avian Preventive Medicine, Yangzhou University, Yangzhou, Jiangsu 225009, China

r t i c l e i n f o

rticle history:eceived 19 January 2012eceived in revised form 7 May 2012ccepted 7 May 2012vailable online 4 June 2012

eywords:oll-like receptorooseACEalmonella Enteritidisxpression

a b s t r a c t

Toll-like receptors (TLRs) are pattern recognition receptors (PRRs) that are vital to activation of the innateimmune system in response to invading pathogens through their recognition of pathogen-associatedmolecular patterns (PAMPs). TLR5 is responsible for the recognition of bacterial flagellin in vertebrates.In this study, we cloned the goose TLR5 gene using rapid amplification of cDNA ends (RACE). The openreading frame (ORF) of goose TLR5 cDNA is 2583 bp in length and encodes an 860 amino acid protein.The entire coding region of the TLR5 gene was successfully amplified from genomic DNA and containeda single exon. The putative amino acid sequence of goose TLR5 consisted of a signal peptide sequence, 11leucine-rich repeat (LRR) domains, a leucine-rich repeat C-terminal (LRR-CT) domain, a transmembranedomain and an intracellular Toll-interleukin-1 receptor (TIR) domain. The amino acid sequence of gooseTLR5 shared 50.5% identity with human (Homo sapiens), 49.8% with mouse (Mus musculus) and 82.7%with chicken (Gallus gallus). The goose TLR5 gene was highly expressed in the spleen, liver and brain;moderately expressed in PBMCs, kidney, lung, heart, bone marrow, small intestine and large intestine;and minimally expressed in the cecum. HEK293 cells transfected with goose TLR5 and NF-�B-luciferasecontaining plasmids significantly responded to flagellin from Salmonella typhimurium indicating thatit is a functional TLR5 homologue. In response to infection with S. enterica serovar Enteritidis (SE), thelevel of TLR5 mRNA significantly increased over the control in PBMCs at 1 d post infection (p.i.) and was

slightly elevated in the spleen at 1 d or 3 d p.i. IL-6 was expressed below control levels in PBMCs butwas upregulated in the spleen. In contrast to IL-6, an evident decrease in the expression level of IL-8 wasobserved in both PBMCs and spleens at 1 d or 3 d p.i. SE challenge also resulted in an increase in the mRNAexpression of IL-18 and IFN-� in PBMCs and the spleen. These results imply that the expression of gooseTLR5 is differentially regulated in various tissues and may participate in the immune response againstbacterial pathogens.

. Introduction

Toll-like receptors (TLRs) are a family of type I transmembraneeceptors classified as pattern-recognition receptors (PRRs) thatlay an important role in the recognition of pathogen-associatedolecular patterns (PAMPs) from invading pathogens (Takeda

t al., 2003). This recognition leads to the activation of the sub-equent signaling pathway (Akira and Takeda, 2004), which results

n the development of host immune responses.

TLR family members consist of an extracellular leucine-richepeats (LRRs) domain for ligand recognition, a transmembrane

∗ Corresponding author at: Jiangsu Key Laboratory of Zoonosis, Yangzhou Univer-ity, 12 East Wenhui Road, Yangzhou, Jiangsu 225009, China.el.: +86 514 8797 1803; fax: +86 514 8731 1374.

E-mail address: jiao@yzu.edu.cn (X. Jiao).1 These authors contributed equally to this work.

161-5890/$ – see front matter © 2012 Elsevier Ltd. All rights reserved.ttp://dx.doi.org/10.1016/j.molimm.2012.05.005

© 2012 Elsevier Ltd. All rights reserved.

domain and an intracellular Toll/interleukin 1 receptor (TIR) sig-naling domain (Medzhitov, 2001). The different structures of theLRR domain in variable TLRs correspond to distinct components ofpathogens. To date, thirteen TLRs have been identified in mammalsand ten TLRs in avians including the chicken (Kaiser, 2010). TLR2recognizes major Gram positive cell wall components such as pep-tidoglycan and lipoteichoic acid; TLR3, double stranded RNA; TLR4,lipopolysaccharide (LPS) of Gram-negative bacteria; TLR5, bacterialflagellin; TLR7, single-stranded viral RNA; and TLR9, unmethy-lated CpG DNA (Iwasaki and Medzhitov, 2004; Takeda et al., 2003;Werling and Jungi, 2003).

In several species, TLR5 is important in the host defense againstbacterial pathogens. TLR5 recognizes flagellin, which contributesto the motility of bacterial pathogens (Hayashi et al., 2001). This

triggers the MyD88-dependent signaling pathway and activatesNF-�B to stimulate transcription of several proinflammatory genes(Didierlaurent et al., 2004; Gewirtz et al., 2001; Hayashi et al.,2001). TLR5-deficient mice lack the flagellin-induced pulmonary

1 mmun

it2otscpsn

iiki

2

2

wCnisndwlIaa(fiCscaciRowsas

2

ofb(aDiBoDP53c

18 Q. Fang et al. / Molecular I

nflammatory response (Feuillet et al., 2006) and are more suscep-ible to E. coli infection of the urinary tract (Andersen-Nissen et al.,007). Exposure of chTLR5+ cells to flagellin induced upregulationf chicken interleukin-1� (chIL-1�), and an aflagellar Salmonellayphimurium mutant exhibited an enhanced ability to establishystemic infection (Iqbal et al., 2005b). Collectively, these data indi-ate that TLR5 plays a role in restricting the entry of flagellatedathogens in mammals and chickens. However, in other aviansuch as goose, TLR5 has not yet been cloned, and its function hasot been reported.

In this paper, we describe the goose TLR5 sequence, analyzets expression in several tissues and its expression after bacterialnfection by quantitative real-time PCR. These data will expand ournowledge of the relationship between TLR5 and innate immunityn avians including chicken, goose and others.

. Materials and methods

.1. Molecular cloning of goose TLR5

Total RNAs were extracted from the spleens of Yangzhouhite geese purchased from the Xinghua Shuangping Livestocko. Ltd. (Taizhou, China) using RNAiso Plus (TaKaRa, Biotech-ology Co. Ltd., Dalian, China) according to the manufacturer’s

nstructions. To avoid contamination with genomic DNA, total RNAamples were treated with RNase-Free DNasel (TaKaRa, Biotech-ology Co. Ltd., Dalian, China). To clone the goose TLR5 gene,egenerate PCR primers were designed based on the relativelyell-conserved nucleotide sequences of TLR5 from chicken (Gal-

us gallus) (GenBank ID: HM747028), Meleagris gallopavo (GenBankD: HQ436463), mouse (Mus musculus) (GenBank ID: AF186107)nd human (Homo sapiens) (GenBank ID: NM 003268). Degener-te PCR was performed with the designed degenerate primersTable 1) and goose spleen cDNA as the template. The ampli-ed PCR product was purified, cloned into pMD18-T with a TAloning Kit (TaKaRa, Biotechnology Co. Ltd., Dalian, China) andequenced. After sequencing and BLAST analysis, the full-lengthDNA sequences of goose TLR5 were obtained by 5′- and 3′-rapidmplification of cDNA ends (RACE) using the SMARTerTM RACEDNA Amplification Kit (Clontech) according to the manufacturer’snstructions. Gene-specific primers used for the amplification ofACE cDNA fragments (Table 1) were designed based on thebtained TLR5 partial nucleotide sequence. PCR amplificationsere performed by touchdown PCR and nested PCR with gene-

pecific nested primers to obtain specific PCR products. PCRmplicons were then cloned into a plasmid vector for nucleotideequencing as described above.

.2. Characterization of intronic regions

Primer pairs covering the entire open reading frames (ORFs)f the goose TLR5 gene were used to amplify gene fragmentsrom genomic DNA, which was extracted from goose wholelood with the Universal Genomic DNA Extraction Kit Ver.3.0TaKaRa, Biotechnology Co. Ltd., Dalian, China). The primers usedre listed in Table 1. PCR was carried out using PrimeSTAR® HSNA Polymerase (TaKaRa, Biotechnology Co. Ltd., Dalian, China)

n a 50 �l reaction volume consisting of 10 �l of 5× PrimeSTAR®

uffer (Mg2+ plus), 4 �l of dNTP Mixture (each 2.5 mM), 1 �l eachf forward and reverse primers (10 �M), 0.5 �l of PrimeSTAR® HSNA Polymerase and 2 �l (∼200 ng) of genomic DNA template.

CR amplifications were performed as follows: 1 cycle of 98 ◦C for

min, then 30 cycles of 98 ◦C for 10 s, 59 ◦C for 15 s and 72 ◦C for min, followed by 1 cycle of 72 ◦C for 10 min. PCR products wereloned and sequenced as described above. The genomic nucleotide

ology 52 (2012) 117– 124

sequences were compared to cDNA sequences to determine theexon–intron boundaries of the gene.

2.3. Sequence analyses

The nucleotide and deduced amino acid sequences of gooseTLR5 were analyzed using DNAstar software and the Expasysearch program (http://au.expasy.org/tools/). SMART (Simple Mod-ular Architecture Research Tool – http://smart.embl-heidelberg.de)was used to predict the protein domain structure of goose TLR5.TLR5 sequences from different species were compared by the NCBIBLAST search program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Amultiple sequence alignment was performed using Clustal W(http://www.ebi.ac.uk/clustalw/) and edited with the Genedocprogram. Phylogenetic analysis was conducted on amino acidsequences using MEGA 4 software, and a phylogenetic tree wasconstructed with the neighbor-joining (NJ) method using a Poissoncorrection model with 1000 bootstrap replicates.

2.4. RT-PCR analysis of goose TLR5 expression in tissues

Total RNAs were extracted from peripheral blood mononuclearcells (PBMCs), spleen, liver, kidney, lung, heart, brain, bone mar-row, small intestine, large intestine and cecum of healthy Yangzhouwhite geese using RNAiso Plus (TaKaRa, Biotechnology Co. Ltd.,Dalian, China) according to the manufacturer’s instructions. TotalRNA samples were treated with RNase-Free DNase I (TaKaRa,Biotechnology Co. Ltd., Dalian, China) to remove contaminatingDNA, and first strand cDNA was synthesized using M-MLV reversetranscriptase (Invitrogen, USA) following the manufacturer’s pro-tocol. RT-PCR was performed with cDNA templates from each tissueand a specific primer set of TLR5 (Table 1). This set of primersyielded a 199 bp fragment. The endogenous control was 18S rRNA(L21170) (Pan et al., 2011). PCR products were then run on 1%agarose gels.

2.5. DNA constructs

An expression construct, pcDNA3.1-TLR5 was made by cloningthe full-length of goose TLR5 into the Kpn I and Xho I sites ofpcDNA3.1(+) expression vector (Invitrogen, USA). DNA fragments ofthe full-length TLR5 ORF were PCR amplified using specific primers(Table 1). The amplified PCR product was cloned into pCR2.1 cloningvector (Invitrogen, USA) and sequenced. The plasmid DNA contain-ing full-length TLR5 ORF was digested with Kpn I and Xho I (TaKaRa,Biotechnology Co. Ltd., Dalian, China), and subcloned into the samerestriction enzymes site of the pcDNA3.1(+) expression vector (des-ignated as pcDNA3.1-TLR5).

2.6. Cell culture, transfection and luciferase assay

To determine the functional response of goose TLR5 to flag-ellin, HEK293 cells were grown in 24-well tissue culture platesin DMEM (Invitrogen, USA) supplemented with 10% fetal bovineserum (FBS) (Invitrogen, USA) until 70% confluence was reached.Cells were washed with PBS before transfection, and then replacedwith Opti-MEM (Invitrogen, USA) medium. Transfection was per-formed with Lipofectamine 2000 (Invitrogen, USA) accordingto the manufacturer’s instructions. Same amount of DNA con-structs including pcDNA3.1-TLR5 or pcDNA3.1-empty and 400 ng ofreporter pGL4.32[luc2P/NF-�B-RE/Hygro] plasmid DNA (Promega,USA) were transfected into the cells. Twenty-four hours after

transfection, 100 ng/ml of purified flagellin from S. typhimurium(Enzo Life Sciences, USA) was added to the cell-culture medium.After stimulation for 5 h, cells were harvested and NF-�B inducedluciferase activity was measured using the Bright-Glo Luciferase

Q. Fang et al. / Molecular Immunology 52 (2012) 117– 124 119

Table 1PCR primers used in this study.

Primer name Primer sequence (5′–3′) Usage

Degenerate F GGATCCATKCYTTGCTSAARCACCT Degenerate PCRDegenerate R GTCGACAACCAGYCWAYATCYTGAT Degenerate PCR

5′-RACEGSP1 CTGCTCTGGGCAAAATTAAAGGCTTCC RACE PCRNGSP1 TAAAGGCTTCCACACACCACCCATCT RACE PCR

3′-RACEGSP2 GAGGAACGAGATTTCTTGCCTGGGGA RACE PCRNGSP2 ATTCGTGATGCCATTTGGAACAGC RACE PCR

Real-time long F and RT-F GCACTCCGGCTGTTTCAGAACA Construction of standard curve and RT-PCR for TLR5Real-time long R and RT-R TGCTTTCACACAGGTTGGATATGGC Construction of standard curve and RT-PCR for TLR5Real-time short F TCCCTTCCTTTCCGCATCTGACG Detection of mRNA for TLR5Real-time short R CAGTTCACCCAGATCTGCCAACCA Detection of mRNA for TLR5

TLR5 F GTCGACATGATGTTACATCAACAGC Characterization of intronic regionsTLR5 R CATATGTAGAAAGAGGGTATCTGGAAAGCC Characterization of intronic regions

TLR5-expression F TAGGTACCACGATGGTGTTACATCAACAGC Construction of TLR5 expression vectorTLR5-expression R TCTCTCGAGCAGCAACCCATACACTGTCAAT Construction of TLR5 expression vector

18S rRNA18S rRNA F TTGGTGGAGCGATTTGTC RT-PCR18S rRNA R ATCTCGGGTGGCTGAACG RT-PCR

�-actin�-actin F CAACGAGCGGTTCAGGTGT Detection of mRNA�-actin R TGGAGTTGAAGGTGGTCTCG Detection of mRNA

IL-6IL-6 F AGCAAAAAGTTGAGTCGCTGTGC Detection of mRNAIL-6 R TAGCGAACAGCCCTCACGGT Detection of mRNA

IL-8IL-8 F GCTGTCCTGGCTCTTCTCCTGATT Detection of mRNAIL-8 R GGGTCCAAGCACACCTCTCTGTTG Detection of mRNA

IL-18IL-18 F TGCCTCTACTTTGCTGACGATGATG Detection of mRNAIL-18 R TATCTTCTACCTGGACGCTGAACGC Detection of mRNA

IFN-�C

Aiud

2S

SbswgT1kbawropl(caw

IFN-� F ACATCAAAAACCTGTCTGAGCAGIFN-� R AGGTTTGACAGGTCCACGAGG

ssay system (Promega, USA) according to the manufacturer’snstructions. Data are expressed as fold induction relative to thenstimulated cells and represent the mean ± SD of three indepen-ent experiments.

.7. Gene expression profiling of goose TLR5 and cytokines afteralmonella infection

Yangzhou white geese were routinely tested for the absence ofalmonella. All birds were housed and handled following approvaly the Institutional Animal Experimental Committee. S. entericaerovar Enteritidis (SE) strain 50041 in the log phase of growth wasashed twice with PBS and then suspended in PBS. Two-day-old

eese were infected orally with 1 × 106 cfu of SE in 0.2 ml of PBS.he control group was mock infected with 0.2 ml of PBS alone. At

and 3 d post-infection (p.i.), three geese from each group wereilled for collection of whole blood and spleen samples. Peripherallood mononuclear cells (PBMCs) were isolated from whole bloods previously described (Pan et al., 2012). Briefly, the blood samplesere collected with 10% EDTA in 10:1 (V:V) ratio and combined in

andom pools at each time point post-infection, to ensure isolationf an adequate quantity of PBMCs for various assays. Each bloodool was centrifuged for 10 min at 200 × g. The erythrocyte pel-

et was resuspended with PBS, then layered onto 1077 Histopaque

10771, Sigma) and centrifuged at 400 × g for 30 min. Mononuclearells were collected from the gradient interface, washed with PBS,nd centrifuged for 10 min at 200 × g. A final wash was performedith antibiotic-free RPMI 1640 (Invitrogen, USA) supplemented

Detection of mRNADetection of mRNA

with 10% fetal bovine serum (FBS) (Invitrogen, USA). The pelletswere then resuspended in antibiotic-free RPMI 1640 with FBS. Cellviability and number were determined by trypan blue exclusion.

Total RNAs were extracted from spleens and PBMCs isolatedfrom blood using RNAiso Plus, treated with RNase-Free DNasel toremove contamination with genomic DNA, and reverse transcribedinto cDNA using the PrimeScript RT Reagent Kit (Perfect Real Time)(TaKaRa, Biotechnology Co. Ltd., Dalian, China) according to themanufacturer’s instructions. Briefly, 1 �g of RNA was reacted with4 �l of 5× PrimeScript Buffer (for Real Time), 1 �l of PrimeScript RTEnzyme Mix I, 1 �l of Oligo dT primer (50 �M), 1 �l of Random 6mers (100 �M) and RNase-free water (TaKaRa, Biotechnology Co.Ltd., Dalian, China) in a final volume of 20 �l. These reactions wereincubated at 37 ◦C for 15 min and heated at 85 ◦C for 15 s to inactivethe enzyme.

The mRNA expression levels of goose TLR5, IL-6 (JF437643),IL-8 (DQ393274), IL-18 (EF159728) and IFN-� (AY524421) in theinfected and control groups were determined by quantitative real-time PCR using SYBR Premix Ex TaqTM II (Perfect Real Time)(TaKaRa, Biotechnology Co. Ltd., Dalian, China). The PCR mixturecontained the following: 2 �l of cDNA, 10 �l of 2× SYBR Premix ExTaqTM II, 0.8 �l each of the forward and reverse primers (10 �M),0.4 �l of ROX Reference Dye II (50×) and RNase-free water to afinal volume of 20 �l. The primer sequences are listed in Table 1.

Quantitative real-time PCR was carried out on an ABI PRISM 7500Real-Time PCR System (Applied Biosystems) with the followingprogram: 1 cycle at 95 ◦C for 30 s, followed by 40 cycles of 95 ◦C for5 s and 60 ◦C for 34 s. Each PCR reaction was performed in triplicate,

1 mmun

atw�tecaems

3

3

f

FGdcc

20 Q. Fang et al. / Molecular I

nd a non-template control was included on every plate to ensurehat there was no contamination in the master mix. Standard curvesere produced for each primer set of TLR5, IL-6, IL-8, IL-18 and IFN-

(Table 1). The expression levels of each gene were normalizedo the expression level of the endogenous control (�-actin) (Pant al., 2011) and were expressed as fold changes relative to theontrol group at each time point using the 2−��Ct method (Livaknd Schmittgen, 2001). Significant differences between the genexpression levels of the infected and control groups were deter-ined using a t-test. P values less than 0.05 were considered to be

ignificant.

. Results

.1. Characterization of the goose TLR5 gene

The full-length cDNA of the goose TLR5 gene was obtainedrom overlapping RACE cDNA fragments. By 3′-RACE PCR, a

ig. 1. Alignment of goose (Go), chicken (Ch), human (Hu) and mouse (Mo) TLR5 amienedoc program. In the goose sequence, the predicted signal peptide and leucine-richenote leucine-rich repeats, the single continuous line indicates a transmembrane domaionserved mode (black shading for conserved residues and light gray shading for similar

hicken HM747028, human NM 003268, and mouse AF186107.

ology 52 (2012) 117– 124

fragment of 971 bp was obtained. Subsequently, 5′-RACE PCR wascarried out, and a 2462 bp fragment was amplified. As a result,a 3345 bp nucleotide sequence representing the complete cDNAof goose TLR5 was obtained; this contained an open readingframe (ORF) of 2583 bp encoding a protein of 860 amino acidsin length (Fig. 1). This sequence was submitted to GenBankand assigned the accession number JN641303. The untranslatedregions (UTRs) were 142 bp and 620 bp for the 5′-UTR and 3′-UTR,respectively.

The entire coding region of the TLR5 gene was successfullyamplified from genomic DNA using primers overlaying the codingregion. Comparisons of the genomic and cDNA sequences revealedthat the goose TLR5 gene consisted of a single exon.

Prediction of protein domains by the SMART program revealed

that the putative amino acid sequence consisted of a signal peptidesequence encompassing the first 21 amino acid residues of the N-terminal region, 11 leucine-rich repeat (LRR) domains, a leucine-rich repeat C-terminal (LRR-CT) domain, a transmembrane domain

no acid sequences performed using the Clustal W program and edited using the repeat C-terminal (LRR-CT) domain are underlined. The double continuous linesn, and the dotted line represents the TIR domain. Shading was performed using theresidues). GenBank accession numbers for the aligned sequences: goose JN641303,

Q. Fang et al. / Molecular Immunology 52 (2012) 117– 124 121

Fig. 2. Phylogenetic tree of the TLR5 amino acid sequences from different species.The trees were constructed by the neighbor-joining method based on the Poissoncorrection model with 1000 bootstrap replicates. The numbers at the branchesindicate bootstrap values. The bar (0.1) indicates the genetic distance. GenBankaccession numbers: chicken HM747028, human NM 003268, pig AB208697, dogNM 001197176, mouse AF186107, Rattus norvegicus NM 001145828, zebrafishNT

ap

aNBsgas7r

3

sj1THsBIntr(Asro

3

alahm

Fig. 3. Expression analysis of the goose TLR5 gene in various tissues by RT-PCR. TotalRNA was extracted from different tissues of a healthy goose and reverse transcribed

Expression levels of IL-6, IL-8, IL-18 and IFN-� were also mea-sured. The results of quantitative real-time PCR showed that IL-6was decreased below the control in PBMCs but was upregulated inthe spleen, especially significantly at 3 d p.i. (Fig. 6A). In contrast

0

1

2

3

4

5Empty

TLR5

*

100 ng/ml flagellin

Fo

ld-i

nd

uct

ion

ov

er

un

stim

ula

ted

ce

lls

Fig. 4. Effect of flagellin-stimulation on NF-�B activity. HEK293 cells were trans-

M 001130595, rainbow trout NM 001124744, Japanese flounder AB562152, andakifugu rubripes AC156437.

nd a 148-amino acid Toll-interleukin-1 receptor (TIR) domain atositions 693–840 of the carboxy-terminus (Fig. 1).

The deduced amino acid sequence of the goose TLR5 wasligned with reported sequences from human (GenBank ID:M 003268), mouse (GenBank ID: AF186107) and chicken (Gen-ank ID: HM747028) using the Clustal W program. A multipleequence alignment illustrated that the amino acid sequence ofoose TLR5 shared 50.5% identity with human, 49.8% with mousend 82.7% with chicken (Fig. 1). Comparison of the amino acidequences of the TIR domains revealed that the goose TLR5 shared1.2%, 67.8% and 93.9% identity with human, mouse and chicken,espectively.

.2. Phylogenetic analysis of TLR5

Phylogenetic analyses were performed on the amino acidequences of the full coding region of TLR5 using the neighbor-oining (NJ) method. The resulting phylogenetic tree consisting of1 protein sequences was composed of two major branches (Fig. 2).LR5 protein sequences from the avians, chicken (GenBank ID:M747028) and goose (GenBank ID: JN641303), were in the same

ubgroup with the sequences from the mammals, human (Gen-ank ID: NM 003268), pig (GenBank ID: AB208697), dog (GenBank

D: NM 001197176), mouse (GenBank ID: AF186107) and Rattusorvegicus (GenBank ID: NM 001145828). The piscine TLR5 pro-ein sequences, including zebrafish (GenBank ID: NM 001130595),ainbow trout (GenBank ID: NM 001124744), Japanese flounderGenBank ID: AB562152) and Takifugu rubripes (GenBank ID:C156437), were in another subgroup. The goose and chicken TLR5equences were the most closely related, as expected. The observedelationships within this cluster reflected the taxonomic positionsf these species.

.3. Expression of goose TLR5 mRNA in different tissues

The expression of goose TLR5 mRNA in various tissues wasssessed by RT-PCR. The TLR5 gene was highly expressed in theymphoid tissue of the spleen and was also very high in the livernd brain. Moderate expression was found in PBMCs, kidney, lung,eart, bone marrow, small intestine and large intestine, and mini-al expression was observed in the cecum (Fig. 3).

to cDNA. 18S rRNA was amplified as the endogenous control. 1, PBMCs; 2, spleen;3, liver; 4, kidney; 5, lung; 6, heart; 7, brain; 8, bone marrow; 9, small intestine; 10,large intestine; 11, cecum.

3.4. Functional analysis of goose TLR5

To evaluate the response of goose TLR5 to flagellin, the effectof flagellin-stimulation on NF-�B activity was determined. Thegene was cloned into the pcDNA3.1(+) expression vector and trans-fected into HEK293 cells, and NF-�B induced luciferase activity wasassayed after flagellin stimulation. The induction level of luciferaseactivity in TLR5-transfected cells at 5 h after stimulation was 3.5-fold when compared to the level in cells transfected with emptyvector control (P < 0.05) (Fig. 4).

3.5. Effect of Salmonella Enteritidis on the expression of gooseTLR5 and inflammatory cytokines

To characterize the effect of SE on the induction of hostresponses, the mRNA expression levels of goose TLR5 and inflam-matory cytokines in the PBMCs and spleens were detected byquantitative real-time PCR. Goose TLR5 gene expression in PBMCswas significantly increased (4.7-fold) over the control at 1 d p.i.;this expression reverted back to the original level at 3 d p.i. (Fig. 5).In the spleen, the level of TLR5 mRNA was slightly elevated at 1 dor 3 d p.i., but these levels were not statistically significant whencompared to the control.

fected with expression vector (pcDNA3.1-TLR5 or pcDNA3.1-empty) and reportervector (pGL4.32[luc2P/NF-�B-RE/Hygro]). Twenty-four hours post-transfection,100 ng/ml of flagellin was added to the transfected cells and NF-�B luciferase activitywas measured after stimulation for 5 h. Data are depicted as fold induction relativeto the unstimulated cells. All data are the mean ± SD from three independent exper-iments. Asterisks indicate significant differences by a t-test between goose TLR5 andempty transfected into HEK293 cells (P < 0.05).

122 Q. Fang et al. / Molecular Immun

TLR5

1 30

1

2

3

4

5

6

7

PBMCs*C1

Spleen

C2

Fo

ld i

nd

ucti

on

Fig. 5. Induction of goose TLR5 gene expression in PBMCs and spleen after SEinfection. Total RNA was extracted from the indicated tissues at 1 and 3 d p.i. Theexpression level of goose TLR5 mRNA was measured by quantitative real-time PCR.Fold induction values are given as mean ± SD. Asterisks represent a significant dif-fts

toAwoprsh

4

t

Fld

erence between the gene expression levels of the infected and control samples by-test (P < 0.05). C1, the control group of the PBMCs; C2, the control group of thepleen.

o IL-6, an evident decrease in the expression level of IL-8 wasbserved in both PBMCs and spleen at 1 d or 3 d p.i. (Fig. 6B).fter SE infection, mRNA expression levels of IL-18 and IFN-�ere increased in PBMCs and spleens (Fig. 6C and D). Induction

f the IL-18 gene was significantly increased in PBMCs at 3 d.i. (2.0-fold) and in spleen at 1 d or 3 d p.i. (3.9- and 3.1-fold,espectively) (Fig. 6C). The expression of IFN-� was especiallytrong in PBMCs at 1 and 3 d p.i. (4.1- and 3.7-fold, respectively);owever, there was no notable difference in the spleen (Fig. 6D).

. Discussion

The TLR family represents a major component of the ver-ebrate PRR system that affords the ability to detect invading

IL-6

1 30

1

2

3

4

5

6

7C1

PBMCs

C2

*

*

(A)

Splee n

*

Fo

ld i

nd

ucti

on

(

IL-18

1 30

1

2

3

4

5

6C1

PBMCs

C2

*

*

*

(C)

Splee n

Fo

ld i

nd

ucti

on

(

ig. 6. Induction of inflammatory cytokine expression in PBMCs and spleen after SE infecevels of IL-6 (A), IL-8 (B), IL-18 (C) and IFN-� (D) were measured by quantitative real-timeifference between the gene expression levels of the infected and control samples by t-te

ology 52 (2012) 117– 124

microorganisms and has a fundamental role in triggering immuneresponses. In contrast to mammalian TLR5 orthologs, little isknown about the sequence variation and biological function ofavian TLR5-like receptors. The demonstrated response of chickenTLR5 to flagellin (Iqbal et al., 2005b) implicates a similar role ofavian TLR5 homologues in the immune response of birds. Chickenand turkey TLR5, which are closely related species, share 97%amino acid identity (Gopinath et al., 2011). Several studies alsocloned TLRs in mammals and teleost fish by 5′- and 3′-rapidamplification of cDNA ends (RACE) (Alvarez et al., 2006; Hwanget al., 2010; Kongchum et al., 2011). Because goose are moredistantly related, we designed degenerate PCR primers based ona comparison of conserved nucleotide sequences of the TLR5 TIRdomain of the chicken, M. gallopavo, mouse and human and thenutilized RACE PCR to clone the goose TLR5 gene. In general, thegoose TLR5 gene has a typical TLR structure (Medzhitov, 2001)that consists of extracellular LRRs, a transmembrane domain andan intracellular TIR domain. However, goose TLR5 exhibits somestructural features that are different from chicken and mammalianTLR5. For example, both chicken and mammalian TLR5 have 9 LRRsaccording to SMART analysis, while goose TLR5 possesses 11 LRRs.The two extra LRR motifs in goose TLR5 occur at positions 171–197and 549–567; these are absent in chicken TLR5. Additionally, thereare also some amino acid differences in the LRR domains of TLR5between the two species (Fig. 1). The structures of LRRs in TLRs arespeculated to mediate specific recognition of PAMPs (Bell et al.,2003). Thus, the differences in the LRRs of TLR5 among differentspecies may influence its functional role as a pathogen receptor.

As known, TLR5 recognizes bacterial flagellin. To evaluate theresponse of goose TLR5 to flagellin, we determined the effect of

flagellin-stimulation on NF-�B activity. After stimulation with flag-ellin, NF-�B induced luciferase activity in goose TLR5-transfectedHEK293 cells was significantly higher than the induced level in cellstransfected with empty vector control. The functionality of chTLR5

IL-8

1 30

1

2C1

PBMCs

C2

*

*

B)

Splee n

*

Fo

ld i

nd

ucti

on

IFN-γ

1 30

1

2

3

4

5

6C1

PBMCs

C2

*

*

D)

Splee n

Fo

ld i

nd

ucti

on

tion. Total RNA was extracted from the indicated tissues at 1 and 3 d p.i. The mRNA PCR. Fold induction values are given as mean ± SD. Asterisks represent a significantst (P < 0.05). C1, the control group of the PBMCs; C2, the control group of the spleen.

mmun

wtllri

wttoeltmiritSpa(sLwittgcsgvS

SiaIoptoirlSmcwtsuw8ameAet

ite

Q. Fang et al. / Molecular I

as evidenced by the SE-induced activation of NF-�B in chTLR5-ransfected HeLa cells and not in control cells, in addition to theack of TLR5 response after targeted mutagenesis of a single pro-ine residue in the TIR signaling domain (Keestra et al., 2008). Ouresult suggested that goose TLR5 as a pathogen receptor play a rolen the recognition of flagellin.

The gene expression pattern of TLR5 in healthy goose tissuesas assessed in this study. TLR5 was found to be expressed in all

issues examined, although expression levels varied. This is consis-ent with the finding that chicken TLR5 is expressed in a broad rangef tissues and cell types (Iqbal et al., 2005a,b). In this study, highxpression levels of goose TLR5 mRNA were observed in spleen,iver and brain, whereas the weakest expression was observed inhe cecum. The observation of goose TLR5 expression at sites of

icrobial contact with immune tissue like spleen (other than inntestines) indicates a functional TLR5-mediated innate immuneesponse to pathogenic challenges in this species. The high leveln the brain and the contrast in the cecum are intriguing and fur-her studies are needed to ascertain the reason. After infection withE, goose TLR5 gene expression was significantly increased at 1 d.i. in PBMCs and slightly elevated at 1 d or 3 d p.i. in the spleen,lthough this elevation was not statistically significant. Abasht et al.2009) investigated the effect of SE challenge on TLR mRNA expres-ion in the spleen of birds from three distinct genetic lines (broiler,eghorn, and Fayoumi) and showed that TLR5 mRNA expressionas consistently decreased in the spleen of all three lines after

nfection compared to mock-infected chicks. In the current study,he expression of goose TLR5 showed no significant increase inhe spleen after SE infection; the observed difference between theoose and the chicken may be due to differences in the structuralharacteristics of the LRRs of goose and chicken TLR5. Additionaltudies to dissect the structural differences between the LRRs ofoose TLR5 and the LRRs of chicken and mammalian TLR5 may pro-ide beneficial insight into their differences in the interaction withalmonella.

Cytokines are an integral part of the immune response toalmonella in avian species (Swaggerty et al., 2006). Specifically,ncreased mRNA expression and secretion of chemokines as wells proinflammatory and Th1 cytokines such as IFN-�, IL-6, IL-8,L-12, and MIP-1� are observed following infection with vari-us Salmonella species (Eckmann and Kagnoff, 2001). IL-6 is aroinflammatory cytokine involved in the transition from innateo acquired immunity and plays a key role in the recruitmentf immune cells to sites of infection (Kaiser et al., 2000). An

n vitro study by Kaiser et al. (2006) reported significant down-egulation in IL-6 and CXCLi2 (previously known as IL-8) mRNAevels in SE-infected PBMCs from 3 chicken lines. Heterophils fromE-resistant chickens had significantly higher levels of proinflam-atory cytokine (IL-6 and IL-8) mRNA expression upon treatment

ompared to heterophils from SE-susceptible lines when culturedith SE (Swaggerty et al., 2004). Cheeseman et al. (2007) found

hat mRNA expression of IL-6 and CXCLi2 [IL-8/CAF] were notignificantly different in the spleen of day-old chicks after oral inoc-lation with SE compared to unexposed birds. In this study, IL-6as decreased in PBMCs but upregulated in the spleen, while IL-

showed an evident decrease in expression level in both PBMCsnd the spleen. Several components of the experimental designay have contributed to these differences in IL-6 and IL-8 mRNA

xpression, including the susceptibility of the goose to Salmonella.dditionally, we cannot rule out the possibility that the mRNAxpression may have already been switched on and off during theime point or activated at an earlier or later time point.

In the present study, mRNA expression of IL-18 and IFN-� werencreased in PBMCs and spleen after SE infection. Induction ofhe IL-18 gene was significantly increased in the spleen, and thexpression of IFN-� was especially strong in PBMCs. IL-18 is a

ology 52 (2012) 117– 124 123

member of the IL-1 family of cytokines, which efficiently promotesIFN-� production by T cells and NK cells, thereby shaping immu-nity toward a Th1-like phenotype (Dinarello and Fantuzzi, 2003;Muhl and Pfeilschifter, 2004; Tsutsui et al., 2000). Challenge withSE increased splenic IL-18 and IFN-� mRNA expression comparedto unexposed birds (Cheeseman et al., 2007). Previous studies ofchicken heterophils in vitro have demonstrated increased IL-18mRNA expression in response to SE (Kogut et al., 2003; Swaggertyet al., 2004). IL-18 strongly induces IFN-� production in chickensplenocytes and serves as a growth factor for CD4+ T cells (Gobelet al., 2003). Our results are in accordance with these studies,although the hosts are different, in which the increased expressionof IL-18 or IFN-� mRNA would promote the avian immune responseagainst intracellular pathogens like Salmonella.

In conclusion, we have cloned and sequenced the goose TLR5gene. We then characterized its predicted protein domains anddetermined that its mRNA is broadly expressed in most tissues ingoose. We also determined the mRNA expression of the goose TLR5and cytokines in response to infection with SE. Further research isneeded to better understand the structural characteristics of theligand binding sites of goose TLR5 and its role in responses to dif-ferent bacterial infections, which will benefit research correlatedwith the innate immune response of avians including chicken andgoose.

Acknowledgments

This work was supported by the 863 program (no.2011AA10A212), the National Natural Science Foundation ofChina (nos. 31172299 and 31001052), the Jangsu Natural ScienceFoundation (no. BK2010039), the Jiangsu “333” program (no.BRA2011141), the Program for Changjiang Scholars and Innova-tive Research Team in University (no. IRT0978), and the PriorityAcademic Program Development of Jiangsu Higher EducationInstitutions.

References

Abasht, B., Kaiser, M.G., van der Poel, J., Lamont, S.J., 2009. Genetic lines differ in Toll-like receptor gene expression in spleens of chicks inoculated with Salmonellaenterica serovar Enteritidis. Poultry Science 88, 744–749.

Akira, S., Takeda, K., 2004. Toll-like receptor signalling. Nature Reviews Immunology4, 499–511.

Alvarez, B., Revilla, C., Chamorro, S., Lopez-Fraga, M., Alonso, F., Dominguez, J.,Ezquerra, A., 2006. Molecular cloning, characterization and tissue expressionof porcine Toll-like receptor 4. Developmental and Comparative Immunology30, 345–355.

Andersen-Nissen, E., Hawn, T.R., Smith, K.D., Nachman, A., Lampano, A.E., Uematsu,S., Akira, S., Aderem, A., 2007. Cutting edge: Tlr5−/− mice are more susceptible toEscherichia coli urinary tract infection. Journal of Immunology 178, 4717–4720.

Bell, J.K., Mullen, G.E., Leifer, C.A., Mazzoni, A., Davies, D.R., Segal, D.M., 2003.Leucine-rich repeats and pathogen recognition in Toll-like receptors. Trends inImmunology 24, 528–533.

Cheeseman, J.H., Kaiser, M.G., Ciraci, C., Kaiser, P., Lamont, S.J., 2007. Breed effecton early cytokine mRNA expression in spleen and cecum of chickens withand without Salmonella Enteritidis infection. Developmental and ComparativeImmunology 31, 52–60.

Didierlaurent, A., Ferrero, I., Otten, L.A., Dubois, B., Reinhardt, M., Carlsen, H.,Blomhoff, R., Akira, S., Kraehenbuhl, J.P., Sirard, J.C., 2004. Flagellin pro-motes myeloid differentiation factor 88-dependent development of Th2-typeresponse. Journal of Immunology 172, 6922–6930.

Dinarello, C.A., Fantuzzi, G., 2003. Interleukin-18 and host defense against infection.Journal of Infectious Diseases 187 (Suppl. 2), S370–S384.

Eckmann, L., Kagnoff, M.F., 2001. Cytokines in host defense against Salmonella.Microbes and Infection 3, 1191–1200.

Feuillet, V., Medjane, S., Mondor, I., Demaria, O., Pagni, P.P., Galan, J.E., Flavell, R.A.,Alexopoulou, L., 2006. Involvement of Toll-like receptor 5 in the recognitionof flagellated bacteria. Proceedings of the National Academy of Sciences of theUnited States of America 103, 12487–12492.

Gewirtz, A.T., Navas, T.A., Lyons, S., Godowski, P.J., Madara, J.L., 2001. Cutting edge:bacterial flagellin activates basolaterally expressed TLR5 to induce epithelialproinflammatory gene expression. Journal of Immunology 167, 1882–1885.

Gobel, T.W., Schneider, K., Schaerer, B., Mejri, I., Puehler, F., Weigend, S., Staeheli,P., Kaspers, B., 2003. IL-18 stimulates the proliferation and IFN-gamma release

1 mmun

G

H

H

I

I

I

K

K

K

K

K

24 Q. Fang et al. / Molecular I

of CD4+ T cells in the chicken: conservation of a Th1-like system in a nonmam-malian species. Journal of Immunology 171, 1809–1815.

opinath, V.P., Biswas, M., Raj, G.D., Raja, A., Kumanan, A.K., Elankumaran, S., 2011.Molecular cloning and tissue-specific expression of Toll-like receptor 5 genefrom turkeys. Avian Diseases 55, 480–485.

ayashi, F., Smith, K.D., Ozinsky, A., Hawn, T.R., Yi, E.C., Goodlett, D.R., Eng, J.K., Akira,S., Underhill, D.M., Aderem, A., 2001. The innate immune response to bacterialflagellin is mediated by Toll-like receptor 5. Nature 410, 1099–1103.

wang, S.D., Asahi, T., Kondo, H., Hirono, I., Aoki, T., 2010. Molecular cloning andexpression study on Toll-like receptor 5 paralogs in Japanese flounder, Par-alichthys olivaceus. Fish and Shellfish Immunology 29, 630–638.

qbal, M., Philbin, V.J., Smith, A.L., 2005a. Expression patterns of chicken Toll-like receptor mRNA in tissues, immune cell subsets and cell lines. VeterinaryImmunology and Immunopathology 104, 117–127.

qbal, M., Philbin, V.J., Withanage, G.S., Wigley, P., Beal, R.K., Goodchild, M.J.,Barrow, P., McConnell, I., Maskell, D.J., Young, J., Bumstead, N., Boyd, Y.,Smith, A.L., 2005b. Identification and functional characterization of chickenToll-like receptor 5 reveals a fundamental role in the biology of infectionwith Salmonella enterica serovar typhimurium. Infection and Immunity 73,2344–2350.

wasaki, A., Medzhitov, R., 2004. Toll-like receptor control of the adaptive immuneresponses. Nature Immunology 5, 987–995.

aiser, M.G., Cheeseman, J.H., Kaiser, P., Lamont, S.J., 2006. Cytokine expression inchicken peripheral blood mononuclear cells after in vitro exposure to Salmonellaenterica serovar Enteritidis. Poultry Science 85, 1907–1911.

aiser, P., 2010. Advances in avian immunology – prospects for disease control: areview. Avian Pathology 39, 309–324.

aiser, P., Rothwell, L., Galyov, E.E., Barrow, P.A., Burnside, J., Wigley, P., 2000. Differ-ential cytokine expression in avian cells in response to invasion by Salmonellatyphimurium, Salmonella Enteritidis and Salmonella gallinarum. Microbiology146 (Pt 12), 3217–3226.

eestra, A.M., de Zoete, M.R., van Aubel, R.A., van Putten, J.P., 2008. Functional char-acterization of chicken TLR5 reveals species-specific recognition of flagellin.Molecular Immunology 45, 1298–1307.

ogut, M.H., Rothwell, L., Kaiser, P., 2003. Priming by recombinant chickeninterleukin-2 induces selective expression of IL-8 and IL-18 mRNA in chicken

ology 52 (2012) 117– 124

heterophils during receptor-mediated phagocytosis of opsonized and nonop-sonized Salmonella enterica serovar Enteritidis. Molecular Immunology 40,603–610.

Kongchum, P., Hallerman, E.M., Hulata, G., David, L., Palti, Y., 2011. Molecular cloning,characterization and expression analysis of TLR9, MyD88 and TRAF6 genes incommon carp (Cyprinus carpio). Fish and Shellfish Immunology 30, 361–371.

Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25,402–408.

Medzhitov, R., 2001. Toll-like receptors and innate immunity. Nature ReviewsImmunology 1, 135–145.

Muhl, H., Pfeilschifter, J., 2004. Interleukin-18 bioactivity: a novel target forimmunopharmacological anti-inflammatory intervention. European Journal ofPharmacology 500, 63–71.

Pan, Z., Wang, J., Tang, H., Li, L., Lv, J., Han, C., Xia, L., Xu, F., 2011. Effects of linoleateon cell viability and lipid metabolic homeostasis in goose primary hepatocytes.Comparative Biochemistry and Physiology Part A: Molecular and IntegrativePhysiology 159, 113–118.

Pan, Z., Fang, Q., Geng, S., Kang, X., Cong, Q., Jiao, X., 2012. Analysis of immune-related gene expression in chicken peripheral blood mononuclear cells followingSalmonella enterica serovar Enteritidis infection in vitro. Research in VeterinaryScience.

Swaggerty, C.L., Kaiser, P., Rothwell, L., Pevzner, I.Y., Kogut, M.H., 2006. Heterophilcytokine mRNA profiles from genetically distinct lines of chickens with dif-ferential heterophil-mediated innate immune responses. Avian Pathology 35,102–108.

Swaggerty, C.L., Kogut, M.H., Ferro, P.J., Rothwell, L., Pevzner, I.Y., Kaiser, P., 2004.Differential cytokine mRNA expression in heterophils isolated from Salmonella-resistant and -susceptible chickens. Immunology 113, 139–148.

Takeda, K., Kaisho, T., Akira, S., 2003. Toll-like receptors. Annual Review of Immunol-ogy 21, 335–376.

Tsutsui, H., Matsui, K., Okamura, H., Nakanishi, K., 2000. Pathophysiological rolesof interleukin-18 in inflammatory liver diseases. Immunological Reviews 174,192–209.

Werling, D., Jungi, T.W., 2003. Toll-like receptors linking innate and adaptiveimmune response. Veterinary Immunology and Immunopathology 91, 1–12.