Multiple layers of temporal and spatial control regulate … · 2011-02-11 · M. Nowrousian et al. / Fungal Genetics and Biology xxx (2006) xxx–xxx 3 ARTICLE IN PRESS Please cite

Fungal Genetics and Biology xxx (2006) xxx–xxx

www.elsevier.com/locate/yfgbi

ARTICLE IN PRESS

Multiple layers of temporal and spatial control regulate accumulation of the fruiting body-speciWc protein APP in Sordaria macrospora

and Neurospora crassa

Minou Nowrousian a, Markus Piotrowski b, Ulrich Kück a,¤

a Lehrstuhl für Allgemeine und Molekulare Botanik, Ruhr-Universität Bochum ND 7/130, Universitätsstr. 150, 44780 Bochum, Germanyb Lehrstuhl für PXanzenphysiologie, Ruhr-Universität Bochum, 44780 Bochum, Germany

Received 9 August 2006; accepted 25 September 2006

Abstract

During fungal fruiting body development, specialized cell types diVerentiate from vegetative mycelium. We have isolated a proteinfrom the ascomycete Sordaria macrospora that is not present during vegetative growth but accumulates in perithecia. The protein wassequenced by mass spectrometry and the corresponding gene was termed app (abundant perithecial protein). app transcript occurs onlyafter the onset of sexual development; however, the formation of ascospores is not a prerequisite for APP accumulation. The transcript ofthe Neurospora crassa ortholog is present prior to fertilization, but the protein accumulates only after fertilization. In crosses of N. crassa�app strains with the wild type, APP accumulates when the wild type serves as female parent, but not in the reciprocal cross; thus, thepresence of a functional female app allele is necessary and suYcient for APP accumulation. These Wndings highlight multiple layers oftemporal and spatial control of gene expression during fungal development.© 2006 Elsevier Inc. All rights reserved.

Keywords: Fruiting body development; Sordaria macrospora; Neurospora crassa; Gene expression; Abundant perithecial protein

1. Introduction

During sexual development, many Wlamentous ascomy-cetes form complex three-dimensional fruiting bodies forthe protection and dispersal of the ascospores (Moore-Lan-decker, 1992; Pöggeler et al., 2006a). Besides cells thatdirectly participate in karyogamy and meiosis, many morespecialized cell types are formed that comprise the maturefruiting body. Of the 28 recognized cell types of Neurosporacrassa, 15 occur only during fruiting body formation (Bistiset al., 2003). This also implies that gene expression changesdrastically during sexual development, as many genesinvolved in diVerentiation processes are expressed only dur-ing distinct phases of the life cycle or in speciWc tissues.Hence, a number of studies have been undertaken with the

* Corresponding author. Fax: +49 234 3214184.E-mail address: [email protected] (U. Kück).

1087-1845/$ - see front matter © 2006 Elsevier Inc. All rights reserved.doi:10.1016/j.fgb.2006.09.009

Please cite this article in press as: Nowrousian, M. et al., Multiple lafruiting body-speciWc protein APP in Sordaria macrospora . . . , Fun

aim to identify genes diVerentially expressed during fruitingbody development in diVerent ascomycetes. Many of thesehave focused on the analysis of transcripts using diVerentialscreening techniques or, more recently, macro- and micro-arrays, and have led to the identiWcation of genes that areexpressed during fruiting body formation (Lacourt et al.,2002; Lee et al., 2006; Li et al., 2005; Nelson et al., 1997a;Nelson and Metzenberg, 1992; Nowrousian et al., 2005;Pöggeler et al., 2006b; Qi et al., 2006). However, analyseswere also undertaken to characterize development-speciWcproteins, and an early investigation by Nasrallah and SrbidentiWed an acidic protein speciWcally associated with sex-ual development in several Neurospora species (Nasrallahand Srb, 1973). A similar protein from fruiting bodies (peri-thecia) of the related pyrenomycete Sordaria Wmicola wasfound to cross-react with antibodies against the N. crassaand Neurospora tetrasperma fruiting body-speciWc protein(Nasrallah and Srb, 1977). During sexual development, thisN. crassa and N. tetrasperma protein constitutes up to 35%

yers of temporal and spatial control regulate accumulation of thegal Genet. Biol. (2006), doi:10.1016/j.fgb.2006.09.009

mailto: [email protected]

mailto: [email protected]

2 M. Nowrousian et al. / Fungal Genetics and Biology xxx (2006) xxx–xxx

ARTICLE IN PRESS

and 20%, respectively, of total perithecial protein; the pro-tein was not detected in vegetative mycelium or conidiosp-ores (Nasrallah and Srb, 1973). The massive accumulationof the protein and its strict correlation with perithecialdevelopment make up an intriguing combination of charac-teristics; and it was speculated early on that the proteinmight be involved in fruiting body development (Nasrallahand Srb, 1973, 1977, 1978). However, the identity of theprotein and the corresponding gene had not been deter-mined yet.

In recent years, we have studied fruiting body formationof Sordaria macrospora, an ascomycete that has long beenused as a model organism of fruiting body development(Pöggeler et al., 2006a). Using a collection of sterilemutants, several genes essential for perithecial developmenthave already been isolated from S. macrospora, and genesdiVerentially expressed in the mutant strains were identiWedusing cross-species microarray hybridizations (Kück, 2005;MasloV et al., 1999; Nowrousian et al., 1999, 2005; Pöggelerand Kück, 2004). Sordaria macrospora is a close relative ofN. crassa, but in contrast to the latter, it is homothallic anddoes not produce any asexual spores. A comparison of 85genes from S. macrospora and N. crassa showed that theaverage nucleic acid identity within exons is close to 90%,and that their genomes are highly syntenic in both geneorder and orientation (Nowrousian et al., 2004). This madeit likely that a homolog to the acidic fruiting body-speciWcprotein from N. crassa might also be found in S. macros-pora, especially as a protein with similar antigenic proper-ties was detected in S. Wmicola (Nasrallah and Srb, 1977).Thus, in this study we set out to address the following fourkey questions: (I) Does a similar protein accumulate in theperithecia of S. macrospora? (II) If so, what is the encodinggene? (III) How is the gene’s development-speciWc expres-sion regulated? (IV) Does the protein play a role in fruitingbody formation in fungi?

2. Material and methods

2.1. Strains, growth conditions and transformation

S. macrospora and N. crassa strains used in this studyare given in Table 1. Unless stated otherwise, standardgrowth conditions and transformation protocols for S.macrospora were as described (MasloV et al., 1999; Now-rousian et al., 1999). For RNA and protein extraction fromcultures developing fruiting bodies, S. macrospora wasgrown at 25 °C in Xoating culture as described (Nowrou-sian et al., 2005). For perithecial protein preparations, S.macrospora was inoculated on solid medium. For extrac-tions from vegetative mycelium, S. macrospora was inocu-lated into an Erlenmeyer Xask with 100 ml of liquidmedium and shaken at 130 rpm as described before (Now-rousian and Cebula, 2005). N. crassa was grown in standardmedia (Vogel’s minimal medium for conidiation, syntheticcrossing medium for sexual development) as described(Davis and deSerres, 1970). For crosses, female strains were

Please cite this article in press as: Nowrousian, M. et al., Multiple lfruiting body-speciWc protein APP in Sordaria macrospora . . . , Fun

grown for 6 days at 25 °C on liquid or solid synthetic cross-ing medium and fertilized with conidial suspensions fromstrains of the opposite mating type. Alternatively, twostrains were inoculated on opposite sides of strips of Wlterpaper immersed in liquid synthetic crossing medium.

2.2. Preparation and analysis of RNA

RNA was prepared as described previously (Yardenet al., 1992). Northern blots were prepared and hybridizedaccording to standard techniques (Maniatis et al., 1982)using 32P-labeled DNA probes.

2.3. Preparation of protein extracts

Protein extraction was performed as described previ-ously (Nasrallah and Srb, 1973) with the following modiW-cations: mycelium was harvested by Wltration andmycelium or perithecia were homogenized in 0.5–2 ml ofphosphate buVer (0.1 M sodium phosphate, pH 7.0). Aftercentrifugation (30 min, 4 °C, 12,000 rpm), the protein con-tent of the supernatant was determined as described previ-ously (Bradford, 1976). Three to six microgram of proteinextracts were separated by native PAGE or SDS–PAGE(Andrews, 1986; Laemmli, 1970).

2.4. In-gel digest and de novo-sequencing by mass spectrometry

For sequencing of the S. macrospora APP polypeptide, aCoomassie-stained protein band from a native gel was

Table 1Strains used in this study

Strain Genotype Reference

S. macrosporaS48977 Wild type Our collectionM8871 pro1 MasloV et al. (1999)S24117 pro11 Pöggeler and Kück (2004)S22528 pro22 Our collectionS38717 pro40 Our collectionS46357 pro41 Our collectionS10938 per5 Nowrousian et al. (1999)�app T1-3 �app This study

N. crassa74-OR23-1VA

(FGSC2489)mat A, wild type Fungal Genetics Stock Center

ORS-SL6a (FGSC4200)

mat a, wild type Fungal Genetics Stock Center

FGSC11297 �NCU04533.2; mat A (�app; mat A)

Colot et al. (2006)

FGSC11298 �NCU04533.2; mat a (�app; mat a)

Colot et al. (2006)

FGSC11283 �NCU00467.2; mat A Colot et al. (2006)FGSC11284 �NCU00467.2; mat a Colot et al. (2006)FGSC11293 �NCU02794.2; mat A Colot et al. (2006)FGSC11292 �NCU02794.2; mat a Colot et al. (2006)FGSC11299 �NCU08741.2; mat A Colot et al. (2006)FGSC11300 �NCU08741.2; mat a Colot et al. (2006)

ayers of temporal and spatial control regulate accumulation of thegal Genet. Biol. (2006), doi:10.1016/j.fgb.2006.09.009

M. Nowrousian et al. / Fungal Genetics and Biology xxx (2006) xxx–xxx 3

ARTICLE IN PRESS

digested in the gel with sequencing grade modiWed trypsin(Promega) as described previously (Jensen et al., 1998).After extraction from the gel, peptides were desalted usingZipTips C18 (Millipore). Mass spectrometric measure-ments were carried out on a quadrupole/time-of-Xighthybrid mass spectrometer (Q-TOF2, Micromass). The sam-ple was introduced as nanospray in positive ion mode. MS-spectra were recorded from m/z 400–1600 with 2.4 s. inte-gration time. Doubly or triply charged molecules wereselected manually for fragmentation in MS/MS mode.Interpretation of MS/MS-spectra was aided by the Max-Ent3 algorithm and the BioLynx software-package of Max-Lnyx 3.4 (Micromass).

2.5. Cloning of S. macrospora app cDNA and DNA

A partial fragment of app (SMU4533) DNA has beencloned previously (Nowrousian et al., 2005). Using thissequence information, cDNA sequences of app wereampliWed by RACE (rapid ampliWcation of cDNA ends).For 5� RACE, cDNA was generated from 1 �g of DNase I-treated total RNA using 600 U Superscript II reversetranscriptase (Invitrogen) as described previously (Now-rousian et al., 2005). A poly(A) tail was added to thecDNA using terminal transferase from the 5�/3� RACEkit (Roche) according to the manufacturer’s protocol.cDNA corresponding to the 5�-end of app was then ampli-Wed using HotMasterTaq polymerase (Eppendorf) in tworounds of PCR. In the Wrst round, 5 �l of the tailing reac-tion were ampliWed with primers SMU4533rev (5� GCCATACTGATCTTCTCCGGTGG) and oligo dT primer(Roche); in the second round, 1 �l of the Wrst round PCRsample was ampliWed with SMU4533-1 (5� GTCGTTGAGAGAACCGGGCACGG) and anchor primer (Roche).For 3� RACE, cDNA was generated from 1 �g of totalRNA using 600 U Superscript II reverse transcriptase(Invitrogen) and 1.25 �M oligo dT-anchor primer(Roche). cDNA fragments corresponding to the 3�-end ofapp were ampliWed using HotMasterTaq polymerase(Eppendorf) and primers SMU4533for (5�GAAAGACTACGAAGGCACCGGCG) and PCRanchor primer (Roche). Genomic DNA of regions adja-cent to the app open reading frame were ampliWed byinverse PCR. Genomic DNA from the S. macrosporawild-type was digested with SalI or BglII, and fragmentswere self-ligated in a total volume of 400 �l using 10 U T4DNA ligase (Roche). Samples were precipitated andresuspended in 100 �l A. dest., and genomic DNA frag-ments were ampliWed from 10 �l of the samples usingprimers SMU4533-1 and SMU4533-2 (5� GTTACGACGGCGGTGTATGTCAGGG) with HotMasterTaq poly-merase (Eppendorf). If necessary, a second, nested PCRwas performed from 1 �l of the Wrst round PCR usingprimers SMU4533-3 (5� CTTGCCCGAGAGGGTAGACGTCG) and SMU4533-4 (5� GGAGACGAAGGAGGTGGATGTGG). PCR fragments were cloned into vec-tor pDrive (Qiagen) and sequenced (MWG Biotech).


2.6. Generation of S. macrospora �app strains

Generation of the app knockout construct pSF41-6 con-taining the hph gene and app Xanking regions was done asdescribed previously using oligos SMU4533Pst (5� GCTGCAGCCTCCACCCACTTCTACCACCGCC) and SMU4533Bam (5� CGGATCCTTTTGGGGTTGGGTTGGTGGTTGG) to amplify 0.55 kb upstream of app, and oligosSMU4533Nhe (5� GGCTAGCAGGACGAGGATAGGGACAAGG) and SMU4533Not (5� GGCGGCCGCGCCTACCAATCCCAC) to amplify 1.1 kb downstream of app(Nowrousian and Cebula, 2005). The knockout plasmidpSF41-6 was digested with PstI and NotI and transformedinto an S. macrospora �ku70 strain that allows preferentialrecovery of transformants with homologous integrationevents (Pöggeler and Kück, 2006). Transformants werescreened for homologous integration by PCR and Southernblot analysis as described previously (Nowrousian andCebula, 2005), and six independent transformants carryinga �app allele were identiWed. All strains had identical, wildtype-like phenotypes. Primary transformants were crossedagainst the wild-type strain to generate �app strains with-out the �ku70 background, and strain �app T1-3 was cho-sen for further analyses.

2.7. Cloning of app–egfp fusion constructs

For expression of an app–egfp fusion under control of aconstitutive promoter, the open reading frame of app wasampliWed from S. macrospora genomic DNA using primersSMU4533Ncofor (5� GAAAGACTACGAAGGCACCGGCG) and SMU4533Ncorev (5� GCCATACTGATCTTCTCCGGTGG) thereby introducing NcoI restriction sites.The resulting fragment was subcloned into pDrive(Qiagen), sequence-veriWed and the NcoI fragment contain-ing app was cloned into vector pEH3. This vector allowsexpression of the app–egfp fusion under control of the gpdpromoter/5� UTR and the trpC terminator of Aspergillusnidulans. These regulatory regions result in a strong consti-tutive expression in S. macrospora (Pöggeler et al., 2003).

For expression of an app–egfp fusion under control ofthe app regulatory regions, the upstream regions (0.6 kb)and open reading frame of app were ampliWed from S. mac-rospora genomic DNA using primers SMU4533Pst2 (5� CTGCAGTGATGTTCGGTTAGGCGTGAGCACC) andSMU4533Nco2 (5� CCATGGCCTCCGAAGGCTTGTTATCAACCAA). The downstream regions (1.1 kb) of appwere ampliWed from S. macrospora genomic DNA usingprimers SMU4533NotIdown (5� GCGGCCGCGGAGGGGCAGGACGAGGATAGGGA) and SMU4533NotIup(5� GCGGCCGCGCCTACCAATCCCACTAC). The result-ing fragments were subcloned into pDrive (Qiagen) andsequence-veriWed. The PstI/NcoI fragment containing appupstream regions and the open reading frame was thencloned into vector pSM2nat, a derivative of EGFP reporterplasmid pSM2 (Pöggeler et al., 2003) where the hph resis-tance cassette was replaced with the ApaI/EcoRI nourseo-



ARTICLE IN PRESS

thricin resistance cassette from vector pD-NAT1 (Kückand HoV, 2006). The resulting vector pAPP1-1 was digestedwith NotI and the NotI fragment containing the app down-stream regions was cloned into pAPP1-1, resulting in plas-mid pAPP1-2. This vector allows expression of the app–egfp fusion under control of the app upstream and down-stream regions.

2.8. Microscopy

For microscopy of mycelia undergoing sexual develop-ment, S. macrospora strains were grown on glass slides witha thin layer of corn meal extract (25 g corn meal per literwater, 12 h 60 °C, diluted 1:1 in water) solidiWed with 0.8%agar. Slides were placed in petri dishes on a spacer. Formicroscopy of vegetative mycelium, strains were grown inshaken culture as described previously (Nowrousian andCebula, 2005). After inoculation, samples were incubated incontinuous light at 25 °C for 2–4 days.

Fluorescence and light microscopic investigations werecarried out with an AxioImager microscope (Zeiss, Jena,Germany) using an an XBO 75 xenon lamp for Xuorescenceexcitation. Fluorescence was studied using Chroma Wlter setC65077 for detection of EGFP. Images were captured witha Photometrix Cool SnapHQ camera (Roper ScientiWc) andMetaMorph (Vers. 6.3.1, Universal Imaging). Recordedimages were edited with MetaMorph and Adobe Photo-shop CS2.

3. Results

3.1. The abundant development-speciWc protein in fruiting bodies of S. macrospora and N. crassa is encoded by app

Crude protein extracts from vegetative mycelium andfruiting bodies of S. macrospora were separated on a non-denaturing gel (Fig. 1). Similar to previous Wndings in sev-eral Neurospora species (Nasrallah and Srb, 1973), a strong,fast-migrating protein band was observed only in extractsderived from perithecia, but not from vegetative mycelium.This indicates that a protein with properties similar to theNeurospora protein, i.e. present only in sexually developingtissue and acidic because of its migration pattern undernon-denaturing conditions, is also found in S. macrospora.The protein band was cut from the gel, the slice washomogenized and used for SDS–PAGE (Fig. 1). The pro-tein extracted from a native gel appears as a single band onthe SDS gel, corresponding to a prominent band of»24 kDa in total protein extracts from perithecia. Theapparent molecular mass of »24 kDa is similar to themolecular mass of »20 kDa that was found for the N.crassa protein (Nasrallah and Srb, 1973). The protein bandwas then cut from a non-denaturing gel, and tryptic pep-tides were sequenced by mass spectrometry using a quadru-pole/time-of-Xight hybrid mass spectrometer. In total,sequences for eight diVerent tryptic peptides were obtained(Fig. 2). To our surprise, sequence comparisons with the


peptide sequences showed that all eight peptides are identi-cal to parts of the derived amino acid sequence ofSMU4533, a gene that had been found previously in amicroarray analysis of genes that are diVerentiallyexpressed in several S. macrospora developmental mutants(Nowrousian et al., 2005). Altogether, the sequenced pep-tides cover 106 amino acids, representing 50% of the pre-dicted 208 amino acid residues of SMU4533 (Fig. 2). Thus,the abundant perithecial protein from S. macrospora isencoded by the SMU4533 gene, and the gene was thereforerenamed app (abundant perithecial protein). In our previ-ous analysis, only a partial genomic sequence of app hadbeen obtained (Nowrousian et al., 2005); therefore, weampliWed cDNA fragments covering the full-length cDNAof app using RACE, and genomic DNA of sequencesupstream and downstream of app using inverse PCR. Com-parison of cDNA and genomic DNA showed that app doesnot contain any introns; the cDNA length of 986 bp is con-Wrmed by the Wnding of a »1.0 kb transcript on Northernblots (data not shown). The predicted isolelectric point (pI)of APP is 4.53, and this Wts well with the observation thatdue to its migration behavior on native gels, APP should bean acidic protein.

Six independent S. macrospora �app strains were gener-ated by homologous replacement of the app open readingframe with a hygromycin resistance cassette. As expected, theknockout strains do not express the app transcript and theAPP band is missing in protein extracts of the knockoutstrains (Fig. 1), further conWrming that app encodes theabundant perithecial protein. However, despite the absenceof APP protein, fruiting body formation of the knockoutstrains is normal; generally, the �app mutants do not diVerfrom the wild type during vegetative growth or sexual devel-opment. This is similar to mutants in the corresponding N.crassa ortholog (see below).

Fig. 1. An acidic protein is present in perithecial extracts from S. macros-pora and missing in a �app strain. (A) Separation of proteins from myce-lium and perithecia by native gel electrophoresis. Three micrograms ofprotein extract from mycelium and perithecia, respectively, were separatedby PAGE and Coomassie-stained. The arrow indicates the protein bandthat was sequenced by mass spectroscopy. (B) Size estimation of APP. Theband representing APP was excised from a native gel as shown in (A) andthe protein was subjected to SDS–PAGE. Perithecial protein extract wasused as a control. (C and D) Northern blot (C) and SDS–PAGE (D) analy-sis of app expression in the wild type and the �app strain T1-3 after 5 days.



ARTICLE IN PRESS

The app ortholog from N. crassa is an open readingframe named NCU04533.2 in the N. crassa genome (Gala-gan et al., 2003). It encodes a predicted protein of 207amino acids with 80% amino acid sequence identity to APP(Fig. 2). As described below, in perithecia from a homozy-gous cross of NCU04533.2 knockout strains, no accumula-tion of the abundant perithecial protein was observed, incontrast to its accumulation in fruiting bodies from wild-type crosses. In connection with all other available data,this conWrms that NCU04533.2 is indeed the open readingframe encoding the abundant perithecial protein APP fromN. crassa.

3.2. Sequence analysis of the abundant perithecial protein

Comparisons of S. macrospora APP with sequences inpublic databases as well as the sequenced genomes of otherfungi showed that there are only a few putative homologs(Fig. 2). The most similar protein apart from the N. crassaAPP protein is a putative protein from the pathogenic asco-mycete Coccidioides immitis. No other possible homologfrom any other fungus could be identiWed by BLASTsearches (Altschul et al., 1997). These Wndings are quite sur-prising as there are a number of whole genome sequencesfrom fungi that are more closely related to S. macrosporaand N. crassa than C. immitis is. However, no homologswere found in the genomes of Magnaporthe grisea (Deanet al., 2005), Podospora anserina (http://podos-pora.igmors.u-psud.fr/index.html), Chaetomium globosum,Fusarium graminearum, and Sclerotinia sclerotiorum (http://www.broad.mit.edu/annotation/fungi/fgi/index.html), andA. nidulans (Galagan et al., 2005), all of which have beenfully sequenced. However, this Wts with data obtained by


Nasrallah and Srb, who found immunologically cross-reac-tive proteins in extracts from S. Wmicola and Gelasinosporacerealis, but not in P. anserina or A. nidulans (Nasrallahand Srb, 1977). At present, it is not clear whether thehomologous C. immitis open reading frame represents afunctional expressed gene. A similar open reading framecan be found in the genome of the related pathogen Coccid-ioides posadasii, but an analysis of SAGE tags from C.posadasii gave no positive result; thus, it is not clearwhether the gene is expressed (Ellen Kellner and MarcOrbach, personal communication).

3.3. Accumulation of the abundant perithecial protein is restricted to fruiting bodies, but is independent of ascosporogenesis in S. macrospora

Under laboratory conditions, the S. macrospora wild-type is able to complete its life cycle within 6 days, and todate, a number of developmental mutants with blocks atdiVerent stages of the life cycle have already been character-ized (Pöggeler et al., 2006a). In a previous analysis, app wasindependently identiWed as a gene whose transcript levelsare downregulated in the developmental mutants pro1,pro11, and pro22 of S. macrospora (Nowrousian et al.,2005). These mutants can only form fruiting body precur-sors, so-called protoperithecia (MasloV et al., 1999; Pögg-eler and Kück, 2004). We have now analyzed app transcriptand protein levels in these three mutants as well as the threemutants pro40, pro41, and per5 (Figs. 3A and B). Mutantspro40 and pro41 have a block at the protoperithecial stage,similar to mutants pro1, pro11, and pro22; however, themutants are non-allelic and carry mutations in Wve diVerentgenes that are essential for fruiting body development in

Fig. 2. Multiple alignment of the S. macrospora APP and putative homologs from other fungi. The multiple alignment was created using CLUSTALX(Thompson et al., 1997) with the following sequences: S.m., Sordaria macrospora APP (emb|CAE00781.1); N.c., Neurospora crassa APP (ref|XP_323886.1);C.i., Coccidioides immitis CIMG_08473 (gb|EAS29727.1). Jalview was used to visualize the alignment (Clamp et al., 2004). Amino acid residues conservedin all three sequences are given in dark blue, residues conserved in two sequences in light blue. Peptides from the S. macrospora APP protein that weresequenced by mass spectrometry are boxed.


http://podospora.igmors.u-psud.fr/index.html



http://www.broad.mit.edu/annotation/fungi/fgi/index.html




ARTICLE IN PRESS

S. macrospora. pro1 encodes a transcription factor (MasloVet al., 1999; Pöggeler and Kück, 2004), and pro11 a WD40protein with homology to the mammalian protein striatin(Pöggeler and Kück, 2004). pro22 and pro40 encode proteinswith similarity to the hyphal fusion proteins HAM-2 and SO,respectively, in N. crassa (Fleissner et al., 2005; Xiang et al.,


2002); and pro41 codes for a putative membrane protein thathas not been characterized previously in other organisms(Kück et al., unpublished data). In contrast to the promutants, mutant per5 carrying a defective ATP citrate lyasegene (acl1) is able to form perithecia with ascus precursors,but no mature ascospores (Nowrousian et al., 1999). Among

Fig. 3. Expression of app in S. macrospora. (A and B) Expression of app in developmental mutants. Northern blot (A) and SDS–PAGE (B) analysis of appexpression in the wild type and six developmental mutants after 4 days. (C and D) Time course of app expression in S. macrospora. Samples were takenfrom vegetative mycelium of the wild type (wt veg., shaken culture) and mycelium undergoing sexual development from the wild type (wt sex., Xoating cul-ture) and mutant pro1 (pro1 sex., Xoating culture). (C) Northern blot analysis with probes for app and gpd as control. (D) SDS–PAGE analysis of crudeprotein extracts. (E) APP is present in the non-cellular matrix as well as in perithecial cells. Perithecia were harvested and the non-cellular matrix (NM)was separated from the perithecial cells (PC, comprising cells of the wall and of the ascus rosette). Protein extracts from total perithecia (T) were used as acontrol; protein extracts were analyzed by SDS–PAGE. RNA and protein extractions were performed at least twice from independently grown mycelia,results from only one representative experiment are shown. The arrow indicates the APP protein.



ARTICLE IN PRESS

the six mutants that were analyzed, per5 is the only one thatexpresses app in a wild type-like manner, i.e. both transcriptand protein can be detected, whereas in the pro mutants,neither transcript nor protein are present (Figs. 3A and B).This Wnding indicates that the formation of protoperitheciais not suYcient to trigger app expression, whereas the matu-ration of ascospores is not a prerequisite for APP accumu-lation.

To gain further insights into the regulation of appexpression, we analyzed transcript and protein levels in thewild type and the developmental mutant pro1 in a timecourse from two to six days, covering the life cycle of S.macrospora (Figs. 3C and D). When grown under condi-tions that allow sexual development, the app transcript waspresent in the wild type throughout the life cycle with apeak after 4 days (Fig. 3C). Under conditions that allowonly vegetative growth, i.e. in shaken culture, no transcriptwas observed, indicating strong transcriptional control ofapp expression. In mutant pro1 grown under conditions forsexual development, no transcript was detected throughoutthe life cycle. Correspondingly, APP protein did not accu-mulate in the mutant or in the wild type when grown vege-tatively (Fig. 3D). In the wild type under conditions ofsexual development, the prominent band of APP protein is


observed after four and six days whereas the transcript isalready present after two days; thus, the app transcript isdetectable much earlier than the protein, probably indicat-ing an additional level of posttranscriptional expressioncontrol.

We also investigated where in the S. macrospora fruitingbody APP is present. For this purpose, the non-cellularmucilagenous perithecial matrix that surrounds the asciwas separated from the perithecial cells, i.e. the perithecialwall and the asci and sterile hyphae from the ascus rosette(Fig. 3E). APP was found to be present in both cellular andnon-cellular compartments whereas other proteins werediVerentially enriched in one compartment, e.g. a protein of»26 kDa that was enriched in the non-cellular matrix and aprotein of less than 15 kDa that was found preferentially inthe perithecial tissue (Fig. 3E).

To further analyze app expression in time and space, theS. macrospora wild-type was transformed with app–egfpfusion constructs under the control of either the app pro-moter/5� UTR and app 3� UTR/downstream regions or thegpd promoter/5� UTR and trpC 3� UTR/downstreamregions from A. nidulans. Microscopic analysis showed thatthe APP–EGFP protein is present in the cytoplasm of vege-tative hyphae as well as fruiting bodies throughout the life

Fig. 4. Microscopic analysis of APP–EGFP fusion proteins. Plasmids pSE124-1 and pAPP1-2 (shown on the top left and right, respectively) were trans-formed into the S. macrospora wild-type. pSE124-1 expresses the app open reading frame (orange) fused to egfp (green) under the control of the Aspergil-lus nidulans gpd promoter/5� UTR and the trpC terminator region (blue). pAPP1-2 expresses the app–egfp fusion under the control of the app promoter/5�

UTR and the app terminator region (orange). Transformants with the two constructs were analyzed after growth in shaken culture (vegetative, after 2days) or on solid medium (protoperithecia after 3 days, young perithecia after 4 days). DIC/BF; diVerential interference contrast was used for observationof vegetative hyphae and protoperithecia, and bright Weld for young perithecia. Bar indicates 20 �m for vegetative hyphae and protoperithecia, and 100 �mfor young perithecia.



ARTICLE IN PRESS

cycle when expressed under control of the A. nidulans regu-latory regions that convey constitutive expression in S.macrospora (Fig. 4). When expressed under the control ofapp regulatory regions, the APP–EGFP fusion protein can-not be detected in hyphae that are grown vegetatively, butis present when the transformants are grown under condi-tions that allow sexual development (Fig. 4). Under the lat-ter conditions, the fusion protein is present inprotoperithecia and perithecia, and it can also be detectedin hyphae that carry young protoperithecia, but is notfound in the surrounding mycelium (Fig. 4). These data arefurther proof that APP is predominantly a fruiting body-speciWc protein and that its expression is subject to tempo-


ral and spatial control mechanisms depending on appupstream and downstream genomic regions.

3.4. Accumulation of the abundant perithecial protein in N. crassa is controlled at the transcript level before fertilization and posttranscriptionally after fertilization and is restricted to fruiting bodies

As app expression seems to be tightly controlled at diVer-ent levels in S. macrospora, we wondered whether similarmechanisms of expression control might be active in N.crassa. In contrast to the homothallic S. macrospora, N.crassa is heterothallic; thus, protoperithecia can only

Fig. 5. Expression of app in N. crassa. (A) Expression of app in the N. crassa wild-type and developmental mutants. Northern blot analysis of app expres-sion in the wild type (wt) and three developmental mutants, gene numbers as indicated above the lanes. Mycelia were grown under conditions allowingprotoperithecia formation. Strains were mat A, and results with mat a strains were the same. (B–F) Expression of app before and after fertilization in N.crassa. Northern blot analysis (B) of app expression in mycelium grown vegetatively and mycelium grown under conditions that allow sexual developmentwith or without fertilization. Time of growth in days as indicated above the lanes. Northern blot (C and E) and SDS–PAGE (D and F) analysis of appexpression in mycelium grown under conditions that allow sexual development with or without fertilization. Time of growth is indicated above lanes forC/D, and is 14 days for E/F. Mycelia were fertilized with conidial suspensions of the opposite mating type after 6 days in C/D; in E/F, fertilized myceliawere generated by inoculating two strains of opposite mating type at the same time. Under these conditions, maturation of perithecia is reached earlier,and RNA can be extracted more readily (E) whereas after fertilization with conidia (C), hardly any RNA could be extracted after 10 days. (G) N. crassaAPP accumulates in perithecia. SDS–PAGE analysis of crude protein extracts from fertilized mycelia including perithecia (total), perithecia separatedfrom residual mycelia (perithecia), and the residual mycelium without perithecia (mycelium). The arrow indicates the APP protein.



ARTICLE IN PRESS

develop into mature perithecia after fertilization. First, weanalyzed whether sterile mutants that form only protoperi-thecia express the N. crassa app. Three diVerent mutantswere obtained from the Neurospora knockout project(Colot et al., 2006). Two of the mutants were knockouts ofthe genes NCU08741.2, the ortholog of the S. macrosporapro11 gene (Pöggeler and Kück, 2004), and NCU02794.2,the ortholog of the S. macrospora pro40 gene (Kück et al.,in preparation). The third mutant was a knockout mutantof NCU00467.2, an ortholog of the A. nidulans COP9 sig-nalosome subunit 5 that is essential for sexual developmentin A. nidulans (Busch et al., 2003). The S. macrospora ortho-log of NCU00467.2 has been shown to be upregulated in S.macrospora during sexual development (Nowrousian andKück, 2006). All three N. crassa knockout mutants are ableto form protoperithecia, but are unable to develop matureperithecia after fertilization, and thus are female sterile(data not shown). The mutants were grown under condi-tions that allow protoperithecium formation. Under theseconditions, the N. crassa wild-type displays high app tran-script levels whereas in the mutants, no app transcript wasdetected (Fig. 5A). Thus, similarly to S. macrospora, N.crassa mutants that develop protoperithecia but no matureperithecia do not express app.

We then analyzed app expression in vegetative myceliumand mycelium grown under conditions that allow protoper-ithecium formation with or without fertilization (Figs. 5B–F). As in S. macrospora, the app transcript in N. crassa isnot observed in vegetative mycelium, but can be detected inmycelium that develops protoperithecia, independent offertilization (Figs. 5B, C, and E). Under the conditions usedin these experiments, perithecia in fertilized cultures reachmaturation after 14 days when strains of opposite matingtype were inoculated together (Figs. 5E and F) or 16 dayswhen strains were fertilized with conidia of the oppositemating type after 6 days (Figs. 5B–D). Under the latter con-ditions, hardly any RNA could be extracted after 10 days(Fig. 5C), whereas RNA could be extracted more readilywhen strains of opposite mating type were inoculated at thesame time (Fig. 5E), thus making the analysis of both RNAand protein levels in mature cultures more feasible. Up to10 days, no APP accumulation can be observed in totalprotein extracts (Fig. 5D); however, after 13 days, APP ispresent as a strong band in crude protein extracts (Figs. 5Dand F). No APP is accumulated in unfertilized myceliathroughout the complete time even though the transcript ispresent all the time (Figs. 5D and F). These data indicatethat, similar to S. macrospora, both transcriptional andposttranscriptional levels of control tightly regulate appexpression in N. crassa; transcriptional control regulatesapp transcript levels prior to fertilization, whereas an addi-tional level of posttranscriptional control seems to activateAPP accumulation after fertilization.

In their previous analysis, Nasrallah and Srb alreadyobserved that the abundant perithecial protein from N.crassa is present in perithecia, but absent from vegetativemycelium grown in submersed liquid culture (Nasrallah


and Srb, 1973). However, it remained unclear whether afterfertilization the protein is present only in perithecia or alsoin the neighboring mycelium. To address this question, weanalyzed protein extracts from perithecia and the sur-rounding mycelium separately (Fig. 5G). The band repre-senting APP is present only in perithecia, but not in proteinextracts from the mycelium carrying the perithecia, thusconWrming the microscopic data from S. macrospora, whereAPP is also abundant in fruiting bodies but not in vegeta-tive hyphae (Fig. 4).

3.5. Accumulation of the abundant perithecial protein in N. crassa requires a functional female app allele

To further analyze app from N. crassa, we obtainedknockout strains of NCU04533.2 (app) in both mating typebackgrounds from the N. crassa knockout project (Colotet al., 2006). Since the abundant perithecial protein consti-tutes a major proportion of protein in fruiting bodyextracts, it was speculated early on that the protein plays arole in fruiting body development (Nasrallah and Srb,1973). However, N. crassa �app strains of both matingtypes are fully fertile in homozygous crosses both as maleand female parents. Similarly, the S. macrospora �appstrains are fully fertile, as mentioned above. Under labora-tory conditions, neither perithecial morphology nor devel-opmental timing is signiWcantly diVerent from that of thewild type, and spores from homozygous crosses germinatereadily and with rates similar to wild-type spores in bothN. crassa and S. macrospora (data not shown). This is

Fig. 6. Formation of N. crassa APP is dependent on the female partner ina cross. Separation of proteins from vegetative mycelium and mature peri-thecia from the wild type and �app strains by SDS–PAGE. Crude proteinextract from S. macrospora perithecia was used as a control. Female part-ners in N. crassa crosses were all mat a, male partners were mat A. Myceliawere fertilized with conidial suspensions of the opposite mating type after9 days. Results with reciprocal mating type combinations were identical.



ARTICLE IN PRESS

somewhat surprising because after all, without APP, a largeamount of protein is missing in perithecia, and it is appar-ently not substituted by an increase in the amount of anyother single protein (Figs. 1 and 6).

The N. crassa app knockout strains and the wild typewere analyzed for the presence of the abundant perithecialprotein under conditions of vegetative growth and sexualdevelopment (Fig. 6). As expected, no accumulation of theprotein was seen under conditions of vegetative growth inany strain. In perithecia from crosses of wild-type strains(a£A, Fig. 6), accumulation of a protein of »24 kDa wasobserved, similar to S. macrospora and as described byNasrallah and Srb (1973). In perithecia from a homozygouscross of app knockout strains (�app;a£�app;A), no accu-mulation of the 24 kDa protein was detected. In heterozy-gous crosses of the wild type with an app knockout strain,accumulation of APP protein can only be detected whenthe wild type is the female parent (Fig. 6), indicating thatthe presence of a functional app allele in the male parent isneither necessary nor suYcient for APP accumulation.

4. Discussion

4.1. The abundant development-speciWc protein accumulating in fruiting bodies of S. macrospora and N. crassa is encoded by app

From the analysis of developmental processes in manyorganisms, it has become clear that morphological changesare usually accompanied by distinct patterns of geneexpression. The expression of quite a number of genes isrestricted to, and thus, can be used as a marker for a speciWcdevelopmental process. In an early analysis of diVerences inprotein content of fruiting bodies and vegetative myceliumof Neurospora species, Nasrallah and Srb already observeda protein that constitutes up to 35% of perithecial protein,whereas it was absent from vegetative mycelium or coni-diospores (Nasrallah and Srb, 1973). This highly speciWcexpression pattern led to speculations about a role for theprotein in sexual development (Nasrallah and Srb, 1973,1977, 1978); however, the identity of the protein and theencoding gene remained obscure. In this study, we wereable to sequence the corresponding S. macrospora proteinby mass spectrometry and characterize the encoding gene,app, in the homothallic S. macrospora, and its ortholog inthe heterothallic N. crassa. Interestingly, the S. macrosporaapp gene had previously been identiWed in a microarrayanalysis of genes that are diVerentially regulated in devel-opmental mutants of S. macrospora (Nowrousian et al.,2005).

The data presented here indicate that expression of theapp gene in S. macrospora and N. crassa is tightly con-trolled at several levels and that accumulation of the pro-tein is restricted to fruiting bodies. Therefore, it issurprising that this protein has no apparent function in sex-ual development as knockout mutants of app for both S.macrospora and N. crassa are fully fertile. One explanation


for this Wnding might be that the possible function of APPis redundant and can, in the absence of APP, be taken overby another protein. However, there are no app paralogs inthe N. crassa genome; thus, any protein with APP-likefunction would have to be unrelated in sequence. This is notan unlikely scenario as in a large-scale analysis of syntheticlethal interactions in yeast, it was found that unrelatedgenes involved in the same biological process, but not nec-essarily in the same regulatory pathway, can buVer oneanother in single mutant backgrounds but show a pheno-type in the double mutant strain (Tong et al., 2004).Another possibility is that APP might have functions thatare dispensable under laboratory conditions. Cases of genesthat do not have knockout phenotypes under standard lab-oratory conditions, but have a function in a more naturalenvironment, have already been described from a numberof organisms (de Haan et al., 2002; Fang et al., 2005; Ponteet al., 1998).

4.2. Expression of app is controlled in a time- and space-dependent manner that is conserved in S. macrospora and N. crassa

However, despite the fact that APP is not essential forsexual development, the corresponding gene is an excellentmarker for developmental stages due to its highly speciWcexpression pattern: the accumulation of the N. crassa abun-dant perithecial protein was previously found to berestricted to tissue undergoing sexual development (Nasral-lah and Srb, 1973). Our data show that the lack of APPprotein in vegetative mycelium is mediated at the transcriptlevel in both S. macrospora and N. crassa. Also in bothfungi, app transcript accumulates under conditions thatallow protoperithecia to be formed. However, formation ofprotoperithecia alone is not enough to induce transcriptaccumulation as transcript levels are downregulated in sev-eral developmental mutants of S. macrospora and N. crassaall of which form protoperithecia but no mature perithecia.In contrast, the S. macrospora mutant per5 which is able toform perithecia but not mature ascospores does express appin a wild type-like manner, indicating that formation of thenon-reproductive tissue of the fruiting body but not of theascospores is a prerequisite for app expression (Fig. 7). Itmight be speculated that the progression from the proto-perithecial state to mature perithecia requires at least oneadditional factor that is not necessary for the formation ofprotoperithecia themselves but nevertheless is present dur-ing early stages of development and might induce appexpression. If this factor were missing in the pro mutants,this would explain the lack of app transcript in thesemutants.

In addition to regulation at the transcript level, appexpression is also regulated at a posttranscriptional level in S.macrospora and N. crassa. It was shown earlier that the pro-tein is present at low levels in protoperithecia from N. crassa,but accumulates only after fertilization (Nasrallah and Srb,1973). Our data indicate that this accumulation of APP



ARTICLE IN PRESS

might involve posttranscriptional levels of regulation,because the transcript can be present for days in unfertilizedmycelia without resulting in protein accumulation. In thehomothallic S. macrospora, one cannot distinguish betweenpre- and postfertilization stages; however, app transcriptnoticeably precedes the accumulation of APP proteinand protein accumulation coincides with the time whenprotoperithecia start to develop. It is tempting to speculate thatthis correlates with the formation of dikaryotic hyphae whichwould be the equivalent to fertilization in N. crassa (Fig. 7).

Even though fertilization is necessary for APP to accu-mulate in N. crassa, our analysis of N. crassa �app mutantstrains shows that a male app allele is not required for thisprocess. This Wnding indicates that the majority of APP pro-tein is synthesized in the non-reproductive tissue of the fruit-ing body which is derived from the female parent, not in theascogenous hyphae, because in this case, the presence of awild-type app allele from the male partner should also leadto accumulation of APP. This also implies that after fertil-ization, a signal is relayed to the non-reproductive tissues ofthe fruiting body to induce APP accumulation.

Microscopic analysis of an APP–EGFP fusion protein inS. macrospora shows that APP localizes to the cytoplasm ofcells in the protoperithecium. Further analysis of proteinextracts from mature perithecia from S. macrospora indicatesthat APP is also present in the non-cellular perithecial matrix.These data are consistent with previous Wndings by Nasrallahand Srb who detected the perithecial protein of N. tetra-sperma in the non-cellular material constituting the mucilag-enous matrix surrounding the asci within the perithecium andin perithecial exudate formed at the ostioles prior to sporerelease (Nasrallah and Srb, 1973, 1978). Possibly, APP is syn-thesized in cells of the non-reproductive tissue of the fruitingbody and later released into the perithecial interior.

Taken together, our data show diVerent levels of expres-sion control that regulate app expression in time and space,and that seem to be conserved in S. macrospora and N.crassa. To the best of our knowledge, this is the Wrst descrip-tion of a gene regulated at the transcript level in prefertiliza-tion stages and posttranscriptionally after fertilization in aWlamentous fungus. Several proteins that speciWcally localize


to fruiting bodies have previously been identiWed in a numberof fungi; however, little is known about their mode of regula-tion. One example for a fruiting body-speciWc protein is therhamnogalacturonase ASD-1 from N. crassa (Nelson et al.,1997b). Similar to app, the asd-1 transcript is not present invegetative mycelium grown exponentially, but can bedetected under crossing conditions (Nelson et al., 1997b; Nel-son and Metzenberg, 1992). However, asd-1 transcript is alsofound in vegetative mycelium during the stationary phase, acondition where app was not detected. ASD-1 is found inascogenous hyphae and young asci, but unlike APP, the pro-tein can also be detected in mycelium prior to fertilization(Nelson et al., 1997b). Another example of a gene with anexpression pattern similar to app is cpeA from A. nidulans. Itencodes a catalase-peroxidase that is found in Hülle cellswhich form part of the non-reproductive tissue surroundingthe fruiting body (Scherer et al., 2002; Wei et al., 2001). Inter-estingly, CpeA protein appears a lot later than the corre-sponding transcript indicating a posttranscriptional level ofregulation (Scherer et al., 2002). One might speculate thatmechanisms similar to those regulating app expression in S.macrospora are involved in activating cpeA expression in A.nidulans. However, A. nidulans also is a homothallic fungus,and therefore it is not apparent whether an event similar tofertilization induces CpeA protein accumulation.

The Wnding that transcripts can be expressed in fungalmycelium prior to fertilization while the accumulation ofthe corresponding protein requires fertilization resembleswell-described cases in animal development where maternaltranscripts are deposited in the oocyte and are translatedlater depending on fertilization or egg maturation (Dwor-kin and Dworkin-Rastl, 1990). Further analysis of factorsthat regulate app expression could show whether conceptu-ally similar mechanisms also play a role during morphogen-esis in Wlamentous fungi.

Acknowledgments

We thank Swenja Ellßel and Ingeborg Godehardt forexcellent technical assistance and Prof. Dr. E.W. Weiler(Bochum) for provision of mass spectrometry facilities.

Fig. 7. Model for the regulation of app expression in S. macrospora and N. crassa. The model depicts fruiting body morphogenesis in S. macrospora and N.crassa starting with the vegetative mycelium (left) and leading to mature perithecia (right). Developmental genes are indicated at those steps at whichdevelopment in the corresponding mutant strains is blocked. For further information, see text.



ARTICLE IN PRESS

This study was supported by the Deutsche Forschungs-gemeinschaft (Sonderforschungsbereich 480, Projects A1/A8).

References

Altschul, S.F., Madden, T.L., SchaVer, A.A., Zhang, J., Zhang, Z., Miller,W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new gen-eration of protein database search programs. Nucleic Acids Res. 25,3389–3402.

Andrews, A.T., 1986. Electrophoresis: Theory, Techniques, and Biochemi-cal and Clinical Applications. Oxford University Press, New York.

Bistis, G.N., Perkins, D.D., Read, N.D., 2003. DiVerent cell types in Neu-rospora crassa. Fungal Genet. Newsl. 50, 17–19.

Bradford, M.M., 1976. A rapid and sensitive method for the quantiWcationof microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254.

Busch, S., Eckert, S.E., Krappmann, S., Braus, G.H., 2003. The COP9 sig-nalosome is an essential regulator of development in the Wlamentousfungus Aspergillus nidulans. Mol. Microbiol. 49, 717–730.

Clamp, M., CuV, J., Searle, S.M., Barton, G.J., 2004. The Jalview Javaalignment editor. Bioinformatics 12, 426–427.

Colot, H.V., Park, G., Turner, G.E., Ringelberg, C., Crew, C.M., Litvink-ova, L., Weiss, R.L., Borkovich, K.A., Dunlap, J.C., 2006. A high-throughput gene knockout procedure for Neurospora reveals functionsfor multiple transcription factors. Proc. Natl. Acad. Sci. USA 103,10352–10357.

Davis, R.L., deSerres, D., 1970. Genetic and microbial research techniquesfor Neurospora crassa. Methods Enzymol. 27A, 79–143.

de Haan, C.A.M., Masters, P.S., Shen, X., Weiss, S., Rottier, P.J.M., 2002.The group-speciWc murine coronavirus genes are not essential, buttheir deletion, by reverse genetics, is attenuating in the natural host.Virology 296, 177–189.

Dean, R.A., Talbot, N.J., Ebbole, D.J., Farman, M.L., Mitchell, T.K.,Orbach, M.J., Thon, M., Kulkarni, R., Xu, J.-R., Pan, H., Read, N.D.,Lee, Y.-H., Carbone, I., Brown, D., Oh, Y.Y., Donofrio, N., Jeong, J.S.,Soanes, D.M., Djonovic, S., Kolomiets, E., Rehmeyer, C., Li, W., Har-ding, M., Kim, S., Lebrun, M.-H., Bohnert, H., Coughlan, S., Butler, J.,Calvo, S., Ma, L.-J., Nicol, R., Purcell, S., Nusbaum, C., Galagan, J.E.,Birren, B.W., 2005. The genome sequence of the rice blast fungus Mag-naporthe grisea. Nature 434, 980–986.

Dworkin, M.B., Dworkin-Rastl, E., 1990. Functions of maternal mRNA inearly development. Mol. Reprod. Dev. 26, 261–297.

Fang, G., Rocha, E., Danchin, A., 2005. How essential are nonessentialgenes? Mol. Biol. Evol. 22, 2147–2156.

Fleissner, A., Sarkar, S., Jacobson, D.J., Roca, M.G., Read, N.D., Glass,N.L., 2005. The so locus is required for vegetative cell fusion and post-fertilization events in Neurospora crassa. Eukaryot. Cell 4, 920–930.

Galagan, J.E., Calvo, S.E., Borkovich, K.A., Selker, E.U., Read, N.D., JaVe,D., FitzHugh, W., Ma, L.J., Smirnov, S., Purcell, S., Rehman, B., Elkins,T., Engels, R., Wang, S., Nielsen, C.B., Butler, J., Endrizzi, M., Qui, D.,Ianakiev, P., Bell-Pedersen, D., Nelson, M.A., Werner-Washburne, M.,SelitrennikoV, C.P., Kinsey, J.A., Braun, E.L., Zelter, A., Schulte, U.,Kothe, G.O., Jedd, G., Mewes, W., Staben, C., Marcotte, E., Greenberg,D., Roy, A., Foley, K., Naylor, J., Stange-Thomann, N., Barrett, R.,Gnerre, S., Kamal, M., Kamvysselis, M., Mauceli, E., Bielke, C., Rudd,S., Frishman, D., Krystofova, S., Rasmussen, C., Metzenberg, R.L., Per-kins, D.D., Kroken, S., Cogoni, C., Macino, G., Catcheside, D., Li, W.,Pratt, R.J., Osmani, S.A., DeSouza, C.P., Glass, L., Orbach, M.J., Bergl-und, J.A., Voelker, R., Yarden, O., Plamann, M., Seiler, S., Dunlap, J.C.,Radford, A., Aramayo, R., Natvig, D.O., Alex, L.A., Mannhaupt, G.,Ebbole, D.J., Freitag, M., Paulsen, I., Sachs, M.S., Lander, E.S., Nus-baum, C., Birren, B., 2003. The genome sequence of the Wlamentousfungus Neurospora crassa. Nature 422, 859–868.

Galagan, J.E., Calvo, S.E., Cuomo, C., Ma, L.-J., Wortman, J.R., Batzog-lou, S., Lee, S.-I., Basturkmen, M., Spevak, C.C., Clutterbuck, J., Kapi-tonov, V., Jurka, J., Scazzocchio, C., Farman, M., Butler, J., Purcell, S.,


Harris, S., Braus, G.H., Draht, O., Busch, S., D’Enfert, C., Bouchier, C.,Goldman, G.H., Bell-Pedersen, D., GriYths-Jones, S., Doonan, J.H.,Yu, J., Vienken, K., Pain, A., Freitag, M., Selker, E.U., Archer, D.B.,Penalva, M.A., Oakley, B.R., Momany, M., Tanaka, T., Kumagai, T.,Asai, K., Machida, M., Nierman, W.C., Denning, D.W., Caddick, M.,Hynes, M., Paoletti, M., Fischer, R., Miller, B., Dyer, P., Sachs, M.S.,Osmani, S.A., Birren, B.W., 2005. Sequencing of Aspergillus nidulansand comparative analysis with A. fumigatus and A. oryzae. Nature 438,1105–1115.

Jensen, O.N., Wilm, M., Shevchenko, A., Mann, M., 1998. Sample prepara-tion methods for mass spectrometric peptide mapping directly form 2-DE gels. In: Link, A.J. (Ed.), Methods in Molecular Biology. HumanaPress, Totowa, NJ.

Kück, U., 2005. A Sordaria macrospora mutant lacking the leu1 geneshows a developmental arrest during fruiting body formation. Mol.Genet. Genomics 274, 307–315.

Kück, U., HoV, B., 2006. Application of the nourseothricin acetyltransfer-ase gene (nat1) as dominant marker for the transformation of Wlamen-tous fungi. Fungal Genet. Newsl. 53, 9–11.

Lacourt, I., Duplessis, S., Abbà, S., Bonfante, P., Martin, F., 2002. Isolationand characterization of diVerentially expressed genes in the myceliumand fruit body of Tuber borchii. Appl. Environ. Microbiol. 68, 4574–4582.

Laemmli, U.K., 1970. Cleavage of structural proteins during the assemblyof the head of bacteriophage T4. Nature 227, 680–685.

Lee, S.H., Lee, S., Choi, D., Lee, Y.W., Yun, S.H., 2006. Identifcation of thedown-regulated genes in a mat1-2-deleted strain of Gibberella zeae,using cDNA subtraction and microarray analysis. Fungal Genet. Biol.43, 295–310.

Li, D., Bobrowicz, P., Wilkinson, H.H., Ebbole, D.J., 2005. A mitogen-acti-vated protein kinase pathway essential for mating and contributing tovegetative growth in Neurospora crassa. Genetics 170, 1091–1104.

Maniatis, T., Fritsch, E.F., Sambrooke, J., 1982. Molecular Cloning. ALaboratory Manual. Cold Spring Harbor, Cold Spring Harbor Labo-ratory.

MasloV, S., Pöggeler, S., Kück, U., 1999. The pro1+ gene from Sordariamacrospora encodes a C6 zinc Wnger transcription factor required forfruiting body development. Genetics 152, 191–199.

Moore-Landecker, E., 1992. Physiology and biochemistry of ascocarpinduction and development. Mycol. Res. 96, 705–716.

Nasrallah, J.B., Srb, A.M., 1973. Genetically related protein variants spe-ciWcally associated with fruiting body maturation in Neurospora. Proc.Natl. Acad. Sci. USA 70, 1891–1893.

Nasrallah, J.B., Srb, A.M., 1977. Occurrence of a major protein associatedwith fruiting body development in Neurospora and related ascomyce-tes. Proc. Natl. Acad. Sci. USA 74, 3831–3834.

Nasrallah, J.B., Srb, A.M., 1978. ImmunoXuorescent localization of aphase-speciWc protein in Neurospora tetrasperma perithecia. Exp.Mycol. 2, 211–215.

Nelson, M.A., Kang, S., Braun, E., Crawford, M., Dolan, P., Leonard, P.,Mitchell, J., Armijo, A., Bean, L., Blueyes, E., Cushing, T., Errett, A.,Fleharty, M., Gorman, M., Judson, K., Miller, R., Ortega, J., Pavlova,I., Perea, J., Todisco, S., Trujillo, R., Valentine, J., Wells, A., Werner-Washburn, M., Yazzie, S., Natvig, D.O., 1997a. Expressed sequencesform conidial, mycelial, and sexual stages of Neurospora crassa. FungalGenet. Biol. 21, 348–363.

Nelson, M.A., Merino, S.T., Metzenberg, R.L., 1997b. A putative rhamno-galacturonase required for sexual development of Neurospora crassa.Genetics 146, 531–540.

Nelson, M.A., Metzenberg, R.L., 1992. Sexual development genes of Neu-rospora crassa. Genetics 132, 149–162.

Nowrousian, M., Cebula, P., 2005. The gene for a lectin-like protein istranscriptionally activated during sexual development, but is not essen-tial for fruiting body formation in the Wlamentous fungus Sordariamacrospora. BMC Microbiol. 5, 64.

Nowrousian, M., Kück, U., 2006. Comparative gene expression analysis offruiting body development in two Wlamentous fungi. FEMS Microbiol.Lett. 257, 328–335.



ARTICLE IN PRESS

Nowrousian, M., MasloV, S., Pöggeler, S., Kück, U., 1999. Cell diVerentia-tion during sexual development of the fungus Sordaria macrosporarequires ATP citrate lyase activity. Mol. Cell. Biol. 19, 450–460.

Nowrousian, M., Ringelberg, C., Dunlap, J.C., Loros, J.J., Kück, U., 2005.Cross-species microarray hybridization to identify developmentallyregulated genes in the Wlamentous fungus Sordaria macrospora. Mol.Genet. Genomics 273, 137–149.

Nowrousian, M., Würtz, C., Pöggeler, S., Kück, U., 2004. Comparativesequence analysis of Sordaria macrospora and Neurospora crassa asa means to improve genome annotation. Fungal Genet. Biol. 41,285–292.

Pöggeler, S., Kück, U., 2004. A WD40 repeat protein regulates fungal celldiVerentiation and can be replaced functionally by the mammalianhomologue striatin. Eukaryot. Cell 3, 232–240.

Pöggeler, S., Kück, U., 2006. Highly eYcient generation of signal transduc-tion knockout mutants using a fungal strain deWcient in the mamma-lian ku70 ortholog. Gene 378, 1–10.

Pöggeler, S., MasloV, S., HoV, B., Mayrhofer, S., Kück, U., 2003. VersatileEGFP reporter plasmids for cellular localization of recombinant geneproducts in Wlamentous fungi. Curr. Genet. 43, 54–61.

Pöggeler, S., Nowrousian, M., Kück, U., 2006a. Fruiting body develop-ment in ascomycetes. In: Kües, U., Fischer, R. (Eds.), The Mycota I.Springer, Berlin, Heidelberg, pp. 325–355.

Pöggeler, S., Nowrousian, M., Ringelberg, C., Loros, J.J., Dunlap, J.C.,Kück, U., 2006b. Microarray and real time PCR analyses reveal matingtype-dependent gene expression in a homothallic fungus. Mol. Genet.Genomics 275, 492–503.

Ponte, E., Bracco, E., Faix, J., Bozzaro, S., 1998. Detection of subtle pheno-types: the case of the cell adhesion molecule csA in Dictyostelium.Proc. Natl. Acad. Sci. USA 95, 9360–9365.


Qi, W., Kwon, C., Trail, F., 2006. Microarray analysis of transcript accu-mulation during perithecium development in the Wlamentous fungusGibberella zeae (anamorph Fusarium graminearum). Mol. Genet.Genomics 276, 87–100.

Scherer, M., Wei, H., Liese, R., Fischer, R., 2002. Aspergillus nidulans catalase-peroxidase gene (cpeA) is transcriptionally induced during sexual develop-ment through the transcription factor StuA. Eukaryot. Cell 1, 725–735.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G.,1997. The ClustalX windows interface: Xexible strategies for multiplesequence alignment aided by quality analysis tools. Nucleic Acids Res.24, 4876–4882.

Tong, A.H., Lesage, G., Bader, G.D., Ding, H., Xu, H., Xin, X., Young, J.,Berriz, G.F., Brost, R.L., Chang, M., Chen, Y., Cheng, X., Chua, G.,Friesen, H., Goldberg, D.S., Haynes, J., Humphries, C., He, G., Hussein,S., Ke, L., Krogan, N., Li, Z., Levinson, J.N., Lu, H., Menard, P., Mun-yana, C., Parsons, A.B., Ryan, O., Tonikian, R., Roberts, T., Sdicu,A.M., Shapiro, J., Sheikh, B., Suter, B., Wong, S.L., Zhang, L.V., Zhu,H., Burd, C.G., Munro, S., Sander, C., Rine, J., Greenblatt, J., Peter, M.,Bretscher, A., Bell, G., Roth, F.P., Brown, G.W., Andrews, B., Bussey,H., Boone, C., 2004. Global mapping of the yeast genetic interactionnetwork. Science 303, 808–813.

Wei, H., Scherer, M., Singh, A., Liese, R., Fischer, R., 2001. Aspergillusnidulans �-1,3 glucanase (mutanase), mutA, is expressed during sexualdevelopment and mobilizes mutan. Fungal Genet. Biol. 34, 217–227.

Xiang, Q., Rasmussen, C., Glass, N.L., 2002. The ham-2 locus, encoding aputative transmembrane protein, is required for hyphal fusion in Neu-rospora crassa. Genetics 160, 169–180.

Yarden, O., Plamann, M., Ebbole, D., Yanofsky, C., 1992. cot-1, a generequired for hyphal elongation in Neurospora crassa encodes a proteinkinase. EMBO J. 11, 2159–2166.


Documents

Multiple layers of temporal and spatial control regulate … · 2011-02-11 · M. Nowrousian et al. / Fungal Genetics and Biology xxx (2006) xxx–xxx 3 ARTICLE IN PRESS Please cite