1

Bachelor project Michael Sass Eskebjerg 25-6-2010

mRNA pseudoknots – Ribosomal roadblocks

Supervisor: Michael A. Sørensen Biocenter: 4-2-26, Ole Maaløse vej 5, 2200 København N

2

Abstract

Programmed ribosomal frame-shifting is a poorly understood mechanism that is facilitated by a

secondary mRNA structure known as a pseudoknot, in front of a slippery sequence, where the

slippage into a different frame happens. The process of PRF is however very relevant to viral

research, since major retro viruses such as HIV, SARS, and Herpes along with other viruses use this

mechanism as part of their viral metabolism. Here a specific set of different pseudoknots is

examined using different techniques, in order to determine if there is a linear correlation between

Induced and uninduced cultures frame-shifting efficiency. Additionally a theory that some

pseudoknots may do more then just force a shift in reading frame is investigated, essentially looking

at the second option proposed by the “9Å model”, and expanding on the idea that the ribosome may

unwind the pseudoknot. In this case the idea is investigated: that a strong pseudoknot could prove

so difficult to unwind that it actually results in a “translational roadblock”, which cripples the

translational speed or halts it entirely.

3

Table of Content

Introduction 3

Materials and Methods 9

• Plasmid: 9

• Culture Medium (MOPS medium) 9

• β-galactosidase assay 10

• Growth during induction 11

• Pulse Chase marking: 12

• Preparation of the sample for SDS gel 12

• SDS gel construction 12

• 2. Basic Dimensional gel 13

• Gst-tag purification 13

Results 14

• Relative frame-shift efficiency investigation 14

• Growth under induced conditions 17

• SDS and 2. dimensional gel 20

• Gst-tagging 24

Discussion 26

Acknowledgement. 28

References 29

Appendix 30

• β-galactosidase assay 30

• Growth during induction 33

• mFold 40

Introduction

4

The process translation, is a very precise mechanism in the cell, in which the transcribed mRNA is

read by a ribosome. The ribosome reads the genetic code of the mRNA, which consists of a set of

codons, and each codon consists of 3 nucleotides. Every codon corresponds to a specific tRNA

anticodon molecule that carries with it one of the 20 amino acids, with the exception of the stop

codon. There are 64 possible combinations, 3 of which are stop codons. This leaves 61 different

types of tRNA molecules, some of which have synonymous amino acids. Some tRNA anticodons

can pair with more then one codon, this is known as wobble base pairing, therefore all 61 types of

tRNA are not required for translation. In Escherichia coli there is a selection of preferred tRNAs,

that are produced in abundance. The Escherichia coli genes primarily use codons that correspond to

the anticodons of the abundantly present tRNAs, and almost completely avoids using codons that

correspond to tRNAs that are not abundantly present.(1, 3)

Protein synthesis begins with a “start codon” (AUG: Met), this 3 nucleotide sequence initiates the

translation and also defines which frame the ribosome is going to read from. Since it reads 3

nucleotides at a time, there would otherwise be 3 possible frames to read from. Once the translating

ribosome reaches a “stop codon” the translation ends and the protein is finished.(1)

If the DNA, from which the mRNA is transcribed suffers a nucleotide deletion or insertion, between

the area which will define the start and stop codon, a frame-shift mutation occurs. A frame-shift

mutation is often associated with a complete and meaningless change in the genetic code, from the

point of mutation.(2) Frame-shift errors can also occur during translation, though the frequency of

this happening is less then 3*10-5.(4)

A frame-shift that happens during translation, independent of any DNA mutation, is however not

always a random event. This ability of the Ribosome to change the reading frame is exploited by a

large diversity of Viruses, who depend on a -1 frame-shift, happening at a certain frequency, in a

specific place during translation. This is event is called -1 programmed ribosomal frame-shifting (-1

PRF), and is facilitated by an RNA pseudoknot (PK), which is a secondary mRNA structure, that

also includes a slippery sequence. The 9Å model suggests that the PK provides resistance to the

movement of the ribosome, and that this tension can be relived by two different mechanisms;

unwinding the pseudoknot or by “slippage” of the mRNA one base backwards inducing the -1

PRF.(5, 6)

5

In Viruses that exploit this mechanism of -1 PRF, the area in which this event happens, is not a

random set of nucleotides. But a specific area known as the slippery sequence, where the ribosome

pauses and is forced to back up by one nucleotide creating the -1 frame-shift. The force that induces

this event is the PK, which is positioned 6-8 nucleotides downstream of the slippery sequence. This

position puts the PK in direct contact with the ribosome as it reaches the slippery sequence,

requiring the ribosome to as suggested in the 9Å model: either unwind the PK or have a -1 PRF.(5,6)

In this work, we look at the H-type RNA pseudoknot, which begins with a single stranded hairpin

stem and loop (hairpin-type PK). The structure of this PK is divided into 4 areas of interest; stem 1,

loop 1, stem 2, and loop 2. The stems are complementary nucleotides of varying lengths, stem 1 is

the very first part of the PK and part of the normal hairpin structure, while stem 2 is created on the

loop (loop 1) of the hairpin structure. The loops connect the stems, loop 1 is the part of the normal

hairpin structure, while loop 2 is the nucleotides that range between the end of stem 1 to the

beginning of stem 2. The nucleotides in this type of PK ranging from the 5’ to the 3’ of the PK are

associated with these 4 areas in the following sequence; stem 1, loop 1, stem 2, stem 1, loop 2, and

stem 2. (Figure 1).(5)

6

There is a considerable interest in understanding the process of -1 PRF, because it is involved in

viral gene expression. This however is likely only one of many areas of interest in which PRF will

prove interesting. Understanding of this mechanism could provide greater insight into how the

ribosome regulates frame-shifting, and unwinds a potential PK. This insight may also prove to

potentially allow a search for frame-shift inducing PK’s in larger Genomes.

In this project I will be looking at a variety of different H-type PK’s, in order to shed more light on

the mechanism of -1 PRG. I will be using the UUUAAAG slippery sequence for all of them,

because it has been found to be more efficient in Escherichia coli.(4)

The PK is added to a plasmid, which includes a detectable product: β-galactosidase, and an area that

confers resistance towards ampicillin, which ensures preservation of the plasmid inside the cell as

long as it is grown on a medium with ampicillin. (Figure 2). There is also an inducible promoter

which will severely increase the production of this mRNA inside the cell.(7)

7

This project will focus on two distinct areas of interest.

First: to investigate the correlation between the frame-shift activity of the PK’s during uninduced

expression of the PK mRNA, with the frame-shift activity during Induced expression of the PK

mRNA already measured by Jesper Tholstrup.

Second: to investigate the 9Å models first proposed mechanism; that the ribosome unwinds the PK.

However here we theorize and pursue investigation of a third options, that the Ribosome during the

unwinding of the PK, may been able to severely slow or even stop the translation of the ribosome

during the unwinding.

(All PK’s shown in figure 4)

In order to measure uninduced frame-shifting activity, we measured the product of the LacZ gene,

the β-galactosidase. In this assay we used the ability of β-galactosidase to cleave through hydrolysis

the bond between ONP and galactose in ONPG. (Figure 3) Access to the β-galactosidase was

gained by using Lysozyme to hydrolyze the bond between N-acetyl glucosamine and N-acetyl

muramic acid (muramidase activity) leading to degradation of peptidoglycan in the cell wall of the

Escherichia coli, which is a Gram-positive bacteria.

8

The theory to investigate the possibly measurable translational pausing caused by a PK, comes from

the initial frame-shift assay results during Induced conditions (SDS-assay). A particular strong PK

(PK5) had an unexpected low amount of frame-shift activity relative to a set of weaker PK’s (PK6,

PK7, PK8). The theory is that if the ribosome tries to unwind a relatively very strong PK. The

translation is halted for a measurable period.

To test this theory we conducted a growth experiment. Using optical density measurements, at 436

nm. During the growth experiment one of a twin set of cultures was induced to overproduce the PK

mRNA. If a PK is able to pause or stop the translation of the ribosome, we expect to see a decrease

in growth rate relative to the induced control that does not contain a PK. Because as the ribosomes

are halted at the PK an increasing number of ribosomes will become unavailable for other cellular

processes, as they pile up on the first open reading frame of gene10 or gst.

To further investigate this we also conducted a 2. dimensional gel of PK’s that would appear to be

slowing down the growth rate of the culture. This was done with induced cultures in order to see if

there were a detectable amount of proteins would show that the ribosome had moved partially

through the PK, indicating that the PK had halted the translation. However gst uses different codons

then gene10, which can result in difference in translation speed. To avoid this uncertainty the

codons usage of gst for a set of cultures were adapted to fit those of gene10. These cultures were

then referred as using “codon-optimized gst”.(8) The use of gst in this experiment rather then gene10

is to allow the option to purify the proteins in the sample to only those with gst, Which could then

be run on a 2. dimensional gel.

9

10

Materials and Methods

Plasmid:

All experiments on the PK’s are done in vivo in the Escherichia coli MAS90 strain, which is

resistant towards kanamycin. A number of plasmids that also confer resistance towards ampicillin

have been constructed with a region that has a PK as shown in fig. 2., which includes gene10 from

the bacteriophage T7 (36 kDa), a slippery sequence, stop codon, PK site, and LacZ in the -1 frame.

In some of the plasmids gene10 has been replaced by Glutathione S-transferase (gst, 26kDa).

The Ptac promoter in the plasmid is derived from merging of a lacUV5 promoter which contains

consensus -10 sequence, with a trp promoter containing consensus -35 sequence. Creating a hybrid

“tac” promoter, which includes the lac operator region. The Ptac is repressed by the Escherichia coli

lac repressor, which keeps the transcription very low but doesn’t stop it entirely. It can however be

radically induced by isopropythio-β-D-galactoside (IPTG). The tac promoter is known to be at least

5 times more efficient then the lacUV5 promoter.(7)

Culture Medium (MOPS medium)

In all experiments done, the Medium in which the cultures were grown was MOPS. This particular

medium supports growth rates comparable to other traditional mediums, and also allows for

isotopic labeling with phosphate, sulfate, and nitrogen. Because these macronutrients are present at

sufficiently low levels.(9)

To this medium we also added to the following compounds to the listed concentration.

1.32 mM K2HPO4

5 µg/ml B1

0.4% Glycerol

100 µg/ml ampicillin

(We will be using sulfate isotopes later, therefore the phosphate concentration does not need to be

minimal, we add B1 is added as a precaution, glycerol is added as a carbon source, and ampicillin is

added to keep the plasmid inside the cells.

11

β-galactosidase assay

-1.9ml of a culture which has grown exponentially for at least 10 generations is harvested to a 2ml

eppendorf tube on ice water with 25 µl 100mg/ml Chloramphenicol (CAM) at OD’s close to 0.4,

0.6, and 0.8. (Take 2 samples of each)

-The samples are then centrifuged to pellet the cells for 5 minutes at 20.000G and resuspent in 50 µl

of lysis solution

-The samples are then placed and incubated at 30oC for 15 minutes

950 µl reaction buffer, which has been pre-warmed to 30oC is then added, and the time is noted

-The samples then incubate for 1-3 hours until a visible yellow colour appears.

-The reaction is stopped with the addition of 1 ml stop solution, put on ice, and the time is noted

-The samples are then centrifuged for 10 minutes at 20.000G to make sure that cell debris is

gathered in a pellet

-Measure Absorbance of 700 µl of the supernatant

-Data: Plot absorbance per L*min along the Y-axis, and the

corresponding OD values on the X-axis. Use both samples for each measurement and add Error

bars. Determine the Slopes of this 3 point measurement. This value is then the β-galactosidase

enzyme activity measured per minute*Liter, and depends on the amount of β-galactosidase in the

sample, which in turn depends on the amount of frame-shift activity.

Data comparing: To Compare this set of frame-shift activities, with those measured under induced

condition using a different method. The Value of PK1 is used and all other Values including PK1 is

divided by the Value of PK1. This is done for both the induced and uninduced data, using the PK1

value of that dataset.

*Lysis solution: B-PER (20 mM Tris-HCl pH 7.5, detergent), 10mM KCL, 2 mM MgSO4

Before use add to concentration of 1mM DTT and 2µl/ml 50/ml (in 20mM Tris-HCl pH 7.5)

Lysozyme.

*Reaction buffer: 20 mM Tris-HCl pH 7.5, 10 mM KCl

Before use add to concentration of 1 mM DTT, 1 mg/ml ONPG

*Stop solution: 1 M Na2CO3

12

Growth during induction

To do a growth analysis the culture used must fulfill the following conditions in order for the

experiment to be reproducible:

The culture must originate from pure genetic material

The culture must have been in exponential growth for at least 10 generations

The culture should have the desired growth rate

The optical density (OD) at 436 nm must be below 0.8

Temperature must be set at 37oC

Cultures were grown overnight for at least 13 hours in MOPS medium, the double time of the

cultures has been measured to close to 78 minutes (this is the time it takes for the Culture to double

also known as a generation). This results in a 1024 fold dilution needed to gain the same OD 13

hours later.

Cultures were grown in 6ml, aiming for an OD of 0.5, the sample was then diluted into two samples

of 20ml with an OD of close to 0.05

Before OD reached 0.2 one of the two samples is added with IPTG to a concentration of 1mM.

Note the time of IPTG induction

Make sure the uninduced culture continues to grow exponentially (it did for all experiments)

At least 1 generation after IPTG-induction, (the earliest measurement used was 124 minutes after

induction) preferably more, take enough measurements to make a new double time estimate.

Double time corresponding log value:

All values were treated with this equation in Excel. Time Unit was minutes.

13

Pulse Chase marking:

This is done in preparation for an SDS or 2. dimensional gel.

The experiment requires similar conditions as the growth experiment:

Exponentially growing cultures of at least 10 generations are used, do at least 3 OD measurement to

make sure they grow exponentially.

Use 8 ml of culture per sample.

Add IPTG to end concentration of 1mg/ml

The Pulse: 15 minutes later add 5µCi/ml culture [35S]methionine

The Chase: 20 seconds later add 10µl 10mg/ml methionine (in excess)

2 minutes later harvest the culture to an eppendorf tube with 25µl 100mg/ml CAM on ice

Centrifuge for 2 minutes and remove the supernatant

Preparation of the sample for SDS gel

The pellet from the pulse chase marking is resuspent in 30µl blue loading buffer.

DTT is added to a concentration of 0.5mM

The sample is boiled for 2 minutes

There should be roughly 45 µl sample

15 µl sample can be used for SDS gel or the first dimension of a 2. dimensional gel.

The rest can be put the freezer. Note it’s best to boil the sample again and add a little DTT again to

a frozen sample.

SDS gel construction

The SDS 10% separation gel is made from: 13.3 ml 30%acrylamid/0.8%bisacrylamid, 10 ml

4*separation buffer, 0.4 ml 10% SDS, 0.4 ml 10% APS, and 16.7 ml deminaralized water. Roughly

40ml

The SDS 5% stacking gel is made from: 1.7 ml 30%acrylamid/0.8%bisacrylamid, 2.5 ml 4*stacking

buffer (0.5 M tris), 0.1 ml 10% SDS, 0.05 ml 10% APS, and 5.7 ml deminaralized water.

The gels are polymerized with TEMED a polymerization accelerator. Add 0.5µl/ml

Stacking buffer is added last and stacking wells are added. Run the gel and once it’s done put it in

weak HCl until it’s yellow then in weak NaHCO3 until it’s blue again and dry it.

Once done the gels are put on a “clean” phosphor screen and a day or more later the screen I read.

14

2. Basic Dimensional gel

A Gel solution is made: (for up to 12 samples) 2.75g Ultra pure Urea (ammonia free), 0.66 ml

30%acrylamid/0.8%bisacrylamid, 1 ml 10% NP 40, 900 µl deminaralized water, 300 µl Ampholiner

pH 3.5 - 10

The Gel solution is heated and placed at room temperature

Glass tubes are placed in eppendorf tubes with one-use plungers.

When the Gel solution is back at room temperature, 15 µl 10% APS and 12 µl TEMED is added.

And 380 µl is distributed fast to the eppendorf tubes. Then use the plungers to suck up the Gel

solution into the glass tubes to about 3.5 centimeters from the top.

The sample is treated as mentioned in the SDS prep. And there is also added half volume 10% NP

40 and 2 µl RIM (30mg/ml), as well as 50 µl O’finished buffer, and the sample is saturated with

Urea.

The glass tubes are mounted on the rubber belt which is closed. 10 mM Phosphor acid is used as

running buffer on top with the + node, and 20 mM NaOH is used as running buffer below with the –

node.

Roughly half volume of the sample is used, the rest can be frozen and saved for later.

After the samples are added, add an extra 10 µl O’finished buffer on top of the samples, so they are

shielded from the running buffer.

The gel is run for 1600 volt hours

For the second dimension: 60 ml 10% separation gels were made using: 20 ml

30%acrylamid/0.8%bisacrylamid, 15 ml 4*separation buffer, 0.6 ml 10% SDS, 0.45 ml 10% APS,

and 24 ml deminaralized water. The first dimension is blown out of the glass tubes and placed in the

2. dimension gels. Otherwise the rest is identical to the SDS gel.

Gst-tag purification

First the cells are opened using Lysozyme. Glutathione-Agarose beads are used to bind the gst

fusion-proteins, the solution is then washed several times, with B-PER buffer (centrifuge with low

force) this is the purification. Then add free glutathione in excess to free the gst-fusion proteins.

Keep samples of each step, and make an input sample, which is before anything is done.

15

Results:

Relative frame-shift efficiency investigation

A set of frame-shift measurements of the PK’s from fig. 4. (a) has been done using the pulse-chase

experimental technique, metabolically labeling with [35S]methionine under IPTG induced

conditions. These were run on an SDS-gel. The frame-shift activity of uninduced strains is however

predicted to be too low to measure using the same type of frame-shift assay. In order to measure it,

we constructed and refined a much more sensitive frame-shift assay. The lacZ gene encodes the

enzyme β-galactosidase, which catalyses the hydrolysis of β-galactosides. In this assay we used

ortho-nitrophenyl-β-galactoside (ONPG), which is hydrolyzed into galactose and ortho-nitrophenol

(ONP), in the presence of β-galactosidase. ONPG is colourless, while ONP is yellow. This allows

us to measure the extend of the hydrolysis through the absorption of a sample that has been

catalyzing this reaction for a known amount of time, until the yellow colour becomes visible, and

then use that to quantify the amount of B-galactosidase present which corresponds to the frame-shift

activity. To increase the accuracy of the assay, we used a 3 point measurement for each PK.

(Example: Experiment 2.1 with PK4, PK5, PK6, and PK7. See appendix for the rest)

16

The experiment was repeated once for each strain and 4 strains were analyzed at a time. The

Experiments were noted as: 1.1, 1.2, 2.1, 2.2, 3.1, 3.2.

1: PK0, PK1, PK2, PK3

2: PK4, PK5, PK6, PK7

3: PK8, PK9, PK10, PK11

There was one exception, the PK11 culture failed in experiment 3.1 so it was done twice during

experiment 3.2

The result of this investigation yielded a similar pattern, for all PK’s investigated compared to the

induced data as shown in fig. 3. indicating with reasonable accuracy that frame-shift efficiency is

the same under both uninduced and induced conditions.

17

The results of these frame-shift efficiencies, supports the hypothesis that a PK can measurably stop

the ribosomal translation. Specifically we look at the frame-shift efficiencies of PK5, PK6, PK7,

and PK8. These PK’s as shown in fig. 4. decrease in strength, with PK5 being the strongest and

PK8 being the weakest. If the ribosome is not halted we would expect to see the largest amount of

frame-shift activity from the strongest of these 4 PK’s PK5. But the results indicate that at the

second weakest PK, PK7 there is this unexpected fulcrum point and from that point the stronger

PK’s have a lower frame-shift activity.

18

Growth under induced conditions

The focus of this experiment was the PK’s PK5 and PK8, but all PK’s were tested. Exponentially

growing cultures were induced with IPTG, and the effect of the induction was then measured on the

effect it had on reducing the growth rate. To make sure that we would not miss the PK “road

blocking” the ribosome, we also tested a set of strains in which the stop codon had been removed,

assuming the ribosome might push through some of the PK before it would be halted. (Example:

Experiment 4.1)

As shown in fig. 6. with JT565, there is a distinct increase in double time, which supports the

hypothesis that the induced culture with PK5, stops the ribosome, thereby reducing the amount of

ribosomes in the cell available to facilitate growth, which results in a lower rate of growth.

We also see that the induction of IPTG overall slows the growth of the cell, which was expected

since overproduction of mRNA will still compete with other mRNA in the cell needed for growth.

19

The growth experiment was done twice for the strains with gene10, and gst. The experiment was

done once for the strains with optimized-gst.

The results suggest that there might be a feint difference between gst and optimized-gst. This

difference however appears to be opposite to what was expected as the Growth rate of optimized-

gst appears to be faster then normal gst. There does appear to be roughly the same tendencies

between the different PK’s.

20

On closer inspection of the data looking only at PK5, and PK8 with and without the stop codon, it

appears that there is no significant difference between the ones using gst. There is so far not enough

data from this experiment to make the same conclusions for the ones using optimized-gst, though a

rough estimate might suggest that there would be. (Figure 7)

21

SDS and 2. dimensional gel

Continuing the analysis of the optimized-gst cultures, the PK’s: PK0, PK5, PK7, PK5-stop, and

PK8-stop were radioactively marked after IPTG induction. They were first done on a normal SDS

gel, and because of a slight error the experiment was repeated. (Figure 8)

The Results of the SDS gel shows a clear stop codon product, on the lanes that have cultures who

have a stop codon and are induced, around were we expect it to be at lower end of the gel, as well as

visible amount of frame-shift product at the top.

22

JT589; PK5 +optimized-gst: Number of amino acids Frame 0: Start 1 Frame 0: Stop 697, 952 (233, 318) Frame -1: Stop …675, 3861 (226, 1288) JT592; PK5 +optimized-gst –stop: Frame 0: Start 1 Frame 0: Stop 952 (318) Frame -1: …675, 3861 (226, 1288) (Data obtained through use of http://us.expasy.org/tools/dna.html )

As shown here the stop codon product (the stop codon at nucleotide 697) corresponds to a 233 long

amino acid protein, while the frame-shift product is 1288 amino acids long. Now there also appears

to be something that’s a little bigger then 233 amino acids in the lane of PK5-stop. Possibly there is

also something in the lane of PK8-stop.

23

24

The Samples from the SDS gel were then run on a 2. dimensional gel. The results of this were very

interesting. Despite the Optimized-gst performing differently then what we had expected, it appears

that the 2. Dimensional gel of PK5-stop codon (JT592) indicates that this PK may in fact be able to

severely cripple the translation of the ribosome, producing partial protein products roughly 248-280

amino acids long. (Figure 10)

We theorized that the ribosome only manages to partially unwind the PK which ranges from amino

acid 234 to 267. However it appears that it does manage to get through the PK but not much further

then that.

Sequence of the PK area of PK5-stop:

TTTAAAGCAGAAA(233 amino acids) GCGCGCGCGCAGCGCGCGCGCAATCCACGCCACGTGCGCGCGCGC(248 amino acids) TGCGCGCGCGCAGCTGGTGCAACTGTGGCTGGTGCAGCACCTCGTGGCAAAAGGGCC (267 amino acids) It would appear that exactly halfway through the second part of stem1 (shown in blue) the ribosome

is halted, then again just after the PK area inside the LacZ area but in reading frame 0, and a third

time further inside the LacZ area.

These findings suggest that mRNA structure of the LacZ gene downstream of the PK may be

relevant. So the 99 first nucleotides (33 amino acids) of it were run through mfold:

http://mobyle.pasteur.fr/cgi-bin/portal.py?form=mfold

(ctaattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagct

ggc) First Structure: 10 20 .-ctaattcactggc| t t cg cgtt t gc gcaa a \ -------------^ t c 30 40 .-tgact ga gg \ cc a \ ----- aa

25

Second Structure: 10 20 .-ctaattcactggc t t cg cgtt t gc gcaa a \ ------------- t c 30 40 50 .-tgact aaaccct--- ttaccc ggga ggcg a ccct ccgc a \ ----- acacgacgtt taattc 80 70 60

The area corresponding to an amino acid length of 269 and 280 in this case is 6

nucleotides and 39 nucleotides (267+6/3, 267+39/3). The “t”’s should be

considered “u”’s, since the program did not convert the DNA sequence to mRNA.

The few base pairs that the program suggests that the RNA, could possible have

an effect.

Gst-tagging

Through the use of the gst-fusion proteins ability to bind to glutathione, a set of samples with

optimized-gst ready to be used for an SDS gel were purified. The option for this process was the

reason for switching out gene10 with gst in the first place. (Figure 11.)

The results show a clear smear in PK5-stop and PK8-stop, which again supports the theory that the

PK’s are able to halt or cripple the translation. There is a clear difference between PK5-stop and

PK8-stop, it would appear that PK5-stop is able cripple the translation more then PK8-stop,

stopping it earlier. Since the smear in PK5-stops lane is further down then the smear in PK8-stops

lane.

26

27

Discussion

In this work primarily one type of pseudoknot with a 22 base pair stem1 and 6 base pair stem 2 has

been studied. The 4 PK’s with this structure differ only by how many G:C and A:U.

The frame-shift efficiency of uninduced cultures with PK’s 1-11 was determined to have a relative

correlation to the frame-shift efficiency of induced cultures with PK’s 1-11. Thereby proposing that

frame-shift efficiency is independent the abundance of mRNA with the PK. Also the 3 point

measurements of the β-galactosidase assay indicates that between OD 0.4 and 0.8 frame-shift

efficiency does not change, which could suggest that frame-shift efficiency is reasonably

independent of OD.

The Growth experiment under induced conditions, had a very clear result for gene10 PK5 showing

that it severely slowed down the double time of the cell. The results were less clear for the gst and

optimized-gst experiments. However the 2. Dimensional gel of the optimized-gst as well as the SDS

that was done with gst-tagged purified samples, also clearly suggests that the PK5 and perhaps also

the PK8 to some lesser extend, is able to stop translation or severely cripple it.

There is a good chance that gene10 has a much higher affinity to the ribosome. And therefore have

a much higher impact on the growth of the cell. IPTG induction merely produces the mRNA, while

the ribosome affinity in this case may well be different. It is even suggested that the secondary

structure of the mRNA near the start codon, will effect the expression of that mRNA far more then

codon optimization.(10)

This idea fits very well with the results. If gst is found to have a stronger secondary structure around

the start codon then gst, this would explain why even under Induced conditions the PK’s are not

able to severely slow the growth of the cell. Because translation of the mRNA is initiated at a lower

frequency, preventing the induced mRNA from competing with the mRNA needed for cellular

growth, which is suggested to have a consistently weak secondary structure at the start codon,

possibly originating from natural selection for cellular fitness.(10)

The results from the 2. dimensional gel of PK5-stop, were also puzzling. The assumption that the

ribosome would get stuck inside the PK doesn’t seem to fit, rather it would appear that the PK

removes momentum from the ribosome and leaves it crawling along a few codons, possibly having

troubles with weaker secondary RNA structures.

These results give rise to a number of interesting new areas to investigate, and methods to use.

In order to adapt the gst strains better to the Escherichia coli translation system, a set of about 37

codons could be added in front of the start codon before gst. These codons would be chosen based

28

on the secondary structure they would create, with the aim being to get a weak secondary structure

similar to other Escherichia coli genes or gene10. Or the exact same codons that gene10 has after

the start codon could be used. Alternatively if this little fusion interferes with gst’s function, the

first 37 codons of gst could be modified to the weakest possible secondary structure while still

encoding the same amino acids.

It would also be interesting to test the theory that a PK can steal momentum from the translating

ribosome, so that even if it manages to unwind the PK it will be slowed or even halted by much

weaker secondary structure downstream of the PK. A plasmid with 2 or 3 weaker PK’s placed next

to each would be interesting to test in a growth experiment and 2. dimensional gel. However copies

of the same PK next to each other will most likely not provide predictable results, the PK’s will

need to differ enough so that they will not begin to bind unpredictably with each other.

However first of all it would be interesting to reproduce the 2. dimensional gel with the gst-tag

purified samples to see if they show the same 5 dots or just the 3 that were predicted.

29

Acknowledgements

I would like to thank Michael A. Sørensen for exceptional supervision, guidance, and leniency. It

has been a privilege to both be allowed to work on relevant, interesting new science, and at the

same time be allowed to pursue any reasonable course of investigative method.

I would like to thank Jesper Tholstrup for the day to day supervision, for allowing me to continue

part of his work, and for keeping an eye on my progress.

I would also like to thank:

Marit Warrer for being available and willing to give technical assistance.

Kim Vollmer Rønne for being available for the occasional questions, and for allowing me to use his

space on more then one occasion

Maria Schaub for being available for the occasional questions.

30

References: 1: Mathews CK, van Holder KE, Ahern KG (2000) Biochemistry third edition. Oregon state university USA. 107 2: Mathews CK, van Holder KE, Ahern KG (2000) Biochemistry third edition. Oregon state university USA. 230-232 3: Ikemura T. Correlation between the abundance of Escherichia coli transfer RNAs and the occurrence of the respective codons in its protein genes: a proposal for a synonymous codon choice that is optimal for the E. coli translational system. J Mol Biol. 1981;151:389–409. 4: Hansen TM, Reihani SN, Oddershede LB, Sorensen MA (2007) Correlation between mechanical strength of messenger RNA pseudoknots and ribosomal frameshifting. Proc Natl Acad Sci USA 104:5830–5835 5: Giedroc DP, Cornish PV. Frameshifting RNA pseudoknots: structure and mechanism. Virus Res. (2009) 139:193–208. 6: Plant EP, et al. (2003) The 9-Å solution: How mRNA pseudoknots promote efficient programmed -1 ribosomal frameshifting. RNA 9:168–174. 7: Amann E, Brosius J, Ptashne M. Vectors bearing a hybrid trp-lac promoter useful for regulated expression of cloned genes in Escherichia coli. Gene. 1983;25:167–178. 8: Thanaraj TA, Argos P. Ribosome-mediated translational pause and protein domain organization. Protein Sci. 1996;5:1594–1612. doi: 10.1002/pro.5560050814. 9: Frederick C, Neidhardt, Philip L, Bloch, David F, Smith (1974) Culture Medium for Enterobacteria. Journal of Bacteriology. 1974: 736-747 10 Kudla G, Murray AW, Tollervey D, Plotkin JB. Coding-sequence determinants of gene expression in Escherichia coli. Science. 2009;324(5924):255–258. doi: 10.1126/science.1170160.

31

Appendix:

β-galactosidase assay

32

33

34

Appendix: Growth under induced conditions:

35

36

37

38

39

40

41

Appendix: mfold Linear DNA folding at 37° C. [Na+] = 1.0, [Mg++] = 0.0. Structure 1 Folding bases 1 to 99 of unknown dG = -9.92 dH = -154.00 dS = -464.55 Tm = 58.4 10 20 .-ctaattcactggc| t t cg cgtt t gc gcaa a \ -------------^ t c 30 40 .-tgact ga gg \ cc a \ ----- aa 50 .-ct ttaccc ggcg a ccgc a \ -- taattc 60 70 80 ttg acatcccc cagc \ gtcg c cg- accgcttt 90 Structure 2 Folding bases 1 to 99 of unknown dG = -9.92 dH = -154.50 dS = -466.16 Tm = 58.3 10 20 .-ctaattcactggc t t cg cgtt t gc gcaa a \ ------------- t c 30 40 50 .-tgact aaaccct--- ttaccc ggga ggcg a ccct ccgc a \ ----- acacgacgtt taattc 80 70 60 90 cctttc| a gcc g cgg c ------^ t