Molecular detection techniques for monitoring three key pest species in ballast water samples from a southeastern port of

AustraliaJawahar Patil, Bruce Deagle, Rasanthi Gunasekera, Nic Bax

and Chad Hewitt

Centre for Research on Introduced Marine Pests

Ballast tanks = Mobile Aquaria

- Globally, ships transfer over 12 billion tonnes of ballast water per year-Vessels travelling between ports will potentially transfer organisms to uninfected areas-Pose Environmental, Economical and Human health consequences

The Problem

MOST WANTED

ABWMAC-PEST list-1994

Species Common nameAlexandrium catenella, Toxic Dinoflagellate Alexandrium minutum, Toxic Dinoflagellate Alexandrium tamarense, Toxic Dinoflagellate Gymnodinium catenatum, Toxic Dinoflagellate Asterias amurensis, North Pacific seastarCarcinus maenas, European shore crabCorbula gibba, European shore clamCrassostrea gigas, Pacific oysterMusculista senhousia, Asian mussel Sabella spallanzanii, European fanworm Undaria pinnatifida, Japanese seaweedVibrio cholerae,Mnemiopsis leidyi and Comb jelleyPotamocorbula amurensis Chinese clam

Context

CRIMP developed a Ballast water Decision Support System(BDSS)

Currently considered as a management tool by Australian Quarantine and Inspection Service (AQIS).

However the risk associated with Type II error still remain to be quantified

This project was conceived as part of the Port of Hastings NationalDemonstration Project- targeting 3 species

Context

Current Study

-Need for physical/empirical verification

- Usually done based on morphological features Problems: - time consuming - larvae with many stages difficult - high level of expertise required

- some species ID is impossible

- Can we use genetic markers to quickly ID larval and planktonic organisms?

Polymerase Chain Reaction (PCR)

agaagggttctacgggtagagtattggtagtagtcatcgatgactacgaaaggtcgattgtatttgaacgtagttt

Allows amplification of a small region of DNA

• Specific• Sensitive

PCR ProductctacggPrimer 1

attgtatttPrimer 2

Nested PCR

S1 :accttgacgagaactaatagtgggtaagtagtcagtcacgatcgcctacgactgacgactgactagcacctgcgccatgctaS2 :accttgacaagagctgctagtgggtaagtagtcagtcacgatcgcctacgactgacgactgactacgaatccccgcatgcta

A.a:accttgaccagagctagtagtaggtaagtagtcagtcacgatcgcctacgactgacgactgactaaaacctccggcatgcta

Species specific PCR product gctag aaacct

Variable VariableConservedConserved Conserved

acctt atgcta

Primary enrichment PCR

Secondary specific PCR

Asterias amurensis- Northern Pacific seastar, arrived in Tasmania in the 1980s. ..... it has become very abundant

Current distribution

Asterias specific PCR -mtCOI locus

PCR Performed on Asterias amurensis and native Australian seastar speciesusing CASF1 and CASR1 primers.

• Aa Aa 1 2 3 4 5 6 7 8 9

Internal Control

Asterias specific

Aa: Asterias amurensis1.Coscinasterias muricata2.Uniophora granifera3.Patiriella calcar4.Tosia magnifica5.T. Australis6.Nectria ocellata7.Echinaster arcystasus8.Plectaster decanus9.Petricia vernicina

• Sequences aligned and 8 pairs of primers designed and tested

- Proof is in the soup-What about mixed samples?

- Tested ~100 individual seastars (15 species) and a diverse range of planktonic organisms -SPECIFIC

- Adults and larvae

Simulated ballast water testing

- collected “blank” ballast water samples

- spiked these samples with known # of larvae

1 2 3

4

56

filter plankton “spike” samples extract DNA

PCR amplification separate PCR products results

Results of a ballast water trial

Aa

Aa# A. amurensis larva spiked(Bipinnaria)

200 mg of plankton as background

Non-Australian species of Asterias

-A. rubens-A. forbesi

- Both of these species give positive results with the PCR test

“Genus- specific”

Species discrimination- Gradient gel

1. A. amurensis TTCAAGATGATCAAATTTATAAAGTTATAGTAACTGCTCATGCTCTTGTAATGATATTTTTTATGGTGATGCCTATTATGATAGGA2. A. amurensis ......................................................................................3. A. rubens .......C...................................C..C....................A..................4. A. rubens .......C...................................C..C....................A..................5. A. rubens .......C...................................C..C....................A.................. 6. A. forbesi ...................C..........................C..G.................A..................7. A. forbesi ...................C..........................C..G.................A..................

Ar AfAa

Crassostrea gigas

•Introduced in 1840s for commercial reasons• Has been a major environmental concern. Formed “Feral”populations

C.gigas -mtCOI locus • Sequences from several individuals and closely related specieswere aligned and suitable primers designed and tested

• Sensitivity-Consistently detect-5 advanced larvae(20hr) -10 early larvae (5 hr)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

Primer pair CCSF3 and CCSR3; lane 2, C.gigas; lanes 3-4, Saccostrea glomerata;lanes 5-8, Ostrea angasi; lane 9-10, Mytilus edulis and lanes 11-19 18S rDNA internal control

CCSF3 and CCSR3 18S rDNA primers

• Testing against other species in the genera

Gymnodinium catenatum

•Toxic bloom forming algae known to cause PSP in humans•Thought Non-native to Australia, with Unknown introduction history

G Catenatum- rDNA loci• SSU and LSU-tested 13 sets of primers

2. Alexandrium affine3. A. catenella4. A. margalefi5. A. tamarense; 6-8. G. catenatum9. Heterocaspa niei10. Kryptoperidinium folaceum;11. Scrippsiella sp 12. Wolonszynskia spG microreticulatumG nolleri

• Sensitivity-some physical hurdles and still needs optimization

1 2 3 4 5 6 7 8 9 10 11 12 13

Primer set-CGSLF2 and CGSLR3

Conclusions

•Developed genetic tests which detect Asterias, Crossostrea gigasand Gymnodinium catenatum DNA.

•We have been able to optimize conditions for detection in ballast water samples

• Currently deployed for screening ballast water samples obtained as part of the Port of Hastings demonstration project. Screened Over 200 samples and hope to complete the whole set of over 500 samples

Future work

• Hope to deploy current probes for environmental studies • Develop semi-quantitative high-throughput screening as a tool for self certification of vessels

Liquid-Solid phase Nested PCR

Acknowledgements

Dr Dr. Brad Evans, Dr.Bob Ward Ms Nicole Murphy, Dr. Sue Blackburn, Dr Chris Bolch and Ms Cathy Johnston-Provided one or more samples

Ms Caroline Sutton-reared Asterias larvae

Dr. Sharon Appleyard and Dr. Peter Grewe- ran sequencing gels.

Dr Ximing Guo-Rutgers University-Oyster DNADr. Kimberly Reece-VIMS