Monteiro et al., 2003.pdf

Molecular Ecology (2003)

12

, 997–1006

© 2003 Blackwell Publishing Ltd

Blackwell Science, Ltd

Molecular phylogeography of the Amazonian Chagas disease vectors

Rhodnius prolixus

and

R. robustus

FERNANDO A. MONTEIRO,

*

TOBY V. BARRETT,

†

S INEAD FITZPATRICK,

‡

CELIA CORDON-ROSALES,

§

DORA FELICIANGELI

¶

and CHARLES B . BEARD

*

*

Division of Parasitic Diseases, Centers for Disease Control and Prevention, Atlanta, USA, 4770 Buford Hwy, Mail Stop F-22, Chamblee, Atlanta, GA 30341–3724, USA,

†

Instituto Nacional de Pesquisas da Amazonia, C.P. 478, Manaus, AM, 69011–970, Brazil,

‡

Pathogen Molecular Biology and Biochemistry Unit, London School of Hygiene and Tropical Medicine, London, UK,

§

Medical Entomology Research and Training Unit/Guatemala, CDC and Center for Health Studies, Universidad del Valle de Guatemala, Guatemala City, Guatemala,

¶

Centro Nacional de Referencia de Flebotomos, Seccion de Entomologia Medica, Universidad de Carabobo, Maracay, Venezuela

Abstract

The phylogeographical structure of the closely related species

Rhodnius prolixus

and

R.robustus

is presented based on a 663-base pair (bp) fragment of the mitochondrial cyto-chrome

b

gene. Twenty haplotypes were recovered from 84 samples examined, represent-ing 26 populations from seven Latin American countries. The resulting phylogenetic treeis composed of five major reciprocally monophyletic clades, one representing

R. prolixus

and four representing

R. robustus

. While

R. prolixus

is a very homogeneous assemblage,

R.robustus

has deeper clades and is paraphyletic, with the clade comprising

R. robustus

fromVenezuela (Orinoco region) more closely related to the

R. prolixus

clade than to the other

R.robustus

populations from the Amazon region. The

R. robustus

paraphyly was supported fur-ther by the analysis of a nuclear gene (D2 region of the 28S RNA) for a subset of specimens.The data support the view that

R. robustus

represents a species complex. Levels of sequencedivergence between clades within each region are compatible with a Pleistocene origin.Nucleotide diversity (

ππππ

) for all

R. prolixus

populations was extremely low (0.0008), suggestingthat this species went through a recent bottleneck, and was subsequently dispersed by man.

Keywords

:

Amazonia, cytochrome

b

, mtDNA, phylogeography,

Rhodnius

, speciation

Received 30 August 2002; revision received 6 January 2003; accepted 7 January 2003

Introduction

The Triatominae (Hemiptera: Reduviidae) comprise asubfamily of haematophagous insects that are vectorsof the Chagas disease agent,

Trypanosoma cruzi

. Chagasdisease (or American trypanosomiasis) is the most seriousparasitic disease of the Americas (World Bank 1993),affecting approximately 12 million people throughout thisregion, with an additional 90 million estimated to be at risk(Schmunis 1999). Most species of triatomines are potentialvectors of

T. cruzi

, but only a few have become welladapted to living in human habitations and are therefore of

greater epidemiological importance. One of these speciesis

R. prolixus

, the main Chagas disease vector in Venezuela,Colombia and Central America (Lent & Wygodzinsky1979).

R. prolixus

is thought to be an exclusively domesticspecies throughout most of its range, but in Venezuelathere has been some confusion due to the presence of theclosely related and morphologically similar sylvatic species

R. robustus

. The latter was reported first in Venezuela byLent & Valderrama (1973) with bugs collected from

Attaleamaracaibensis

(=

A. butyracea

) palm trees. However, theexistence of a ‘sylvatic

R. prolixus’

has long been known byVenezuelan researchers (Gamboa 1963, 1973; Goméz-Núñez1963) but its status, to date, remains unclear (Schofield2000). The distribution of these two species overlaps inmost of northern South America (Colombia, Venezuela,Bolivia, Ecuador, French Guiana and north Brazil) with

R.prolixus

occurring further north through Central America to

Correspondence and present address: Fernando Monteiro,Laboratório de Doenças Parasitárias, Departamento de MedicinaTropical, Instituto Oswaldo Cruz, Avenida Brasil 4365, Rio deJaneiro, RJ, Brasil, 21045–900. E-mail: [email protected]

998

F . A . M O N T E I R O

E T A L .

© 2003 Blackwell Publishing Ltd,

Molecular Ecology

, 12, 997–1006

southern Mexico (Lent & Wygodzinsky 1979). Considerableoverlap of key morphological characteristics used to separatethese species (Hurtado-Guerrero 1992; Harry 1993a; Harry1994), however, has led to occasional misidentifications,thus making the precise limits of their distributions dif-ficult to establish (Solano

et al

. 1996).

R. prolixus

and

R. robustus

are two of the four membersof the

R. prolixus

species group that also includes

R. neglectus

and

R. nasutus

, from drier habitats in central and north-eastern Brazil, respectively. Although it is relatively easy todistinguish

R. neglectus

and

R. nasutus

from each other andfrom the rest of the group based on morphology (Harry1994; Dujardin

et al

. 1999), the separation of

R. prolixus

from

R. robustus

can be problematic (Harry 1993a). Thisobservation, together with the lack of diagnostic allozymeloci between these two species (Harry

et al

. 1992), led to thesuggestion that

R. robustus

was not a valid taxon (Harry1993b; Barrett 1995). It was shown later, based on two mito-chondrial DNA (mtDNA) fragments (cytochrome

b

andlarge subunit ribosomal RNA), that these two speciesbelonged to different evolutionary lineages and shouldthus be regarded as separate (Lyman

et al

. 1999). The ana-lysis of additional samples from the Amazon region, how-ever, uncovered a more interesting pattern, showing that

R. robustus

is quite heterogeneous (Monteiro

et al

. 2000)and could conceal more than one incipient species. In addi-tion, the relationship between

R. prolixus

and

R. robustus

inthe Venezuelan Orinoco basin remains unclear.

Therefore, we present here a comprehensive mtDNAphylogeographical analysis of this controversial pair ofspecies, which includes samples representing 25 popula-tions from seven Latin American countries. Samples of

R.robustus

include specimens from geographical locationsvery close to the ‘type localities’ for this species. [

R. robustus

was described by Larrousse in 1927 based on two femalespecimens from two different geographical locations.Curiously, Larrousse did not designate a holotype (ortype locality) for the new species. See Discussion for moreinformation.] Results are discussed in terms of taxonomy,biogeography and epidemiological significance.

Materials and methods

Samples and gene fragment used

A total of 84 specimens representing 12 populations of

R.prolixus

and 14 populations of

R. robustus

were sequencedfor a 663-base pair (bp) fragment of the mitochondrialcytochrome

b

(cyt

b

) gene. The closely related

R. nasutus

was used as the outgroup. Detailed information on thesamples used in this study is given in Table 1.

Insects were identified on the basis of size and colour dif-ferences on the hind tibia of later stage nymphs (Lent &Wygodzinsky 1979).

DNA extraction, amplification and sequencing

Genomic DNA was extracted from individual bug legs asdescribed in Lyman

et al

. (1999). Standard polymerase chainreaction (PCR) techniques were used to amplify the genefragments using the following primers: CYTB7432F, 5

′

-GGACG(AT)GG(AT)ATTTATTATGGATC, and CYTB7433R,5

′

-GC(AT)CCAATTCA(AG)GTTA(AG)TAA. Primer designwas based on conserved regions of the cyt

b

gene of

Triatoma dimidiata

(Dotson & Beard 2001) after comparisonwith other insect cyt

b

sequences. Amplified PCR frag-ments were sequenced, edited and aligned as describedin Monteiro

et al

. (2000).In order to validate the results based on the mitochon-

drial cyt

b

fragments, and to exclude the possibility ofmtDNA introgression between the

R. prolixus

and

R. robus-tus

lineages, we also present an alignment of the D2 vari-able region of the 28S RNA (D2) for a randomly selectedsubset of samples which represent the five main cyt

b

clades observed (and the outgroup). Four D2 sequenceswere already available (Monteiro

et al.

2000), and threeothers were sequenced here with the same primers, D2F,5

′

-GCGAGTCGTGTTGCTTGATAGTGCA

G

and D2R, 5

′

-TTGGTCCGTGTTTCAAGACGGG (Porter & Collins 1996

).

Phylogenetic analysis

Sequences were subjected to parsimony and distanceanalyses. When more than one individual yielded the samesequence, only a single haplotype was included in the ana-lysis. However, for illustrative purposes, same haplotypesfrom different populations were incorporated to the tips ofthe tree a posteriori. Maximum parsimony (MP) trees wereconstructed using

paup

* version 4.0b8 (Swofford 1999).The shortest trees were found via a heuristic search withstepwise addition of taxa, using 100 random input ordersand tree bisection–reconnection (TBR) branch swapping.We examined the effects of several different characterweighting schemes on tree topology: equal weight acrosssites, applying a 1:15 transition/transversion ratio (TS:TV),and giving first, second and third codon positions weightsof 4-8-1, respectively. In all cases characters were con-sidered unordered. The neighbour-joining (NJ; Saitou &Nei 1987) algorithm was used to construct a tree based ona Kimura 2-parameter (K2-p, Kimura 1980) distance matrix.The K2-p method was used to produce the distance matrixbecause the Jukes & Cantor (1969) estimate of the numberof nucleotide substitutions per site between haplotypeswas smaller than 0.3, and the TS:TV ratio was higher than2 (Nei 1996). Statistical support for clades in the MP and NJphylogenetic trees was assessed by the bootstrap method(Felsenstein 1985) with 1000 replications. For MP bootstrapanalysis, simple stepwise addition of taxa and TBR branchswapping options were used. Basic statistics from aligned

P H Y L O G E O G R A P H Y O F

R H O D N I U S P R O L I X U S / R . R O B U S T U S

999


Molecular Ecology

, 12, 997–1006

sequences, K2-p distances between haplotypes, and nucle-otide diversity (

π

: equation 10.5 in Nei 1987) were computedusing

mega

(Kumar

et al

. 1994).

Genetic variation in

R. prolixus

In order to assess the levels of genetic diversity in naturalpopulations of

R. prolixus

, we compared field-collectedsamples from three villages in Guatemala — Tituque,Tuticopote and Las Palmas — with samples from Orica,a village in the neighbouring Central American countryHonduras. These areas have not been treated previouslywith insecticides for Chagas disease control. Tituque,Tuticopote and Las Palmas are small villages (approximately250 small adobe houses each) in a mountainous area in eastGuatemala. While Tituque is separated from Tuticopote bya valley of 1 km in breadth, these two villages are 4 km apartfrom Las Palmas. The three villages are approximately250 km from Orica, in Honduras. Three houses were sampledfrom each Tituque and Tuticopote while six houses weresampled from Las Palmas. Sampled houses were separatedby at least 200 meters from each other. One bug wasanalysed per house, with the exception of two houses in

Tituque where from two and six bugs were sampled, inorder to detect within-house polymorphism. Samples fromOrica, Honduras represented a pool from several houses.

Results

Sequence variation and phylogenetic analysis

Analysis of the 86 sequences (including the outgroup)for the cyt

b

gene fragments revealed the existence of21 unique haplotypes (Table 2). Phylogenetic analysesof these haplotypes yielded 111 variable characters, ofwhich 40 were autapomorphies and 71 were parsimonyinformative. MP analysis of these characters produced fourequally parsimonious trees of 150 steps (CI = 0.753, RI =0.888, RC = 0.669), which differed only in some fine-scalearrangement of terminal taxa within otherwise stableclades. No significant change was observed with the use ofalternative weighing schemes. One of the four MP treeswas recovered using the NJ method with Kimura 2-parameters distances (Fig. 1). The saturation of transitionswas not a concern because all uncorrected (

p

, Nei 1987)pairwise distances were below the 9–10% saturation

Table 1 List of samples used in the study

Species Collection site n HaplotypeField/colony

Domestic/sylvatic Code Date collected

R. prolixus Orica, Francisco Morazan, Honduras 7 a F D prHO 1999Las Palmas, Guatemala 6 b F D prGU 1 June 1995Tituque, Guatemala 9 b F D prGU 2 June 1995Tuticopote, Guatemala 3 b F D prGU 3 June 1995Modesto Loaiza, Coyaima, Colombia 1 b C D prCO 1 September 1996Ibague, Colombia 1 b C D prCO 2 February 1995Pampanito, Trujillo, Venezuela 3 c C D prVE 1 1997Pampan, Trujillo, Venezuela 1 c C D prVE 2 1987Pampanito, Trujillo, Venezuela 2 c C D prVE 3 1960San José Tiznados, Guárico, Venezuela 3 b C S prVE 4 1988Ortiz, Guárico, Venezuela* 4 b F S prVE 5 July 2001Cojedes, Venezuela 1 b C D prVE 6 1995

R. robustus Pampanito, Trujillo, Venezuela 4 d C S roVE 1 1997Candelaria, Trujillo, Venezuela 3 e,f C S roVE 2 1988Napo, Ecuador 2 g C S roEC —Carauarí, Amazonas, Brazil 4 h,i,j F S roBR 1 February 2000Porto Velho, Rondonia, Brazil 1 k C S roBR 2 1985Apuí, Amazonas, Brazil 4 l,m C S roBR 3 September 1996Itupiranga, Pará, Brazil 1 n C S roBR 4 1984Purupurú, Amazonas, Brazil 4 n C S roBR 5 December 1995Novo Repartimento, Pará, Brazil 5 o C S roBR 6 August 1998Barcarena, Pará, Brazil 5 p C S roBR 7 1996Cayenne, French Guiana 1 g F S roFR March 2000Balbina, Amazonas, Brazil 1 r C S roBR 8 November 1983UHE Paredão, Roraima, Brazil 5 s C S roBR 9 March 1987Rio Mapuera, Pará, Brazil 3 t C S roBR 10 June 1986

R. nasutus Teresina, Piauí, Brazil 2 u C D naBR —

*Three of the four samples were sequenced for 415 bp only.

1000

F . A . M O N T E I R O

E T A L .


Molecular Ecology

, 12, 997–1006

Table 2 Polymorphic sites observed in 20 R. prolixus and R. robustus haplotypes. Hapotypes a–f are from the Orinoco basin, haplotypes g–t are from the Amazon region. Sites 171, 222 and 423 are transversions

000000000001111111111111122222222222222333333334444444444444445555555556666666666601124566678001223345667792233444477788912456799001122234556678123344669022233334453388840138759119087425148252535890298942751626925140365769581302146948401271469451

Haplotype * * * ** ** * * * * *a GAG....C.A.TC.........C....A.T.....TCCACC.AT...G.T.CC..GC..CGTAT...TT.T...........b G.G....C.A.TC.........C....A.T.....TCCACC.AT...G.T.CC..GC..CGTAT...TT.T...........c G.G....C.A.TC.........C....A.T.....TCCACC.AT.A.G.T.CC..GC..CGTAT...TT.T...........d G.G.CCGCGA.T...T....G.C..A...T...G.T..ACC.ATG..G.T.CCG..C.CC.TATGG.TT.T..A....T...e G.G.CCGCGA.T...T....G.C..A...T...G.T..ACC.ATG..G.T.CCG.GC.CC.TATGG.TT.T..A....T...f G.G.CCGCGA.T...T....G.C..A...T...G.T..ACC.ATG..G.T.CCG.GCTCC.TATGG.TT.T..A....T...g ...............TC.CCG.....T.........C.............................A...TTC.......TGh ...............TCCCCG.....T.........C.............................A....TC.......TGi ...............TC..C......T.........CC............................A....TC.......TGj ...............TC..CG.....TA........CC............................A....TC.......TGk ...............TC..CGT....T.........CC..........G.G....................TC...C.T.T.l .............G.TC..CGT.C..T..............A........................A....TC.......T.m ...............TC..CGT.C..T.......................................A....TC.......T.n ...A.....AG.............T.....C.T...C.........G..T.....G.....T...........AC....T..o ...A.....AG.............T.....C.T.............G..T.....G.....T...........AC.......p ........................T......CT...C.........G...G...T..................A.G..TT..q ..............A.........T.......T...C.............G...T..................A.G.GT...r ........................T.......T.............G.......T..................A.G.GTTT.s .......................CT...A...T.T...........G.......T..............A...A.G.GTT..t ........................T.......T.............G.......T......TA..........A.G.GTTT.Consensus AGAGTTATAGACTTGCTTTTACATCCCGGCTTCACCTTGTTGGCAGAAACATAACATCTTACGCAAGCCGCCTGTATACCCA

*Nonsilent substitutions. Sequences representing the variation observed (haplotypes a, d, g, n and p), have been submitted to Genebank, Accession nos: AF421339, AF421340, AF421341, AF421342, and AF421343.

Fig. 1 Maximum parsimony tree (one of fourshortest trees with 150 steps and CI = 0.753)of 21 unique 663 bp cyt b haplotypes. Notethat while R. prolixus is monophyletic andhomogeneous, R. robustus is a paraphyleticassemblage of four different lineages fromtwo different regions. *The Amazon regionincludes the samples from the Amazon andTocantins basins, and French Guiana. Severalterminal branches represent more than oneindividual sharing the same haplotype.

P H Y L O G E O G R A P H Y O F R H O D N I U S P R O L I X U S / R . R O B U S T U S 1001

© 2003 Blackwell Publishing Ltd, Molecular Ecology, 12, 997–1006

threshold for the cyt b gene (7.8% within the ingroup, and9.7% with inclusion of the outgroup; Meyer 1994; Griffith1997). As expected for a protein-coding gene, third codonpositions were the most variable (75.0%) followed byfirst (19.6%) and second (5.4%). Estimated nucleotide fre-quencies were A, 0.313; C, 0.213; G, 0.138; and T, 0.336.

Tree topology and sequence divergence

The tree is composed of five major clades, one representingR. prolixus and four representing R. robustus. While R. prolixusis a very homogeneous and monophyletic assemblage, R.robustus has deeper clades and is paraphyletic, since theclade composed of the R. robustus from Venezuela (or theOrinoco region) is related more closely to the R. prolixusclade than to the other R. robustus clades from the Amazonregion (Figs 1 and 2). The tree is well supported with themajority of bootstrap values being 99 or higher. Sequencedivergence within clades is usually small (maximum K-2pcorrected = 1.5%); whereas, between clades in each region ison average 6 times higher. The sequence divergence of haplo-types between regions can be as high as 8.5% (Table 3).

The alignment of the seven 630 bp nuclear D2 sequencesobtained for samples naBR, roBR4, roEC, roBR8, roVE2,prCO1 and prVE5, is presented in Table 4. These samplesare a random selection of members of the five main cladesseen in the cyt b tree (Fig. 1), plus the outgroup (naBR). Theingroup shares six synapomorphies (four substitutions atpositions 6, 97, 274, and 429 and two insertions: 189–190and 195–204). However, the most important observation isthat R. prolixus (prCO1 and prVE5) and R. robustus fromthe Orinoco region (roVE2) share a derived C in position360, therefore further supporting the R. robustus paraphylyobserved in the cyt b tree.

ComparisonsSequence divergence (%)

Estimated separation (Myr)

1. Within cladesR. prolixus 0.2 (0.2–0.3) —R. robustus I 0.2 (0.2–0.3) —R. robustus II 1.0 (0.3–1.5) 0.4R. robustus III 0.2 (0.2–0.2) —R. robustus IV 1.0 (0.3–1.4) 0.4

2. Between R. prolixus and R. robustusI from Orinoco region

3.3 (3.0–3.3) 1.4

3. Between clades in Amazon regionR. robustus II vs. R. robustus III 4.0 (3.6–4.4) 1.7R. robustus II vs. R. robustus IV 3.4 (3.0–3.9) 1.5R. robustus III vs. R. robustus IV 2.3 (2.0–2.8) 1.0

Between 2 and 3 7.2 (5.6–8.5) 3.1

Table 3 Mean cytochrome b sequencedivergence levels (Kimura 2-parameter)for within and between clade comparisons(range in parenthesis) and estimated timeof separation from common ancestor.Separation time is estimated assuming arate of 2.3% pairwise sequence divergenceper million years (Myr). Note how allbetween clade comparisons in bothregions (numbers 2 and 3) give estimatesthat fall within the Pleistocene (before 2My ago). Some estimates are not givenbecause of insufficient sampling orpossible lack of resolution

Fig. 2 Geographic location of the five monophyletic cytochrome bhaplotype clades of R. prolixus (dotted line) and R robustus I–IV.Numbers 1 and 2 indicate collection sites of R. robustus samplesthat are very close to the ‘type localities’ given by Larrousse (1927)in the description of the species: mouth of the Tefé river, in Brazil,and French Guiana, respectively. Levels of sequence diver-gence (Kimura 2-parameter) between clades within the Amazonand Orinoco regions are indicated. It should be noted, however,that R. prolixus has never been recorded from Panama or southernCosta Rica.

1002 F . A . M O N T E I R O E T A L .


Genetic variation in R. prolixus

The 18 field-collected R. prolixus samples from Tituque,Tuticopote and Las Palmas, Guatemala were surprisinglysimilar, presenting a single haplotype. A single haplotypewas also detected in the seven samples from Orica,Honduras, which differed from the former by a nonsilenttransversion. Therefore, nucleotide diversity (π) wasvery low: zero for populations of each country, and

0.0006 when these were combined. Colony samplesderived from six populations in Venezuela and twopopulations in Colombia revealed the same lack ofvariation, and were remarkably similar to the haplotypesfound in Guatemala and Honduras. Their inclusion inthe analysis (one haplotype of each population) onlyslightly increased π (0.0008). In summary, only threehaplotypes were detected for all R. prolixus samplesanalysed.

Table 4 Alignment of 450 bp fragments (of the 630 bp sequenced) showing the variation observed in the D2 region of the 28S RNA for arandom selection of members of the five main clades seen in the cyt b tree, plus the outgroup (naBR). Note how the derived C in position360 is shared by R. prolixus (prCO1 and pr VE5), and R. robustus from the Orinoco region (roVE2), further indicating that R. robustus isparaphyletic. GenBank Accession nos AF435856–AF435862

1 90naBR .......... .......... .......... .......... .......... .......... .......... .......... ..........roBR4 .....C.... .......... .......... .......... .......... .......... .......... .......... ....G.....roEC .....C.... .......... .......... .......... .......... .......... .......... .......... ....G.....roBR8 .....C.... .......... .......... .......... .......... .......... .......... .......... ..........roVE2 .....C.... .......... .......... .......... .......... .......... .......... .......... ....G.....prVE5 .....C.... .......... .......... .......... .......... .......... .......... .......... ....G.....prCO1 .....C.... .......... .......... .......... .......... .......... .......... .......... ....G.....Consensus TTGCTTAACT TTTAAATGAT TTGAGATGGC CTCTCGCCCT ATTCAGTGTA ACAGCTGTGA TAGTGGGTTT GGTCGCTCTC ATTTAAATAG

91 180naBR .......... .......... .......... .......... .......... .......... .......... .......... ..........roBR4 ......T... .......... .......... .......... .......... .......... .......... .......... ........T.roEC ......T... .......... .......... .......... .......... .......... .......... .......... ..........roBR8 ......T... .......... .......... .......... .......... .......... .......... .......... ..........roVE2 ......T... .......... .......... .......... .......... .......... .......... .......... ..........prVE5 ......T... .......... .......... .......... .......... .......... .......... .......... ..........prCO1 ......T... .......... .......... .......... .......... .......... .......... .......... ..........Consensus CAAGGGCAAT GGTGGACCGC ACTTCTCCCT TAGTAGGACG TTGTGACCTG TCAATAAATA TTCTAAGTAT TTGGCTATTA TGTCTGTTCT

181 270naBR ........-- ....------ ----...... .......... .......... .......... .......... .......... ..........roBR4 .......... .......... .......... .......... .......... .......... .......... .......... ..........roEC .......... .......... .......... .......... .......... .......... .......... .......... ..........roBR8 .......... .......... .......... .......... .......... .......... .......... .......... ..........roVE2 .......... .......... .......... .......... .......... .......... .......... .......... ..........prVE5 .......... .......... .......... .......... .......... .......... .......... .......... ..........prCO1 .......... .......... .......... .......... .......... .......... .......... .......... ..........Consensus AAGTTATACC GTTAAGGTAT TTTCTTTAAA ACAGTTTTAG CCGTTTTATA TACTGGATAA AATTGACAGT AACGAATTAT GGTGTTGAGC

271 360naBR .......... .......... .......... .......... .......... .......... .......... .......... ..........roBR4 ...A...... .......... .......... .......... .......... .......... .......... .......... ..........roEC ...A...... .......... .......... .......... .......... .......... .......... .......... ..........roBR8 ...A.A.... .......... .......... .......... .......... .......... .......... .......... ..........roVE2 ...A...... .......... .......... .......... .......... .......... .......... .......... .........CprVE5 ...A...... .......... .......... .......... .......... .......... .......... .......... .........CprCO1 ...A...... .......... .......... .......... .......... .......... .......... .......... .........CConsensus CACTTGAAAT TATATATATG TAAAAATATA TATAATGGAA AGTGTCCTAA AATATGGCTG TTTGCAAGTG GGTTGGTAAA AAATAGTTTT

361 450naBR .......... .......... .......... .......... .......... .......... .......... .......... ..........roBR4 .......... .......... .......... .......... .......... .......... ........T. .......... ..........roEC .......... .......... .......... .......... .......... .......... ........T. .......... ..........roBR8 .......... .......... .......... .......... .......... .......... ........T. .......... ..........roVE2 .......... .......... .......... .......... .......... .......... ........T. .......... ..........prVE5 .......... .......... .......... .......... .......... .......... ........T. .......... ..........prCO1 .......... .......... .......... .......... .......... .......... ........T. .......... ..........Consensus AATTCGGATT TTTAACCGGT TAACTATTCC GCCTACTGTT GGTAAACTGT TCCTAGGACT GTGCTTATAA TCACCGGTCG GCAGCGATTC



Discussion

This study supports the idea that the closely related R.prolixus and R. robustus are separate taxa, but at the sametime reveals that R. robustus is a paraphyletic speciescomplex. Surprisingly, R. robustus I (from the Orinocobasin) is related more closely to R. prolixus than to the otherR. robustus (II–IV) from the Amazon region, based on bothmitochondrial and nuclear gene fragments (Figs 1 and 2,Table 4). The phylogeography of these two species revealsstrong geographical structuring, with R. prolixus forming anorthern genetically depauperate clade, while R. robustusis an artificial assemblage comprised of a clade from theOrinoco basin plus three reciprocally monophyletic andparapatric Amazonian clades.

R. prolixus was described first from rural houses in the regionof La Guayra, Venezuela by Stål (1859). Following CarlosChagas’ discoveries in Brazil (Chagas 1909) it was implicatedas a major vector of Chagas disease to humans, and reportedprogressively from various localities in Venezuela, Colombiaand some parts of Central America and southern Mexico(Dias 1952). Throughout most of its distribution it appearsto be an exclusively domestic species, and shows very littlevariation either by mtDNA sequences (Fig. 1, Table 2), orallozymes (Chavez et al. 1999; Dujardin et al. 1999).

By contrast, R. robustus was described by Larrousse in1927, based on two female specimens considered largerand darker than a reference series of domestic R. prolixus.One of these originated from the region of Cayenne,French Guiana, and the other from the mouth of the Tefériver, in the Brazilian Amazon (Fig. 1, nos 1 and 2),although neither was formally designated as holotype. Inspite of this poor description, the validity of the taxon wasacknowledged by Lent & Jurberg (1969) and Lent &Wygodzinsky (1979) on the basis of colour differences onthe hind tibia of later stage nymphs, and slight differencesin the shape of the basal plate struts of the male genitalia.

R. robustus samples from the Amazon region have beenshown recently to be genetically different from R. prolixus(Lyman et al. 1999; Monteiro et al. 2000); however, the rela-tionship of these taxa in Venezuela is controversial.

In that country, R. prolixus was thought to be an exclu-sively domestic species until 1961, after several unsuccess-ful attempts to detect its sylvatic foci. However, it wasshown later to occur in palm trees in a tropical semihumidenvironment in Guárico State (Gamboa 1963). Studiescomparing R. prolixus from palms and from huts revealedsome differences between the two, the most distinctive onebeing related to the larger size of the domestic insects(Goméz-Núñez 1963; Gamboa 1973). These observationsintroduced the idea of the possible existence of two fullyfertile (Goméz-Núñez 1963; Gamboa 1973), albeit ecologic-ally different, forms of R. prolixus: a domestic form in hutsand a sylvatic form in palm trees. Lent & Valderrama

(1973) later recognized the existence of the morpholo-gically similar, and essentially sylvatic, R. robustus inVenezuela. However, the absence of diagnostic allozymeloci between R. prolixus and R. robustus from that countryled to the idea that R. robustus was not a valid taxon (Harry1993b). Lack of allozyme differences is not per se proofof cospecificity, and high allozyme similarity in spite ofsignificant divergence of mitochondrial genes has beenobserved in other arthropods (e.g. Langor & Sperling 1997;Gusmao et al. 2000), indicating that allozymes might some-times be too conserved to detect recent speciation events,particularly when levels of gene variation are low.

According to our data, the uniqueness of the R. robustusI haplotypes and the condition of sympatry between thesetwo taxa in Pampanito (3.3% sequence divergence) arguein favour of the idea that R. prolixus and R. robustus I areindeed separate taxa in Venezuela. Moreover, the resultsagree with cross-mating experiments between prVE4 androVE2, which show a decrease in fecundity (Galíndez-Girón et al. 1994), and with wing shape differences betweenthese two species recently detected by geometric morpho-metrics (Villegas et al. 2002). Therefore our results, addedto previous observations, favour the following scenario forthe distribution of R. prolixus and R. robustus I, in Venezuela:R. robustus I is sylvatic and found in palm trees, whereasR. prolixus is primarily domestic but can also be found inthe sylvatic habitat, as indicated by the samples from SanJosé Tiznados and Ortiz, in Guárico state (see origin ofVenezuelan samples in Table 1).

The taxonomic status of R. robustus

We analysed field-collected samples from sites that arevery close to where the two specimens used by Larrousse,to describe R. robustus, originated. If the samples weanalysed from the roBR1 and roFR geographic regions(Fig. 1, nos 1 and 2) are representative of Larrousse’soriginal specimens, it becomes clear that the original typespecimens belong to different evolutionary lineages.R. robustus clades II and IV differ on average by 3.4% ofsequence divergence, which is about the same level ofdifferentiation seen between sympatric R. prolixus and R.robustus I, in Venezuela. However, even though the threeAmazonian R. robustus clades are reciprocally monophyleticand present regional coherence, at present they lackdiagnosable characters other than the molecular ones thatdefine them, and thus do not meet all three criteria of theoperational procedure used by da Silva & Patton (1998) foridentifying allopatric species forms in Amazonian mammals.Nonetheless, it has been shown that fertility betweenmembers of the three R. robustus clades from the Amazonregion (roBR2, roBR4 and roBR8) is greatly reduced incross-mating experiments (Barrett 1995), which seems toindicate the existence of some form of barrier to gene flow.

1004 F . A . M O N T E I R O E T A L .


Similar observations have been made for some Heliconiuserato butterfly races in northern South America, whichpresented comparable levels of sequence divergence (Brower1996). Therefore, we believe that Larrousse’s description ofR. robustus was based on insects that belong to two of the(possibly) four different cryptic R. robustus taxa.

The delineation of the different prolixus/robustus evolu-tionary units will now facilitate the search for distinguishablecharacters to allow for their morphological identification.To resolve the R. robustus paraphyly, we suggest thatgroups II, III and IV of R. robustus from the Amazon regionkeep their present name, according to the law of priority(but still acknowledging the existence of the three sub-groups), while giving R. robustus I a new name. However,we strongly recommend any nomenclatural change to takeplace only after a thorough morphological and morpho-metric characterization has been completed for all four R.robustus lineages revealed in this study.

Biogeography, times of divergence and speciation

The traditional view that diversification of the Amazonianbiota was caused by glaciation cycles during thePleistocene was introduced by Haffer (1969), based ondistributional data for birds, and became known as the‘refugium theory’. The theory attempts to explain the latestof the series of differentiation events beginning in theCenozoic that contributed to the development of themodern biota of the Amazon basin (Simpson & Haffer1978). In short, it is based on the premise that climaticchanges during the Pleistocene caused rain forests tocontract into isolated pockets separated by savannah. Thiswould have confined small populations and favoured theirdivergence by genetic drift, which would have facilitatedallopatric speciation. The increasing availability of mole-cular data has made it possible to test whether sister taxafrom the Amazon (as well as in other tropical rain for-ests) are actually compatible with a Pleistocene origin(Moritz et al. 2000). Even though the refugium theoryseems to account adequately for the pattern seen in somespecies of neotropical bats (Ditchfield 2000), it fails toexplain the diversification seen in several other Amazonianmammals such as didelphid marsupials, echimyd rodentsor pithecine monkeys, all of which appear to predate thePleistocene (da Silva & Patton 1998; Boubli & Ditchfield2000). These estimates of the time of divergence betweenlineages are derived from rates of sequence divergencethat are calibrated generally based on ‘known’ vicariantevents. Such rates have been calculated either for the entiremitochondrial genome for recently diverged arthropodtaxa (within the last 3 Myr, 2.3% per Myr; Brower 1994), orfor the cytochrome oxidase I gene (2.4–2.6% per Myr) forbeetles (Caccone & Sbordoni 2001). Assuming that suchvalues are applicable to triatomines (and to the cyt b

fragment we used), even if the slightly slower rate of 2.3%of sequence divergence per million years is used, allestimates between the clades within both Amazon andOrinoco regions are compatible with a Pleistocene origin(Table 3). Because such a pattern of phylogenetic discon-tinuity with geographical orientation of haplotypes mostprobably involves long–term biogeographical barriers togene flow (Avise et al. 1987), it could well be explained bythe refugium theory.

Group I of R. robustus, from the Orinoco region of Vene-zuela, forms a major clade with R. prolixus, while groups II,III and IV form a second major clade representing thosefrom the Amazon forest region (Fig. 2). The vicariant eventthat would have separated the ancestors of these two majorclades is older (2.4–3.7 My) and dates within the Pliocene.

Hypothesis on the origin and spread of R. prolixus

Our data indicate that R. prolixus probably originated ataround 1.4 million years ago in the Orinoco lowlandforests, when an ancestral prolixus/robustus I stock wasseparated in different refugia, giving rise to R. prolixus andR. robustus I. Both species lived in association with birdsand mammals, especially those that nest on palm trees.They encountered man some time after his arrival in SouthAmerica and R. prolixus developed the ability to colonizehuman habitations. It was probably very recently, afterEuropean colonization, that R. prolixus became an increasinglydomestic species (Schofield & Dujardin 1999). Demographicgrowth and increased mobility of human populationscaused its dissemination to regions ecologically differentfrom its putative centre of origin (Dujardin et al. 2000).Thus, for most of its present distribution, it seems unable tomove back from huts and colonize the new sylvaticenvironments. The fact that all domestic R. prolixus analysedin this study are genetically depauperate (overall π = 0.0008)seems to be an indication of a recent bottleneck. However,whether this bottleneck is a reflection of the adaptation todomesticity remains to be demonstrated by the analysis ofmore field-collected sylvatic R. prolixus populations.

Implications for vector-control

Rhodnius prolixus is the primary Chagas disease vector inVenezuela, Colombia and parts of Central America. Themain reason why it is such a good vector is because it isessentially domestic throughout most of its range, forreasons discussed above. Thus, once a village is treatedwith insecticide and becomes triatomine-free, there will beno great risk of reinvasion of treated premises from sylvaticfoci. Hence, it is believed that it should be a feasible targetfor eradication in much the same way as with the domesticforms of Triatoma infestans in the Southern Cone region inSouth America (Schofield & Dujardin 1997). There is no



doubt that in the past some of the sylvatic R. prolixuspopulations in Venezuela were misidentified R. robustus I,and that reports of sylvatic R. prolixus from the Amazonregion were, in the same way, misidentifications of R.robustus II–IV (Monteiro et al. 2000). Moreover, it is themost probable explanation for the observation in Venezuelaof ‘huts long inhabited by men and triatomine-free, althoughsurrounded by “R. prolixus” infested palms’ (Goméz-Núñez1963). However, it should be considered that at least inareas in Venezuela where true sylvatic R. prolixus populationsseem to occur (as prVE4 and 5, from Guárico) recolonizationof domiciles by sylvatic insect populations might be aconcern. On the other hand, all four R. robustus clades appearto represent entirely sylvatic species, and it is not clear whythese populations have been unable to make the transitionto domestic environments as R. prolixus. Although thereare no reports, to date, of R. robustus colonizing houses, itcan be found occasionally in human habitations, where itflies in from neighbouring palms attracted by light (Tonnet al. 1976; Naiff et al. 1998; Feliciangeli et al. 2002). Theepidemiological significance of these accounts is negligiblein comparison with disease transmission mediated by R.prolixus, but localized cases are likely to occur in someareas (Miles et al. 1983; Feliciangeli et al. 2002).

Acknowledgements

We thank J.P. Dujardin, I. Galíndez-Girón and T. Lehmann forhelpful discussion and comments. The authors are also grate-ful to C. Aznar, I. Galíndez-Girón, J. Jurberg, R. Carcavallo,J.S. Patterson, M. Yeo, M.A. Miles, S.A.S. Valente, C. Ponce andC.J. Schofield, for kindly providing specimens. We also thankB. Holloway and the staff of the NCID Biotechnology Core Facilityfor synthesis of the oligonucleotide primers. This work bene-fited from international cooperation through the ECLAT researchnetwork, and from the Pilot Programme for Protection of BrazilianRainforests/PPD G-7. The use of trade names does not constituteendorsement by the US Public Health Service or the Centers forDisease Control and Prevention.

References

Avise JC, Arnold J, Ball RM et al. (1987) Intraspecific phylogeo-graphy: the mitochondrial DNA bridge between populationgenetics and systematics. Annual Review in Ecology and Systematics,18, 489–522.

Barrett TV (1995) Species interfertility and crossing experiments inTriatomine systematics. In: Proceedings of the International Work-shop on Population Genetics and Control of Triatominae (eds SchofieldCJ, Dujardin JP, Jurberg J), pp. 72–77. INDRE Press, Mexico.

Boubli JP, Ditchfield AD (2000) The time of divergence betweenthe two species of Uacari monkeys: Cacajao calvus and Cacajaomelanocefalus. Folia Primatologica, 71, 387–391.

Brower AVZ (1994) Rapid morphological radiation and con-vergence in the butterfly, Heliconius erato, inferred from patternsof mitochondrial DNA evolution. Proceedings of the NationalAcademy of Sciences USA, 91, 6491–6495.

Brower AVZ (1996) Parallel race formation and the evolution ofmimicry Heliconius butterflies: a phylogenetic hypothesis frommitochondrial DNA sequences. Evolution, 50, 195–221.

Caccone A, Sbordoni V (2001) Molecular biogeography of cavelife: a study using mitochondrial DNA from bathysciine beetles.Evolution, 55, 122–130.

Chagas C (1909) Nova tripanozomiaze humana. Estudos sobrea morfolojia e o ciclo evolutivo de Schizotrypanum cruzi n.General n. sp., agente etiolojico de nova entidade morbidado homem. Memórias do Instituto Oswaldo Cruz, 1, 159–218.

Chavez T, Moreno J, Dujardin JP (1999) Isoenzyme electrophoresisof Rhodnius species: a phenetic approach to relationships withinthe genus. Annals of Tropical Medicine and Parasitology, 93, 229–307.

Dias E (1952) Doença de Chagas nas Américas. III. América Central.Revista Brasileira de Malariologia E Doenças Tropicais, 4, 75–84.

Ditchfield AD (2000) The comparative phylogeography of neo-tropical mammals: patterns of intraspecific mitochondrial DNAvariation among bats contrasted to nonvolant small mammals.Molecular Ecology, 9, 1307–1318.

Dotson EM, Beard CB (2001) Sequence and organization of themitochondrial genome of the Chagas disease vector, Triatomadimidiata. Insect Molecular Biology, 10, 205–215.

Dujardin JP, Chavez T, Moreno JM, Machane M, Noireau F,Schofield CJ (1999) Comparison of isoenzyme electrophoresisand morphometric analysis for phylogenetic reconstruction ofthe Rhodniini (Hemiptera: Reduviidae: Triatominae). Journal ofMedical Entomology, 36, 653–659.

Dujardin JP, Schofield CJ, Panzera F (2000) Les vecteurs e la maladiede Chagas. Recherches taxinomiques, biologiques et génétiques. NS 24(5). Académie Royale des Sciences d’Outre-Mer, Classe des Sci-ences naturelles et médicales.

Feliciangeli MD, Dujardin JP, Bastrenta B et al. (2002) Is Rhodniusrobustus (Hemiptera: Reduviidae) responsible for Chagas dis-ease transmission in Western Venezuela? Tropical Medicine andInternational Health, 7, 280–287.

Felsenstein J (1985) Confidence limits on phylogenies: anapproach using bootstrap. Evolution, 39, 783–791.

Galíndez-Girón I, Barazarte R, Marquez J et al. (1994) Relacionesreproductivas entre Rhodnius prolixus Stal y Rhodnius robustusLarrousse (Hemiptera, Reduviidae, Triatominae) bajo condi-ciones de laboratorio. Entomologia y Vectores, 1, 3–14.

Gamboa CJ (1963) Comprobación de Rhodnius prolixus extra-domiciliario en Venezuela. Boletin de la Oficina Sanitaria Panamericana,54, 18–25.

Gamboa CJ (1973) La población silvestre de Rhodnius prolixus enVenezuela. Archivos Venezolanos de Medicina Tropical y Parasito-logia Medica, 5, 321–352.

Goméz-Núñez JC (1963) Notas sobre la ecología del Rhodniusprolixus. Boletín Informativo de la Dirección de Malariologia ySaneamiento Ambiental, 3, 262–272.

Griffiths CS (1997) Correlation of functional domains and rates ofnucleotide substitution in cytochrome b. Molecular Phylogeneticsand Evolution, 7, 352–365.

Gusmao J, Lazoski C, Sole-Cava AM (2000) A new species ofPenaeus (Crustacea: Penaeidae) revealed by allozyme andcytochrome oxidase I analyses. Marine Biology, 137, 435–446.

Haffer J (1969) Speciation in Amazonian forest birds. Science, 165,131–137.

Harry M (1993a) Use of the median process of the pygophore inthe identification of Rhodnius nasutus, R. neglectus, R. prolixusand R. robustus (Hemiptera: Reduviidae). Annals of TropicalMedicine and Parasitology, 87, 277–282.

1006 F . A . M O N T E I R O E T A L .


Harry M (1993b) Isozymic data question the specific status ofsome blood-sucking bugs of the genus Rhodnius, vectors ofChagas disease. Transactions of the Royal Society of Hygiene andTropical Medicine, 87, 492–493.

Harry M (1994) Morphometric variability in the Chagas diseasevector Rhodnius prolixus. Japanese Journal of Genetics, 96, 233–250.

Harry M, Galindez I, Cariou ML (1992) Isozyme variability anddifferentiation between Rhodnius prolixus, R. robustus and R.pictipes, vectors of Chagas disease in Venezuela. Medical andVeterinary Entomology, 6, 37–43.

Hurtado-Guerrero JC (1992) Análise Morfométrica de 14 Colôniasde Rhodnius prolixus e espécies afins (Hemiptera: Reduviidae:Triatominae). MSc thesis, Universidade do Amazonas, Manaus.

Jukes TH, Cantor CR (1969) Evolution of protein molecules. In:Mammalian Protein Metabolism (ed. Munro HN), pp. 21–132.Academic Press, New York.

Kimura M (1980) A simple method for estimating evolutionaryrate of base substitutions through comparative studies of nucle-otide sequences. Journal of Molecular Evolution, 16, 111–120.

Kumar S, Tamura K, Nei M (1994) mega: molecular evolutionarygenetics analysis software for microcomputers. ComputationApplied to Biosciences, 10, 189–191.

Langor DW, Sperling FAH (1997) Mitochondrial DNA sequencedivergence in weevils of the Pissodes strobi complex (Coleoptera:Curculionidae). Insect Molecular Biology, 6, 225–265.

Larrousse F (1927) Etude biologique et systématique du genre RhodniusStal (Hémiptères, Reduviidae). Annales de Parasitologie, 5, 63–88.

Lent H, Jurberg J (1969) O gênero Rhodnius Stål, 1859, com umestudo sobre a genitália das espécies (Hemiptera, Reduviidae,Triatominae). Revista Brasileira de Biologia, 29, 487–560.

Lent H, Valderrama A (1973) Hallazgo en Venezuela del tri-atomino Rhodnius robustus Larrousse, 1927 en la palma Attaleamaracaibensis Martius (Hemiptera, Reduviidae). Boletin de laOficina Sanitaria Panamericana, 13, 175–179.

Lent H, Wygodzinsky P (1979) Revision of the Triatominae (Hemiptera:Reduviidae) and their significance as vectors of Chagas disease.Bulletin of the American Museum of Natural History, 163, 123–520.

Lyman DF, Monteiro FA, Escalante AA et al. (1999) MitochondrialDNA sequence variation among triatomine vectors of Chagas disease.American Journal of Tropical Medicine and Hygiene, 60, 377–386.

Meyer A (1994) Shortcomings of the cytochrome b gene as a mole-cular marker. Trends in Ecology and Evolution, 9, 278–280.

Miles MA, Arias JR, Souza AA (1983) Chagas disease in theAmazon Basin. V. Periurban palms as habitats of Rhodnius robustusand Rhodnius pictipes — triatomine vectors of Chagas disease.Memórias do Instituto Oswaldo Cruz, 78, 391–398.

Monteiro FA, Wesson DM, Dotson EM, Schofield CJ, Beard CB(2000) Phylogeny and molecular taxonomy of the Rhodniiniderived from mitochondrial and nuclear DNA sequences.American Journal of Tropical Medicine and Hygiene, 62, 460–465.

Moritz C, Patton JL, Schneider CJ, Smith TB (2000) Diversificationof rainforest faunas: an integrated molecular approach. AnnualReview in Ecology and Systematics, 31, 533–563.

Naiff MF, Naiff RD, Barrett TV (1998) Wild vectors of Chagas’ dis-ease in an urban area of Manaus (AM): flying activity duringdry and rainy seasons. Revista da Sociedade Brasileira de MedicinaTropical, 31, 103–105.

Nei M (1987) Molecular evolutionary genetics. Columbia UniversityPress, New York.

Nei M (1996) Phylogenetic analysis in molecular evolutionarygenetics. Annual Review in Genetics, 30, 371–403.

Porter CH, Collins FH (1996) Phylogeny of Neartic members of the

Anopheles maculipennis species group derived from the D2 vari-able region of 28S ribosomal RNA. Molecular Phylogenetics andEvolution, 6, 178–188.

Saitou N, Nei M (1987) The neighbor-joining method: a newmethod for reconstructing phylogenetic trees. Molecular Biologyand Evolution, 4, 406–425.

Schmunis GA (1999) Iniciativa del Cono Sur. In: Proceedings of the SecondInternational Workshop on Population Biology and Control of Triatom-inae (eds Schofield CJ, Ponce C), pp. 26–31. INDRE, Mexico City.

Schofield CJ (2000) Area-wide control of Chagas disease vectors inLatin America. In: Area-wide control of fruit flies and other insect pests(ed. Tan KH), pp. 131–133. Penerbit Universiti Sains Malaysia,Penang.

Schofield CJ, Dujardin JP (1997) Chagas disease vector control inCentral America. Parasitology Today, 13, 141–144.

Schofield CJ, Dujardin JP (1999) Theories on the evolution ofRhodnius. Actualidades Biologicas, 21, 183–197.

da Silva MNF, Patton JL (1998) Molecular phylogeography andthe evolution and conservation of Amazonian mammals. Mole-cular Ecology, 7, 475–486.

Simpson BB, Haffer J (1978) Speciation patterns in the Amazonianforest biota. Annual Review of Ecology and Systematics, 9, 497–518.

Solano P, Dujardin JP, Schofield CJ, Romana C, Tibayrenc M(1996) Isoenzymes as a tool for identification of Rhodniusspecies. Research and Reviews in Parasitology, 56, 41–47.

Stål C (1859) Monographie der Gattung Conorhinus und Ver-wandten. Berliner Entomologische Zeitschrift, 3, 99–117.

Swofford DL (1999) PAUP*. phylogenetic analysis using parsimony(*and other methods), version 4. Sinauer Associates, Sunderland, MA.

Tonn RJ, CarcavalloRU, Ortega R (1976) Notas sobre la biología,ecología y distribución geográfica de Rhodnius robustus Larrousse,1927 (Hemiptera: Reduviidae). Boletín de la Dirección de Malario-logia Y Saneamiento Ambiental, 16, 158–162.

Villegas J, Feliciangeli MD, Dujardin JP (2002) Wing shape diver-gence between Rhodnius prolixus from Cojedes (Venezuela) andRhodnius robustus from Mérida (Venezuela). Infection, Geneticsand Evolution, 2, 121–128.

World Bank (1993) World development report 1993. Investing inhealth. Oxford University Press, New York.

Fernando Monteiro is a research scientist at the Oswaldo CruzInstitute (FIOCRUZ) in Rio de Janeiro, Brazil. He is interestedin the systematics, phylogeography and population genetics ofChagas disease vectors. Toby Barrett is a research scientist on thestaff of the National Institute of Amazonian Research (INPA) inManaus, Brazil, with interests in the ecology and vector biology oftrypanosomiases and leishmaniases. Sinead Fitzpatrick is a graduatestudent at the London School of Hygiene and Tropical Medicine,where she is working on population genetics of R. prolixus inVenezuela. Celia Cordon-Rosales is a research biologist at theMedical Entomology Research and Training Unit/Guatemala, CDC,and the Center for Health Studies, Universidad Valle, Guatemala,with interest on the biology of Chagas and malaria disease controland prevention. Dora Feliciangeli is Head of the section of MedicalEntomology and of the National Sandfly Reference Center at theUniversidad de Carabobo, Venezuela, where she works on theepidemiology and control of Leishmaniasis and Chagas disease.Ben Beard is Chief of the Vector Genetics Section in the Divisionof Parasitic Disases at CDC and works in molecular epidemiologyand genetics of parasitic diseases and their insect vectors.

Documents

Monteiro et al., 2003.pdf