[CANCER RESEARCH 53,5244-5250. November 1, 1993]

Molecular Cloning of a Human Monoclonal Antibody Reactive to Ganglioside GM3Antigen on Human Cancers1

Dave S. B. Hoon,2 Yuan Wang, Lan Sze, Hidetoshi Kanda, Takeshi Watanabe, Sherie L. Morrison, Donald L. Morton

and Reiko F. Irie

John Wayne Institute for Cancer Treatment and Research, Santa Monica, California 90404 [D. S. B. H., Y. W., L. S., D. L. M., R. E /./, Department of Molecular Immunology,Medical Institute of Bioregulalion, Kyushu University, Fukuoka 812, Japan ¡H.K.. T. W.¡:and Department of Microbiology and Molecular Genetics, The Molecular BiologyInstílale, University of California, Los Angeles, California 90024 /S. L. M.¡

ABSTRACT

In this study we report the characterization of a human monoclonalantibody (HuMab), L612, that reacts with ganglioside GM3 and has therapeutic application for the treatment of human neoplasms, particularlymelanoma. A permanent IgM-secreting Epstein-Barr virus-transformedB-cell line L612 was established. L612 HuMab bound specifically to neo-

plastic cell lines in culture and in tissue biopsy specimens such as melanoma, colon, breast, and lung cancer. The antibody did not bind to normalcells or biopsy tissue. HuMab L612 showed the highest reactivity to melanoma cells, particularly to those with high concentrations of GM3. Im-munostaining on high-performance thin-layer chromatography plates

demonstrated that L612 HuMab bound to (.\,, purified from melanomacells. Removal of the sialic acid from GM.<abolished antibody binding.HuMab L612 also reacted to (.,,, purified from egg yolk, indicating thatit recognizes an NeuAca2-3 galactose antigen determinant. HuMab L612

heavy and light chains were sequenced and determined to belong to the /.iheavy chain variable subgroup III and K chain variable subgroup IVfamilies, respectively. The studies indicate that the L612 HuMab hassignificant therapeutic potential for a wide variety of human cancers.

INTRODUCTION

In previous studies we and others have observed an aberrant expression of gangliosides (sialic acid-containing glycolipids) on the cellsurface of various human neoplasms (2-6). Several of these gangliosides have been shown to induce antibody responses in humans (7—

10). We have shown that the humoral immune response to specificgangliosides on tumor cells plays an important role in host protectiveimmunity and correlates with prolonged survival (7). There are anumber of murine Mabs3 to carbohydrate determinants on glycolipid

molecules that are associated with human cancer. These antibodieshave provided an important tool in identifying specific immunogeniccarbohydrate determinants and sequences (11-16) and several of these

murine Mabs have been used in clinical trials in the treatment ofcancer (16-18), but only in a very few cases have they produced

significant therapeutic benefit. This benefit was transient because theformation of human antibodies to murine antibodies precludes repeated and prolonged treatment periods. In addition the murine immune system can recognize different antigen determinants from thehuman immune system and often overlooks the polymorphic antigendeterminant(s) on the cell surface of human cancer cells, insteadproducing antibodies that also react with normal human cells.

Received 6/14/93: accepted 8/23/93.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advertisement in accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1This study was supported by USPHS Grant ÇAI2582 and the California Research

Institute Fund (D. S. B. H.).2 To whom requests for reprints should be addressed, at John Wayne Institute for

Cancer Treatment and Research, Division of Molecular and Cellular Immunology, 2200Santa Monica Blvd.. Santa Monica. C'A 90404.

3 Mah, monoclonal antibody; IA, immunoadherence assay; GMi. ganglioside.H'NcuAc-LacCer [Svennerholm classification (1)]; HPTLC, high-performance thin-layer

chromatographv; HuMab. human monoclonal antibody; PCR. polymerase chain reaction;V. variable region of antibody gene; EBV, Epstein-Barr virus; cDNA. complementary

DNA; dNTP. deoxynucleotide triphosphntc.

Considerable effort has been expended to develop HuMabs fortherapeutic purposes and as a tool to identify immunogenic determinants on human tumor cells. Successful production of HuMabs totumor-associated antigens has lagged far behind mouse Mab. Themain problem is the development of long-term stable lines that secrete

antibodies continuously. Our laboratory has succeeded in establishingseveral HuMabs to tumor-associated ganglioside antigens by transforming patients' B-cells with EBV (19). This approach has been

successfully used to establish monoclonal antibodies to tumor-asso

ciated ganglioside antigens GM2 and GD2 (19, 20). We have demonstrated that intralesional injections of these HuMabs can induce melanoma tumor regression (20, 21). HuMabs with specificity to dominanttumor-associated ganglioside antigenic determinants may have better

therapeutic potential than HuMabs with specificity to less dominantantigenic determinants.

One of the antigens that have been biochemically identified asdominating the cell surface of several human tumors, particularlymelanoma, is GM3 (2). GM3 is found on human normal cells but at amuch lower density than human melanoma (2). A murine Mab M2590was reported to react with GM3 antigen on B16 melanoma but not onnormal cells because of the greater density and tertiary structure ofGM3 on the cell surface of melanoma cells (14). We also have produced a murine Mab 202 which recognizes the terminal disaccharide(sialyla2-3Gal) on GM3 and/or GM2; Mab202 reacts to GM3 of human

melanoma and not normal tissue (13). The specificity of this Mab formelanoma cells also may be due to the density of the antigen. HuMabrecognizing carbohydrate epitopes may have a restricted usage of VHor V, regions (22). Establishing and cloning HuMabs specific tocarbohydrate epitopes will allow us to answer this question.

We were interested in developing a therapeutic HuMab to GM3. Inthis study we characterized the binding specificity and variable genesequence of a HuMab L612 that binds strongly to GM3 and reacts withhuman cancers but not normal tissue.

MATERIALS AND METHODS

Establishment of L612 Cell Line. HuMab L612 was established by transformation of a patients' B-cells with EBV as described previously (19). The

B-cclls were from regional lymph nodes of a breast cancer patient who had

undergone elective lymphadenectomy. Briefly, lymphocytes were obtained bypassage of dissected lymph nodes through a steel mesh wire and by separationon Ficoll-Hypaque gradient (Pharmacia, Piscataway, NJ). The T-cells wereremoved by E-rosetting (19). The enriched B-cell fraction was then washed 3times with Hanks' buffered saline solution and incubated with EBV for 20 h in

RPM1 1640 (GIBCO, Grand Island, NY) containing 10% heat-inactivated fetalcalf serum (Gemini Bioproducts, Calabasas, ÇA).B-cells were then cloned by

limiting dilution and assessed for antibody secretion by the IA assay as described previously (23).

In screening for anti-GM1 antibody-producing B-cell clones the M12 mela

noma cell line was used as the target cell in the IA assay. Previously we haddetermined that M12 expresses a high density of GM, on its cell surface (24).Of 43ft B-cell clones that secreted antibodies, those that produced a consistent

amount of antibodies and reacted to M12 in the IA assay were recloned. Cloneswere adapted to grow in serum-free medium containing growth factors(SGF-6S in CEM 2000; Scott Lab, Carson, CA) and subsequently recloned for

5244

on July 21, 2021. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HUMAN MONOCLONAL ANTIBODY TO GANGLIOSIDE GM<

Table 1 HuMab I.(yl2 binding specificity lo neoplasie and normal cells

An IA assay was performed with 0.116 jig HuMab L612/ml to evalúale antibodybinding. The scale used to quantitate binding was 4+ (strongest) to 0 {no binding) asdescribed in "Materials and Methods."

Human celllinesMelanomaLung

adenocarcinomaBreastcarcinomaGastrointestinaladenocarcinomaErythroleukemiaT-cell

leukemiaMyelomaNeuroblastomaEBV

B-lymphoblastsNo.

positive/no.tested12/164/45/72/7(I/II/I11,10/10/11Av.

cellreactivity+

+++++++II+000

high antibody secretion. From these clones we selected one B-cell clone line

(L612) that produced antibodies highly reactive to M12. The doubling time ofthe cell line, which is grown in suspension culture, is about 24 h. The cell linehas now been secreting antibodies for over five years.

HuMab L612 was purified for analysis and therapy as described previously(25). Briefly, the L612 line was grown in serum-free medium. IgM in the

concentrated spent medium was purified by salt and hypotonie precipitationfollowed by Sephacryl S-300 column chromatography (Pharmacia Biotech,

Inc., Alameda, CA). Each fraction was tested for protein concentration byspectrophotometric analysis and anti-GM, antibody tiler by a GM.i-enzyme-

linked immunoabsorbent assay (24). Each fraction containing an equal concentration of protein and human IgM with high anti-melanoma cell activity

was pooled and concentrated to 5 mg/ml. Purified HuMab was filteredthrough a 0.22 (¿mfilter and cryopreserved until needed. Each lot was testedfor the presence of bacteria, Mycopiasma, endotoxins, hepatitis virus, andother viruses.

Antibody Specificity Analysis: Immunoadherent Assay. An IA assaywas performed on cultured cell lines as described previously (23). The IA is avery sensitive method to detect complement binding antibody to tumor cells.Briefly, the assay detects IgM bound to tumor cells by specific rosette formation of human erythrocytes in the presence of complement (23). The adherenceof one or more pre-screened human erythrocytes to the cell surface was graded

using the following scale: >9()% of cells adhered, 4+; 75%, 3+; 50%, 2+;and 0 if no adherence was observed. Immune absorption was performed inseveral experiments prior to the IA assay. The immunoabsorption assay involved incubating HuMab with purified antigen, such as gangliosides or cells,before performing the IA assay (23). This assay allows analysis of antibodyspecificity by antigen-competitive blocking. Melanoma cell lines MIO, M12,

M14, M15, and M24 were established in our laboratory. From several of thepatients both melanoma lines and EBV-transformed B-lymphoblast lines were

established.Antibody Staining of Human Tissues. Tissue sections 4 p.m thick were

cut from human biopsy tissue frozen in tissue-freezing compound. The sectionswere immediately fixed in cold formaldehyde buffer and air-dried. Slides were

incubated with Tris buffer for 5 min and treated with 3% hydrogen peroxide for10 min to quench endogenous peroxidase activity (26). Slides were thenwashed in running water for 5 min and treated with human serum for 20 min.A three-step immunoperoxidase staining technique was used to detect L612

HuMab binding to tissue sections as described previously (26). Briefly, tissuesections were first incubated with L612 HuMab and then incubated with aspecific a-anti-idiotypc mouse Mab to L6I2 (18C10) (24). Biotinylated goatanti-mouse IgG (Vector Laboratories. Burlingame, CA) and peroxidasc-con-

jugated Strcptavidin (Zymed Laboratories, San Francisco, CA) were used asindicator antibodies. Sections were countcrstained with hematoxylin and cov-erslips were applied using glycerol-gelatin. Photographs of slides were taken

using a Nikon light microscope equipped with a Nikon camera (Nikon, Melville, NY).

Ganglioside Analysis. The ganglioside fraction of cultured melanoma cellswas isolated and purified as described previously (2). Purified gangliosideswere applied to HPTLC and identified by resorcinol-HCl method (27). Gan

glioside standards were purified from human and bovine sources.Immunostaining with L612 HuMab against purified gangliosides was per

formed on HPTLC plates (Merck, Darmstadt, Germany). Briefly, after chromatography, gangliosides on HPTLC plates were soaked in 0.01% polyisobu-tylmethacrylate in n-hexane. air-dried, and incubated with 1% gelatin-

phosphate-buffered saline solution at 37°Cfor 1 h. HPTLC plates were thenincubated with L612 HuMab (20 fig/ml) at 37°Cfor 90 min. Plates were then

incubated with horseradish peroxidase-conjugated goat anti-human IgM(Boehringer Mannheim Biochemicals, Indianapolis, IN) at 37°Cfor 30 min

followed by five washings and the addition of substrate solution of 2 mg/mlo-phenylenediamine (Sigma, St. Louis, MO) in 0.1 Mcitrate-phosphate buffer

(pH 5.0) containing 0.006% H2O2. When the color of the bands developed, thereaction was stopped and the plates were washed in phosphate-buffered saline

five times.PCR Cloning of the Variable Regions of L612 HuMab. The guanidium

thiocyanate-cesium chloride procedure was used to prepare total RNA from the

L612 B-lymphoblast line (28). Ten /¿gof RNA were mixed with 60 pmol ofeither ¡iheavy or K light chain 3' primers and heated at 7()°Cfor 10 min. The

mixture was then added to 50 /j.1 reverse transcriptase reaction solution containing 10 fil 5X reverse transcriptase buffer (Promega, Madison, WI). 4 fj.1 10

HIMdNTP mix (200 fjLMdATP, dCTP, dGTP, and dTTP final concentration), and3 ¿¿I(600 units) reverse transcriptase (Promega). The mixture was incubated at37°Cfor 1 h.

The PCR reaction was performed as follows. Ninety-seven fil of PCRmixture were added to 3 /¿Iof RNA-cDNA mixture. The PCR mixture con

tained 10X PCR buffer, 10 mw dNTP mix at 60 ¡J.Mfinal concentration of eachdNTP, 5 units of Taq polymerase (Promega), and 60 /IM appropriate 5' and 3'

heavy and light chain primers. The mixtures were subjected to 35 cycles ofamplification at 91°Cfor 1 min, 52°Cfor 2 min, and 72°Cfor 1.5 min followedby a final incubation at 72°Cfor 10 min in a Perkin Elmer/Cetus thermal

cycler. An aliquot of the PCR product was run on a 2% agarose gel to verifythe correct size band product. The n heavy chain and K light chain primersproduced a 495- and 603-base pair cDNA product, respectively. When the gelshowed a correct size of single product, the remainder of the RNA-cDNA

product was subjected to PCR to obtain more product.The gel products were isolated, pooled, and subjected to phenol-chloroform

extraction and ethanol precipitation. The DNA was then digested with appropriate restriction enzymes, extracted, precipitated, purified with GeneClean(BiolOl; San Diego, CA), and ligated into Bluescript (Stratagene, La Jolla.CA) (29). Ten independent clones of the variable region /j. chain and fourindependent clones of the variable region K chain were isolated and sequenced(29). A JH heavy chain probe was used for screening and verifying the heavychain clones. Sequencing was done by the dideoxynuclcotide method with T7DNA polymerase (Sequenase; United States Biochemicals, Cleveland, OH)according to the manufacturer's protocol. Three heavy /Achain leader primers

were used (30): GGGAATTCATGGACTGGACCTGGAGG(AG)TC(CT)-TCr(GT)C;GGGjMLT£ATGGAG(CT)TTGGGCTGA(CG)CTGG(CG)TTT-(CT)T; and GGGAALTÇATG(AG)A(AC)(AC)(AT)ACT(GT)TG(GT)(AT)-

(CG)C(AT)(CT)(CG)CT(CT)CTG. These contain an £coRI (underlined)restriction site to facilitate cloning. The heavy fj. chain ./ region primer wasCCAAGCTTAGACGAGGGGGAAAAGGGTT. This contains an Hindm site(underlined). Two light «chain leader primers were used (31): GACATC-

GAGCTCACCCAGTCTCCA: and GAAATTGAGCTCACCCAGTCTCCA.These primers contain an Sad site (underlined). The light K chain J regionprimer was GCGCCGTCTAGAACTAACACTCTCCCCTGTTGAAGCTCT-

TTGTGACGGGCAAG. This primer contains an A7>al site (underlined). Initially we used the light K chain leader primers of Larrick t-i a!. (30); however,

we obtained poor PCR-cDNA product yield and switched to another set of

primers (31).Transfection. The pAG4202 mammalian expression vector containing spe

cific promotors engineered for human immunoglobulin expression and a neo-

Table 2 ¿.672binding correlation to melanoma cell ganglioside expressionGangliosides were purified from cell lines as described in "Materials and Methods" and

fun on HPTLC for quantitation (2). Gangliosides were expressed as dry wcight/g of cell.Gangliosides described according to the classification of Svcnnerholm and Friedman ( 1)and 1UPAC-IUBC (47). IA was performed on cell lines with HuMab L612 as described inTable 1. L612 reactivity to cells was measured on a scale of 4+ to 0.

CelllinesM15

M12M14MidM24Gangliosides

(nmol/gcell)GM.I20.6

18.17.37.10.3GM20.5

04.08.28.2GD32.0

2.84.22.60.4ÖD200

2.44.50.7IA

binding(L612

reactivity)0

5245

on July 21, 2021. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HUMAN MONOCLONAL ANTIBODY TO OANOLIOSIDE GM3

GM3-

GDIb-

GTIb-

STD M12Fig. 1. Purified gangliosides from melanoma cell line M12 run on HPTLC. Ganglio

sides were isolated and purified as described in "Materials and Methods" and visualized

with resorcinol-HCl reagent. Ordinate, ganglioside standards (STD).

mycin drug marker (developed by Dr. S. Morrison) was linearized at a uniquePvu\ site. The human IgM constant region gene (a kind gift from Dr. M. J.Shulman) was isolated and inserted into the pAG4202 vector. The pCN4203mammalian expression vector containing the human K constant region genewith a xanthine-guanine phosphoribosyl drug marker (developed by Dr. S.

Morrison) was linearized al a unique Pvwl site. The genomic cloned L612 VLand VH genes were inserted into their respective vectors. Vectors with theirrespective inserts were transfected into Sp2/0-Agl4 nonproducing mouse my

eloma cells as described previously (29). The transfected cell lines wereselected for both drug markers and cloned. Supernatants from the clones werecollected, concentrated, and tested in the IA assay with M12 cells for reactivity.

RESULTS

Characterization of L612 HuMab. The L612 cell line is stable,secreting approximately 20 fig/ml IgM antibody/48 h. This cell linealso expresses cell surface membrane IgM which could be detected byflow cytometric analysis using a ß-anti-idiotype murine Mab (4C10)

specific for L612 (data not shown). The L612 IgM light chain wasdetermined to be K using specific anti-human light chain Mabs (Bec-ton-Dickinson, Mountain View, CA) by flow cytometry and Western

blotting.The binding of HuMab L612 to different tumor cell lines was

assessed (Table 1). The IA assay showed antibody binding on severalneoplastic cell lines of different histogenèses. Although the percentageof melanoma lines showing binding of L612 was lower than that oflung lines, melanoma cell lines demonstrated the strongest reactivity.No binding of HuMab L612 was observed to peripheral blood lymphocytes (T- and B-cells, monocytes, and granulocytes) and erythro-

cytes tested from 32 and 44 individual volunteers tested, respectively.For comparison purposes, HuMab L612 binding to cultured mela

noma cell lines and the level of GM3 expression of the individual lineswere assessed (Table 2). Melanoma lines with a high GM3 content,such as M12 and M15, had strong antibody binding. The cell linesMIO, M14, and M24, which express low levels of GM3, showedpoorer binding of L612. As a control, anti-GM2 HuMab IgM (L55

HuMab) (21) binding was assessed using the same melanoma lines.Cell lines with high GM2 had strong antibody binding, whereas thosewith no GM2, such as M12, had no binding (data not shown). Thissuggested that the IgM HuMabs binding to the melanoma cells wasspecific and not general, nonspecific binding. The ganglioside profilerun on HPTLC of M12 is shown in Fig. 1. Treatment of M12 and M15

Table 3 HuMab L612 binding specificity to gangliosides

Gangliosides described according to the classification of Svennerholm and Friedman(1) and IUPAC-IUBC (47). Specificity binding analysis of HuMab L612 to gangliosides

was assessed by an IA immunoabsorption inhibition assay. L612 HuMab was incubatedwith individual antigens (5 nmol) before being assessed for binding in the IA assay withM12 cells (see "Materials and Methods").

GlycolipidnameNeutral

glycolipidCTH"GlobosideAsialo-GviiGangliosidesGM4GMÕGM.IGM2GM2,

GMUSPGSPGGDJGD2GDI»GDihGUI,IA

adsorptioninhibitionGlycolipid

structureGbOsejCerGbOse4CerGbOse4CerI'NeuAc-GalCerII'NeuAc-LacCerII'NeuGc-LacCerII'NeuAc-GgOseiCerIFNeuAc-GgOse4CerlV'NeuAc-nLcOse4CerIV'NeuGc-nLcOse4CerII^NeuAc^-LacCerIF(NcuAc)2-GgOse.,CerIV'NeuAc,II3NeuAc-GgOse4CerlI3(NeuAc)2-GgOse4CerIV'NeuAc.IPfNeuAcb-GgO^CerAntigenliter0(1(I6464000160(1(1(1(1Q

" CTH, ceramide trihexoside; SPG, sphingosine.

(strongest L612 binding) with Vibrio choleras neuraminidase abolished HuMab L612 binding (IA assay), while treatment with trypsindid not (several experiments; data not shown). These experimentssuggested that the HuMab L612 binding to cell surface was related tosialic acid recognition.

L612 Specificity to Gangliosides. To verify the binding of L612HuMab to purified gangliosides, an IA immune absorption inhibition

GM3

Fig. 2. Immunostaining with HuMab L612 of gangliosides purified from melanomacell lines run on HPTLC; see "Materials and Methods" for procedures. Lane l, M12

melanoma gangliosides treated with Vïhriochoierai" neuraminidase. No staining with

HuMab L612 was observed. Lane 2, total M12 gangliosides run without neuraminidasetreatment. GM.i band stains with L612 HuMab only. Lane 3, lower band of GM.i from M12run only on HPTLC. Lane 4, total M12 gangliosides run. GMj band stained only withHuMab L612.

5246

on July 21, 2021. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Fig. 3. Photomicrograph of HuMah L612staining. Three-step immunoperoxidase stainingof hiopsied tumor tissue. Primary eutaneousmelanoma (A), eolon adcnocarcinoma (/i), andlung adenocarcinoma (C'( were first incubated

with MuMah 1.M2, then with murine anti-idio-

typc <«18Cd antibody, followed by biotinylatedanti-murinc IgG. For controls, tissues werestained as described above without HuMab L612.No staining occurred in controls (data notshown). X250.

5247

on July 21, 2021. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HUMAN MONOCLONAL ANTIBODY TO GANGLIOSIDE GM,

HuMab L612 heavy chain variable region sequence'

-19 -15 -10 -5Met Glu Phe Gly Leu Thr Trp Leu Phe Leu Val Ala Asn Leu LysATG GAG TTT GGG CTG ACC TGG CTT TTT CTT GTG GCT AAT TTA AAA

15 10Gly Val Gin Cys Glu Val Gin Leu Leu Asp Ser Gly Gly Gly LeuGGT GTC GAG TGT GAG GTG GAG CTG TTG GAT TCT GGG GGA GGC TTG

15 20 25Val Gin Pro Gly Gly Cys Leu Arg Leu Ser Cys Ala Ala Ser GlyGTA CAG CCT GGG GGG TGC CTG AGA CTC TCC TGT GCA GCC TCT GGA

30 35 40Phe Thr Phe Ser Ser Cvs Ala Met Ser Trp Val Arg Gin Ala ProTTC ACC TTT AGC AGC TGT GCC ATG AGC TGG GTC CGC CAG GCT CCA

45 50 52 52a 55Gly Lys Gly Leu Glu Trp Val Ser Ala Ile Ser Glv Ser Glv GlyGGG AAG GGG CTG GAG TGG GTC TCA GCT ATT AGT GGT AGT GGT GGT

60 65 70Ser Thr Tvr Tvr Ala Asp Ser Val Lys Glv Arg Phe Thr Ile SerAGC ACÕ TAC TAC GCA GAC TCC GTG AAG GGC CGC TTC ACC ATC TCC

75 80 82 82a 82b 82cArg Asp Lys Ser Lys Asn Thr Leu Tyr Leu Gin Met Asn Ser LeuAGA GAC AAA TCC AAG AAC ACG TTG TAT CTG CAÕ ATG AAC AGC CTG

85 90 95Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Lys Glv Glv AsnAGA GCC GAG GAC ACG GCC GTA TAT TAC TGT GCG AAA GGT GGC AAC

100 A B C 105Asp Ile Leu Thr Glv Tvr Tvr Ala Trp Gly Gin GLy Thr Leu ValGAT ATT TTG ACT GGT TAT TAT GCT TGG GGC CAG GGA ACC CTG GTC

110

Fig. 4. Nuclcotide and deduced amino acid sequence of (he heavy chain of HuMabL612. Underlined amino acids represent the complementary determining regions CDRI.CDR2, and CDR3 (95-102) in order. * The sequence data are under accession no. LI 1699

from GenBank.

test was performed (Table 3). Purified gangliosides (5 nmol) isolatedfrom melanoma cells and other sources were assessed for their abilityto competitively block HuMab L612 binding to M12 in the IA assay.Both GM4 and GM1 showed the strongest blocking. Sphingosineshowed some blocking but was much weaker. None of the neutralglycolipids or other gangliosides blocked L612 HuMab binding.

To confirm that HuMab L612 reacts to ganglioside GM3, we developed HPTLC plates with purified gangliosides from melanoma celllines M12 and M14. Fig. 2 shows a representative immunostainingexperiment indicating the specificity of HuMab L612 binding to GM3.In Lanes 2 and 4, L612 bound only to GM3. In Lane 1, gangliosideswere treated with Vibrio cholerae neuraminidase to remove sialic acid.No antibody binding was observed, indicating that sialic acid on GM1was part of the recognition site of HuMab L612. These studies confirmed the above studies on the ability to abolish L612 binding to cellsby treatment with neuraminidase. GM3 from melanoma cells has twobands which represent different lengths of fatty acid chains (2). TheHuMab L612 bound to the lower band as well as the upper band.

Immunostaining Tissue Sections. A three-step immunoperoxi-

dase staining technique was used to evaluate the specificity of theHuMab L612 to various types of tumor tissue. One of the difficultiesof assessing HuMab staining of tumor tissue sections is that theindicator antibody will also bind to natural antibodies in the tissuesections. We circumvented this problem by using an a-anti-idiotype

murine IgG Mab (18C10) specific to HuMab L612 as an indicatorantibody. Fig. 3, A, B, and C show HuMab L612 immunostaining offrozen sections of an invading cutaneous melanoma, colon adenocar-

cinoma, and lung adenocarcinoma, respectively. HuMab L612strongly stained invading melanoma cells in the skin; however, it didnot stain adjacent tissue cells. Tissue sections of melanoma biopsiesconsistently showed very strong binding with the HuMab. StrongHuMab staining was also demonstrated with colon and lung adeno-

carcinomas. No binding to normal adjacent tissues in the colon or lungwas observed.

Cloning and Sequencing of HuMab L612 Variable Regions.The variable regions of the heavy and light chain genes were clonedand sequenced using PCR. Specific oligonucleotide primers wereconstructed that corresponded to the 5' signal peptide and conserved3' constant region of both chains. PCR was performed on RNA

extracted from L612 cells and the PCR cDNA products were clonedinto Bluescript vector. Multiple clones containing the heavy and lightchain V regions were selected for sequencing. Analysis of the genesequence verified that the PCR cDNA products encoded functionaldomains. All the clones had identical sequences demonstrating noerror in cloning. RNA from different passages of the L612 cell linewas run separately in the PCR, and the PCR products were cloned andsequenced to verify gene sequences.

Analysis of the sequence of the heavy chain indicated that it belonged to the heavy chain subgroup III (Fig. 4) (32). The leadersequence is similar to many of the other antibodies that belong to thisgroup (32). L612 HuMab is unusual in that it has two additionalcysteine residues in the V,, region at position 17 in the frameworksegment of the antibody, FRI, and at position 32 in CDRI; no otherV//III sequences have these additional cysteine residues. CDR3 is 11amino acids (GGNDILTGYYA) long and constitutes a region of considerable variability among the members of this subgroup.

The sequence analysis of the light chain indicated it belonged to Klight chain variable subgroup IV (Fig. 5). The L612 light chain is100% identical to the reported V K IV germline sequence from position 1 (FRI region) to position 95 (CDR3 region) (31), suggesting thatno somatic mutation has occurred. The CDR3 is 9 amino acids(QQYYSTPPT) long and constitutes a region with many similaritiesamong this subgroup. The light chain uses JK\ with a proline residuelocated at the V-J junction.

We also performed genomic DNA sequencing as described previously (33) of the variable antibody region genes of L612 cells. Thegenomic DNA sequence of L612 V light chain and heavy chainshowed that the nucleic acid sequences were identical to the PCRanalysis (data not shown). Analysis of genomic antibody sequences bydigestion with restrictive enzymes and Southern blot analysis with aJu probe indicated the cell line was monoclonal (data not shown).

HuMab L612 light chain variable region sequence*

15 10 15Asp Ile Val Met Thr Gin Ser Pro Asp Ser Leu Ala Val Ser LeuGAC ATC GTG ATG ACC CAG TCT CCA GAC TCC CTG GCT GTG TCT CTG

20 25 27 27a 27b 27cGly Glu Arg Ala Thr ILe Asn Cys Lvs Ser Ser Gin Ser Val LeuGGC GAG AGG GCC ACC ATC AAC TGC AAG TCC AGC CAG AGT GTT TTA

27d 27e 27f 30 35Tyr Ser Ser Asn Asn Lvs Asn Tvr Leu Ala Trp Tyr Gin Gin LysTAC AGC TCC AAC AAT AAG AAC TAC TTA GCT TGG TAC CAG CAG AAA

40 45 50Pro Gly Gin Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr ArgCCA GGA CAG CCT CCT AAG CTG CTC ATT TAC TGG GCA TCT ACC CGG

55 60 65Glu Ser Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly ThrGAA TCC GGG GTC CCT GAC CGA TTC AGT GGC AGC GGG TCT GGG ACA

70 75 80Asp Phe Thr Leu Thr Ile Ser Ser Leu Gin Ala Glu Asp Val AlaGAT TTC ACT CTC ACC ATC AGC AGC CTG CAG GCT GAA GAT GTG GCA

85 90 95Val Tyr Tyr Cys Gin Gin Tvr Tvr Ser Thr Pro Pro Thr Phe GlyGTT TAT TAC TGTCAG CAÕ TAT TAT AGT ACT CCT CCG ACG TTC GGC

100 105Gin GLy Thr Lys Val Glu Ile Lys ArgCAÕ GGG ACC AAG GTG GAA ATC AAA CGA

Fig. 5. Nucleotide and deduced amino acid sequence of the light chain of HuMab L612.Underlined amino acids represent the complementary determining regions CDRI, CDR2.and CDR3 (90-97) in order. * The sequence data are under accession no. LI 1700 from

GenBank.

5248

on July 21, 2021. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HUMAN MONOCLONAL ANTIBODY TO GANGLIOSIDE GMJ

Transfection and Expression of Human-Human Chimeric IgM-

L612. HuMab L612 variable genes were genetically engineered to beexpressed in a myeloma cell line. The objective was to determine thefunctional activity of the cloned variable genes. The isolated L612genomic V, and V,/ genes were cloned into specific expression vectorsand were simultaneously transfected into nonproducing myeloma celllines. Stably transfected cells (IgM-L612) were selected for both drug

markers. Transfectomas producing both chimeric heavy and lightchains were isolated and cultured, and the supernatant was collected.Chimeric antibodies were concentrated and assessed for binding toM12 cells using an IA assay. Two separate selected transfectoma linesof chimeric HuMab bound and reacted strongly to M12. These studiesindicated that the cloned V/, and V, genes were functional.

DISCUSSION

This study characterizes the binding specificity and sequence of aHuMab that binds to GM3 on the cell surface of human neoplasticcells. HuMab L612 binds not only to GM3 but also to GM4. Theremoval of the sialic acid component of GM1 abolished the binding ofL612. The specificity of L612 to the sialic acid on GM3 was verifiedby the lack of blocking of asialo-GM3 in the IA inhibition assay. These

studies suggest that the HuMab L612 detects the terminal sugar of thegangliosides that have a NeuAc a2-3-galactose residue. There is apossibility that L612 may react with other glycoconjugates with N-and O-linked structures. Future studies will examine other potential

glycoconjugates as antigens for L612.Immunostaining of frozen sections with HuMab L612 indicated a

strong specificity for neoplastic tissue, including melanoma, colonadenocarcinomas, and lung adenocarcinomas. Recently, we haveshown that HuMab L612 binds to renal cell carcinomas (35). GM3 isan excellent target antigen on melanoma cells in that it is expressed in>95% of melanoma biopsies and often at high density. There areseveral hypotheses why HuMab L612 recognizes GM3 antigen ontumor cells and not on normal cells. One reason why L612 may bindto neoplastic cells is the high density of GM1 compared to normalcells. Another possible explanation is that the ganglioside is moreassessable on the tumor cell surface (14). Further studies are neededto determine the mechanism of the recognition of cell surface GM, byL612 HuMab. A similar differential binding specificity between melanoma and normal cells has been reported with a murine Mab recognizing GM3 (14, 34).

The expression of GMs on the neoplastic cell surface has beenshown to influence several functional properties including cell adhesion, spreading, and motility (36). These are essential processes duringinvasion and metastasis of tumors (37). It is interesting to note thatsialidase treatment can neutralize the effect of GM1 in these processes(36). The sialic acid in GM1 plays an important role in the functionalactivity of the molecules as well as a role as an antigenic determinant.The HuMab L612 may have potential application in blocking melanoma cell invasion and metastasis.

The development of PCR-based cloning techniques allows one to

rapidly clone and sequence antibody variable regions. The sequencingof the light chain of HuMab L612 showed it to be identical to thegermline VKIV gene and to use 7^1. Except for the proline residue atthe V-J junction, the light chain of HuMab L612 was identical to thelight chain of FK-001; a IgM antibody produced by an EBV transformed B-cell line specific to Pseudomonas (¡eruginosa exotoxin A(40). The heavy chain of the FK-001 belongs to the variable subgroup

(V,/) (31). The Vf, region of L612 had two additional cysteine residues. These two additional cysteine residues have the potential ofproducing disulfide bonds, thus making the IgM molecule more rigid,possibly leading to changes in functional activity (39). Several of the

light chains in the V K IV subgroup are from cold agglutinins withanticarbohydrate specificities (41). It is interesting to note that mostcold agglutinins bind to carbohydrate structures consisting of lactos-

amine disaccharides on RBC (41). GM1 and sphingosine, which L612binds to, are normal components of human erythrocytes; however,L612 does not bind to erythrocytes.

There are only a few HuMabs to tumor-associated antigens (19, 21,42, 43) produced by stable secreting EBV-transformed cloned B-cell

lines that have been reported. Only a subset of these antibodies recognize carbohydrate epitopes. None have been sequenced to assessrestriction of heavy and light chain variable family usage (44). The V,,of L612 HuMab belongs to a large family and shows considerablehomology to the sequences of 18/2, 18/17, 18/9, and 1/17, which areanti-DNA antibodies (45, 46), and the anti-tumor-associated antigenantibody 4G12 (46). Interestingly, the latter represents a Mab (mouse-human hybridoma) to a tumor-associated glycoprotein antigen on

human malignant tumor cells. Thus, the L612 HuMab may belong toa family of autoantibodies. Immune responses to melanoma have beenthought to represent autoimmune responses in the host, and anti-

ganglioside antibody responses in humans are considered as possibleautoimmune responses (42). Preliminary studies have shown the presence of anti-GM1 antibodies in melanoma patients (48). Currently, weare evaluating the presence of anti-GM, immune responses againsthuman melanoma. The presence of IgM anti-GM1 antibodies may be

a natural autoantibody defense mechanism against cells, such as neoplastic cells, that overproduce this antigen.

Cloning and sequencing of these human variable genes will allowus to genetically engineer immunoglobulin class switches (38) and"rescue" antibodies from unstable EBV-transformed B-cell lines, as

well as allow the engineering of recombinant chimeric molecules andproduction of functional recombinant immunoglobulin-like molecules

such as single chain Fv (39). The availability of human antibody genesnow permits us to engineer antibodies to make them better therapeuticagents, stabilize their structure, use site-directed mutagenesis to ex

plore and control specificity, etc. Sequencing of the amino acid structure of HuMabs specific to ganglioside antigens may provide insightsinto the mechanism of interaction between the antibody and the carbohydrate epitope they recognize.

Currently, clinical pilot studies are being planned to test the efficacyof the HuMab L612 to treat patients with malignant melanoma. Preliminary studies on one melanoma patient have shown that intra-

lesional injection of HuMab L612 with control HuMab IgM significantly induced tumor regression.

ACKNOWLEDGMENTS

We wish to thank Dr. A. Walsh for her editorial assistance.

REFERENCES

1. Svennerholm, L., and Friedman. P. A procedure for the quantitation of gangliosides.Biochcm. Biophys. Acta, 6/7: 97-109, 1980.

2. Tsuchida. T., Saxton, R. E-, Morton. D. L.. and Irie, R. F. Gangliosides of humanmelanoma, i. Nati. Cancer Inst., 78: 45-54, 1987.

3. Hakomori, S-I. Aberrant glycosylation in cancer cell membranes as found on glyco-lipids: overview and perspectives. Cancer Res.. 45: 2405-2414, 1985.

4. Spitalnik. S. L.. Spitalnik. P. F. Dubois. C.. Mulshine. I., Magnani. I. L.. Cutitta. F.,Civin, C. I.. Minna. J. D., and Ginsburg. V. Glycolipid antigen expression in humanlung cancer. Cancer Res., 46: 4751-4755. 1986.

5. Frecdman, P. Gangliosides in human malignant gliomas. In: R. W. Lceden, E. L.Hogan, G. Tettamanti. A. i. Yates, and R. K. Yu (eds.). New Trends in GangliosideResearch: Neurochemical and Ncurogenerative Aspects, pp. 151-161. Padua, Italy:Liviana Press, 1988.

6. Schulz. G., Cheresh, D. A., Varki, N. M., Yu, A., Staaffileno, L. K.. and Reisfeld. R.A. Detection of ganglioside G|,: in tumor tissues and sera of neuroblastoma patients.Cancer Res., 44: 5914-5920, 1984.

7. Jones, P. C., Sze, L. L., Liu, P. Y., Morion, D. L., and Irie, R. F. Prolonged survivalfor melanoma patients with elevated IgM antibody to oncofetal antigen. J. Nail.Cancer Inst., 66: 249-254, 1981.

5249

on July 21, 2021. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

HUMAN MONOCLONAL ANTIBODY TO OANOLIOSIDE GMi

8. Tai, T., Cahan, L. D., Tsuehida, T., Irie, R. F., and Morton, D. L. Immunogenicity ofmelanoma-associated ganglioside in cancer patients. Int. J. Cancer, 35: 607-612,1985. 29.

9. Portoukalian, J., Carrel, S., Dore, J. F., and Rumke, P. Humoral immune response indisease free advanced melanoma patients after vaccination with melanoma-associatedgangliosides. EORTC Cooperative Melanoma Group. Int. J. Cancer, 49: 893-899, 30.

1991.10. Livingston, P. O., Ritter, G., Srivastava, P., Padavan, M., Calves, M. J., Oettgen, H.

F., and Old, L. J. Characterization of IgG and IgM antibodies induced in melanomapatients by immunization with purified GM: ganglioside. Cancer Res., 49: 7045- 31.7(150, 1989.

11. Thurin, J. Binding sites of monoclonal anti-carbohydrate antibodies. Curr. Top. Mi-crobiol. Immunol., 139: 59-79, 1988. 32.

12. Tai, T., Sze, L., Kawashima, I., Saxton. R. E.. and Irie, R. F. Monoclonal antibodydetects monosialogangliosides having a sialic acid a2-3-galactosyl residue. J. Biol.Chem., 262: 6803-6807, 1987.

13. Tai, T., Kawashima, I.. Furukawa, K., and Lloyd, K. O. Monoclonal antibody R24 33.distinguishes between different W-acetyl and ¿V-glycolylneuraminic acid derivativesof ganglioside G,,,. Arch. Biochem. Biophys., 260: 51-55, 1988.

14. Ñores, G. A., Dohi, T., Taniguchi. M., and Hakomori, S-I. Density-dependent recog- 34.nition of cell surface GM.I by a certain anti-melanoma antibody, and GM.I lactone asa possible immunogen: requirements for tumor-associated antigen and immunogen. J.Immunol.. 139: 3171-3176, 1987.

15. Natoli, E. J., Livingston, P. O., Pukel, C. S., Lloyd, K. O.. Wiegandt, H., Szalay, J., 35.Oettgen, H. F., and Old, L. J. A murine monoclonal antibody detecting 7V-acetyl- andW-glycoly-GMj: characterization of cell surface reactivity. Cancer Res., 46: 4116-

4120, 1986. 36.16. Cheung, N. K., Burch, L., Kushner, B. H., and Munn. D. H. Monoclonal antibody 3F8

can effect durable remission in neuroblasloma patients refractory to chemotherapy: aphase II clinical trial. Prog. Clin. Biol. Res., .ÃŽ66:395^100, 1991. 37.

17. Bujoin. D. F.. Chapman, P. B., Wong, G., Cort, D. G., Kunicka, J., Dimaggiou, J.,Cordon-Cardo, C., Urmacher, C.. Dantes, L., and Templeton, M. A. Phase I evaluationof a combination of monoclonal antibody R24 and interleukin-2 in patients with 38.metastatic melanoma. Cancer Res., 50: 7950-7955, 1990.

18. Reuland, P.. Handgretinger, R., Smykowski, H., Doper, R., Klingebiel, T., Miller, B. 39.M., Reisfeld, R. A.. Gallagher, S., Koscelinak, E., and Treiner, J. Application of themurine anti-G,)2 antibody 14.GD2 for diagnosis and therapy of neuroblastoma. Int. J. 40.Radial. Appi. Instrum. Part B. 18: 121-125, 1991.

l1). Irie, R. F., Sze, L. L., and Saxton, R. E. Human antibody to OFA-1, a human antigen,produced in vitro by Epstcin-Barr virus-transformed human B-lymphoid cell line. 41.Proc. Nati. Acad. Sci. USA, 79: 5666-5670, 1982.

20. Irie, R. F., and Morton, D. L. Regression of cutaneous metastatic melanoma byintralcsional injection with human monoclonal antibody to ganglioside Gi>2. Proc.Nati. Acad. Sci. USA, 83: 8694-8698, 1986.

21. Irie, R. F., Matsuki, T, and Morton, D. L. Human monoclonal antibody to ganglioside 42.GM2 for melanoma treatment. Lancet, /: 786-787, 1989.

22. Zenila, K., Hirashima, K.. Shigata, K., Hirawa. N., Takada. D.. Hashimoto, K.,Fujumota, E., Yaga, K., and Kannagi, R. Northern hybridization analysis of VH gene 43.expression in murine monoclonal antibodies directed to cancer-associated gangliosideantigen having various sialic acid linkages. J. Immunol., 144: 4442—1451, 1990.

23. Tai, T., Paulson. J. C., Cahan, L. D., and Irie, R. F. Ganglioside GM2 as a human tumorantigen (OFA-I-1). Proc. Nail. Acad. Sci. USA. 80: 5392-5396, 1983. 44.

24. Yamamoto, S., Yamamoto, T, Saxton, R. E., Hoon, D. S. B., and Irie, R. F. Anti-

idiotype monoclonal antibody carrying the internal image of ganglioside GM> i Nati. 45.Cancer Inst., 82: 1757-1760, 1990.

25. Katano, M.. Saxton, R. E., and Irie, R. F. Human monoclonal antibody to tumor-associated ganglioside G,)2. J. Clin. Lab. Immunol., 15: 119-126, 1984. 46.

26. Saito, H., Wen, D-R., Yamamoto, S., Yamamoto, T., Saxton, R. E., Cochran, A. J., andIrie, R. F. Murine monoclonal anti-idiotype antibody (a) as a probe to detect humanmonoclonal antibody bound to human tumor tissues. J. Immunol. Methods, 134:121-128, 1990. 47.

27. Leeden, R. L., and Yu, R. Gangliosides: structure, isolation and analysis. Meth. 48.Enzymology, S3: 139-191, 1982.

28. Chromczynski. P.. and Sacchi. N. Single-step method of RNA isolation by acid

guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem.. 762: 156-159, 1987.Hastings. A., Morrison, S. L., Kanda, S., Saxton, R. E., and Irie, R. F. Production andcharacterization of a murine/human chimeric anti-idiotype antibody that mimicsganglioside. Cancer Res., 52: 1681-1686, 1992.Larrick. J. W., Danielsson, L., Brenner, C. A., Abrahamson, M., Fry, K. E., andBorrcbaeck, A. K. Rapid cloning of rearranged immunoglobulin genes from humanhybridoma cells using mixed primers and the polymerase chain reaction. Biochem.Biophys. Res. Commun., 160: 1250-1256, 1989.

Mats. A.. Persson, A., Caothien, R. H., and Burton, D. R. Generation of diversehigh-affinity human monoclonal antibodies by repertoire cloning. Proc. Nati. Acad.Sci. USA, 88: 2432-2436, 1991.

Kabat, E., Wu, T. T., Perry, H. M., Gottesman, K. S., and Foeller, C. Sequences ofProteins of Immunological Interest. Ed. 5. United States Department of Health andHuman Resources, Washington, DC: United States Government Printing Office,1991.Nishimura, Y, Yokoyama, M.. Araki, K., Ueda, R., Kudo, A., and Watanabe, T.Recombinant human-mouse chimeric monoclonal antibody specific for commonacute lymphocytic leukemia antigen. Cancer Res., 47: 999-l(X)5, 1987.Hirabayashi. Y, Hamoaka, A., Matsumoto. M., Marsubura, T.. Tagawa, M., Waka-bayashi, S., and Taniguchi, M. Syngeneic monoclonal antibody against melanomaantigen with interspecies cross-reactivity recognizes GM1, a prominent ganglioside ofB16 melanoma. J. Biol. Chem., 260: 13328-13333, 1985.Hoon, D. S. B., Okun, E., Banez, M., Irie, R. F., and Morton, D. L. Interleukin-4 aloneand -y-intcrfcron or a-tumor necrosis factor inhibits cell growth and modulates cellsurface antigens on human renal cell carcinomas. Cancer Res., 57: 5687-5693, 1991.Kojima, N., and Hakomori, S-I. Cell adhesion, spreading, and motility of GM.Vexpressing cells based on glycolipid-glycolipid interaction. J. Biol. Chem., 266:17552-17558, 1991.

Fidler. 1. J. The evolution of biological heterogeneity in metastatic neoplasms. In: G.L. Nicolson and L. Milas (eds.), Cancer Invasion and Metastasis: Biologic andTherapeutic Aspects, pp. 5-28. New York: Raven Press, 1984.

Morrison, S. L., and Oi. V. T. Genetically engineered antibody molecules. Adv.Immunol., 44: 65-92, 1989.

Morrison, S. L. In vilro antibodies: strategies for production and application. Annu.Rev. Immunol., 10: 239-265, 1992.

Nakatani, T.. Nomura. N., Horigome. K., Ohtsuka, H., and Noguchi, H. Functionalexpression human monoclonal antibody genes directed against Pseudomonas exo-toxin A in mouse myeloma. Biotechnology, 7: 805-810, 1989.Pascual, V, Victor, K., Lelsz, D., Spellerberg, M. B., Hamblin, T. J., Thompson, K.M., Randen, I., Natvig, J., Capra, J. D., and Stevenson, F. K. Nucleotide sequenceanalysis of the V regions of two IgM cold agglutinins. Evidence that the V//2-27 genesegment is responsible for the major cross-reactive idiotype. J. Immunol.. 746: 4385-

4391, 1991.Lloyd. K. O., and Old, L. J. Human monoclonal antibodies to glycolipids and othercarbohydrate antigens: dissection of the humoral immune response in cancer patients.Cancer Res., 49: 3445-3451, 1989.

Furukawa, K., Yamaguchi, H., Oettgen, H. F., Old, L. J., and Lloyd, K. O. Analysisof the expression of /V-glycolylneuraminic acid-containing gangliosides in cells andtissues using two human monoclonal antibodies. J. Biol. Chem., 263: 18507-18512,1988.Pascual, V, Andris, J., and Capra, J. D. Heavy chain variable region gene utilizationin human antibodies. Int. Rev. Immunol., 5: 231-238, 1990.Dersimonian, H., Schwartz, R. S.. Barrett, K. J., and Sfollar, B. D. Relationship ofhuman variable region heavy chain germ-line genes to genes encoding anti-DNAautoantibodies. J. Immunol., 739: 2496-2501, 1987.

Kishimoto, T.. Okajima, H., Okumoto, T., and Taniguchi, M. Nucleotide sequence ofthe cDNAs encoding the V regions of H- and L-chains of a human monoclonal

antibody with broad reactivity to malignant tumor cells. Nucleic Acids Res., 77:4385,1989.IUPAC-IUB. Commission on Biochemical Nomenclature. Lipids. 72: 455-463, 1977.Ravindranath. M. H.. Guenther, M., Kunnath, S., Nizze, A., Famatiga, E., and Morton,D. L. Anti-ganglioside IgM response to new melanoma cell vaccine (MCV) inmelanoma patients. Proc. Am. Assoc. Cancer Res., 34: 488, 1993.

5250

on July 21, 2021. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

1993;53:5244-5250. Cancer Res   Dave S. B. Hoon, Yuan Wang, Lan Sze, et al.  

Antigen on Human CancersM3Ganglioside GMolecular Cloning of a Human Monoclonal Antibody Reactive to

  Updated version

  http://cancerres.aacrjournals.org/content/53/21/5244

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/53/21/5244To request permission to re-use all or part of this article, use this link

on July 21, 2021. © 1993 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from