Molecular phylogeny and phylogeography of Lupinus (Leguminosae) inferred from nucleotide sequences of the rbcL gene and ITS 1 + 2 regions of rDNA

P1. Syst. Evol. 208:139-167 (1997) --Plant

Systematics and

Evolution © Springer-Verlag 1997 Printed in Austria

Molecular phylogeny and phylogeography of Lupinus (Leguminosae) inferred from nucleotide sequences of the rbcL gene and ITS 1 + 2 regions of rDNA

ERNST KXSS and MICHAEL WINK

Received May 2, 1996; in revised version August 6, 1996

Key words: Leguminosae, Papilionoideae, Genisteae, Lupinus. - Molecular phylogeny, cpDNA, rbcL, rDNA, internal transcribed spacer (ITS).

Abstract: Total DNA was extracted from 55 species of the Leguminosae (including 29 species of Lupinus). The chloroplast gene rbcL and the ITS 1 + 2 regions of nuclear RNA genes were amplified by polymerase chain reaction (PCR) and sequenced directly. The sequences obtained were evaluated with character state (Maximum Parsimony) and distance methods (Neighbour Joining). Phylogenetic trees obtained with both data sets and methods are mostly congruent. Genisteae and Crotalarieae are sister groups and share ancestry with the 7hermopsideae/Podalyrieae. The genus Lupinus, which forms a monophyletic clade within the Genisteae, shows a distinct Old-New World disjunction and appears to be divided into several more or less distinct groups: (1) The species from the eastern part of South America. (2) The homogeneous rough-seeded group (Scabrispermae) of the Old World species which is well distinguished from the smooth-seeded group (Malacospermae). (3) Within the rather heterogeneous smooth-seeded lupins a smaller subgroup with L. angustifolius, L. hispanicus and L. luteus is recognized. (4) Also separated are North American lupins and South American species with a western distribution. Genetic distances imply that the genus Lupinus evolved during the last 12-14 million years, ruling out the hypothesis that the present Old-New World disjunction can be interpreted as a result of the continental drift. The genetic data suggest an origin in the Old World and an independant colonisation of the Eastern parts of South America as opposed to North America and the Western parts of South America.

The genus Lupinus L. represents a fairly large genus within the Leouminosae. Its species are of Old World and New World distribution. The Old World is represented by at least 12 species in the Mediterranean region and Nor th Africa which are all herbaceous annuals with chromosome counts of 2n=32 , 36, 38, 40, 42, 50, 52 (GLADSTONES 1974, CARSTAIRS ~% al. 1992). With regard to their seed coat structure lupins have been divided (PLITMANN ~% HEYN 1984) into smooth-seeded (Sect. Malacospermae: L. albus, L. anoustifolius, L. hispanicus, L. luteus, L. micranthus) and rough-seeded species (Sect. Scabrispermae: L. atlanticus, L. cosentinii, L. dioitatus, L. palaestinus, L. pilosus, L. princei, L. somaliensis). In contrast, the New World species

140 E. KAss & M. WINCe:

comprise annual and perennial, partly shrubby species with few variations in chromosome numbers (2n=48, 36; DUNN 1984). According to different authors 200-600 species have been described for North and South America, with radiation centers in the Rocky Mountains and the Andes. Because of higher morphological variability and interspecific hybridisation species delimitation sometimes appears ambiguous in some New World species.

Due to their agricultural importance, lupins have been of human interest since ancient times and were already mentioned in the very first botanical works: THEOPHRAST (372 288 BC) and following authors (e.g., CATO 234-149 BC; VARRO 116-27 BC; VIRGIL 70-19 BC) described not only the agricultural use but also the medical exploitation of lupins (especially seeds of L. albus) (DIOSCORIDES ~ 70 AC). Until the Middle Ages three species were known L. albus, L. luteus and L. angustifolius; description of L. pilosus and L. micranthus followed later (HANELT 1960, HONDELMANN 1996). At the end of the 17th century North American lupins, such as L. perennis and L. polyphyllus were brought to Europe. In the first edition of the "Species plantarum" LINN~ listed six species: L. perennis, L. albus, L. varius, L. hirsutus, L. angustifolius and L. luteus (PLANCHUELO 1982).

In the 19th century DE CANDOLLE (1825-1827) described 36 species, and AGARDH (1835) 76 species. AGARDH divided the genus into groups, which he named after a "lectotype" (i.e. "albi", "lutei", "angustifoli"). The order within the groups is not in agreement with the present phylogenetic evidence (i.e. "albi" contains L. mutabilis, "angustifoli" L. nanus) (see below). After AGARDH (1835) the only complete description of the genus (including a subdivision) was carried out (based partly on DE CANDOLLE 1825-1827 and WATSON 1873) by TAUBERT (1894). Other authors, e.g., BENTHAN (1865), HUTCHINSON (1964) or POLHILL (1976), did not further subdivide this large genus, although the remaining genera of the Genisteae were minutely splitted. The classification of North and South American lupin species by SMITH ("Species Lupinorum", 1917-1938) has caused some confusion, because he described about 600 species of rather uncertain status (PHILLIPS 1995, PLANCHUELO 1982). Inspite of these shortcomings it has to be conceded that SMITH (1944) and before him WATSON (1873) were the only authors who did attempt a subdivision of the North American species.

Present publications usually deal with part of the genus, either Old World (KAZIMIERSKI • NOWACKI 1961, GLADSTONES 1974, PLITMANN 1981, PLITMANN d~: HEYN 1984, PLITNANN & PAZY 1984) or New World species (PHILLIPS 1955; DtrNN & GILLETT 1966; PLANCHUELO 1982, 1984; PLANCHUELO & DUNN 1984). In addition lupin classifications can be found in local floras (e.g., GAMS 1923--1924, SMITH 1944, BURKART 1952, AMARAL FRANCO & PINTO DA SILVA 1968, RIGGINS 8~; SHOLARS 1993).

The size of the genus Lupinus and the wide geographical distribution of its taxa, but also the relatively uniform morphological features (i.e. mostly digitate leaves with many leaflets; herbaceous, seldom shrubby growth; blue or multicoloured flowers in racemes; distinct root nodules) may have been responsible for its incom- plete taxonomic analysis. Also an integration of the genus Lupinus in the Genisteae (shrubs or subshrubs characterized by simple or digitate leaves with three leaflets; yellow flowers seldom in form of a raceme) remained ambiguous: This has led (a) to the exclusion of the genus Lupinus at least from part of the Genisteae (ROTHMALER 1944), (b) to the creation of a new tribe together with Ar#yrolobium (HUTCHINSON

Molecular phylogeny and phylogeography of Lupinus 141

1964) or (c) to the separation as a monogeneric subtribe (BISBY 1981). Seen from a pragmatic perspective, the morphological homogeneity of the lupins has saved them from being split into several genera (as compared to the taxa of the Cytisus or Genista complex).

Since "classical" morphological and cytological studies (PHILLIPS 1957, SANUDO 1979, GOLDBLATT 1981, DUNN 1984, CARSrAIRS & al. 1992) did not produce a convincing taxonomy of Lupinus, chemotaxonomical markers including low molecular compounds and macromolecules such as proteins have been widely employed. Due to the occurrence of quinolizidine alkaloids, which are most abundant defence compounds in Lupinus and in other Genisteae a large number of phytochemical studies is available (CRANMER & TURNER 1967; FAUGERAS & PARIS 1971; MEARS & MABRY 1971; SALATINO & GOTTLIEB 1980, 1981; GoMEs & al. 1981; KINGHORN ~; SMOLENSKI 1981; WINK & WITTE 1983; KINGHORN d~; BALANDRIN 1984; HOENEISEN & al. 1993; WINK 1993; HEGNAUER 1994; WINK & al. 1995). Besides alkaloids, non-protein amino acids, flavonoids and isoflavonoids have been covered in some detail (HARBORNE 1969, HARBORNE & al. 1971, NICHOLLS & BOHM 1983, WILLrAMS & al. 1983, HEGNAUER 1994). Since most legumes store seed proteins, surveys based on either protein electrophoresis (SALMANOWlCZ & PRZBYLSKA 1994, SALMANOWICZ 1995) or serological methods (CRISTOFOLIN1 & CHIAPELLA 1977, 1984; NOWACKI & JAWORSKI 1978; CRISTOFOLINI 1987, 1989) have been another means to address the phylogenetic relationships between these tribes and within the genus Lupinus.

The application of molecular markers, especially of nucleotide sequences, is a recent development, but due to their high resolution and relevance for systematic surveys they are the methods of choice at present. The advantages of molecular markers, e.g. the possibility to cover large taxonomic units and to overcome convergent traits, have been discussed in the reviews of HILLIS & DIXON (1991), DOYLE & al. (1992), HAMBY & ZIMMER (1992), SOLTIS & al. (1992), CHASE & al. (1993), CLEGG (1993), DOYLE & DOYLE (1993), BAUM (1994), DONOGHUE (1994) and OLMSTEAD & PALMER (1994).

Molecular approaches addressing taxonomic problems of the Leguminosae have included RFLP analyses (BRUNEAU & DOYLE 1993, DELGADO-SALINAS ~; al. 1993, DOYLE ~% DOYLE, 1993, YAMAZAKI 1993, BADR & al. 1994, BRUNEAU • al. 1995) as well as sequence data. Surveys based on sequence data have been carried out with the evolutionary conserved rbcL gene (WINK & al. 1993; DOYLE 1994, 1995; KXSS & WINK 1994, 1995, 1996) or the more variable internally transcribed spacer regions of nuclear ribosomal genes (WoJCIECHOWSKI & al. 1993). Although it was known for a long time that many taxonomic groups of the Leguminosae must be para- or polyphyletic (POLItILL 1981 a), the "true" phylogenetic relationships of the family can now be deduced for the first time with the help of molecular data.

Apart from taxonomic classifications a number of the hypotheses have been published concerning the phylogeography of the genus Lupinus with its distinct Old-New World disjunction:

(1) Lupinus should have evolved as a distinct line directly from Sophoroid ancestors in South America, without a close relationship to the other Genisteae (DUNN 1971), or out of the Crotalarieae with South America as the center of origin (DuNN 1984, GROSS 1984).

142 E. KAss & M. WINK:

(2) Alternatively, Lupinus should have derived from Yhermopsideae (Thermopsis) with a North American origin and Europe/Africa as secondary centers of differentiation. In this case the rough and smooth seeded groups could represent single or separate evolutionary lines (PLITMANN 1981).

(3) It was also postulated that lupins evolved out of primitive Genisteae in the Mediterranean region and migrated to Nor th and South America (CRISTOFOLIN~

CHIAPELLA 1984), or (4) together with the rest of the Genisteae, lupins might have derived from

Thermopsideae in the Sino-Himalayian region (TURNER 1981) and the Mediterra- nean and American regions figure as secondary centers of speciation (CRISTOVOLINI 1989).

(5) It has also been speculated that after an early development of rough and smooth seeded lupins a further distribution to the Old and New World was caused by continental drift (NOWACKI & JAWORSKI 1978).

In the present study we have analysed the nucleotide sequences (both rbcL and ITS-sequences) of 29 lupin species and 26 other taxa of the Papilionoideae to reconstruct the phylogeny of lupins with regard to the evolution of the tribes Genisteae/Thermopsideae/Crotalarieae and the phylogeny and phylogeography of Old and New World lupins.

Materials and methods

Plants and DNA isolation. A list of the taxa studied in this survey is given in Table 1. Live plant material has been obtained from the Botanical Garden Heidelberg and from natural habitats, and seed material from other Botanical Gardens as well as the seed banks of the ,,Bundesforschungsanstalt ftir Landwirtschaft Braunschweig-V~lkenrode" (FAL) and the ,,Institut ftir Pflanzengenetik und Kulturpflanzenforschung Gatersleben" (IPK). Plants were grown from seeds whenever possible. Total DNA was isolated from fresh or dried leaf material using a modified version of the CTAB method (DOYLE & DOYLE 1990).

PCR and DNA-sequencing. Primer pairs used for PCR flank the beginning and the end of the rbcL-gene (rbcL N: 5'ATG TCACCACAAACAGAAACTAAAGC 3', rbcL R:5' TATC- CATTGCTGGGAATTCAAATTTG 3') and the end of the 18 S RNA gene and the beginning of the 26S RNA gene (ITS18: 5'GTCCACTGAACCTTATCATTTAGACC 3', ITS26: 5' GCCGTTACTAAGGGAATCCTTGTTAG 3') respectively. For amplification 1 ~tg of total DNA was used as a target, plus 25 pmol each of primers rbcL-N and rbcL-R (or ITS18 and ITS26), 1.5 mM MgCI2, 0.1 mM of each dNTP, 10 ~tl amplification buffer and 2 units Taq-Polymerase (Promega) in a total volume of 100 ~tl. After an initial denaturation (2 rain at 94°C) 30 cycles of 30 s at 94°C, 30 s at 45°C, and 60 s at 72°C were performed on a Biometra thermocycler. After 30 cycles the reaction temperature was maintained at 72°C for 4 rain and then lowered to 4°C for further storage. Non-incorporated primers and nucleotides were inactivated enzymatically by shrimp alkaline phosphatase and exonuclease I and 5 ~tl of 100 ~1 double-stranded PCR product was used to carry out a sequencing reaction according to the "Sequenase PCR direct sequencing kit" (USB-Amersham). 35S-dATP was used as a radioactive tracer. For the rbcL gene, the following sequencing primers were used to obtain overlapping sequences: Primer NR: 399 bp reverse: 5' ATTCGCAAATCTTCCAGACG 3', primer OF: 174 bp: 5' GCCGAATCTTCTACTGGTAC 3', primer 2F: 426 bp, 5' TGCTTAT- GTTAAAACTTTCC 3', primer 3F: 635 bp: 5' TGCGTTGGAGAGACCGTTTC 3', primer 1R: 1207 bp reverse: 5' GGGTGCCCTAAAGTTCCTCC 3', primer RF: 1105 bp: 5' TAT- TTCACTCAGGATTGGG 3'. Sequencing primers for the ITS regions completely cover


Table 1. Sources of plant material (BG Botanical Garden, FALBundesforschungsanstalt fhr Landwirtschaft Braunschweig-V/Skenrode, IPK Institut fiir Pflanzengenetik und Kultur- pflanzenforschung Gatersleben; I, II refers to individuals when two specimens of a species were sequenced: EMBLEuropean Molecular Biology Laboratory)

Species Origin Voucher and EMBL- accession-numbers (rbcL, ITS1-2)

Anagyris foetida L. AspaIathus cephalotes THUNB. Cercis siliquastrum L. Chamaecytisus supinus (L.) LINK Crotalaria capensis JACQ. Crotalaria pallida AIT. Cytisus scoparius (L.) LINK Genista tinctoria L. Laburnum anagyroides MED. Lupinus aIbescens HOOKER & ARNOTT L. albifrons BENTH. L. albus L. subsp. 9raecus

(BoISS & SPRUNER) FRANCO & P. SILVA

L. albus L. subsp, albus (= L. termis FORSK~L) L. angustifolius L.

L. arboreus SIMS L. arcticus WATS. L. argenteus PURSH L. aschenbornii SCHAUEP, L. atlanticus GLADSTONES L. aureonitens GILLES L. bemhamii A. A. HELLER L. bogotensis BENTH. L. cosentinii Guss.

L. cruckshanskii (HOOK.) SWEET L. densiflorus var. menziesii

(AGARDH) C. P. SMITH L. digitatus FORSKXL L. elegans H. B. K. L. formosus E. GREENE

var. formosus L. hispanicus BoIss. &

REUTER var. hispanicus L. latifolius J. AGARDH

var. latifolius L. luteus L.

I + II: BG Nice, France Cape Province, South Africa BG Heidelberg, Germany BG Heidelberg, Germany Cape Province, South Africa BG Lome, Togo Gellmersbach, Germany BG Heidelberg, Germany I + II: BG Hohenheim, Germany I + II: Sante F6, Argentina BG St Barbara, California I: Saatzucht Hege, Germany

II: Egypt

I: Evora, Portugal II: Saatzucht Hege BG Glasgow, UK BG Kirovsk, Russia BG Denver Chirrippo Massif, Costa Rica FAL 22355, Marokko Midano de Bragado, Argentina IPK 51/91, California BG Bogota, Colombia I: FAL 22324, Algerie II: FAL 22346, Tunesia BG Glasgow, UK IPK 49/91, California

I + II: Wadi Kharit, Egypt BG Mtinchen, Germany BG Rancho Sta. Ana, Claremont, California I: IPK 481/79 II: FAL 48713, Spain BG Rancho Sta. Ana, Claremount, California I: Evora, Portugal II: Lissabon, Portugal

87, Z70122, Z72318-9 380, Z70132, Z72308-9 -, Z70164, Z72350-1 64, Z70082, Z72238-9 366, Z70133, Z72310-1 121, Z70135, Z72312-3 -, Z70086, Z72246-7 69, Z70099, Z72270 1 352, Z70077, Z72226-7 95, Z70074, Z72212-3 97, Z70053, Z72164-5 322, Z70068, Z72198-9

t4, Z70068, Z72200 1

6, 62, Z70064, Z72202-3

3, Z70054, Z72166-7 56, Z70055, Z72156-7 355,-, Z72158-9 331,-, Z72190-1 224, Z70069, Z72216-7 94, Z70075, Z72210-1 252, -, Z72168-9 328, Z70060, Z72192-3 239, 241, Z70070, Z72218-9

37,-, Z72194-5 248, Z70062, Z72186-7

229, 230, Z70071, Z72220 1 31, ,Z72170-1 49,-, Z72172-3

297, 19, Z70065, Z72204-5

8, Z70059, Z72174-5

2, 1, Z70066, Z72206-7

144

Table 1 (continued)

E. KXss & M. WINK:

Species Origin Voucher and EMBL- accession-numbers (rbcL, ITS1-2)

L. micranthus Guss.

L. microcarpus SIMS L. mutabilis SWEET

L. nanus BENTH. var. nanus

L. nootkatensis DONN ex SIMS L. paraguariensis CHODET ~L HASSLER

L. perennis L. L. pilosus MURRAY

L. polycarpus GREENE L. polyphyllus LINDLEY L. princei HARMS L. pubescens BENTH. L. rivularis LINDLEY L. subcarnosus HOOK. L. succulentus KOCH Maackia amurensis RUPRECHT

MAXIM. Podalyria caIyptrata WILLD. Sophora jaubertii SPACH S. secundiflora (ORTE~.) LAG. S. flavescens AIT. Styphnolobium japonicum L. TeIine canariensis (L.) WE•B. & BERTH. Thermopsis fabacea DC. Ulex europaeus L. Virgilia oroboides (P. BEROIUS) T. M. SALTER

I: FAL 22380, Israel II: Spain I + II: Chile I: 'Coyo', Evora, Portugal II: 'Cholita', Evora, Portugal I + II: BG Rancho Sta. Ana, Claremont, California BG Kirovsk, Russia I: Misiones S. Ignacia, Argentina II: Corrienties/Ituzaingo, Argentine BG Heidelberg, Germany I: IPK 68/78 II: FAL 22375, Turkey IPK 54/91, California Traben-Trarbach, Germany I + II: Kenia Chelsea Physics Garden IPK 79/91, California IPK 25/84 BG Glasgow, UK BG G6ttingen, Germany

BG Heidelberg, Germany Alpengarten Wien, Austria I + II: Arizona BG Berlin-Dahlem, Germany I + II: BG Heidelberg, Germany I: Bajamar, Tenerife II: BG Heidelberg, Germany BG Heidelberg, Germany BG Heidelberg, Germany Cape Province, South Africa

262, 21, Z70067, Z72208-9

4, Z70063, Z72188-9 180, 179, Z70061, Z72196-7

43, 44, Z70056, Z72176-7

54, Z70057, Z72160-1 304, 305, Z70076, Z72214 5

6, Z70058, Z72162-3 24, 264, Z70073, Z72222-3

254,-, Z72180-1 p4, Z70052, Z72154-5 232, 233, Z70072, Z72224-5 34,-, Z72178-9 258,-, Z72182-3 39, , 61, , Z72184-5 -, Z70137, Z72336-52

199, Z70127, Z72328 9 103, Z70140, Z72342-3 107, Z70141, Z72346-7 250, Z70139, Z72353 39 288, Z70142, Z72340-1 338, 28, Z70106, Z72282 3

-, Z70121, Z72316-7 -, Z70111, Z72290-5 378, Z70130, Z72334-5

both strands of the ITS regions to overcome problems of secondary structures: $1:61 bp of the 5.8S r-DNA reverse, 5' CGCATTTCGCTACGTTCTTC 3', $2: 101bp of the 5.8S r-DNA forward, 5' TCTTTGAACGCAAGTTGCGC 3', $3:23 bp before ITS1 forward, 5' AACCTGCGGAAGGATCATTG 3' $4: 23bp behind ITS2 reverse, 5' TAG- CCCCGCCTGACCTGAGG 3', $5: 124bp of the 5.8S r-DNA reverse, 5' TTCGGGCGCAACTTGCGTTC 3', $6:19 bp of the 5.8S r-DNA forward, 5' ATATC- TCGGCTCTTGCATCG 3'. Primers S1, $2 and $5, $6 were used alternatively.

Molecular phylogeny and phylogeography of Lupinus

A B

145

[] mean Disl~nce rtx~L

0 max. Distanc~ rl:x:L

30

T t

" i "

o ~ ~ 2

, . i . , . : . l . : , , 4 . ,

, . . . . , . . . , , . . . . . ,

i iilii o

¢/1

2 5 -

2 0 -

15 -

10 -

[]

[]

O

ZX

mean [N~mee IT$1 0

mean Di~an~ ITS2

max. Distance ITS1

max. Distance ITS2 "i'i

i:i: I iiii ,.%

0 0 0 :::: iii?

& & :.:.

I 1 I 1 I ] [ T

Fig. 1. Genetic distance within taxonomic groups of the Papilionoideae. A Distances based on rbcL gene sequences (mean _+ s.d. and maximal distances), B distances based on ITS1 + 2 sequences (mean _+ s.d. and maximal distances) (Cyt-Gr Cytisus-group, Gen-Gr Genista- group, Gen Genisteae, Cro CrotaIarieae, The Thermopsideae, Pod Podalyrieae, Sop Sophoreae)

Products of the sequencing reactions were separated on a 6% polyacrylamide/7 M urea gel by electrophoresis at 65 W. After drying, the gel was exposed to an x-ray film (Hyperfilm-MP, Amersham) for 3-4 days, and developed (X-ray developer and fixer, Kodak). About 350 nucleotides were readable per sequencing run. The complete sequences were aligned to the rbcL gene sequence of Lupinus polyphyllus.

Phylogenetic trees were reconstructed using the Maximum Parsimony method (MP; phylogeny program PAUP 3.1.1; SWOVFORD 1993), and the distance method Neighbour Joining (N J, as implemented in the program package MEGA 1.0, KUMAR & al. 1993). In the Neighbor Joining analyses genetic distances were calculated based on the Tamura-Nei aIgorithm which corrects for any bias in transition/transversions and uneven codon usage. Gaps in the Dataset (ITS) were excluded from the analysis. Bootstrap analyses (FELSENSTEIN 1988) were performed to obtain confidence estimates for each furcation. When using PAUP exact algorithms were employed ("Branch & Bound"; options: addition sequence furthest, compute via stepwise, keep minimal trees only, ACCTRAN, MULPARS).

Additionally, quinolizidine alkaloid patterns of lupins (WINK & al. 1995) were combined in a datamatrix (program Mac Clade; MADDISON & MADDISON 1992). Maximum Parsimony

146 E. K£ss & M. WINK:

Table 2. Pairwise genetic distances between members of the Papilionoideae and Cercis siIiquastrum based on 1368 nucleotides (primers excluded) of the rbcL gene. Above diagonal: relative distances

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20

1 Lupinuspolyphytlus - .001 .001 .001 .001 .006 .006 .004 .005 .005 .005 ,007 .006 .005 .006 .006 .005 .006 .005 .006 2 Lupinus atbifrons 2 - .003 .001 .003 .004 .005 .004 .005 .005 .004 .006 .004 .004 .004 .004 .004 .004 .004 .004 3 Lupinusnanus 2 4 - .002 .003 .007 .008 .006 .006 .006 .006 .008 .007 .006 .007 .007 .006 .007 .006 .007 4 Lupinus latifoIius 1 1 3 - .002 .005 .006 .005 .006 .006 .004 .006 .005 .004 .005 .005 .004 .005 .004 .005 5 Lupinus murabilis 2 4 4 3 - .004 .005 .003 .004 .004 .005 .006 .004 .005 .004 .004 .004 .004 .004 ,004 6 Lupinus densifiorus 8 6 10 7 6 - .001 .004 .005 .005 .004 .004 .004 .004 .004 .004 .003 .003 .002 .003 7 Lupinusmicrocarpus 9 7 11 8 7 1 - .005 .006 .006 .005 .004 .004 .005 .004 .004 .004 .004 .003 .004 8 Lupinus angustifolius 6 6 8 7 4 6 7 .002 ,002 .004 .004 .003 .004 .003 .003 .002 ,003 .002 .003 9 Lupinus hispanicus 7 7 9 8 5 7 8 3 - .000 .006 .005 .004 .004 .004 .004 .003 ,004 .003 .004

10 Lupinusluteus 7 7 9 8 5 7 8 3 0 - .006 .005 .004 .004 .004 .004 .003 ,004 ,003 .004 11 Lupinusmicranthus 7 5 9 6 7 6 7 5 8 8 .005 .004 .003 .004 .004 .003 ,004 .004 .004 12 Lupinusalbus 10 8 12 9 8 5 6 6 7 7 7 - .003 .004 .003 .003 .002 .004 .003 .004 13 LupinusatIanticus 8 6 10 7 6 5 6 4 5 5 5 4 - .001 .000 .000 .001 ,002 .001 .002 14 Lupinuscosentinii 7 5 9 6 7 6 7 5 6 6 4 5 1 -- .001 .001 .001 .003 .002 .003 15 Lupinusdigitatus 8 6 10 7 6 5 6 4 5 5 5 4 0 1 - .000 .001 .002 .001 .002 16 Lupinusprincei 8 6 10 7 6 5 6 4 5 5 5 4 0 1 0 - .001 .002 .001 .002 17 Lupinuspilosus 7 5 9 6 5 4 5 3 4 4 4 3 1 2 1 1 .001 .001 .001 18 Lupinusalbescens 8 6 10 7 6 4 5 4 5 5 6 5 3 4 3 3 2 - .001 .000 19 Lupinus aureonitens 7 5 9 6 5 3 4 3 4 4 5 4 2 3 2 2 1 1 - .001 20 Lupinus paraguariensis 8 6 l0 7 6 4 5 4 5 5 6 5 3 4 3 3 2 0 1 - 21 Laburnumanagyroides 14 14 16 15 12 13 14 10 11 11 13 12 10 11 10 10 9 11 10 11 22 Chamaecytisussupinus 15 15 17 16 15 16 17 13 14 14 16 15 13 14 13 13 12 14 13 14 23 Cytisusnigricans 15 15 17 16 15 16 17 13 14 14 16 15 13 14 13 13 12 14 13 14 24 Cytisusscoparius 14 14 16 15 14 15 16 12 13 13 15 14 12 13 12 12 11 13 12 13 25 Genista tinctoria 23 21 25 22 21 21 22 17 18 18 20 19 19 20 19 19 18 17 18 17 26 "Feline canariensis 13 13 15 14 11 13 14 9 10 10 14 13 11 12 11 l l 10 9 10 9 27 UIex europaeus 18 18 20 19 16 17 18 14 15 15 19 17 16 17 16 16 15 16 15 16 28 Thermopsisfabacea 42 40 44 41 44 43 44 42 42 42 41 42 40 39 40 40 39 41 40 41 29 Anagyrisfoetida 47 45 49 46 49 48 49 47 47 47 46 47 45 44 45 45 44 46 45 46 30 Podalyria calyptrata 40 38 42 39 40 39 40 40 40 40 39 40 38 39 38 38 37 39 38 39 31 VirgiIia oroboides 41 39 43 40 41 40 41 39 39 39 40 39 37 38 37 37 36 38 37 38 32 Aspalathus cephaIotes 47 45 49 46 47 46 47 47 47 47 46 44 45 46 45 45 44 46 45 46 33 Crotalaria capens~s 61 59 63 60 61 58 59 61 61 61 60 56 59 60 59 59 58 60 59 60 34 Crotalaria pallida 57 55 59 56 57 54 55 57 57 57 56 52 55 56 55 55 54 56 55 56 35 Maackia amurensis 49 47 51 48 49 46 47 47 47 47 48 45 45 46 45 45 44 46 45 46 36 Sophoraflavescens 48 46 50 47 48 47 48 46 46 46 47 46 44 45 44 44 43 45 44 45 37 Sophorajaubertii 54 52 56 53 54 53 54 52 52 52 53 52 50 51 50 50 49 51 50 51 38 Sophora secundiflora 57 55 59 56 57 54 54 55 55 55 56 53 53 54 53 53 52 54 53 54 39 Sophorajaponica 51 49 53 50 51 48 49 49 49 49 50 47 47 48 47 47 46 48 47 48 40 Cercis siIiquastrum 67 67 69 66 67 66 67 65 68 68 66 65 65 66 65 65 64 66 65 66

with heuristic methods was employed ("Heuristic Closest"; options: stepwise addition closest; hold-- 1; TBR; collapse and MULPARS in function). No exhaustive search was possible in this case. Since an additional search under "Random addition" did not reveal other topologies, 100 shortest trees were combined in a "50% Majority Rule" cladogram.

Results

Sequence variation, genetic distances and divergence times. All rbcL sequences (n = 46) were of equal length (1420 bp), no deletions, insertions or inversions of nucleotides or sequence elements were observed. For the complete dataset, 170 positions were variable and 109 positions parsimony informative. The lengths of ITS sequences (56 species) are relatively equal within Lupinus, with 235-236 bp in ITS1 and 217 bp in ITS2, while single base insertions or deletions occur in the remaining Genisteae and the other tribes. Cercis (subfam. Caesalpinioideae) was used as an outgroup and shows a sequence length of nearly the same size (ITSI: 229 bp, ITS2: 213 pb). In this dataset, 308 positions were variable and 208 positions parsimony informative. The skewness of 1000 randomly sampled trees generated with P A U P


(1.0 = 100%); below diagonal: absolute distances: numbers of nucleotide substitutions (sequence of Lupinus polyphyllus identical to L. arboreus, L. arcticus, L. nootkatensis, and L. perennis; L. mutabilis identical to L. bogotensis)

21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40

.010 .011 .011 .010 .016 .009 ,013 ,030 .033 .028 .029 .033 .043 .040 .035 .034 .038 .040 .036 .047

.010 .011 .011 .010 .015 .009 .013 .028 .032 .027 .027 .032 .042 .039 .033 .032 .037 .039 ,035 .047

.011 .012 .012 .011 .018 .01i .014 .031 ,035 .030 .030 .035 .044 .042 .036 .035 .039 .042 .037 ,049

.011 .011 .011 .011 .015 .010 .013 .029 .032 .027 .028 .032 .042 .039 .034 .033 .037 .039 .035 .046

.008 .011 .011 .010 .015 .008 .011 .031 .035 .028 .029 .033 .043 .040 .035 ,034- .038 .040 .036 .047

.009 .011 .011 .011 .015 .009 .012 .030 .034 .027 .028 .032 .041 .038 .032 .033 .037 .038 .034 .046

.010 .012 .012 .011 .015 .010 .013 .03l .035 .028 .029 .033 .042 .039 .033 .034 .038 .038 .035 .047

.007 .009 .009 .008 .012 .006 .010 .030 .033 .028 .027 .033 .043 .040 .033 .032 .037 .039 .035 .046

.008 .010 .010 .009 .013 .007 .0 l i .030 .033 .028 .027 .033 ,043 .040 .033 .032 .037 .039 .035 .048

.008 .010 .010 .009 .013 .007 ,011 .030 .033 .028 .027 .033 .043 .040 .033 .032 .037 .039 .035 .048

.009 .011 .011 .011 .014 .010 .013 .029 .032 .027 .028 .032 .042 .039 .034 .033 .037 .039 .035 .046

.008 .011 .011 .010 .013 .009 .012 .030 .033 .028 .027 ,031 .039 .037 .032 .032 .037 .037 .033 .046

.007 .009 .009 .008 .013 .008 .011 .028 .032 .027 .026 .032 .042 .039 .032 .031 .035 .037 .033 .046

.008 .010 .010 .009 .014 .008 .012 ,027 .031 .027 .027 .032 .042 .039 .032 .032 .036 .038 .034 .046

.007 .009 .009 .008 .013 .008 .011 .028 .032 .027 ,026 ,032 .042 .039 .032 .031 .035 .037 .033 .046

.007 .009 .009 .008 .013 .008 .011 .028 .032 .027 .026 .032 .042 .039 .032 .031 .035 .037 .033 .046 • 006 .008 .008 .008 .013 .007 .011 .027 .031 .026 .025 .031 .041 .038 ,031 .030 .035 .037 .032 .045 .008 .010 .010 .009 .012 .006 .011 .029 .032 .027 ,027 .032 .042 .039 .032 .032 .036 .038 .034 .046 .007 .009 .009 .008 .013 .007 .011 .028 .032 .027 .026 .032 .042 .039 .032 .031 .035 .037 .033 .046 .008 .010 .010 .009 .012 .006 ,011 .029 .032 .027 .027 .032 ,042 .039 .032 .032 .036 .038 .034 .046

.004 .004 .003 .009 .002 .006 .026 .029 .025 .025 .030 .040 .037 .029 .028 .032 .035 .030 .044 5 - .000 .001 .011 .004 .008 .025 .028 .025 .024 .031 .039 .037 .029 .027 .032 .033 .030 .043 5 0 - .001 .011 .004 .008 .025 .028 .025 .024 .031 ,039 .037 .029 .027 .032 .033 .030 .043 4 l 1 - .011 .004 .007 .026 .029 .025 .025 .030 .040 .037 .029 .028 .032 .034 .030 .044

13 16 16 15 .007 .009 .029 .032 .029 .030 ,033 .042 .039 .032 .032 .037 ,039 .035 .046 3 6 6 5 10 .005 .027 .030 .026 .025 .031 .04l .038 .030 .029 .033 ,036 .031 .044 8 11 11 10 13 7 -- .029 .032 .028 .029 .033 .042 .039 .031 .03I .035 .037 .032 .044

37 36 36 37 41 38 41 -- .013 .015 .014 .025 .032 .030 .016 .015 .020 .023 .021 .039 41 40 40 41 45 42 45 18 -- .017 .018 .030 .034 .032 .018 .016 .023 .025 .022 .038 36 35 35 36 41 37 40 21 24 - .006 .024 .032 .029 .018 .015 .020 .025 .021 .037 35 34 34 35 42 36 41 20 25 9 .024 .033 .032 .019 .016 .020 .025 .020 .036 43 44 44 43 47 44 47 35 42 34 34 - .018 .018 .029 .028 .030 .033 .032 .046 57 56 56 57 59 58 60 45 48 45 47 26 .004 .032 .035 .042 .037 .036 .052 53 52 52 53 55 54 56 43 46 41 45 26 6 - .030 .034 .039 .035 .035 .051 41 41 41 41 45 42 44 23 26 26 27 41 46 42 - ,016 .024 .021 .020 .037 40 39 39 40 46 41 44 22 23 22 23 40 50 48 23 - .009 .025 .024 .039 46 45 45 46 52 47 50 29 32 29 28 43 59 55 34 13 - .028 .027 .043 50 47 47 48 56 51 53 33 35 35 35 47 53 50 30 35 40 - .014 ,032 43 42 42 43 49 44 46 30 31 30 29 45 51 49 29 34 39 20 -- .026 62 61 61 62 65 63 63 55 54 53 51 66 74 72 53 56 61 46 37

from both datasets indicate the presence of significant phylogenetic signals (HILLIS & HUELS]~NBECK 1992). For many species two unrelated individuals were sequenced (Table 1), but except for the ITS sequences of the two subspecies of L. albus no intraspecific sequence variation was found.

Genetic distances between major taxonomic groups are illustrated in Table 2 (rbcL-dataset) and Table 3 (ITS-dataset). The size (i.e. the number of genera and species) of tribes of the Papilionoideae varies much, due to a more (Podalyrieae and Genisteae) or less (Sophoreae) intense subdivision of the tribes sensu BENTHAM (1865). Since the classification, are often artificial, we must expect that genetic distances between different ranks are not strongly correlated. Although the genus Lupinus contains many taxa, genetic distances between its members are in the range of intrageneric distances (Fig. 1) and reach tribal distances only if compared to those obtained in the small tribe Podalyrieae. Ideally, intrageneric distances should be of equal size; therefore, a separation of Lupinus as a tribe of its own (as suggested by some authors; ROTHMALER 1944, HUTCHINSON 1964) would lead to very uneven classifications compared to the remaining Genisteae. On the other hand, within

148 E. K)~ss & M. WINK:

A . ~ Lupinus polyphyllus ~ Lupinus albus

I ~- Lupinus aureonitens 17 t ~ Chamaecytisus supinus

I~1 J cytisus scoparius t~ l r" i-qburnum anagyroides Genisteae ~ 2~5 Genista tinctoria

Ulex europaeus Teline canariensis

6 Aspalat#us cephalotes 4 16 - - '~ ' 17 ~ Crotalaria capensis ._ j crotalarieae

I ~ Crotalaria pallida 8 Thermopsis fabacea

~-~ i 10 Anagyris foetida ~ Thermopstcieae 9 ~ Podalyria calyptrata

2] ~ oVirgilia oroboides 6 [ 10 r~--~ophora flavescens

1 ~ ' ~ Sophora jaubertii ~ 4 Maackia arnurensis

lo Sophora secundiflora Styphnolobium japonicurn

Cercis siliquastrurn

Podafyrieae

S o p h o r e a e _ _

- - Cercideae ( Caesalpinioideae)

.2 %

Maximum parsimony

,---Lupinus polyphyllus 1 Lupinus albu$ I ~gL Lupinus aureonitens

~ ee 1 ~ Chamaec~'sus supinus J I hCY tisu$ scopatius Genisteae ~F Laburnum anagyroides 4G~ .C- Genista tinctoria -U L._ Ulex europaeus G3L Teline canariensi$

~ Aspalathus cephalotes .---] F-- Crotalarfa capensls | Crotalarieae

:tee !_ Crotalaria pallida Podalyria calyptrata

5i ~ ~ i L--- Virgilia oroboides ~ Thermopsis fabacea Anagyris foetida

• r - Sophora flavescens e ~ Sophorajaubertii

Maackia amurensis - Sophora secundiflora

- Styphnolobiumjaponicum Cercis siliquastrurn

---'] Podalyrieae

---'] Thermopsideae

0' ~,01

Sophoreae

Ce~ideae (Caesa~mio~eae)

Neighbour Joining

Fig. 2. Phylogenetic relationships between tribes of the Papilionoideae based on rbcL (A) and ITS (B) sequences using Cercis siliquastrum (Caesalpinioideae) as an outgroup. A Upper panel: analysis by maximum parsimony, phylogram of the single most parsimonious tree of a branch & bound search (length 251 steps, min/max length 183-540 steps: CI 0.750, HI 0.250, RI 0.829, RC 0.622); branch lengths are proportional to the number of nucleotide substitutions between taxa (indicated above each branch). Lower panel: NJ analysis, numbers at each furcation are bootstrap values (100 replicates) using the TANURA-NEI algorithm; branch lengths are proportional to the distance between taxa. B Upper panel: MP analysis, phylogram of the single most parsimonious tree of a branch & bound search (length 687 steps, min/max length 446-1095 steps; CI 0.649, HI 0.351, RI, 0.629, RC 0.408). Lower panel: NJ analysis: numbers below each furcation are bootstrap values (100 replicates) using the TAMURA-NEI algorithm


B Lupinus polyphyllus 13~--.- Lupinus a/bus 1

~ Lupinus aureonitens 14 ] 61~ Chamaecy~sussupinus

I ~ Cytisus scoparius Genisteae I ~ ~ l~bumum anagyroides

21 J I~ ~ Genista tinctoria - - ULgJ_ 20 [ 1 ~ Teline canariensis I I 1 ~-L!~- Ulex europaeus

sp /athus cepha/otos ----q [ I ~115 ~r~- Crotalaria capensis ] Crotalarieae I I ~ C r o t a l a r i a pallida ] 1 21 2= Podalyria calyptrata

28 / ~ Viroilia oroboides ~ Podalyrieae | ~ Thermopsis fabacea [ .111 J '~ ~.~nagyrisfoetida ~ Thermopsideae

a4 hol [ 31 ~ Sophora flavescens ' - ~ 39 i ,~ Sophora jaubertii

Maackia amurensis 5o Sophora secundiflora

26 Styphnolobium japonicum Cercis siliquastrum

Sophoreae __

I Cercideae ( Caesalpinioideae)

Maximum parsimony

(b

I 91

sgr- Lupinus polyphyllus Lupinus albus

29~ ~ Lupinus aureon!tens II Tefine canafiensls

[ ~ l Ulex europaeus 9s I h Genista tinctoria

I II r - Laburnum anagyroides j s=-~, r--Chamaecytisus supinua I -~3-L_ Cytisus scopafiua I F---- Aspalathus cephalotes s ~ Crotalafia capensis

lee ~_ Crotalafia pal/ida r - Podalyria calyptrata

~ee L_ Vir.gilia oroboides Thermopsis fabacea

~ee [ Anagyfis foetida Maackia amurensis

Sophora flavescens tee [ Sophora jaubertii

Sophora secundiflora Styphnolobium japonicum

Cercis siliquastrum

0 .01

Neighbour Joining

Fig. 2 (continued)

I Genisteae

Crotalarieae

- ' - ] Podalyfieae

"--] Thennopsideae

- ~ Sophoreae __

- - Cercideae ( Caesalpinioideae)

O

Lupinus distance values were observed that come close to the distances of the Cytisus- or Genista-complex (Fig. 1), which, depending on the author, contain up to 20 genera (HOLUBOVA-KLASKOVA 1964, GIBBS 1966, POLHmL 1976, BIS~¥ 1981). If equal standards would be applied, many genera of the Cytisus- and Genista-group would collapse or Lupinus would have to be subdivided.

150 E. K)~ss & M. W~NK:

Table 3. Pairwise genetic distances between members of the Papilionoideae and Cercis siIiquastrum based on ITS 1 + 2 nucleotides sequences. Above diagonal: relative distances (1.0 = 100%); below

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23

1 Lupinus polyphyllus 2 Lupinus albifrons 3 Lupinus arboreus 4 Lupinus benthamii 5 Lupinus eIegans 6 Lupinusformosus 7 Lupinus latifolius 8 Lupinus nanus 9 Lupinus polycarpus

10 Lupinus rivularis 11 LupinussuccuIentus 12 Lupinus densiflorus 13 Lupinus mierocarpus 14 Lupinus bogotensis 15 Lup¢nus mutabilis 16 Lupinus albus I 17 Lupinus albus II 18 Lupinus angustifolius 19 Lupinus hispanicus 20 Lupinus Iuteus 21 Lupinus micramhus 22 Lupinus aureonitens

- .004 .002 .002 .002 .007 .002 .022 .009 .002 .004 .015 ~020 .002 .007 ,015 .017 .020 .020 .028 .031 .033 .035 2 - .002 .007 .007 ,002 .007 .026 .013 .002 .004 .015 ,020 .007 .011 .020 .022 .024 .024 .033 .035 .033 .039 1 1 - .004 .004 .004 .004 .024 .011 .000 .007 .017 ,022 .004 .009 .017 .020 .022 .022 .031 .033 .035 .037 1 3 2 - .004 .009 .004 .024 .011 .004 .007 .017 ,022 .004 .009 .017 .020 .022 .022 .031 .033 .035 .037 1 3 2 2 - 0.09 .004 .024 .011 .004 .007 .017 ,022 .004 .009 .017 .020 .022 .022 .031 .033 .035 .037 3 1 2 4 4 - .009 .028 .011 .004 .007 .017 ,022 .009 .013 .022 ,024 .026 .026 .035 .037 .035 .041 1 3 2 2 2 4 - .020 .011 .004 .007 .017 .022 .004 .009 .017 .020 .022 ,022 .031 .033 .035 .037

10 12 11 11 11 13 9 - .017 .024 .022 .033 ,037 .024 .024 .033 .035 .039 .041 .046 .048 .050 .052 4 6 5 5 5 5 5 8 - .Oll .013 .024 .028 .011 .015 .024 .026 .028 .028 .037 .039 .037 .039 1 1 0 2 2 2 2 11 5 - .007 ,017 .022 .004 .009 .017 .020 .022 .022 .031 .033 ,035 .037 2 2 3 3 3 3 3 10 6 3 - .011 .015 .007 .007 .015 ,017 .024 .024 .028 .031 .033 .039 7 7 8 8 8 8 8 15 11 8 5 .004 .017 .017 .022 .024 .028 .035 .039 .041 .039 .046 9 9 10 10 10 10 10 17 13 i0 7 2 - .022 .022 .026 .028 .033 .035 .039 .046 .044 .050 1 3 2 2 2 4 2 11 5 2 3 8 10 - .004 .017 .020 .022 .022 .031 .033 .035 .037 3 5 4 4 4 6 4 11 7 4 3 8 10 2 - .017 .020 .026 .026 ,031 .033 .039 .041 7 9 8 8 8 10 8 15 11 8 7 10 12 8 8 - .002 .022 .024 ,028 .028 .035 .033 8 10 9 9 9 I1 9 16 12 9 8 11 13 9 9 1 - .024 .026 .031 .031 .037 .035 9 11 10 10 10 12 10 18 13 10 11 13 15 10 12 10 11 - .013 .022 .039 .035 .037 9 11 10 10 10 12 10 19 i3 10 11 16 16 10 12 11 12 6 -- .013 ,037 .039 .039

13 15 14 14 14 16 14 21 17 14 13 18 18 14 14 13 14 10 6 .041 .048 .048 14 16 15 15 15 17 15 22 18 15 14 19 21 15 15 13 14 18 17 19 - .048 .046 15 15 16 16 16 16 16 23 17 16 15 18 20 16 18 16 17 16 18 22 22 .007

23 Lupinus albescens 16 18 17 17 17 19 17 24 18 17 18 21 23 17 19 15 16 17 18 22 21 3 - 24 Lupinusparagual'iensis 22 24 23 23 23 25 23 30 24 23 24 27 29 23 25 21 22 23 24 28 28 13 10 25 Lupinusatlamicus 16 18 17 17 17 19 17 22 20 17 16 19 21 17 17 16 17 17 20 21 24 21 22 26 Lupinus cosentinii 14 16 15 15 15 17 15 20 18 15 14 17 19 15 15 14 15 15 18 19 22 20 21 27 Lupinus digitatus 16 18 17 I7 17 19 17 22 20 17 16 17 19 17 17 16 17 17 20 21 24 22 23 28 Lupinus pilosus 16 18 17 17 17 19 17 22 20 17 16 19 2I 17 17 16 17 17 20 21 24 22 23 29 Lupinusprincei 16 18 17 17 17 19 17 22 20 17 16 17 19 17 17 16 17 17 20 21 24 22 23 30 Laburnum anagyroides 25 27 26 24 26 28 25 33 29 26 27 30 32 26 28 26 27 28 30 30 34 32 33 31 Chamaecytisus supinus 33 35 34 32 34 34 33 41 35 34 35 38 40 34 36 34 35 36 38 40 42 40 41 32 Cytisus nigricans 31 33 32 30 32 34 31 38 35 32 33 36 38 32 32 32 33 34 36 38 37 36 37 33 Cyrisus scoparius 33 35 34 32 34 36 33 38 37 34 33 36 38 34 34 32 33 36 38 38 38 40 41 34 Genista tinctoria 45 45 44 44 46 44 44 49 45 44 47 51 53 46 48 45 46 47 49 50 51 53 52 35 Teline canariensis 38 38 37 39 39 37 37 41 40 37 38 41 43 39 39 37 38 40 43 45 39 43 44 36 Ulex europaeus 38 40 39 37 39 39 37 42 38 39 40 43 45 39 41 39 40 41 43 45 47 43 44 37 AspaIathus cephalotes 46 48 47 45 45 47 46 51 48 47 46 48 50 47 47 45 46 50 52 52 49 51 50 38 Crotalaria capensis 54 56 55 53 55 55 54 63 56 55 56 57 58 55 57 55 56 57 58 61 58 59 60 39 CrotaIaria pallida 53 55 54 52 54 54 53 62 55 54 55 57 59 54 56 54 55 55 58 61 59 60 61 40 Thermopsisfabacea 76 78 77 75 77 77 76 81 77 77 78 81 83 77 79 77 78 79 81 83 82 78 79 41 Anagyrisfoetida 76 78 77 77 77 77 76 81 77 77 78 79 81 77 79 77 78 79 81 82 83 79 80 42 Podalyria calyptrata 65 65 64 66 66 64 65 71 66 64 67 70 70 66 68 66 67 65 66 68 71 72 73 43 Virgilia oroboides 68 68 67 69 69 67 68 74 69 67 70 73 73 69 71 69 70 68 69 71 74 75 76 44 Maaekia amurensis 83 83 82 84 82 82 83 86 82 82 85 90 90 84 86 87 88 88 88 89 91 94 94 45 Sophoraflavescens 93 93 92 94 94 92 93 97 94 92 95 94 96 93 95 92 93 93 96 97 96 96 95 46 SophoJ,ajaponica 97 97 96 98 97 96 97 102 96 96 98 99 101 98 99 95 96 99 100 100 101 102 101 47 Sophorajauberti 89 89 88 90 90 88 89 93 90 88 91 92 94 89 91 91 92 93 94 95 94 92 93 48 Sophorasecundiflora 108 110 109 108 108 109 108 112 109 109 108 104 106 109 109 106 107 110 113 113 111 114 113 49 Cercissiliquastrum 158 I57 158 157 159 156 158 156 156 158 156 159 159 159 159 158 159 161 162 161 163 164 165

In the rbcL trees (Fig. 2A) branch lengths, which are correlated to base substitutions or genetic distances, differ substantially between the Sophoreae/Podalyri- eae/Thermopsideae on one hand and Crotalarieae/Genisteae on the other hand. This phenomenon cannot be explained by the fossil record or morphological data. More likely, a change in mutational rates occurred which was confirmed by a relative rate test (according to SARICH & WILSON 1973). Therefore, it is extremely difficult to estimate reliable evolutionary rates and thus divergence times using the rbcL gene (K~ss 1995, KXss & WINK 1996).

Mutational rates seem to be much more even in the ITS dataset (Fig. 2B; KXss 1995, K)~ss & WINg 1996). The model of KINURa (1980) was used to estimate evolutionary rates. With a proposed divergence time of 60 mio years for Cercis (subfam. Caesalpinioideae) and Sophora (subfam. PapiIionoideae) (i.e. for the separation of both subfamilies; HE~,ENDEEN & al. 1992) evolutionary rates of 3.6 10 .9 (ITS1)/3.3 10- 9 (ITS2) were calculated (equivalent to 0.36-0.33% base substitutions


diagonal: absolute distances: numbers of nucleotide substitutions (sequence of Lupinus polyphyllus identical to L. arcticus, L. argenteus, L. nootkatensis, and L. perennis, L. elegans identical to L. pubescens and L. aschenbornii; L. mutabilis identical to L. cruckshanskii)

24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49

.048 .035 .031 .035 .035 .035 .055 .072 .068 .072 .099 .083 ,083 .101 .1t8 .116 .166 .166 .143 .149 ,182 .204 .213 .196 .237 .355

.052 .039 .035 .039 .039 .039 .059 .076 .072 .076 .099 .083 .087 .105 .123 .120 .170 .170 .143 .i49 .182 .204 .213 .196 .242 .353

.050 .037 .033 .037 .037 .037 .057 .074 .070 .074 .096 .081 .085 .103 .120 ,118 .168 .168 .140 .147 .180 .202 .21i .193 .240 ,355

.050 .037 .033 .037 .037 .037 .052 .070 .066 .070 .096 .086 .081 .098 .116 ,114 .164 .168 .145 .151 .185 ,206 .215 .198 .237 .353

.050 .037 .033 .037 ,037 .037 .057 .074 ,070 .074 ,101 .086 ,085 .098 .120 ,118 .168 .168 .145 .151 .180 .206 .213 .198 .237 .357 • 054 .04t .037 .041 .041 .041 .061 .074 .074 .079 .096 .081 .085 .103 .120 .118 168 168 .140 .147 .180 .202 .21i .193 .240 .351 .050 .037 .033 .037 .037 .037 .055 .072 .068 ,072 .096 .081 .081 .101 .118 .116 .166 .166 .143 .149 .182 .204 .213 .196 .237 .355 .065 .048 .044 .048 .048 .048 .072 .090 .083 .083 .107 .090 .092 .112 .138 .136 .177 .177 .156 .162 .189 .213 .224 .204 .246 .35I .052 .044 .039 .044 .044 .044 .063 .076 .076 .081 .099 .088 ,083 .105 .123 .120 .168 .168 .145 .151 .180 .206 .211 .198 .240 .351 .050 .037 .033 .037 .037 .037 .057 .074 .070 .074 .096 .081 .085 .103 .120 .118 .168 .168 .140 .147 .180 .202 .211 .193 .240 .355 • 052 .035 .031 .035 .035 .035 .059 .076 .072 .072 ,103 .083 .087 .101 .123 .120 .170 .170 .147 .154 .187 .208 .215 .200 .237 .351 .059 .041 .037 .037 .041 .037 .066 .083 .079 .079 .112 .090 .094 .105 .125 .125 .177 .172 .154 ,160 .198 ,206 .218 .202 .229 .357 .063 .046 .041 .041 .046 .041 .070 .087 .083 .083 .116 .094 .098 .109 .127 .129 ,181 .177 .154 .I60 .198 .211 .22 .207 .233 .357 .050 .037 .033 .037 .037 .037 .057 .074 .070 .074 .101 .086 .085 .103 .120 .118 .168 .168 .145 .151 .185 .204 .215 .196 .240 .357 .054 .037 .033 .037 .037 .037 .061 .079 .070 .074 ,105 .086 .090 .103 .125 .123 .172 .173 .149 .156 .189 .208 .218 .200 .240 .357 .046 .035 .03I .035 .035 .035 .057 .074 .070 .070 .099 .081 .085 .098 .120 .118 .168 .168 .145 .151 .191 .202 .209 .200 .233 .355 .048 .037 .033 .037 .037 .037 .059 .076 ,072 .072 .101 .083 .087 .i01 .123 .120 .170 .I71 .147 .154 .193 .204 .211 .202 .235 .357 .050 .037 .033 .037 .037 .037 .061 .079 .074 .079 .103 .088 .090 .109 .125 .120 .172 .I73 .143 .149 .193 .204 .218 .204 .242 .362 .052 .044 .039 .044 .044 .044 .066 .083 .079 .083 .107 .094 .094 .114 .127 .127 .177 .177 .145 .151 .193 .211 .220 .207 .248 .364 .061 .046 .041 .046 .046 .046 .066 .087 .083 .083 .110 .099 .098 .114 ,133 .133 .181 .179 .149 .156 .196 .213 .220 .209 .248 .362 • 061 .052 .048 .052 .052 .052 .074 .092 .081 .083 .112 .086 .103 .107 .127 .129 .179 .182 .156 .162 .200 .211 .222 .207 .244 .366 .028 .046 .044 .048 .048 .048 .070 .087 .079 .087 .116 .094 .094 .112 .129 .131 .170 .173 .158 .164 .207 .21t .224 .202 .251 .369 .022 .048 .046 .050 .050 .050 .072 .090 .08i ,090 .114 .096 .096 .109 .131 .133 .172 .175 .I60 .167 .207 .208 .222 .204 .248 .371

- .065 .063 .068 .068 .068 .090 .107 ,100 .103 .132 .116 .116 .I29 .142 .140 .188 .193 .164 .171 .209 .224 .229 .220 .262 .369 30 - .007 .007 .007 .007 .072 .090 .085 .085 .116 .094 ,105 .112 .131 .129 .I79 .179 .147 .I54 .202 ,217 .229 .21I .248 .355 29 3 .004 .004 .004 .068 .085 .081 .081 .112 .090 ,100 .112 .131 .129 ,179 .179 .147 .154 .202 .217 .224 .211 .244 .357 31 3 2 - .004 .000 .072 ,090 .085 .085 .II6 ,094 .105 .112 .131 .129 .183 .184 .147 .154 .207 .217 .224 .211 .244 .355 31 3 2 2 - .004 .072 .090 ,085 .085 .116 .094 .105 .112 .13I .129 .183 .179 .147 .154 .204 .217 .229 .211 .248 .355 31 3 2 0 2 - .072 .090 ,085 .085 .116 .094 .105 .112 .131 .129 .183 .184 .147 .154 .207 .217 .224 .211 .244 .355 41 33 31 33 33 33 - .031 ,037 .035 .088 .072 .072 ,086 .105 .103 .15l .154 .141 .147 .187 .196 .211 .192 .227 .369 49 41 39 4i 41 41 14 - ,042 .028 .088 .083 .083 .094 .114 .112 .153 .160 .136 .i45 .189 .189 .216 .185 .229 .362 46 39 37 39 39 39 17 19 - .033 .103 .081 .074 .099 .118 .121 .147 .158 .145 .152 .192 .191 ,225 .185 .242 .372 47 39 37 39 39 39 ]6 13 15 - .095 .077 .077 .101 .123 .116 .147 .164 .138 .147 .189 .189 .214 .185 .229 .358 60 53 51 53 53 53 40 40 47 43 - .103 J lO .119 .143 .145 .180 .187 .148 .155 .197 .203 .219 .195 .248 .356 53 43 41 43 43 43 33 38 37 35 47 - .083 .112 ,I28 .130 .176 .181 .152 .157 .199 .214 .217 .204 .230 .372 53 48 46 48 48 48 33 38 34 35 50 38 - .I07 .127 .127 ,166 .178 .156 .163 .207 .207 .214 .205 .249 .378 59 51 51 51 51 51 39 43 45 46 54 51 49 - .081 .074 .155 .167 .134 .141 .185 .193 .216 .187 .222 .360 65 60 60 60 60 60 48 52 54 56 65 58 58 37 -- .033 ,171 .180 .127 .130 .207 ,215 .238 .205 .244 .369 64 59 59 59 59 59 47 51 55 53 66 59 58 34 15 - .166 .175 .127 .i34 .200 .215 .227 ,207 .240 .351 86 82 82 84 84 84 69 70 67 67 82 80 76 71 78 76 .085 .136 .147 .169 ,175 .229 .156 .240 .357 88 82 82 84 82 84 70 73 72 75 85 82 81 76 82 80 39 - .143 .154 .172 .176 .211 .163 .227 .349 75 67 67 67 67 67 64 62 66 63 67 69 71 61 58 58 62 65 - .015 ,159 .181 .214 .163 .227 .341 78 70 70 70 70 70 67 66 69 67 70 71 74 64 59 61 67 70 7 - .170 .192 .222 .174 .233 .352 95 92 92 94 93 94 85 86 87 86 89 90 94 84 94 91 77 78 72 77 .194 .238 ,188 .254 .351

102 99 99 99 99 99 89 86 87 86 92 97 94 88 98 98 80 80 82 87 88 .223 .068 .238 .350 I04 104 102 102 104 102 96 98 102 97 99 98 97 98 108 I03 104 96 97 101 108 101 - .232 .200 .325 100 96 96 96 96 96 87 84 84 84 88 92 93 85 93 94 71 74 74 79 85 31 105 - .223 .362 119 113 111 111 i13 111 103 104 110 104 112 104 113 101 111 109 109 103 i03 106 115 108 91 101 - .372 164 158 159 158 158 I58 164 161 165 159 158 165 168 160 164 156 159 155 151 156 155 155 144 t60 t65 --

per million years), without correction for transition/transversion ratios and 1.2" 10- 9 (ITS1 + 2) per base per year (equivalent to 0.12% base sustitutions per million years) with correction of transition and transversion events. These rates were applied to distances of taxa pairs of the different tribes and groups to estimate approximate divergence times for lupins and other taxa (Table 4).

Phylogenetie position of the genus Lupinus. In a first set of analyses we have determined the phylogenetic position of Lupinus within the Papilionoideae, employ- ing rbcL (Fig. 2A) and ITS data (Fig. 2B). Independent of the methods used for phylogeny reconstructions (i.e. MP or N J) or the genes analyzed, the monophyletic genus Lupinus always clusters with the Genisteae (Fig. 2A, B). Both datasets show that Crotalaria and Aspalathus (as representatives of the tribe Crotalarieae) are a well supported sister tribe to the Genisteae and share ancestry with them. The Genisteae themselves form a natural, monophyletic group. Three clusters seem to have evolved in the Genisteae: the Cytisus complex (Cytisus, Chamaecytisus and

152

A

1

Lupinus polyphyllus

3 I I 2 . Lupinus nanus

i Lupinus mutabilis

1 Lupinus angustifolius

2 Lupinus luteus

3 Lupinus albus

1_ Lupinus cosentinii

-J-~ Lupinus princei

Lupinus pilosus

lr_~ Lupinus albescens 1 I' Lupinus paraguariensis

I Lupinus aureonitens

Laburnum anagyroides

Maximum parsimony

E. KXss & M. WINK:

New World Species (North America and western regions of South America)

1 Old World Species (Mediterranean region and North Africa)

--1 New World Species (Eastern regions of South America)

Lupinus polyphyllus 93 [ ,. ~: . . . . i Lupinus nanus

Lupinus mutabilis

6-~41 Lupinus angustifolius

- - Lupinus luteus 3z/ Lupinus albus 4~ L upinus pilosus

] r - - - Lupinus cosentinii ---4 o~ L Lupinus princei

5z I ~ Lupinus albescens ' Lupinus paraguariensis

65 J Lupinus aureonitens


Old World Species (Mediterranean region and North Africa)

•-• New World Species (Eastern regions of South America)


8 .00t

Neighbour Joining

Fig. 3. Phylogeographic relationships between Old and New World lupins using Laburnum anagyroides as a outgroup and rbcL (A) or ITS (B) sequences. A Upper panel: MP analysis, phylogram of the single most parsimonius tree of a branch & bound search (length 27 steps, min/max length 26-48 steps; CI 0.963, HI 0.037, RI 0.955, RC 0.919). Lower panel: N J-bootstrap analysis using the TANURA-NEI algorithm. B Upper panel: MP analysis, phylogram of the single most parsimonious tree of a branch & bound search (length 81 steps, min/max length 72-133 steps; CI 0.889, HI 0.111, RI 0.852, RC 0.758). Lower panel: N J-bootstrap analysis using the TAMURA-NEI algorithm

allies), the Genista complex (Genista, Ulex, Teline and allies) and the genus Lupinus which was always distinct, albeit a sister group to the Cytisus-Genista complex.

Whereas the Podalyrieae/ Thermopsideae/ Sophora flavescens/ Sophora jaubertii appear in a monophyletic clade in the rbcL dataset (Fig. 2A) which shares ancestry with the Genisteae and Crotalarieae, they are divided into separate units in the ITS


B Lupinus polyphyllus I 3 I _ £ Lupinusnanus

[ 2 Lupinus mutabilis j~ ~ 3 _ Lupinus albus

t 3~____{ 3 Lupinusangustifolius Lupinus luteus

9 j Lupinus cosentinii l ~ Lupinus pilosus

I1 Lupinus princei - Lupinus aureonitens

9 LA~ Lupinus albescens I lo

1 Lupinus paraguariensis - ~ Laburnum anagyroides

Maximum parsimony



New World Species (Eastern regions of South America)

z:

8B_5 ~ Lupinus polyphyllus ] Lupinus nanus

- - Lupinus mutabilis - - Lupinus albus - ~

Lupinus angustifolius Lupinus luteus [ Lupinus cosentinii i o6 I F - Lupinus pilosus ~-a8 tL_ Lupinus princei --5~'_upinus aureonitens _ ~

1 ee Lupinus albescens Lupinus paraguariensis Laburnum anagyroides

8 ~ '.81 Neighbour Joining

Fig. 3 (continued)



New World Species (Eastern regions of South America)

data set (which is based on more informative positions; Fig. 2B). The monotypic genus Maackia which clearly belongs to this cluster, assumes various positions which cannot be resolved with certainty (see low bootstrap values), ldrgilia, included either in the PodaIyrieae (POLHILL 1981C) or in the Sophoreae (HUTCHINSON 1964) definitely belongs to the Podalyrieae. Sophorajaponica has recently been reclassified as Styphnolobium japonicum (L.) SCHOTT (PALOMINO • al. 1993, SOVSA & RUDD 1993), on the basis of habit, stipels, bracteoles, legume and chromosome numbers which would agree with its isolated position in the molecular trees and being separated from the other Sophoreae at the base of the Papilionoideae.

154 E. K)~ss & M. WINK:

A

2 I m

Maximum parsimony

Lupinus angustifolius ] - - Lupinus hispanicus

Malaco- Lupinus luteus spermae

- - Lupinus micranthus

- - Lupinus albus

Lupinus atlanticus l Lupinus cosentinii

- - Lupinus digitatus Scabri- spermae - - Lupinus pdncei

- - Lupinus pilosus Laburnum anagyroides

•L Lupinus angustifolius

Lupinus hispanicus Malaco-

93 Lupinus luteus spermae

Lupinus micranthus

42~_~ Lupinus cosentinii

I J I Lupinus digitatus Scabri- [ ~ Lupinus princei spermae

58 ] L Lupinus atlanticus

I~__I Lupinus albus _ _ Malaco- spermae

_ _ Scabri- 291 Lupinus pilosus spermae


r - - 1 0 ,801

Neighbour-Joining

Fig. 4. Phylogenetic relationships between Old World lupins based on rbcL (A) or ITS (B) sequence data. A Upper panel MP analysis; strict consensus cladogram of the 5 most parsimonious trees of a branch & bound search (length 22 steps, min/max length 20-32 steps; CI 0.909, HI 0.091, RI 0.833, RC 0.758). Lower panel: NJ-bootstrap analysis using the TAMURA-NEI algorithm. B Upper panel: MP analysis; strict consensus cladogram of the 3 most parsimonious trees of a branch search (length 70 steps, min/max length 64/214 steps; CI 0.914, HI 0.086, RI 0.960, RC 0.878). Lower panel: NJ-bootstrap analysis using the TAMURA-NEI algorithm

Relationships within the genus Lupinus. Phylogenetic relationships in the genus Lupinus (Figs. 3-5) were constructed using Laburnum anagyroicles as an outgroup. Laburnum, belonging to the Genisteae, was chosen because both its rbcL and ITS sequences show very few autapomorphies thus minimizing homoplasy. Since the complete data set oflupins is very complex, subsets were chosen which are illustrated and compared in the following. The first trees provide an overview over the


B

23

2

3 [ - - 2

, 1 [__ 1

- - Lupinus a/bus I ]

1 Lupinus atbus II

Lupinus micranthus Malaco-

! Lupinus angustifolius spermae

1 Lupinus hispanicus

5. Lupinus luteus

Lupinus atlanticus

- - Lupinus digitatus ScabrF

Lupinus princei spermae

Lupinus pflosus

Lupinus cosentinii


Maximum parsimony

5~

97 ~_u~in,s M/bus I Lupinus a/bus 11

Lupinus micranthus Malaco- Lupinus angustifolius spermae

Lupinus hispanicus Lupinus luteus U kupinus atlanticus

7-61611 Lupinus dlgitatus l ~[ Lupinus princei Scabri-

tog spermae

lL27o2'22 Laburnum anagyroides

- - q

,91

Neighbour-Joining

Fig. 4 (continued)

geographical groups, i.e. Old and New World lupins (Fig 2A, B), whereas the other trees analyse the phylogeny of different subgroups in more detail (Figs. 4, 5).

Disjunction of Old and New World lupins. Although only few informative (11)/ variable (23) positions are available for analysis in the rbcL dataset (Fig. 3A), tree topology in the ITS tree (based on 32 informative/70 variable positions; Fig. 3B) is almost congruent. Whereas South and North American lupins occur in clearly separated clades, Old World lupins show phylogenetic relationships with either group of New World lupins (Fig. 3A, B); three major evolutionary lines become visible:

(1) The South American species of the "Atlantic region", i.e. eastern South America (PLANCHUELO 1984).

(2) The rough-seeded Old World lupins (L. cosentinii, L. princei, L. pilosus) probably sharing common ancestory with the South American lupins of the Atlantic region.

156 E. KXss & M. WINI{:

A Lupinus polyphyllus 1 Lupinus albifrons

-J -~ Lupinus latifolius

2 Lupinus arboreus Lupinus arcticus

bogotens 2is Lupinus nanus 2 Lupinus nootkatensis

Lupinus perennis

Lupinus

Lupinus mutab lis Lupinus densiflorus 4 1

] ~ Lupinus microcarpus Laburnum anagyroides

Maximum parsimony

B

24

2

1

1 [ _ _ 3

1 7 3

1

1

3 l

Maximum parsimony

Lupinus polyphyllus Lupinus arcticus Lupinus argenteus Lupinus nootkatensis Lupinus perennis Lupinus albifrons Lupinus arboreus

- - Lupinus elegans Lupinus pubescens Lupinus aschenbomfi Lupinus formosus Lupinus latifolius Lupinus nanus Lupinus polycarpus Lupinus rivulafis Lupinus succulentus Lupinus densiflorus Lupinus microcarpus Lupinus bogotensis Lupinus cruckshanskfi Lupinus mutabifis Lupinus benthamii Laburnum anagyroides

?

99

t Lupinus polxohyllus L upin us arcticus

57 Lupinus nanus Lupinus perennis

6o Lupinus nootkatensis Lupinus arboreus

Lupinus albifrons Lupinus latifolius

Lupinus bogotensis Lupinus mutabilis

Lupinus densiflorus Lupinus microcarpus


Lupinus polyphyllus Lupinus argenteus

I Lupinus nootkatensis t Lupinus perennis I Lupinus arcticus I I Lupinus aschenbornii

Lupinus elegans I l Lupinus pubescens

4~ Lupinus albifrons 21 . ~-- Lupinus formosus =~ Lupinus arboreus ~ Lupinus rivularis

s_~T Lupinus succulentus Lupinus densiflorus

L Lupinus microcarpus _~BLupinus bogotensis

Lupinus cru_ckshanskii Lupinus mutabilis

- Lupinus latifolius Lupinus nanus

7~ L~ Lupinus potycarpus Lupinus benthamii

Laburnum anagyroides r - - - - , @ 1.881 e' . ~

Neighbour-Joining Neighbour-Joining

Fig. 5. Phylogenetic relationships between New World lupins (North, Central and South America (Andean region) based on rbcL (A) and ITS (B) sequence data. A Upper panel: MP analysis, phylogram of the single most parsimonious trees of a branch & bound search (length 23 steps, min/max length 21-53 steps; CI 0.913, HI 0.087, RI 0.938, RC 0.856). Lower panel: N J-bootstrap analysis using the TAMURA-NEI algorithm. B Upper panel: MP analysis; strict consensus cladogram of the 25 most parsimonious trees of a branch & bound search (length 53 steps, min/max length 47-95 steps; CI 0.887, HI 0.113, RI 0.875, RC 0.776). Lower panel: N J-bootstrap analysis using the TAMURA-NEI algorithm

(3) The third line in all trees contain L. angustifolius and L. luteus from the Old World, North American species (L. polyphyllus, L. nanus) and South American species (L. mutabilis) of western distribution (i.e. the "Andean region"; PLANCHt~LO 1984).

A major difference was encountered for the position of the smooth-seeded L. albus: In the rbcL trees (Fig. 3A) L. albus stands apart from the other Malaco-


spermae (L. angustifolius and L. luteus) albeit the number of base substitutions show its distinctness from the Scabrispermae. In the more informative ITS trees (Fig. 3B) L. albus clearly clusters with the Malacospermae but again it is well separated.

Relationships within Old World lupins. In the following analyses, we have tried to reconstruct the phylogeny of lupins within geographic groups. The phylogenetic trees based on rbcL and ITS data covering the Old World Lupinus species (Fig. 4A, B) support the taxonomic separation oflupins in rough- and smooth-seeded species. Whereas the rough-seeded lupins appear to be closely related, the smooth-seeded taxa form a rather heterogeneous assemblage. Three lines are apparent:

(1) The Scabrispermae (L. cosentinii, L. digitatus, L. princei, L. atlanticus, L. piIosus), which do not show much variability, are supported as a distinct group by both base substitutions and bootstrap values in the ITS data set (Fig. 4B).

(2) The smooth-seeded group of L. angustiJblius, L. hispanicus and L. luteus. (3) The smooth-seeded L. albus and L. micranthus which share morphological

and chemical traits (e.g., patterns of quinolizidine alkaloids; WINK & al. 1995), are clustered in a common clade in ITS trees (Fig. 4B), whereas in rbcL-trees (Fig. 4A) they are separated and even positioned in the rough-seeded lupin clade. This discrepancy can be explained by the fact that only few characters are left in the rbcL data set (14 informative/20 variable positions) as compared to the higher number of informative (32)/variable (70) characters in the ITS dataset. In consequence, we assume that the ITS-data set is more reliable. The difference between L. albus I and II in the ITS data set correlates with the distinction of two subspecies L. albus subsp. albus and L. albus subsp, graecus.

Relationships in New World lupins. In contrast to the twelve Mediterra- nean/African Lupinus species some hundred American species, often of doubtful taxonomic relevance, have been described. In the rbcL trees of North American and South American lupins of western distribution (L. mutabilis, L. bogotensis, L. microcarpus) again only few characters are available for an analysis (8 informative/ 20 variable characters; Fig. 5A). Nevertheless a few clades become apparent; e.g., L. microcarpus/L, densiflorus (equivalent to the "microcarpi"-group of SMITH (1944) or "platycarpos"-group of WATSON 1873, which also share a particular alkaloid pattern in that both taxa accumulate alpha-pyridone alkaloids; WINK & al. 1995), the South American L. mutabilis and L. bogotensis and the L. perennis/L, nootkatensis/ L. arboreus/L, polyphyllus complex of perennial lupins with related alkaloid profiles.

A better differentiation of these taxa is achieved in the ITS data set (consisting of 24 informative/51 variable characters); still many of the furcations are supported by single base substitution only (Fig. 5B): Again L. microcarpus/L, densiflorus (plus L. succulentus), furthermore the South American L. mutabilis/L, cruckshanskii/L. bogotensis and the annual species L. nanus/L, polycarpus (equivalent to the "micranthi"-group of SMITH 1944) form reproducible and morphologically supported subgroups. Three other clades (which are less well supported) include (a) mainly shrubby species (L. albifrons, L. arboreus, L. rivularis) or (b) species of Central or northern South American origin (L. aschenbornii, L. elegans, L. pubescens) and (c) the perennial L. polyphyllus, L. arcticus, L. perennis and L. nootkatensis which did not show any interspecific variability (Fig. 5A, B). As mentioned above, the South

158 E. KASS & M. WINK:

American lupins of easterly distribution (i.e.L. aureonitens, L. albescens and L. paraguariensis) represent a distinct evolutionary line and are not closely connected to the other New World lupins (Fig. 3).

Discussion

In general, trees based on rbcL and ITS sequence data and studied by both NJ and MP (Figs. 2-5) show a high degree of congruence, indicating that the conclusions drawn from clades which are identical in all reconstructions are well supported. Differences between data sets can be due to homoplasies but also to reticulate evolution inside a genus caused by past hybridizations. Since bootstrap values supporting divergent branches in rbcL as compared to ITS trees were usually small, we omitted a detailed discussion in most instances.

Evolution from Sophora to Lupinus. Part of the Sophoreae appear at the base of the Papilionoideae and some of the basal taxa already show very elaborate papilionoid features (e.g., Styphnolobium japonicum). Molecular data imply that the Sophoreae and also the genus Sophora do not represent natural groups, but an artificial assemblage. This was also revealed in an analysis based on rbcL data covering a wider range of taxa of the Papilionoideae (KXss & WINK 1995, 1996). The next cluster branching off the evolutionary line leading to lupins contains members of Sophoreae, Podalyrieae and Thermopsideae. The genetic data do not confirm that Thermopsis or other "woody temperate Thermopsideae, (PLITMANN 1981) were direct ancestors of the Genisteae though they obviously share ancestry. Sero-systematic surveys came to a similar conclusion for the relationships between the Sophoreae/Thermopsideae/Genisteae (CmSTOVOLIM & CHIAPELLA 1984; CRISTOFOLINI 1987), although the stringency and resolution of the sequence data was not achieved.

Genisteae and Crotalarieae, which figure as sister groups, are the most advanced groups and a direct evolution from sophoroid ancestors can be excluded. Although Genisteae and Crotalarieae derived from the same ancestral line, the number of nucleotide substitutions imply that it is unlikely that CrotaIaria is ancestral to Lupinus as suggested by DtrNN (1984). POLHILL (1981a) assumed that the morphological resemblence of genera of these tribes was due to convergence and considered Thermopsideae/Genisteae and Podalyrieae/Liparieae/Crotalarieae as distinct independent evolutionary lines, a view that is not supported by the present molecular data.

The taxonomic rank of Lupinus and the Genisteae seems to be best described by BISBY (1981; based on the tribal definition of POLHILL 1976), who assigned subtribus rank to Lupinus and grouped the rest of the Genisteae without a further tribal subdivision. Both our data sets lead to the conclusion that Genisteae are a natural monophyletic group that includes Lupinus. A contradictory conclusion was recently drawn from RFLP data of cpDNA (BADR & al. 1994), which might be due to an uneven taxon sampling. Better correlated again are serological studies that suggested a monophyletic origin of Lupinus and a close relationship with Genisteae (CRISTOFOLINI 1989).

Evolution and phylogeography of the Lupinus complex. The marked differences between rough- and smooth-seeded lupins, which are evident from molecular data,


can be found in serological (CRISTOFOLINI 1989), protein (SALMANOWICZ & PRZYBYLSKA 1994, SALMANOWICZ 1995) and flavonoid data (WILLIAMS & al. 1983). However, quinolizidine alkaloids do not allow such an unambiguous classification (Fig. 6) (WINK & al. 1995); e.g., the bicyclic lupinine or multiflorine-type alkaloids (which occur in a limited number of taxa only) are the major alkaloids of the rough-seeded lupins, but also occur in smooth-seeded species, such as L. luteus and in some North and South American species.

Molecular data clearly show that the rough-seeded lupins (Scabrispermae) are closely related and do not detect a closer relatedness of the subgroups L. atlanticus, L. digitatus and L. cosentinii (CARSTAIRS & al. 1992) nor of L. digitatus and L. cosentinii (SALMANOWICZ 8~; PRZYBYLSKA 1994, SALMANOWICZ 1995). The surveys based on alkaloids (CARSTAIRS 1992, WINK & al. 1995), flavonoid (WILLIAMS & al. 1983) and protein data (SALMANOWICZ & PRZYBYLSKA 1994, SALMANOW1CZ 1995) also support the uniformness of this group. PLITMANN (1981) assumed that the differences between rough-seeded species are mainly quantitative. As the rough- seeded species do not grow sympatrically, it might be suggested that they are geographically isolated forms of one species and might as well be regarded as subspecies (as in "Flora Europaea", AMARAL FRANCO • PINTO DA SILVA 1968), although their genetic distances, chromosome data and crossing behaviour indicate species status (CARSTAIRS & al. 1992). The rough-seeded species were thought to be ancestral to North American species when flavonoid patterns were evaluated (WILLIAMS & al. 1983, PLITMANN & HEYN 1984). However, molecular data indicate that they have diverged prior to the evolution of North American species (Fig. 3), and that a relationship exists with South American lupins of easterly distribution ("atlantic group").

As already stated, the smooth-seeded species are far more heterogeneous than the rough-seeded ones. The close relationship ofL. luteus and L. hispanicus was never questioned (PLITMANN 1981), but L. angustifolius has to be included in this group according to molecular data and flavonoid pattern (WILLIAMS & al. 1983) but not to alkaloid data (Fig. 6). Some phylogenetic reconstructions (Fig. 4) imply that L. albus and L. rnicranthus are genetically related, albeit not very closely. Also their alkaloid patterns show similarities; both taxa contain alkaloids of the multiflorine series (WINK ~; al. 1995), but their flavonoid pattern differ (WILLIAMS & al. 1983). Genetically, L. micranthus differs most from all other Old World lupins, confirming serological data (CRISTOVOLIN~ 1989). Seed characters and alkaloid data (PLITMANN 1981, PLITMANN & PAZY 1984) implied that the smooth-seeded Old World lupins (especially L. angustifolius) are closer connected to the North American than to other Old World lupins, a view that is corroborated by our molecular data (Figs. 3, 4).

Only part of the American lupins have been covered by our present study; but if the results of both datasets are combined at least three groups of New World lupins are apparent; (1) the South American species of eastern origin (Atlantic region), (2) the North American species and South American species of western distribution (Andean region) and (3) possibly the "microcarpi" ("platycarpos") group with L. microcarpus of North and South American distribution. The surveys of WATSON (1873) and SMITH (1944) differ because WATSON only considered qualitative differences to establish groups (i.e. the small number of ovules or the joint cotyledons in his "platycarpos" group), while SMITH preferred a very thorough grouping based on


quantitative differences. However, the authors agree in the "microcarpi/platycarpos" group which is also clearly defined in the molecular trees (Fig. 5). While WATSON (1873) did not further subdivide the North American species, some groups of SMITH (1944) are also confirmed by molecular data (like the "micranthi" -group), while others (like the "arborei"-group) are not well supported. Neither flavonoid data (NICHOLLS & BOHM 1983) nor alkaloid data (Fig. 6) provide a better resolution. Serological data agree in so far as no marked difference between annual and perennial species were found (CRISTOFOLINI 1989).

Members of the Cytisus and Genista complex (plus allies) are Old World species. Considering the position of lupins in the phylogenetic trees (Figs. 2, 3) we conclude that ancestors oflupins also had an Old World distribution and that the New World lupins derived from them. The existence of distinct evolutionary lines (Fig. 3) and the genetic distances (Tables 2, 3) imply that lupins must have reached North and South America independently from their Old World origin, whereas a North American origin or a South American origin directly from Sophoreae or Crotalarieae is less likely. The close connection between North American lupins and South American taxa of the Andes, suggests a migration from North to South America.

Although a close connection between rough-seeded Old World species and South American lupins ("Atlantic region") has not been suggested before, phytochemical data provide some additional evidence: Multiflorine and derivatives are abundant in the atlantic South American species (e.g., L. albescens) and in the rough-seeded species plus L. albus and L. micranthus of Old World distribution, but are not accumulated to any substantial degree in North American species (W~NK & al. 1995).

While a migration via the Bering street could have been one way for the European species to reach North America until recent times (correlating well with a divergence time of about 3-4 mio years; Table 4), it is not certain how the Old World lupins could have reached atlantic South America. Assuming that the calibration of the "molecular clock" (Table 4) is reliable, theories that explain the present distribution with plate tectonics cannot be correct. At the time the Pa- pilionoideae and lupins evolved (Table 4), the continents had already been separated for a long time. Either land bridges connected the continents for a much longer period, or other means like storms, water or animals ("long range dispersal"; DUNN

Table 4. Divergence times (mio years) between different groups of PapiIionoideae based on ITS 1 + 2 sequences (see Table 3)

Taxon ITS1 ITS2

Lupinus: Old World and North American species ~ 4 ~ 3 Lupinus: Scabrispermae and Malacospermae ,,~ 6 ~ 5 Lupinus of eastern regions of South America and Scabrispermae ~ 8 ~ 8 Lupinus and Genisteae ~ 14 ~ 12 Genisteae and CrotaIarieae ,,~ 18 ~ 16 Genisteae and Thermopsideae ~ 26 ~ 25 Thermopsideae and Sophoreae ~ 33 ~ 34


94

65

81

94

75

52

56

68 °41 71

87[

65

90

Maximum parsimony

- - Lupinus polyphyllus 9 7 [ 90 ~ [ - - Lupinus perennis

[ - - Lupinus mutabilis

97 [ [ Lupinus albus Lupinus micranthus

Lupinus elegans Lupinus pubescens

Lupinus cruckshanskii

Lupinus albifrons

- - Lupinus arboreus

- - Lupinus formosus 97 F I _ _ Lupinus nootkatensis

- - Lupinus argenleus

I - - Lupinus densiflorus 97 l I _ _ Lupinus microcarpus

Lupinus polycarpus

Lupinus arcticus

_ 9 ~ - - Lupinus hispanicus 87 - - Lupinus pilosus

- - Lupinus atlanticus

Lupinus digitatus

Lupinus albescens 9o ~ Lupinus paraguariensJs

I - - Lupinus princei

Lupinus cosentinii

Lupinus nanus

Lupinus succulentus

~ ] Lupinus angustifolius 94 / - - Lupinus aureonitens

Lupinus latifolius

I Lupinus luteus


Fig. 6. Dendrogram based on quinolizidine alkaloid pattern of lupins (WINK • al. 1995); analysis by maximum parsimony: 50% majority rule consensus cladogram of 100 parsimonious trees of a heuristic closest search (length 231 steps, min/max length 84-392 steps; CI 0.364, HI 0.641, RI 0.523, RC 0.190). The number indicates how often a branch was found in 100 trees

1971) must be responsible for the dispersal of seeds or plants from the Old World to South America.

Chemical versus molecular phylogeny. Chemical characters such as the distribution of certain secondary metabolites have been used for cladistic analyses in some recent studies of legume systematics (CRISP & DOYLE 1995). However, since the production of secondary metabolites is important for the fitness of a plant (i.e. they function as defence or signal compounds; WINK 1988, 1992), patterns of secondary metabolites must be regarded as adaptive, especially at a low taxonomic level.

The tribes of this survey have always been considered to be related because of the occurrence of quinolizidine alkaloids. As this trait is already developed in the early


Sophoreae the quinolizidine alkaloid producing tribes were regarded as old. How- ever, the genetic data show that Genisteae and Crotalarieae certainly are advanced tribes. Furthermore, a strict survey of alkaloid patterns shows some major excep- tions. Not all genera of the Podalyrieae and Crotalarieae accumulate quinolizidine alkaloids and most importantly, CrotaIaria which produces pyrrolizidine instead of quinolizidine alkaloids, would be excluded from this evolutionary line if the occurrence of these chemical compounds would be evaluated in a strict cladistic way.

To illustrate the limited value of alkaloid pattern as a taxonomic marker, we employed the alkaloid analysis of WINK & al. (1995) to create a data matrix of quinolizidine alkaloids. Individual quinolizidine alkaloids were counted as present or absent in this matrix. The resulting 50% majority rule consensus of a maximum parsimony analysis (Fig. 6) reveals only few phylogenetically meaningful relationships in the genus Lupinus; the rough seeded lupins are more or less recognized as a group because of their consistent pattern of multiflorine-type alkaloids. If a strict consensus was employed, all branches collapsed and no information remained. A recent analysis that combined molecular data (RFLP-pattern) of lupins with the "evolution" of quinolizidine alkaloid patterns (YAMAZAKI 8¢ al. 1993) was equally unsuccessful.

This work was supported by the Deutsche Forschungsgemeinschaft (SPP Molekulare Grundlagen der Evolution bei Pflanzen; Wi 719/8-1,2). For plant and seed material of Lupinus we are indebted to ANA PLANCHUELO, BEVAN BUIRCHELL and to several seed collections and Botanical Gardens as indicated in Table 1).

References

AGARDH, C., 1835: Synopsis generls Lupini.- Lund: Berling. AMARAL, FRANCO, J. DO, PINTO DA SILVA, A.R., 1968: Lupinus L . - I n TUTIN, T. G.,

HEYWOOD, V. H., BURGES, N. A., MOORE, D. M., VALENTINE, D. H., WALTERS, S. M., WEBB, D. A., (Eds): Flora Europaea, 2, pp. 105-106.- Cambridge: Cambridge University Press.

BADR, A., MARTIN, W., JENSEN, U., 1994: Chloroplast restriction site polymorphism in Genisteae (Leguminosae) suggests a common origin for European and American lupines. - P1. Syst. Evol. 193: 95-106.

BAUM, D., 1994: RbcL and seed-plant phylogeny. - TREE 9: 39-41. BENTHAM, G., 1865: Leguminosae.- In BENTHAM, G., HOOKER, J. D., (Eds): Genera plan-

tarum, 1(2), pp. 434 600. London: Reeve. BISBY, F. A., 1981: Genisteae (ADANS.) BENTH.- In POLHILL, R. M., RAVEN, P. H., (Eds):

Advances in legume systematics, 1, pp. 409-425. - Kew: Royal Botanic Gardens. BRUNEAU, A., DOYLE, J. J., 1993: Phylogenetic analysis of chloroplast DNA restriction site

characters in Erythrina L. (Phaseoleae: Leguminosae). - Syst. Bot. 18: 229-247. - PALMER, J. D., 1990: A chloroplast DNA inversion as a subtrial character in the

Phaseoleae (Leguminosae). - Syst. Bot. 15: 378-386. - DOYLE, J. L., 1995: Phylogenetic relationship in Phaseoleae: evidence from chloroplast

DNA restriction site characters. - In CRISP, M., DOYLE, J. J., (Eds): Advances in legume systematics, 7, pp. 309-330. - Kew: Royal Botanic Gardens.

BURKART, A., 1952: Las leguminosas Argentinas silvestres y cultivadas. Buenos Aires: Acme Agency.

CANDOLLE, A. P., DE, 1825-1827: Prodromus systematics naturalis, 2.-Paris: Treuttel & Wfirtz.


CARSTAIRS, S. A., BUIRCHELL, B. J., COWLING, W. A., 1992: Chromosome number, size and interspecific crossing ability of three Old World lupins, Lupinus princei HARMS, L. atIamicus GLADSTONES and L. digitatus FORSKKL, and implications for cyto-systematic relationships among the rough-seeded lupins. - J. Roy. Soc. Western Australia 75: 83-88.

CHASE, M. W., & al., 1993: An analysis of nucleotide sequences from the plastid gene rbcL. - Ann. Missouri Bot. Gard. 80: 528-580.

CLEGG, M. T., 1993: Chloroplast gene sequences and the study of plant evolution. Proc. Natl. Acad. Sci. USA 90:363 367.

CRANMER, M. F., TURNER, B. L., 1967: Systematic significance of lupine alkaloids with particular reference to Baptisia (Leguminosae).- Evolution 21: 508-517.

CRISP, M. D., DOYLE, J. J., 1995: Advances in legume systematics. 7. - Kew: Royal Botanic Gardens.

CRISTOFOLINI, G., 1987: Serological relationships among Sophoreae, Yhermopsideae and Genisteae (Fabaceae). Bot. J. Linn. Soc. 94:421 432.

- 1989: A serological contribution to the systematics of the genus Lupinus (Fabaceae). - P1. Syst. Evol. 166: 265-278. CHIAPELLA, L. F., 1977: Serological systematics of the tribe Genisteae (Fabaceae). - Taxon 26: 43-56. 1984: Origin and diversification of Genisteae (Fabaceae): a serosystematic purview. Webbia 38: 105-122.

DELGADO-SALINAS, A., BRUNEAU, A., DOYLE, J. J., 1993: Chloroplast DNA phylogenetic studies in the New World PhaseoIinae (Leguminosae: Papilionoideae: Phaseoleae). - Syst. B o t . 1 8 : 6 17.

DONOGI-IUE, M. J., 1994: Progress and prospects in reconstructing plant phylogeny. Ann. Missouri Bot. Gard. 81: 405-418.

DOYLE, J. J., 1993: DNA, phylogeny and the flowering of plant systematics.- BioScience 43: 380-389. 1994: Phylogeny of the legume family: an approach to understanding the origins of nodulation.- Annual Rev. Ecol. Syst. 25: 325-349. 1995: DNA data and legume phylogeny: a progress report. - In CRISP, M., DOYLE, J. J., (Eds): Advances in legume systematics, 7, pp. 11-13.- Kew: Royal Botanic Gardens.

DOYLE, J. L., 1990: Isolation of plant DNA from fresh tissue.- Focus 12: 13-15. - 1993: Chloroplast DNA phylogeny of the papilionoid legume tribe Phaseoleae.-Syst.

Bot. 18:309 327. - LAVIN, M., BRUNEAU, A., 1992: Contributions of molecular data to papilionoid legume

systematics. - In SOLTIS, P. S., SOLTIS, D. E., DOYLE, J. J., (Eds): Molecular systematics of plants, pp. 223-251.-New York: Chapman & Hall.

DUNN, D. B., 1971: A case of long range dispersal and "rapid speciation" in Lupinus. -Trans. Missouri Acad. Sci. 5: 26-38. 1984: Genetic resources: cytotaxonomy and distribution of new world lupin species. - In Proceedings of the Third International Lupin Conference, pp. 68-85.- La Rochelle: International Lupin Association.

- GILLETT, J. M., 1966: The lupines of Canada and Alaska. Canada Department of Agriculture, Monograph 2. - Ottawa: Queen's Printer.

FAUGERAS, G., PARIS, R., 1971: Nouvelles recherches phytochimiques sur les Papilionac6es- G6nist6es d'Europe. - Boissiera 19: 201-218.

FELSENSTEIN, J., 1988: Phylogenies from molecular sequences: inference and reliability.- Annual Rev. Genet. 22: 521-565.

GAMS, H., 1923-1924: Leguminosae. - In HEGI, G., (Ed.): Illustrierte Flora yon Mitteleuropa 4(3), pp. 1113-1644. - Wien: Pichler.

164 E. K)iss & M. WINK:

GraBS, P. E., 1966: A revision of the genus Genista L. - Notes Roy. Bot. Gard. Edinburgh 27: 1 1 - 9 9 .

GLADSTONES, J. S., 1974: Lupins of the Mediterranean region and Africa. - Techn. Bull. Dept. Agric. Western Australia 26: 1-48.

GOLDBLATT, P., 1981: Cytology and the phylogeny of Leguminosae.-In POLHILL, R. M., RAVEN, P. H., (Eds): Advances in legume systematics, 1, pp. 427-463.- Kew: Royal Botanic Gardens.

GOMES, C. M. R., GOTTLIEB, 0. R., GOTTILEB, R. G., SALATINO A., 1981: Phytochemistry in perspective: chemosystematics of the Papilionoideae. - In POL~IILL, R. M., RAVEN, P. H., (Eds): Advances in legume systematics, 1, pp. 409 425. - Kew: Royal Botanic Gardens.

GROSS, R., 1984: First Reinhold yon Sengbusch memorial lecture: Lupins in the Old and New w o r l d - a biological-cultural coevolution.- In: Proceedings of the Third Interna- tional Lupin Conference, pp. 244-277.- Rochelle: International Lupin Association.

HAMBY, R. K., ZIMMER, E. A., 1992: Ribosomal RNA as a phylogenetic tool in plant systematics.- In SOLTIS, P. S., SOLTIS, D. E., DOYLE, J. J., (Eds): Molecular systematics of plants, pp. 50-91. - New York: Chapman & Hall.

HANELT, P., 1960: Die Lupinen. - Wittenberg: Ziemsen. HARBORNE, J. B., 1969: Chemosystematics of the Leguminosae. Flavonoid and isoflavonoid

patterns in the tribe Genisteae. - Phytochemistry 8: 1449-1456. - 1971: Distribution of flavonoids in the Leguminosae.- In HARBORNE, J. B., BOULTER, D.,

TURNER, B. L., (Eds): Chemotaxonomy of the Leguminosae, pp. 31-67.- London: Aca- demic Press.

- BOULTER, D., TURNER, B. L., (Eds), 1971: Chemotaxonomy of the Leguminosae. - London: Academic Press.

HEGNAUEP,, R., 1994: Chemotaxonomie der Pflanzen, l la, Leguminosae. Basel: Birkh/iuser. HERENDEEN, P. S., CREPET, W. L., DILCHER, D. L., 1992: The fossil history of the Leguminosae:

phylogenetic and biogeographic implications.- In HERENDEEN, P. S., DILCI~R, D. L., (Eds): Advances in legume systematics, 4, pp. 303-316. - Kew: Royal Botanical Gardens.

HILLIS, D. M., DIXON, M. T., 1991: Ribosomal DNA: molecular evolution and phylogenetic inference. Quarterly Rev. Biol. 66: 411-453.

- HUELSENBECK, J. P., 1992: Signal, noise, and reliability in molecular phylogenetic analyses.- J. Hered. 83: 189-195.

HITCHCOCK, C. L., CRONQUIST, A., OWNBEY, M., THOMPSON, J. W., 1961: Vascular plants of the Pacific Northwest. 3. - Seattle: University of Washington Press.

HOENEISEN, M., SILVA, M., WIN~, M., CRAWFORD, D. J., STUESSY, T., 1993: Alkaloids of Sophora of Juan Fernandez islands and related taxa. Bol. Soc. Chilena Quimica 38: 167-171.

HOLUBOVA-KLASKOVA, A., 1964: Bemerkungen zur Gliederung der Gattung Cytisus L. s.1. - Acta Univ. Carol. Biol., Suppl. 2:1 24.

HONDELMANN, W., 1996: Die Lupine: Geschichte und Evolution einer Kulturpflanze. - Wiss. Mitt. FAL Braunschweig-V61kenrode, Special issue 162.

HUTCHINSON, J., 1964: The genera of flowering plants. 1. - London: Oxford University Press. KXss, E., 1995: Molekulare Phylogenie der Schmetterlingsblfitler (Familie Leguminosae).-

Ph.D Thesis, University of Heidelberg. WINK, M., 1992: rbcL sequences from lupins and other legume species. - P1. Molec. Evol. Newslett. 2: 21-26. 1994: Molecular phylogeny of lupins. - In MARTINS, J. M. N., BEIRAO DA COSTA, M. L., (Eds): Advances in lupin research. Proceedings of the 7th International Lupin Conference, Evora, Portugal, pp. 267-270. Lisbon: ISA Press. 1995: Molecular phylogeny of the Papilionoideae (family Leguminosae): RbcL gene sequences versus chemical taxonomy. - Bot. Acta 108: 149-162.


- 1996: Molecular evolution of the Leguminosae: Phylogeny of the three subfamilies based on rbcL-sequences. - Biochem. Syst. Ecol. 24:365 378.

KAZIMIERSKI, T., NOWACKI, E., 1961: Lupins of the Old World. - Genet. Polon. 2:113 118. KIMURA, M., 1980: A simple method for estimating evolutionary rates of base substitutions

through comparative studies of nucleotide sequences. J. Molec. Evol. 16: 121-147. KINGHORN, A. D., SMOLENSKI, S. J., 1981: Alkaloids of Papilionoideae.- In POLHILL, R. M.,

RAVEN, P. H., (Eds): Advances in legume systematics, 2, pp. 585-598.-Kew: Royal Botanic Gardens.

- BALANDRIN, M. F., 1984: Quinolizidine alkaloids of the Leguminosae: structural types, analysis, chemotaxonomy, and biological activities. - In PELLETIER, E. S., (Ed.): Alkaloids: chemical and biological perspectives, pp. 105-148.- New York: Wiley.

KUMAR, S., TAMURA, K., NEI, M., 1993: MEGA molecular evolutionary genetics analysis, version 1.0. - Pennsylvania State University.

LAVIN, M., DOYLE, J. J., PALMER, J. D., 1990: Evolutionary significance of the loss of the chloroplast-DNA inverted repeat in the Leguminosae subfamily Papilionoideae.- Evo- lution 44: 390-402.

MADDISON, W. P., MADDISON, D. R., 1992: MacClade: analysis of phylogeny and character evolution, version 3.0.- Sunderland: Sinauer.

MEARS, J. A., MABRY, T. J., 1971: Alkaloids in the Leguminosae.-In HARBORNE, J. B., BO~JLTER, D., TURNER, B. L., (Eds): Chemotaxonomy of the Leguminosae, pp. 83-168. - London: Academic Press.

NICHOLLS, K. W., BOHM, B. A., 1983: Flavonoids and affinities of some North American lupines. Canad. J. Bot. 61: 708-730.

NOWACKI, E., JAWORSKI, A., 1978: A study on the evolution of the genus Lupinus by serological methods. - Genet. Polon. 5:47-56

OLMSTEAD, R. G., PALMER, J. D., 1994: Chloroplast DNA systematics: a review of methods and data analysis. - Amer. J. Bot. 81: 1205-1224.

PALMER, J. D., SINGH, G. P., PILLAY, D. Y. N., 1983: Structure and sequence evolution of three legume chloroplast DNAs. Molec. Gen. Genet. 190: 13-19.

- ALDRICH, J., THOMPSON, W. F., 1987: Chloroplast DNA evolution among legumes: loss of a large inverted repeat occurred prior to other sequence rearrangements.- Curr. Genet. 11: 275-286.

- THOMPSON, W. F., 1988: Evolutionary significance of inversions in legume chloroplast DNAs. - Curt. Genet. 14: 65-74.

PALOMINO, G., MARTINEZ, P., BERNAL, C., SOUSA, S. M., 1993: Chromosomal differences among some species of the genus Sophora L. and Styphnolobium SCUOTT. - Ann. Missouri Bot. Gard. 80: 284-290.

PHILLIVS, L. L., 1955: A revision of the perennial species of Lupinus of North America exclusive of Southwestern United States. Res. Stud. State Coll. Wash. 23: 161-201. 1957: Chromosome numbers in Lupinus.- Madrofio 14: 30-36.

PLANCHUELO, A.M., 1982: Literature review of the genus Lupinus. Lupine Newslett. 4: 37-39.

- 1984: Taxonomic studies of Lupinus in South America.- In: Proceedings of the Third Inter- national Lupin Conference, pp. 39-54.- La Rochelle: International Lupin Association. D~NN, D. B., 1984: The simple leaved lupines and their relatives in Argentina.- Ann. Missouri Bot. Gard. 71: 92-103.

PLITMANN, U., 1981: Evolutionary history of the Old World lupines.- Taxon 30: 430-437. - HEYN, C. C., 1984: Old World lupins: taxonomy, evolutionary relationships, and links

with New World species. - In: Proceedings of the Third International Lupin Conference, pp. 56-66.- La Rochelle: International Lupin Association.

166 E. K)~ss & M. WINK:

- PAZY, B., 1984: Cytogeographical distribution of Old world Lupinus. - Webbia 38: 531- 539.

POLHILL, R. M., 1976: Genisteae (ADANS.) BENTH. and related tribes. - Bot. Syst. 1:143 380. - 1981a: Papilionoideae.- In POLmLL, R. M., RAVEN, P. H., (Eds): Advances in legume

systematics. 1, pp. 191-205.- Kew: Royal Botanic Gardens. - 1981b: Crotalarieae.-In POLnlLL, R. M., RAVEN, P. H., (Eds): Advances in legume

systematics. 1, pp. 399-402. - Kew: Royal Botanic Gardens. - 1981c: Podalyrieae.-In POLHILL, R. M., RAVEN, P. H., (Eds): Advances in legume

systematics. 1, pp. 396-397. - Kew: Royal Botanic Gardens. RAVEN, P. H., (Eds), 1981: Advances in legume systematics. 1 & 2 . - Kew: Royal Botanic Gardens.

RAVEN, P. H., POLItlLL, R. M., 1981: Biogeography of the Leguminosae.- In POLHILL, R. M., RAVEN, P. H., (Eds): Advances in legume systematics, 1, pp. 409-425.-Kew: Royal Botanic Gardens.

RIGGINS, R., SHOLARS, T., 1993: Lupinus.- In HICKMAN, J. C., (Ed.): The Japson Manual, higher plants of California, pp. 622-636. - Berkeley: University of California Press.

ROTHMALER, W., 1944: Die Gliederung der Gattung Cytisus L. Feddes Repert. 53: 137-150. SALATINO, A., GOTTLIEB, O. R., 1980: Quinolizidine alkaloids as systematic markers of the

Papilionoideae.- Biochem. Syst. Ecol. 8: 133-147. - 1981: Quinolizidine alkaloids as systematic markers of the Genisteae.-Biochem. Syst.

Ecol. 9: 267-273. 1983: Chemogeographical evolution of quinolizidines in PapiIionoideae. P1. Syst. Evol. 143: 167-174.

SALMANOW~CZ, B. P., 1995: Comparative study of seed albumins in the old-World Lupinus species (Fabaceae) by reversed-phase HPLC. - P1. Syst. Evol. 195: 77-86.

- PRZYBYLSKA, J., 1994: Electrophoretic patterns of seed albumins in the Old-World Lupinus species (Fabaceae): variation in the 2S albumin class. - P1. Syst. Evol. 192:67 78.

SANGER, F., NICKLEN, S., COULSON, A. R., 1977: DNA sequencing with chain-terminating inhibitors.- Proc. Natl. Acad. Sci. USA 74:5463 5467.

SANUDO, A., 1979: Chromosome variability in the Genisteae (ADAMS.) BENTH. (Leguminosae). - Webbia 34: 363-408.

SARICH, V. M., WILSON, A. C., 1973: Generation time and genome evolution in primates.- Science 179:1144-1147.

SMITH, C. P., 1917 1938: Species Lupinorum. - California: Saratoga. - 1944: Lupinus.- In ABRAMS, L., (Ed.): Illustrated Flora of the Pacific states, 2, pp. 483-

519.- Stanford University: Stanford University Press. SOLTIS, P. S., SOLTIS, D. E., DOYLE, J. J., 1992: Molecular systematics of plants. -New York:

Chapman & Hall. SOUSA, S. M., RUDD, V. E., 1993: Revision of the genus Styphnolobium (Leguminosae,

Papilionoideae, Sophoreae). - Ann. Missouri Bot. Gard. 80: 270-283. SWOFFORD, D. L., 1993: PAUP: phylogenetic analysis using parsimony, version 3.1.1.

Computer program distributed by the Illinois Natural History Survey, Champaign, Illinois.

TAUBERT, P., 1894: Leguminosae.-In ENGLER, A., PRANTL, K., (Eds): Die nattirlichen Pftanzenfamilien, 3(3), pp. 70-396. - Leipzig: Engelmann.

TURNER, B. L., 1981: Thermopsideae.- In POLmLL, R. M., RAVEN, P. H., (Eds): Advances in legume systematics, 1, pp. 403-408. Kew: Royal Botanic Gardens.

WATSON, S., 1873: Revision of the extra-tropical North American species of the genera Lupinus, Potentilla and Oenothera.- Proc. Amer. Acad. Arts 8: 517-618.


WILLIAMS, C. A., DEMISSIE, A., HARBORNE, J. B., 1983: Flavonoids as taxonomic markers in Old World Lupinus species.- Biochem. Syst. Ecol. 11:221-231.

WINK, M., 1988: Plant breeding: importance of plant secondary metabolites for protection against pathogens and herbivors. Theor. Appl. Genet. 75: 225-233. 1992: The role of quinolizidine alkaloids in plant insect interactions. In BERNAYS, E. A., (Ed.): Insect plant interactions, 4, pp. 131 166. Boca Raton: IRC Press.

- 1993: Quinolizidine alkaloids. - In WATERMAN, P., (Ed.): Methods in plant biochemistry, 8, pp. 197 239. - London: Academic Press.

- WITTE, L., 1983: Evidence for a wide-spread occurrence of the genes of quinolizidine alkaloid biosynthesis.- FEBS Lett. 159:196 200.

- KKss, E., KAUFMANN, M., 1993: Molecular versus chemical taxonomy. - In NAHRSTEDT, A., (Ed.): Society for Medical Plant Research, 41st congress, pp. 17-18. - Stuttgart: Thieme.

- MEISSNER, C., WITTE, L., 1995: Patterns ofquinolizidine alkaloids in 56 species of the genus Lupinus. - Phytochemistry 38:139-153.

WOJCIECtlOWSKI, M. F., SANDERSON, M. J., BALDWIN, B. G., DONOGHUE, M. J., 1993: Monophyly of aneuploid Astraoalus (Fabaceae): evidence from nuclear ribosomal DNA internal transcribed spacer sequences.- Amer. J. Bot. 80: 711-722.

YAMAZAKI, M., SATO, A., SAITO, K., MURAKOSHI, I., 1993: Molecular phylogeny based on RFLP and its relation with alkaloid patterns in Lupinus plants. - Biol. Pharm. Bull. 16: 1182-1184.

Address of the authors: Dr ERNST KXSS, Prof. Dr MICHAEL WINK (correspondence), Institut ffir Pharmazeutische Biologie, Universit/it Heidelberg, Im Neuenheimer Feld 364, D-69120 Heidelberg, Germany.

Accepted August 12, 1996 by F. EHRENDORFER

Documents

Molecular phylogeny and phylogeography of Lupinus (Leguminosae) inferred from nucleotide sequences of the rbcL gene and ITS 1 + 2 regions of rDNA