MURJ - Los Angeles Mission College · MURJ Volume 3 January 2015 Published by ... Sahil Khullar, Dylan Martin, Heilly Salinas, Houman Tazhibi, Firmin Dingue Tchiengue, and Jesus M

MURJMission Undergraduate Research Journal

VOLUME 3 - JANUARY 2015

CALIFORNIA STATE UNIVERSITY NORTHRIDGE

Los Angeles Mission College

Title III STEM Program

Mission Undergraduate Research Journal

MURJVolume 3

January 2015

Published by


Title III STEM program

LAMC Faculty Involved:

J. Michael Reynolds, M.S. and Stephen Brown, Ph.D.

STEM Director: Mike Fenton, Ph.D.

Editor: Stephen Brown, Ph.D.

Internship stipends were provided by the Title III STEM grant.

©2015 Los Angeles Mission College, STEM

http://lamission.edu/stem

STEM is funded by the U.S. Department of Education.

MURJ - VOLUME 32

Th e mission of the Mission Undergraduate Research Journal

(MURJ) is to encourage, recognize, and reward academic

activity outside the classroom, while providing an opportunity

for the conversation of research and ideas. MURJ strives to

encourage students to become interested in science research

by presenting the studied work and by off ering the means of

communicating knowledge between the STEM disciplines.

“I had a great time working and learning

at UCLA. Th is was a great opportunity to get

hold of. I would recommend this to

every Biology or Biochemistry major.

Th is was a great opportunity; I wish

I could do it again. Th is internship

is absolutely needed for someone

pursuing the biological fi eld. It will

help you determine whether you like

the research area of science or not.”

– Houman Tazhibi

LOS ANGELES MISSION COLLEGE 3

A Letter from the EditorDear Reader,

Los Angeles Mission College is proud to present the third edition of the Mission

Undergraduate Research Journal. In the past year, the STEM program at Los Angeles

Mission College has expanded its support and the number of students participating in this

dynamic program. As a result nearly twice as many students had the opportunity to spend

an entire summer working in primary research laboratories at California State University,

Northridge and the University of California at Los Angeles (UCLA) which provided them

with invaluable experience toward meeting their academic and career goals.

In this edition you will fi nd scientifi c articles written by the following student interns:

Viviana Asencion, Cindy Barrios, Karyll Capistrano, Sergio Gonzalez, Cesar M. Aliaga,

Sofi ya Pascual, Gabriel Robles, Luis Corona, Dezerey Escanuelas, Vanessa Garcia, Amy Heman,

Sahil Khullar, Dylan Martin, Heilly Salinas, Houman Tazhibi, Firmin Dingue Tchiengue, and

Jesus M. Lopez Baltazar. Th ese articles are accounts of active research in which each student

participated over a 10 week period, research that is still ongoing. Th ough the narrative of

each article basically presents an excerpt of a larger research goal, you will be very impressed

with the scope of research covered in such a short period of time as well as the quality of

presentation. Th is is especially remarkable since this is the fi rst experience working in a

research environment for each student intern.

Th ese opportunities would not have been possible without the generous support of

our collaborators – Drs. Maria De Bellard, Robert Espinoza, Ray Hong, Aida Metzenberg,

Michael Summers, Maria Elena Zavala, Gloria Melara, Vibhav Durgesh, and Behzad Bavarian

at CSU Northridge, and Drs. Ann Hirsch, Chentao Lin, Yunfeng Lu and graduate student

Huihui Zhou at UCLA. Without their willingness to take our student interns into their

laboratories to train and guide in the challenges of primary research, there would be no

intern program at all. And we must also acknowledge the fi nancial, administrative and

academic support of our STEM program, in particular the STEM director Mike Fenton as

well as the STEM staff and supporting STEM faculty, and our extraordinary graphic designer

Leonard Baptiste.

We will continue to off er such research opportunities for our students each summer with

whatever resources we have available. Th is is the fi rst year that I have had the honor of

serving as mentor for our summer interns and I have seen for myself how much the students

enjoy, value and learn from the experience. In fact, many of our interns have voluntarily

chosen to continue their research during the fall term in the labs that sponsored them,

even while continuing their studies at Mission College. We all look forward to seeing our

future students benefi t from the same opportunities to receive the experience, support, and

confi dence necessary to succeed in their academic as well as personal goals.

Sincerely,

Stephen T. Brown, Ph.D.

Vice Chair, Life Sciences Department


MURJ - VOLUME 34


Contents

Silencing of the Robo Receptor in Trunk Neural Crest Cells Allows Migration

to the Gut – Viviana Asencion .................................................................................................. 6

On the Verge of Developing Gene Th erapy for Neurofi bromatosis Type I

– Cindy K. Barrios....................................................................................................................12

Sigma Factor and Anti-sigma Factor Interactions of Nostoc Punctiforme

– Karyll Capistrano ..................................................................................................................17

Is the Survival of the Mediterranean House Gecko in New Environments Caused

by Evolution? – Dezerey Escanuelas .......................................................................................28

ZOG1 Gene Eff ects on Arabidopsis Cell Size – Vanessa Garcia .............................................33

Neurofi bromatosis Type 1: Th e Race to Treating Optic Gliomas – Amy Heman .................36

Advancing Research on Neurofi bromatosis Type 1 – Sahil Khullar .....................................43

Progress for Neurofi bromatosis Type 1 – Dylan Martin .......................................................52

Using Small Subunit Ribosomal RNA (18S) Gene Sequences to Identify

Wild Nematodes – Heilly Salinas ...........................................................................................58

STEM-HSI Web Portal – Sergio Gonzales ...............................................................................62

AIMS2014 Fluid Mechanics: Flow Visualization Study Around an Air Foil

– Cesar Moshe Aliaga, Sofi ya Pascual .......................................................................................66

Antifreeze as a Corrosion Inhibitor of Steel Rebar – Gabriel Robles ....................................68

Th e C.O. Gene of Arabidopsis Th aliana Functions as a Regulator of Flowering

in Response to Blue Light – Luis Corona ...............................................................................72

Cryptochrome 2 Interaction Kinase 1 (CIK1) in Arabidopsis – Houman Tazhibi .................77

Research of Novel Plant-Nodulating Bacteria – Firmin Dingue Tchiengue ...........................81

Eff ects of Fluorinated Microporous Active-Carbon in the Capacitance of Electrochemical

Double-Layer Capacitors (TSSRP) – Jesus M. Lopez Baltazar ...............................................91

COMPUTER SCIENCE/ENGINEERINGUCLA

BIOLOGY CSUN

MCBD UCLA

COMPUTER SCIENCE/ENGINEERINGCSUN

MURJ - VOLUME 36

Silencing Of Th e Robo Receptor In Trunk Neural Crest Cells

Allows Migration To Th e GutViviana Asencion

Sponsored by Dr. Maria De Bellard, Department of Biology

California State University, Northridge

INTRODUCTION

Neural crest cells are multipotent, migratory

cells that originate from the dorsal neural

tube during vertebrate development. Th ese

cells then migrate throughout the embryo,

giving rise to wide variety derivatives

including the peripheral nervous system,

craniofacial skeleton, pigment cells, and

endocrine organs (De Bellard et al., 2003).

In order to migrate, neural crest cells need

to change from non-motile epithelial cells

to highly motile mesenchymal cells. Th is is

possible through a process known as EMT,

epithelia to mesenchymal transition, and is

accompanied by changes in the expression of

transcription factors, cell adhesion molecules

and alterations in the cytoskeleton (Vernon

and LaBonne, 2004; Taneyhill et al., 2007;

Salvador et al., 2009; Th iery et al., 2009).

Many key molecules are known to be part

of the EMT process; however, Slit molecules

are very important proteins for signaling

the starting or preventing EMT. Th e Slit

ligands and Robo receptors are both present

at the beginning of neural crest EMT and

throughout migration (De Bellard et al., 2003;

Jia et al., 2005). Slit proteins (1, 2 and 3) are

known key players in axonal guidance as well

as guiding neural crest cells during migration

(Brose et al., 1999; De Bellard et al., 2003; Jia

et al., 2005; Kidd et al., 1999; Li et al., 1999).

But, most important is that Slits and their

Robo receptors have been found to play a role

in cancer metastasis (Schmid et al., 2007;

Singh et al., 2007; Prasad et al., 2008; Tseng et

al., 2010). Slit molecules have recently been

defi ned as true tumor suppressor molecules

(Dallot et al., 2002, 2003a; Dickinson et al.,

2010). Slit expression correlates with reduced

cell motility in cancer cells while reduced Slit

expression is associated with more aggressive

cancer types. Slit also regulates beta-catenin

expression, which is critical during cell

migration (Goivannone et al., 2012).

Th e main purpose of this research is to study

Slit Robo receptors in trunk neural crest

cells in chicken embryos and what is keeping

trunk neural crest cells from migrating to

the gut. Slit is found in higher counts than

Robo in vagal neural crest cells, which do

migrate to the gut. On the other hand, Robo

receptors are found in higher counts than Slit


Figure 2 - Transverse cross-section of chicken embryo

in the trunk neural crest cells, which do not

migrate to the gut. Th e reason may be because

Slit that is present in the migration path

to the gut binds to the Robo receptors and

impairs migration. Th e study of the possible

functional role of Robo gain of function and

Robo loss of function mutations may help to

explain migration to the gut. Robo gain of

function mutations express the receptor which

will bind to Slit and migrations slows down or

stops. Robo loss of function mutations silence

the receptor which is therefore unable to bind

to Slit and migration takes place. Th e fi ndings

of this research can be applied to studying the

role of Slit-Robo in cancer cell metastasis.

Th e process of studying trunk neural crest

cells is complex and involves many diff erent

techniques including: Electroporations with

a GFP-Robo gain of function construct,

GFP-Robo loss of function construct, and

a GFP control construct; preparing embryo

whole mounts, sectioning embryos with a

vibratome, in vitro neural crest culture, cell

and neural tube transfection, and RT-PCR

analysis among others. My role in this lab

so far is to section the trunk of the embryo

embedded in 4% agarose using a vibratome.

Th ese 50 micrometer sections are studied

under a microscope and if signals of migration

from the neural tube to the gut are visible,

pictures are taken for the record. I have also

practiced electroporation with the GFP control

construct. In addition, I have taken pictures of

the whole embryos as well as sections to look

for signals of migration from the neural tube

to the gut.

RESULTS

In this study, we examine the potential role of

Robo receptors in the process of trunk neural

crest cells migration to the gut area. Robo

receptors are expressed in the trunk neural

crest cells, while Slit ligands are expressed

in the vagal neural crest cells. Vagal neural

crest cells, not trunk, enter and colonize the

developing gut to form the enteric nervous

system. We can see vagal and trunk areas in

Figure 1. In order to study migration of trunk

neural crest cells to the gut area, chicken

embryos of diff erent stages (HH16-17, HH19,

and HH20-21) were cross-sectioned to look

for the signal. Embryos were cross-sectioned

Figure 1 - Whole chicken embryo

MURJ - VOLUME 38

transversally as in Figure 2, in order to fi nd a

signal that would show the migration of the

trunk neural crest cells to the gut.

Before trunk neural crest cells start migration

at HH14, they express both ligands and

receptors. Later during peak neural crest cell

migration, HH16-17, pre-migratory neural

crest cells express Slit while the migrating

neural crest cells express Robo (De Bellard

et al., 2003; Jia et al., 2005). Slit expression

at the entrance of the gut is a repellant for

ventrally migrating trunk neural crest cells

(De Bellard et al, 2003). Th erefore, when

Slit molecules encounter Robo receptors

present in trunk neural crest cells, migration

slows down or stops. Th is study explores the

possibility that the RoboD2 loss of function

mutation will allow trunk neural crest cells to

migrate to the intestinal portal.

In Figure 3A, electroporation of neural crest

cells with GFP control shows that neural

crest cells do not necessarily migrate to the

gut. Robo receptors in trunk neural crest

cells cannot migrate to the gut due to the

Slit molecules express there. Slit molecules

express at the entrance of the gut area attach

to Robo receptors expressed in the trunk

neural crest cells and stops migration. In

Figure 3B, we clearly see trunk neural crest

cells that have migrated to the gut. Silencing

Robo receptors in trunk neural crest cells

allows migration to the developing gut.

Figure 4 (A, C, E, G) shows a cross-section

supporting the results in Figure 3A. Figure

4 (A, C, E, G) GFP control cross-sections

show no migration to the gut area because

Slit molecules at the entrance of the gut

stop migration by attaching to trunk neural

crest cell Robo receptors. Expression of

the RoboD2 loss of function mutation in

Figure 4 (B, D, F, H) cross-sections show the

migration of trunk neural crest cells to the gut

Figure 3 - (A) TGPF control image of a whole embryo at gut level. There is no migration of trunk neural crest cells to the gut.- (B) Dominant negative RoboD2 image of a whole embryo at gut level. There is migration of trunk cells to the gut.

Figure 4 - GFP control (A, C, E, G) There is no migration of trunk neural crest cells to the gut. Slit molecules express at the entrance of the gut attach to the Robo receptors expressed in the trunk neural crest cells stopping migration. - RoboD2 (B, D, F, H) Migrating trunk neural crest cells are present in the gut. RoboD2 Loss of function mutation allows trunk neural crest cells to migrate to the gut. Slit molecules are not able to attach to the Robo receptors because they are silent.


supporting Figure 3B. Th e RoboD2 mutation

silences the Robo receptors in the trunk

neural crest cells so Slit molecules cannot

attach to the receptors making migration

possible. Figure 4G shows that neural crest

cells normally do not migrate to the gut.

Figure 4H shows the migration of the trunk

neural crest cells to the gut due to the loss of

Robo receptor function.

In conclusion, trunk neural crest cells

normally would not migrate to the gut, as we

see in Figure 5A with the GFP control. Th is

study shows that the RoboD2 loss of function

mutation silence the Robo receptors of the

trunk neural crest cells allowing migration

to the gut as show in Figure 5B, and that the

RoboG gain of function construct does not

allow migration at all from the neural crest

cells as show in Figure 5C.

DISCUSSION

Neural crest cell migration is a very complex

process because it encompasses many cell

functions. In this study we were able to

examine the role of Robo receptors expressed

in the trunk neural crest cells during the

migration process. Based on the results,

we can conclude that Robo receptors play

an important role in trunk neural crest

cell migration to the gut. Th ese fi ndings

demonstrate that Robo receptors can be

silenced in order to migrate to the gut where

Slit molecules are present. Slit molecules

are capable of stopping migration when

they contact Robo receptors. However, if

Robo receptors are mutated (Silence), then

Slit molecules are not capable of stopping

migration. Th ese results can also be used to

study cancer cell metastasis.

Figure 5 - (A)Trunk neural cells do not migrate to the gut in the control. When the Robo receptors are silent, trunk neural crest cells migrate to the gut as noticed in (B). In (C), trunk neural cells expressing RoboG gain of function did not migrate as far as in GFP control.

MURJ - VOLUME 310

MATERIALS AND METHODS

Electroporation with GFP and Harvesting

GFP (Green Fluorescence Protein) expression

plasmid was injected into chicken embryo

neural tubes using a mouth pipette and

immediately electroporated with 50-ms

pulses of 25 mV each. Embryos were

sealed with tape and re-incubated for 24

or 48 hours. After incubation, embryos

were harvested. Harvesting consisted of

the removal of the embryo from the egg.

Harvested embryos were placed overnight

in 4% paraformaldehyde (PFA) to fi x the

embryos. Embryos in PFA were extensively

washed in 0.01 M Phosphate Buff ered Saline

(1 x PBS) before trimming the membrane.

Electroporations and embryo harvesting

were carried out using a stereoscopic

dissecting microscope.

Mount of Embryos and Imaging

Electroporated, trimmed embryos were

embedded in 4% agarose. Once embedded,

the embryos were sectioned using a

vibratome. Fifty micrometer thick sections

were placed in 1 x PBS wells. Each well has

about 8-10 sections. Twenty microliters of

DAPI, a fl uorescent stain that colors the cell

nucleus blue, was added to each well before

mounting. Only sections from the trunk part

of the embryo were mounted. All sections

were photographed using a Zeiss

A-1 AxioImager.

ACKNOWLEDGMENTS

I would like to thank my PI Dr. De Bellard for

all her support, lab tech Blanca Ortega for all

the help she off ered me during the time I was

there, and students Nora, Ian, Hanna.

REFERENCES

Brose K, Bland KS, Wang KH, Arnott D,

Henzel W, Goodman CS, Tessier-Lavigne M,

Kidd T 1999. Slit proteins bind Robo receptors

and have an evolutionarily conserved role in

repulsive axon guidance. Cell 96:795-806.

Dallol A, Da Silva NF, Viacava P, Minna JD,

Bieche I, Maher ER, Latif F. 2002. SLIT2, a

human homologue of the Drosophila Slit2

gene, has tumor suppressor activity and is

frequently inactivated in lung and breast

cancers. Cancer Res 62:5874-5880.

Dallol A, Krex D, Hesson L, Eng C, Maher

ER, Latif F. 2003a. Frequent epigenetic

inactivation of the SLIT2 gene in gliomas.

Oncogene 22:4611-4616.

De Bellard, Rao Y, Bronner-Fraser M, 2003.

Dual Function of Slit2 in repulsion and

enhanced migration of trunk, but not vagal,

neural crest cells. J Cell Biol 162:269-279.

Dickinson RE, Dallol A, Bieche I, Krex

D, Morton D, Maher ER, Latif L. 2004.

Epigeneric inactivation of SLIT3 and SLIT1

genes in human cancers. Br J Cancer 91:

2071-2078.


Giovannone D, Reyes M, Reyes M, Correa L,

Martinez D, Ra H, Gomez G, Kaiser J, Ma L,

Stein MP, DeBellard M. 2012. Slit aff ect the

timely migration of neural crest cells via robo

receptor. Dev Dynamics 241:1274-1288.

Jia L, Cheng L, Raper J, 2005. Slit/Robo

signaling is necessary to confi ne early neural

crest cells to the ventral migratory pathway in

the trunk. Dev Biol 282:411-421.

Kidd T, Bland KS, Goodman CS, 1999. Slit is

the midline repellent for the robo receptor in

Drosophila. Cell 96:785-794.

Li HS, Chen JH, Wu W, Fagaly T, Zhou L,

Yaun W, Dupuis S, Juang ZH, Nash W, Gick C,

Ornitz DM, Wu JY, Rao Y. 1999. Vertebrate

Slit, a secreted ligand for the transmembrane

protein round about, is a repellent for

olfactory bulb axons Cell 96:807-818

Prasad A, Paruchuri V, Preet A, LAtif F, Ganju

TK. 2008. Slit-2 induces a tumor-suppressive

eff ect by regulating beta-catenin in breast

cancer cells. J Biol Chem 283:26624-26633.

Salvador SM, Vernon A, LaBonne C. 2009.

Th e role of snail family transcription factors

in neural crest development and tumor

progression. Dev Biol 331:438.

Schmid BC, Rezniczek GA, Fabjani G, Yoneda

T, Leodolter S, Zeilliger R. 2007. Th e neural

guidance cue Slit2 induces targeted migration

and may play a role in brain metastasis of

breast cancer cells. Breast Cancer Res Treat

106:333-342.

Singh Rk, Indra D, Mitra S, Mondal RK, Basu

PS, Roy A, Roychowdhury S, Panda CK. 2007.

Deletions in chromosome 4 diff erentially

associated with the development of cervical

cancer: evidence of slit2 as a candidate tumor

suppressor gene. Hum Genet 122:71-81.

Taneyhill LA, Coles EG, Bronner-Fraser M.

2007. Snail2 directly represses cadherin6B

during epithelia-to-mesenchymal transitions

of the neural crest. Development 134:

1481-1490.

Th iery JP, Duband JL, Delouvee A. 1982.

Pathwaysand mechanisms of avian trunk

neural crest cells migration and localization.

Dev Biol 93:324-343.

Tseng RC, Lee SH, Hsu HS, Chen BH, Tsai WC,

Tzao C, Wang YC. 2010. SLIT2 attenuation

during lung cancer progression deregulates

beta-catenin and E-cadherin and associates

with poor prognosis. Cancer Res 70:543-551.

Vernon AE, LaBonne C. 2004. Tumor

metastasis: a new twist on epithelia-

mesenchymal transitions. Curr Bio 14:

R719-R721.

MURJ - VOLUME 312

On Th e Verge Of Developing Gene Th erapy For

Neurofi bromatosis Type ICindy K. Barrios

Sponsored by Dr. Aida Metzenberg, Department of Biology


INTRODUCTION

Neurofi bromatosis type 1 (NF1), also known

as von Recklinghausen disease or Watson

syndrome, is a common autosomal dominant

genetically inherited disorder aff ecting about

1 in 2,700 newborns. Aff ected individuals

have a dysfunctional Neurofi bromin

(neurofi bromatosis- related protein NF-

1) due to mutations within the Nf1 gene

located on chromosome 17. NF-1 is a

protein that regulates cell division in normal

cells, but mutation within the Nf1gene

induces tumor growth. A faulty NF-1 causes

tumors to grow uncontrollably along the

central nervous system, aff ecting the ability

of the nerves to function correctly. Th is

malfunction could lead to symptoms such as

scoliosis (curvature of the spine), learning

disabilities, optic pathway gliomas (vision

disorder), and epilepsy. Some individuals

with NF1 may be prone to have few clinical

characteristics of NF1, while others may

develop severe manifestations. Th e age of

onset is unpredictable, and the disease is not

signifi cantly increased in any ethnic group

or gender (Szudek et al., 2003). Children

carrying the faulty NF1 allele have a 70%

risk of developing optic pathway gliomas

(Listernick et al., 2007). Childhood optic

pathway gliomas are usually benign (non-

cancerous) and slow growing. Optic pathway

gliomas occur along the nerves that send

messages from the eye to the brain also

called the optic pathway (Marsden, 2014).

Irreversible nerve damage, due to NF1, may

lead to a decrease in visual acuity, abnormal

pupillary function, and optic nerve atrophy

(Westphal & Lamszus, 2011). Th ere is no

cure for optic pathway gliomas; however,

tumors that cause pain or loss of function

may be either removed surgically or treated

with chemotherapy. Th e research described in

this report focuses on developing a non-viral

gene therapy mode for the prevention of optic

pathway gliomas.

A recent investigation regarding gene

therapy for NF1 is from Andrea Cosco, who

emphasized his master’s thesis on the eff ect

of NF1, specifi cally children aff ected with

optic pathway gliomas. During his research,

Cosco successfully created a construct, which

in theory would be able to slow down the

proliferation and growth of benign tumors.


Figure 4 - pEPito Nf1-GDR construct ranging from 23 ng/µL to 207 ng/µL in a 200 µL total volume (135,760 ng total weight)

He used a non-viral mammalian expression

vector pEPito and inserted a GRD domain

of the NF1 gene to further be utilized for

gene therapy (GRD is the region in which a

majority of mutations in the NF1 gene are

found to occur). However, due to the effi cacy

of the blood brain barrier, his construct is

not capable of traveling to the optic nerve

for it to treat optic pathway gliomas. Th e

objective of my research was to amplify

the construct (pEPito NF1-GRD) through

the transformation of competent bacterial

cells and plasmid mini preparations. Th e

amplifi ed construct can then be modifi ed for

gene therapy treatment specifi cally for those

with optic pathway gliomas by including a

lactotransferrin gene, which has being shown

to successfully cross the blood brain barrier

(Ji, et al., 2005).

RESULTS

Before adding the lactotransferrin gene to

the construct (pEPito NF1-GRD), we fi rst

needed to amplify the construct in order

to generate enough to further use for gene

therapy of optic pathway gliomas. Competent

Top 10 E. Coli cells were prepared, aliquoted

into 200 μL portions and stored at -70 °C

in 15% glycerol (Figure 1). Th e competent

cells were then tested using a control plasmid

(pUC19). Once we verifi ed the competency

of the competent cells, by the growth of

colonies, we then proceeded to transform

the cells with the plasmid of interest (pEPito

Nf1-GRD). Figure 2 shows some of the plates

used for transformation. Plate A contained

Figure 1 - 200 µL aliquots of competent cells to be used for transformation

Figure 2 - Plates of Transformed BacteriaPlate A -10 µL of pEPito NF1-GRD transformed cells Plate B -100 µL of pEPito NF1-GRD transformed cellsPlate C - remaining 890 µL to 900 µL of pEPito NF1- GRD transformed cells. Each plate was LB agar plus 0.5 µg/mL ampicillin.

Figure 3 - Nano Drop profi le of purifi ed plasmid obtained from a plasmid miniprep

A

B C

MURJ - VOLUME 314

10 μL of pEPito NF1-GRD transformed cells.

Plate B contained 100 μL of pEPito NF1-

GRD transformed cells. Plate C contained

the remaining 890 μL to 900 μL of pEPito

NF1-GRD transformed cells. Isolated

colonies from the plates were grown and

plasmid DNA purifi ed by “plasmid miniprep.”

Figure 3 shows the purifi ed Nano Drop

curve of a plasmid miniprep and the 260/280

ratio of 2.03 represents the pureness of

the construct. Th en, we stored the plasmid

DNA at -20 °C to be later used for adding the

lactotransferrin gene. At the beginning of the

investigation, there had been produced one vial

of 22 ng/μL in a 150 μL total volume (13,300

ng total weight) of the construct pEPito Nf1-

GRD; by the end of the summer investigation

we increased the amount of the construct to

fourteen vials ranging from 23 ng/μL to 207

ng/μL in 200 μL aliquots (135,760 ng total

weight). Figure 4 shows the vials produced by

the end of the summer internship.

DISCUSSION

Neurofi bromatosis Type 1 is a common

genetic inherited disorder that aff ects 1 in

2,700 newborns. A faulty neurofi bromin

gene causes uncontrollable growth of tumors

along the central nervous system leading to

optic pathway glioma. Th ere is no cure for

optic pathway glioma; thus, in theory, gene

therapy can become a treatment for patients

with optic pathway glioma. A construct

pEPito NF1-GRD was design by Andrea Cosco

for gene therapy; however, this construct

cannot cross the blood brain barrier to treat

the optic glioma. Th erefore, the construct

pEPito NF1-GRD must fi rst be inserted with

a lactotransferrin gene, which has being

shown to successfully cross the blood brain

barrier. In this research, we were successful

at amplifying the construct to fourteen vials

ranging from 23 ng/μL to 207 ng/μL in a 200

μL aliquots (135,760 ng total weight). From

this point, the lactotransferrin DNA needs

to be inserted into the pEPito NF1 GRD

construct and its effi ciency analyzed using a

live model organism such as mice or zebrafi sh

in order to show conclusive evidence for our

construct’s effi cacy.


Preparation of Competent Cells

Five milliliters of Luria Broth (LB) was

inoculated with a single, isolated colony of

Top 10 Escherichia coli (E. coli) Miller Fisher

Biotech. Th is was incubated at 37 °C, in a

shaker at 250 rpm for 16 hours. At the 16th

hour, 1 mL of overnight growth was diluted in

50 mL LB and incubated at 37 °C, in a shaker

at 250 rpm until the absorbance at 600 nm

(A600

) reached approximately 0.6 absorbance.

Th e culture was then centrifuged at 4 °C and

5,098 x g for 10 minutes. Th e pellet was

resuspended in 5.0 mL cold 0.1 M CaCl2, and

placed on ice for 15 minutes. Th e culture was

centrifuged again at 4 °C and 5,098 x g for 10

minutes. Th e supernatant was discarded and

the pellet was resuspended in 1 mL cold 0.1 M

CaCl2. Fifty microliters of sterile H

2O and 450

μL of sterile 50% glycerol was added and the

cells were aliquoted and stored at -70 °C.


Transformation

Two microliters of plasmid DNA at 10.0 pg/μL

was added to 100 μL of competent cells (see

above). Th e tube was placed on ice for 30

minutes, then heat shocked in a 42 °C water

bath for exactly 45 seconds, and immediately

placed on ice for 2 minutes. Nine hundred

microliters of Super Optimal Broth with

Catabolite Repression (SOC medium) (2%

tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5

mM KCl, 10 mM MgCl2, and 20 mM glucose)

was added to each tube and then placed in a

shaker at 37 °C at 225 rpm for 45 minutes.

Cells were plated on three LB agar plus 0.05

μg/mL ampicillin plates and incubated at 37

°C for 12 hours.

Plasmid Miniprep

Colonies were inoculated into 5.0 mL of

Luria broth (LB) and 2 μL/mL of ampicillin;

and placed in a shaker at 37 °C at 250 rpm

for 16 hours. One and one half milliliters

of overnight culture was centrifuged for 25

seconds at 20,800 x g at room temperature.

All but 100 μl of supernatant were discarded,

and the remaining 100 μL were vortexed

until the cells were completely resuspended.

Th ree hundred microliters of TENS (10.0 mM

(Tris-HCl pH 8.0, 1.0 mM EDTA pH 8.0, 0.1 M

NaOH, 0.5% SDS) was added and the mixture

was vortexed on high for 5 seconds. One

hundred fi fty microliters of 3M Na Acetate

(pH 5.2) was added and the sample was

vortexed for 5 seconds and centrifuged for 4

minutes at 20,800 x g at room temperature.

Approximately 450 μL of supernatant was

transferred to a new tube. Th e sample was

mixed with 0.9 mL of 95% ethanol previously

cooled to -20 °C and centrifuged for 2 minutes

at 20,800 x g at room temperature. Without

disturbing the pellet, the supernatant was

gently removed and the pellet washed twice

with 70% ethanol. Th e pellet was then

resuspended in 200 μL TE (10 mM Tris-HCl

pH 8.0, 1 mM EDTA pH 8.0).

ACKNOWLEDGMENTS

I would like to express my very great

appreciation to Dr. Aida Metzenberg, Chair

Department of Biology CSUN, for allowing

me to work within her lab. I would like to

off er my special thanks to Dr. Mike Fenton,

STEM Director, for the opportunity to partake

in this wonderful learning experience. I am

particularly grateful to Dr. Stephen Brown

for his valuable and constructive suggestions

during the planning and development of

this research work. I want to thank Anamica

Sood and Osvaldo Larios for their patience,

dedication and constant advice. In addition,

I want to thank Amy and Dylan for being

wonderful lab partners during our internship.

Lastly, I would like to thank the STEM

program and its faculty for allowing me to

work in a research environment. I will carry

this research experience with me and continue

to pursue a career in the biological

science fi eld.

MURJ - VOLUME 316

REFERENCES

Cosco, Andrea. Filling in the Gaps in

Neurofi bromatosis Type 1. California State

University Northridge [Accessed July

15, 2014]

Ji, B. (2005, May 25). Pharmacokinetics and

brain uptake of lactoferrin in rats. Retrieved

September 5, 2014, from http://www.nirs.

go.jp/seika/brain_e/e_seika/pdf/Ki_Life_

Sciences.pdf

Listernick, R. et al., 2007. Optic pathway

gliomas in neurofi bromatosis-1: controversies

and recommendations. Annals of Neurology,

61(3), pp.189–198. Available at: http://

www.ncbi.nlm.nih.gov/pubmed/17387725

[Accessed July 15, 2014].

Marsden, T. (2014, January 1). Optic

pathway glioma. Retrieved August 11, 2014,

from www.royalmarsden.nhs.uk/cancer-

information/children/optic-pathway-glioma

Neurofi bromatosis type I. (2014, July

12). In Wikipedia, Th e Free Encyclopedia.

Available at: http://en.wikipedia.org/w/

index.php?title=Neurofi bromatosis_type_I&o

ldid=616706669 [Accessed July 15, 2014].

Szudek, J., Evans, D.G. & Friedman, J.M.,

2003. Patterns of associations of clinical

features in neurofi bromatosis 1 (NF1).

Human genetics, 112(3), pp.289–97.

Available at: http://www.ncbi.nlm.nih.gov/

pubmed/12596053 [Accessed July 15, 2014].

Westphal, M. & Lamszus, K., 2011. Th e

neurobiology of gliomas: from cell biology to

the development of therapeutic approaches.

Nature Reviews Neuroscience, 12(9), pp.495–

508. Available at: http://www.ncbi.nlm.nih.

gov/pubmed/21811295 [Accessed July

15, 2014].


Sigma Factor And Anti-Sigma Factor Interactions Of Nostoc Punctiforme

Karyll Capistrano Sponsored by Dr. Michael Summers, Department of Biology


INTRODUCTION

Nostoc punctiforme is a species of

Cyanobacteria whose vegetative cells can

diff erentiate into a variety of cell types as a

result of diff erent environmental stresses.

Cell types that occur include heterocysts that

are able to fi x nitrogen in response to a lack of

nitrogen, hormogonia that allow for motility,

and spore-like akinetes that can withstand

strong temperatures. Within bacteria,

initiation of RNA synthesis occurs with the

help of a protein called a sigma factor. A

sigma factor is a subunit of RNA polymerase

that begins initiation of gene transcription

at promoter regions recognized by the sigma

factor. Within N. punctiforme, there are 13

diff erent sigma factors. Sigma factor A is the

house keeping sigma factor responsible for

regular cell function. Th e function of the rest

of the 12 sigma factors is unknown. To fi nd

out the function of these 12 sigma factors

including what genes they regulate or how

they are controlled, the sigma factors can be

exposed to anti-sigma factors. Anti-sigma

factors are endogenous proteins that bind

to sigma factors and inhibit transcription,

and can sometimes control sigma factors.

In this experiment, 7 sigma factors will be

analyzed to confi rm their solubility and ability

to interact with anti-sigma factor 0876 to

determine if any of the sigma factors are

complementary to anti-sigma 0876. Th is

experiment involves a GST Pulldown Assay

with anti-sigma factor 0876 being tagged

with GST (glutathione S-transferase), which

has a high affi nity for glutathione, and the

sigma factors being His-tagged (attached to

6 histidine residues). Th e GST lysates will

be attached to glutathione beads, and will

serve as “the bait” for the sigma factors to

attach to. Th e His-tagged protein lysates will

serve as “the pond.” Th e beads with attached

GST lysate proteins will be incubated in E.

coli extracts containing His-tagged proteins.

Th e sigma factors will then be run on two

SDS protein gels, with one gel being used for

regular protein staining to see if the soluble

protein is present while the other will be used

for a western blot to confi rm if there is any

interaction between each sigma factor and

anti-sigma 0876.

MURJ - VOLUME 318

RESULTS

To allow for interaction between the sigma

factors and anti-sigma 0876, expression of

soluble protein of the sigma factors needed to

be achieved. Seven sigma factor genes were

cloned into the pET28a expression vector

and expressed in E. coli cells as a His-tagged

protein (Table 1). Protein expression from

the 7 sigma factor-His-tagged plasmids is

shown in Figure 1. Th e supernatant (referred

to as SOLUBLE) after 5 hours of induction

(T5) of the sigma factors 0307, 0996, 1499,

3293, and 5797 resulted in bands not present

before induction (T0), confi rming the

presence of the induced protein in soluble

form. However, only sigma factor 3293

resulted in the correct band size while 0307,

0996, 1499, and 5797 resulted in larger band

Table 1 - The Nostoc punctiforme genes and their gene product Sigma factors that each pET28a vector expressed.

Figure 1 - First protein induction with 0.4 mM IPTG of the 7 sigma factor-His-tagged plasmids: A. Sigma factors 0307 and 1337; B. Sigma factors 0996 and 3293; C. Sigma factors 1499 and 1771; D. Sigma factor 5797; T0 refers to time zero of induction; T5 refers to 5 hours post-induction; S refers to soluble protein, and T refers to total protein; LAD refers to the protein molecular weight ladder. A band present in the T5 SOLUBLE (S) sample that was not observed at T0 indicated the desired protein was present. The molecular weight of the corresponding band was compared to the expected MW (indicated at the bottom of the gel) to confi rm expression of the sigma factor. Bands indicating successful induction are identifi ed by a red arrow.

N. punctiforme genes Sigma Factor product 0307 SigE 0996 SigC 1337 SigJ 1499 SigB-a 1771 SigB-b 3293 SigB-c 5797 SigD

sizes. Th ese sigma factors were induced again

a second time. An increase of the percent of

the SDS-PAGE gel from 10% polyacrylamide

to 12% was done to increase band intensity

and spacing between the bands. Th ere was no

induction of sigma factors 1337 and 1771 as

shown by no diff erence between the T0 and

T5 samples.


A second induction of the sigma factors 0307,

0996, 1499, and 5797 resulted in soluble

protein, while 1337 and 1771 resulted in no

soluble protein (Figure 2). Induction times

of T0 and T5 were run again, along with

Figure 2 - Second protein induction with 0.4 mM IPTG of the sigma factor-His-tagged plasmids for samples from the 1st induction that were soluble but had a large molecular weight, along with the 2 sigma factors that failed to express soluble protein: A. Sigma factor 0307; B. Sigma Factor 0996; C. Sigma factor 1499; D. Sigma factor 5797; E. Sigma factor 1337.; F. Sigma factor 1771; T0 refers to time zero of induction; T5 refers to 5 hours post-induction; S refers to soluble protein, and T refers to total protein; LAD refers to the protein molecular weight ladder. A band present in the T5 SOLUBLE (S) sample that was not observed at T0 indicated the desired protein was present. The molecular weight of the corresponding band was compared to the expected MW (indicated at the bottom of the gel) to confi rm expression of the sigma factor. Bands indicating successful induction are identifi ed by a red arrow.

induction time after 2.5 hours (T2.5) to see

if soluble proteins were induced at this time.

Th ese proteins were all run on 12% SDS-

PAGE gels with the same settings as with the

previous gels.

MURJ - VOLUME 320

For both protein 1337 and 1771 (Figures 2E

and 2F), no presence of soluble protein at

T2.5 and T5 confi rms no induction of protein

as had been seen in the fi rst induction. To

achieve soluble expression, induction at a

colder temperature was done to see if this

would have any eff ect (Figure 3).

A third induction of 1337 and 1771 at a colder

temperature resulted in no soluble protein

(Figure 3). Another method of making these

insoluble proteins soluble is needed.

Th e expression of both the GST-tagged anti-

sigma factor 0876 (GST-0876) and the GST-

only plasmid pGEX5X-1 resulted in a band

in soluble form at T5 only, with a molecular

weight of ~26 kDa consistent with the

molecular weight of GST (data not shown).

Both the GST and GST-protein lysates were

tested before a GST pulldown assay was done

by fi nding an amount or dilution of lysate that

Figure 3 - Protein induction with 0.4 mM IPTG at a colder temperature of 18 °C for the 2 sigma factor-His-tagged plasmids that were not successfully induced after two attempts: A. Sigma factor 1337; B. Sigma factor 1771. T0 refers to time zero of induction. T5 refers to 5 hours post-induction. T O/N indicates induction overnight; S refers to soluble protein, and T refers to total protein; LAD refers to the protein molecular weight ladder. A band present in the T O/N SOLUBLE (S) sample that was not observed at T0 indicates the desired protein was present. The molecular weight of the corresponding band was compared to the expected MW (indicated at the bottom of the gel) to confi rm expression of the sigma factor. Bands indicating successful induction are identifi ed by a red arrow.

would provide 500 ng of protein to attach to

10 μL of packed glutathione-agarose beads.

Th is was necessary to avoid non-specifi c or

false-negative interactions which could result

if there were too much or not enough GST

bait proteins.

Both the GST-0876 and GST-only lysates

were each bound to 10 μL of glutathione-

agarose beads at two diff erent dilutions with

TGEM (0.1) (1/10 and 1/100), and another

at full concentration with 40 μL of GST lysate

without TGEM (0.1). After rolling incubation

for ~2 hours in the refrigerator to allow for

the lysate to interact with the beads, the

packed beads of GST-0876 and GST-only

were loaded onto two separate SDS-PAGE

gels, stained for 1 hour and destained for

~15 minutes. Th e GST-0876 SDS-PAGE gel

resulted in no bands indicating that the GST-

0876 lysate did not bind to the beads (data


not shown). However, bands around ~26 kDa

did appear on the GST-only SDS-PAGE gel

(Figure 4).

Th e GST-0876 lysate was incubated with

agarose beads a second time for ~2 hours

with a higher volume of lysate (300 μL) at full

concentration to increase the chances of bead

interaction (Figure 5).

After attachment of the GST protein lysates

to the glutathione-agarose beads, and washing

away non-specifi c binding with TGEM (1.0)

and TGEM (0.1), the beads with attached

proteins serving as “the bait,” were incubated

with His-tagged protein lysates (“the pond”)

that had been confi rmed to have induced

soluble protein. Th ese beads were then loaded

onto 2 SDS-PAGE gels. One gel was stained

Figure 4 - SDS-PAGE gel of GST-tagged pGEX5X-1 lysate (GST-only) bound to glutathione-agarose beads: “Full” indicates full concentration of 40 µL of GST-only lysate without TGEM (0.1), “1/10” indicates dilution of 5 µL of GST-only lysate with 45 µL TGEM (0.1), and “1/100” indicates dilution of 5 µL of GST-only lysate with 495 µL TGEM (0.1). Bands present at ~26 kDa confi rmed that the GST-tagged pGEX5X-1 lysate was successfully bound to the agarose beads.

Figure 5 - SDS-PAGE gel of GST-tagged pGEX5X-1::0876 (GST-0876) bound to glutathione-agarose beads: “Full” indicates full concentration of 300 µL of GST-0876 lysate without TGEM (0.1). The two bands present at ~26 kDa confi rmed that the GST-tagged anti-sigma factor 0876 lysate was successfully bound to the agarose beads.

to confi rm the GST-only and GST-0876

protein bound to the His-tagged proteins.

However, the amount of His-tagged protein

that attached to the bait may not have been

enough to stain, requiring a western blot

for better confi rmation of interaction. Th e

second gel was used for chromogenic western

blot analysis to confi rm that the His-tagged

protein bound to the GST lysates. Th e SDS-

PAGE gel GST interaction with His-tagged

proteins 0996 and 3293 after protein staining

is shown in Figure 6. Th e western blot of

0996 and 3293 resulted in two faint green

bands of His-0996 and His-3293 (data not

shown). Th is weak signal could be due to too

little protein being loaded or poor transfer

effi ciency as indicated in the One-Hour

Western Detection System user manual.

MURJ - VOLUME 322

Another GST pulldown assay was done with

two other His-tagged proteins, 0307 and

1499. Th e same procedures were done as

with His-tagged proteins 0996 and 3293

except a chemiluminescent western blot was

done instead of chromogenic western blot

to see if this method would result in greater

sensitivity. Th e SDS-PAGE gel GST interaction

with His-tagged proteins 0307 and 1499 after

protein staining is shown in Figure 7. Th e

western blot of 0307 and 1499 resulted in

three bands of His-0307 but no bands resulted

for His-1499 (Figure 8).

Figure 6 - SDS-PAGE gel of His-tagged proteins 0996 and 3293 interacting with GST-only and GST-0876: +3a is GST-0876 bound to 0996. +4a is GST-only bound to 0996. -1 is GST-0876 not bound to any sigma factor. -2 is GST-only not bound to any sigma factor. +4b is GST-only bound to 3293. +3b is GST-0876 bound to 3293. With bands at ~26 kDa, interaction of GST lysates was confi rmed. The His-tagged proteins with no beads and GST are shown on the ends of the gel.

Figure 7 - SDS-PAGE gel of His-tagged proteins 0307 and 1499 interaction with GST-only and GST-0876: +3a is GST-0876 bound to 0307. +4a is GST-only bound to 0307. -1 is GST-0876 not bound to any sigma factor. -2 is GST-only not bound to any sigma factor. +4b is GST-only bound to 1499. +3b is GST-0876 bound to 1499. With bands at ~26 kDa, interaction of GST lysates was confi rmed. The His-tagged proteins with no beads and GST are shown on the ends of the gel.

Figure 8 - Film of western blot membrane of His-tagged proteins 0307 and 1499 interaction with GST-only and GST-0876: +3a is GST-0876 bound to 0307. +4a is GST-only bound to 0307. -1 is GST-0876 not bound to any sigma factor. -2 is GST-only not bound to any sigma factor. +4b is GST-only bound to 1499. +3b is GST-0876 bound to 1499. The three bands that resulted indicate that His-tagged protein 0307 interacted with GST-only and GST-0876. No bands resulted for His-tagged protein 1499.


DISCUSSION

Th e western blot of sigma factors 0996, 3293,

and 1499 resulted in no bands indicating no

interaction between the His-tagged sigma

factors with anti-sigma 0876. Although the

western blot of sigma factor 0307 resulted in

bands indicating interaction with anti-sigma

0876, a second GST pulldown assay should

be done to confi rm their interaction. As seen

with the fi nal results, the chemiluminescent

western blot was more eff ective in showing

bands on the fi lm compared to the

nitrocellulose membrane of the chromogenic

western blot. Diff erent concentrations of

IPTG (0.4 mM, 0.8 mM, and 1.0 mM) used

for induction of GST-0876 were run on SDS-

PAGE gels to see if concentration of IPTG had

any eff ect on induction of soluble protein

(data not shown). Th e bands that resulted

showed that diff erent concentrations resulted

in same band intensity indicating IPTG

concentration didn’t aff ect induction. Due

to the many variables that could aff ect the

interaction between the glutathione-agarose

beads, His-tagged sigma factors, and GST-

0876, including washing of the beads and

loading of SDS-PAGE gels, another method of

observing interaction between sigma factors

and anti-sigma factors of N. punctiforme is

currently being done in the laboratory.


PREPARATION OF GST LYSATES FOR ATTACHMENT TO GLUTATHIONE BEADS

(Th e Bait)

Preparation of Starting Culture

Transformed both protein-of-interest-GST

plasmid pGEX5X-1::0876 and GST-only

plasmid pGEX5X-1 into CaCl2 competent

Escherichia coli Rosetta strain and plated

onto Luria Broth (LB) ampicillin 100 μg/mL

(Ap100) agar plates and grew overnight at 37 °C.

Th e next day in the late afternoon, 2 single

colonies for each plasmid were inoculated into

2 test tubes per plasmid, each containing 5 mL

LB Ap100 with a fi nal concentration of ~20

mM of glucose added and incubated rolling

overnight at 37 °C.

Protein Induction and Lysate Preparation

One half milliliter of the overnight culture

was cryopreserved with an equal volume of

cryo solution and mixed thoroughly, and

placed in -80 °C freezer to be used to inoculate

a larger scale prep for future use if the strain

ended up working. Th e remaining overnight

culture was inoculated into 50 mL LB Ap100

in a 125 mL Erlenmeyer fl ask and grown at

37 °C on a shaker until the optical density

(OD) at 600 nm was ~0.6 on the spectrometer.

One thousand microliters of the uninduced

culture was removed and put into a 1.5 mL

microfuge tube, centrifuged for 2 minutes

at max speed (17.0 x g), and all media was

removed (dumped out, re-centrifuged for 20

seconds at same speed, then removed the

rest of the LB with a pipette). Th e remaining

pellet of cells, which serves as the uninduced

MURJ - VOLUME 324

control at time zero (T0) was frozen at -80 °C

to be later run on a sodium dodecyl sulfate

polyacrylamide gel electrophoresis (SDS-

PAGE) protein gel. Th e rest of the overnight

culture fl ask was induced by adding isopropyl-

ß-D-thiogalactopyranoside (IPTG) to a fi nal

concentration of 0.4 mM (200 μL of 100 mM

stock per 50 mL culture) and transferred to

a room temperature water bath shaker at

23 °C with heat off . Six hundred microliters

of culture was removed after 5 hours of

induction (T5), and the pellet was frozen at

-80 °C for later gel analysis along with the

T0 culture.

Th e remaining 50 mL T5 induced culture was

centrifuged at 12,000 x g at room temperature

in a falcon tube for 15 minutes. Th e

supernatant was completely removed and the

remaining pellet was frozen at -80 °C for later

use after confi rmation that the T5 lysates

do contain the induced protein of interest in

soluble form.

SDS-PAGE

Ice cold Tris-buff ered saline (TBS) was added

to each E. coli pellet; 150 μL to T0 and 300 μL

to T5. Th e pellets were sonicated on ice with

a micro-tip probe (~1/8 inch diameter tip) for

10 cycles each with rest on ice in between, 30

seconds per cycle at 6% amp for T0 and 12%

amp for T5. Fifteen microliter samples of

lysed cells for T0 and T5 were each removed

and mixed with 5 μL of 4X SDS-PAGE loading

buff er (TOTAL). Th e remaining lysed cells

were centrifuged at max speed (17.0 x g)

in a refrigerated microcentrifuge at 4 °C

for 15 minutes. Fifteen microliters of the

supernatant containing the soluble proteins

(SOLUBLE) from T0 and T5 were mixed with

5 μL 4X SDS-PAGE loading buff er. Th e TOTAL

and SOLUBLE samples were heated at 95 °C

for 5 minutes and immediately placed on ice.

Twenty microliters of each sample and 5 μL

of PageRuler Unstained Broad Range (BR)

protein ladder were loaded into the wells of a

12% SDS-PAGE gel and run for ~45 minutes

at 200 volts in 1X SDS-PAGE running buff er.

Th e gel was rinsed with deionized water for 15

minutes to completely remove the remaining

4X SDS dye. Th e gel was stained with GelCode

Blue Safe Protein Stain (Pierce) for 1 hour and

destained for ~15 minutes as described by

the manufacturer.

Lysate Preparation after SDS-PAGE Induction Confi rmation

Each of the T0 and T5 pellets in the 50 mL

falcon tubes from -80 °C were suspended in

10 ml of ice cold TGEM (0.1) (20 mM Tris-

HCl pH 7.8, 20% Glycerol, 1 mM EDTA, 5 mM

MgCl2, 0.1 M NaCl), 100 μL of HALT protease

inhibitor (Th ermo Scientifi c), 100 μL of 0.1 M

dithiothreitol (DTT), and 10mg of lysozyme,

and the cells were resuspended by vortexing.

Cells were lysed twice by refrigerated French

press, each at 16,000 psi. Fifteen microliters

of TOTAL was taken and mixed with 5 μL of

4X SDS loading buff er. Th e remaining lysed

cells were centrifuged at 12,000 x g at 4 °C for

15 minutes in the 50 mL falcon tubes. Fifteen

microliters of SOLUBLE was taken and mixed

with 5 μL of 4X SDS loading buff er. Both

TOTAL and SOLUBLE were run on 12% SDS-


PAGE gel as previously described above to

check for induction. Two hundred microliters

of the remaining supernatant containing

the soluble proteins were aliquoted into 20

microfuge tubes and stored in a -80 °C freezer

for future use.

PREPARATION OF HIS-TAGGED PROTEIN LYSATES (Th e Pond)

Th e optimization of soluble protein expression

followed the same protocol used in producing

the GST lysates described above except for the

diff erences indicated below:

Transformation and Protein Induction

CaCl2 competent E. coli DH5-alpha (DH5a)

cells were transformed with pET28a (His-

tagged vector), plated onto LB kanamycin 30

μg/mL (Km30) agar plates and grown at 37 °C

overnight. Th e next day in the late afternoon,

2 single colonies were inoculated into 2 test

tubes, each containing 5 mL LB Km30 with

a fi nal concentration of ~20 mM of glucose

added and incubated rolling overnight at 37

°C. Protein induction was done with the same

procedure as with the GST-tagged protein.

Preparation of Glutathione-Agarose Beads for Pulldown Assay

Forty microliters of 50% slurry solution (50%

ethanol solution and 50% agarose beads with

glutathione attached) containing 10 μL of

agarose beads was pelleted in microfuge tubes

at room temperature for 2 minutes at 800 x

g. Th e liquid was then aspirated with a 25 Ga

needle. Ten times the packed bead volume

of TGEM (0.1) was added, mixed, and the

supernatant aspirated as before to wash the

beads. Th is wash was repeated 3 more times

for a total of 4 washes. Th e washed beads

were suspended in a 25% slurry by adding

3 times the bead volume of TGEM (0.1) and

aliquoted 40 μL of the slurry into separate

reaction tubes which were placed in

the refrigerator.

Normalization of GST-Binding to beads

GST and GST-protein lysates stored at -80 °C

were thawed on ice and microcentrifuged at

max speed (17.0 x g) for 20 minutes and the

clear supernatant was put into pre-chilled

microtubes on ice. Each lysate was diluted

1/10 and 1/100 in TGEM 0.1:

a. 1/10: 5 μL cleared lysate + 45 μL of cold

TGEM 0.1

b. 1/100: 5 μL cleared lysate + 495 μL of cold

TGEM 0.1

Forty microliters each of undiluted lysate,

the 1/10 dilution, and the 1/100 dilution

were added into 40 μL of washed beads (25%

slurry; 10 μL packed beads) and incubated in

the refrigerator on a rolling machine at 5 rpm

for ~2 hours to maximize bead interaction

with lysate. Microfuge tubes were centrifuged

at 800 x g for 2 minutes at 4 °C, and the

supernatant removed. Th e beads were washed

2 times with 130 μL ice cold TGEM (1.0) (20

mM Tris-HCl pH 7.8, 20% Glycerol, 1 mM

EDTA, 5 mM MgCl2, 1.0 M NaCl), and another

2 times with TGEM (0.1), centrifuging and

aspirating between washes as done before.

Washed pelleted beads were mixed with 10 μL

of 4X SDS buff er, heated for 5 minutes at 95

°C, cooled to room temperature, and 20 μL of

MURJ - VOLUME 326

each sample and 5 μL of Unstained BR protein

ladder were loaded into the wells of a 12%

SDS-PAGE gel. Th e gel was run, stained, and

washed as done with the previous gels.

GST Pulldown Assay

Th e GST-only and GST-0876 lysates that were

confi rmed to successfully bind to the agarose

beads were thawed on ice from the -80 °C

freezer and centrifuged in the same manner

as done with the normalization step. Each

lysate was diluted or kept at full concentration

to the amount that was determined to result

in ~500 ng of GST-protein attached to 10 μL

of agarose beads. Forty microliters of the

proper dilution of GST lysate was added to 10

μL of washed packed beads into a total of 8

microtubes with 2 tubes per GST

lysate mixture:

Tube 1 (duplicates): GST-protein fusion lysate

(GST-0876)

Tube 2 (duplicates): GST-only lysate from

pGEX5X-1 without an insert (GST-only)

Tube 3 (duplicates): GST-protein fusion lysate

(GST-0876)

Tube 4 (duplicates): GST-only lysate from

pGEX5X-1 without an insert (GST-only)

Th e microtubes were incubated on a rolling

machine in the refrigerator as done with

the normalization of beads. Th e His-tagged

lysates were prepared while GST lysates were

incubated. Th e His-tagged protein lysates

that had induced soluble protein were thawed

from the -80 °C freezer on ice and centrifuged

as done with the GST lysates to retrieve

cleared His-lysate. Th e GST lysates+beads

were washed and aspirated as done with

normalization. Approximately 150-300 μL

of the cleared His-lysate was added to Tubes

3 and 4 and incubated in refrigerator as done

with the GST lysates:

Tube 1 (duplicates): added nothing;

kept on ice

Tube 2 (duplicates): added nothing;

kept on ice

Tube 3 (duplicates): added cleared His-lysate

Tube 4 (duplicates): added cleared His-lysate

All the tubes were then washed 4X with ice

cold TGEM (0.1). Ten microliters of 4X SDS

loading dye was added to the packed beads

and heated at 95 °C for 5 minutes. Th e

beads were left at room temperature to avoid

clumping together. Th e beads were run on

two 12% SDS-PAGE gels the same way as done

with prior gels. One gel was loaded with 5 μL

of PageRuler Unstained Broad Range protein

ladder and the other gel was loaded with 5 μL

of PageRuler Plus Prestained protein ladder.

Fifteen microliters of each His-tagged cleared

lysate with no beads were loaded onto the gels

as well. One SDS-PAGE gel was stained with

GelCode Blue Safe Protein Stain (Pierce) for

1 hour and destained for ~15 minutes. Th e

second SDS-PAGE gel was western blotted

using GenScript One-Hour Detection System

kits as described by the manufacturer. Th e

One-Hour Western Standard Kit with TMB

(Mouse) L00205T was used for chromogenic

western blot analysis. Th e One-Hour Western

Standard Kit (Mouse) L00205C was used for

chemiluminescent western blot.


ACKNOWLEDGEMENTS

I would like to thank my sponsor Dr. Michael

Summers for allowing me the opportunity to

work in his laboratory. I would also like to

thank all the members of Dr. Summers’ lab

for welcoming me and helping me during the

research process, especially Jenevieve Polin

for taking the time to teach and explain to

me the laboratory procedures and concepts

during my internship. I would like to thank

Dr. Stephen Brown for guiding my fellow

interns and myself during the duration of our

internship with advice and encouragement.

Of course, a special thank you to the STEM

program at Los Angeles Mission College for

allowing this wonderful opportunity to have

been possible. Th ank you all very much.

REFERENCES

GenScript One-Hour Western Detection

System User Manual. (2010). Web.

Hayworth, Douglas. “GST-tagged Proteins-

Production and Purifi cation”. <http://

www.piercenet.com/method/gst-tagged-

proteins>. Web.

Mahmood, Tahrin and Yang, Ping-Chang.

“Western Blot: Technique, Th eory, and

Trouble Shooting”. (2012). Web.

Snider, Jared. “Pull-Down Assays”. <http://

www.piercenet.com/method/pull-down-

assays>. Web.

MURJ - VOLUME 328

Is Th e Survival Of Th e Mediterranean House Gecko In New Environments Caused By Evolution?

Dezerey Escanuelas Sponsored by Dr. Robert Espinoza, Department of Biology


INTRODUCTION

Hemidactylus turcicus is a non-native species

of gecko found in the United States. It

is commonly called the Mediterranean

house gecko because it originates from the

Mediterranean region. Th e fi rst sighting of

the Mediterranean house gecko in the United

States was in the state of Florida in 1915(1).

It is believed that this species was brought

over in ships and is now being transported

throughout the country by traveling with

people(2). Today, the geckos tend to stay

where people are because they use the heat

of outdoor lights at night for warmth and

eat the insects that are drawn to the lights.

Th erefore, they often spread around homes

of people and end up fi nding their way into

objects that people end up taking with them

when they travel to diff erent regions in

the country.

Th e Mediterranean house gecko population

has been spreading quickly throughout the

country for nearly 100 years. Since their fi rst

sightings in Florida in 1915, they have now

been found in places as far west as California.

With the spread reaching across the country,

the geckos have been found living in diverse

environments with diff erent conditions such

as subtropical, Mediterranean, and desert

climates. Th is is signifi cant because normally

a species will only survive in the particular

type of climate they are adapted to. Since

the geckos have been found in such diverse

climate conditions, the question arises as

to how they are surviving. In order for this

species to survive in a new environment,

evolution or adaption will have taken place.

Th is study focuses on whether the

Mediterranean house geckos have evolved

over time through evolution or adapted

quickly into their environments. Evolution

is a process of species adapting over time

through generations. Th is happens when a

species develops genetic traits that help it

survive in a new environment. Adaption is

a process that occurs much faster and only

requires one generation to make changes

in response to their new environments(3).

Adaptation involves physiological changes

to take place in order for the organism to

respond to the changes it is experiencing in

its new environment. By collecting a group


of geckos from diff erent habitats throughout

the country and placing them in equal

environments, it can be determined which

factor played a role in the survival of these

geckos in diff erent regions. Experiments

will be conducted observing each individual

gecko’s abilities in diff erent climate

conditions. Th e experiments involve putting

the geckos into hot and cold temperatures

and observing their activity. Some may have

diff erent abilities in specifi c temperatures

based on the region from where they were

collected. If all the geckos have similar

abilities under certain temperatures, then

they will prove to have a very large capacity to

adapt when it comes to climates. If the geckos

from diff erent regions have diff erent results,

then this will indicate that they have evolved

to fi t their specifi c environment.

RESULTS

Critical Temperature Determination

Critical temperature is the coldest

temperature reached where a gecko cannot

right itself. To determine the critical

temperature for geckos isolated from various

climates in the United States (Figure 1),

we tested geckos from each location at

successively lower temperatures until the

critical temperatures were identifi ed. Th e

results shown in Figure 2 indicate that geckos

from the Mediterranean climate regions

have a colder critical temperature compared

to the geckos from the subtropical and

desert climate regions. Th e geckos from the

subtropical and desert climate regions showed

closer results. Th e results were gathered by

taking the average critical temperature of a

gecko population from each location. Th e

average temperature from each location was

grouped into similar climate regions and the

total average of critical temperatures from a

particular climate region was calculated.

Sprints

Th e sprints could not be carried out because

the equipment (sprinting track) was

inoperative, therefore there were no results.

Figure 1 - The climate regions from which geckos were collected - The geckos were collected in several locations throughout the United States by the staff of California State University, Northridge.

Figure 2 - Critical temperature resultsThe graph shows the average critical temperature reached by the geckos from a particular climate region. The geckos from the Mediterranean region reached the coldest temperature.

MURJ - VOLUME 330

will be weighed for evaporative water loss.

It is predicted that geckos that live in hotter

regions will retain more water in their bodies

after exposure to higher temperatures than

geckos from colder regions.


Geckos

Several Mediterranean House geckos were

collected from diff erent regions in the United

States such as the states Arizona, Alabama

California, Louisiana, and Missouri. Th ey

were kept in the same living conditions for

several weeks to ensure that the results of the

geckos’ abilities will be based on the response

to the same environment. Th is will determine

DISCUSSION

To determine whether evolution or adaption

took place, additional tests will need to be

done on specimens from diff erent locations

throughout the United States. Th e tests

on critical temperature will still continue

with more gecko specimens collected from

new locations in the same climate regions

(Mediterranean, subtropical, and desert).

Th ere are more climate regions in the

United Sates that specimens have not been

tested from. Eventually those specimens

will be observed, which will add data to

report on that will support or disprove the

determination of evolution taking place.

Th ere were no results to report on the

sprinting experiment because the track

the geckos were going to sprint on was

getting repaired throughout the summer.

Based on the results of the geckos’ critical

temperatures, the geckos from the

Mediterranean region are predicted to

perform faster than the geckos from the

subtropical and desert regions when the track

is set to colder temperatures.

Further experiments will also be done in order

to analyze how the geckos respond to hotter

temperatures. Th e amount of water within

the geckos’ bodies will be observed when they

are put into hotter temperatures. Similar to

the other experiments, the geckos will be

grouped by region. In order to ensure the

safety of the gecko and avoid dehydration, at a

certain high temperature the gecko will begin

to pant and that is the point where the gecko

will be fi nished with the test. Th e geckos

Figure 3a - Equal living environment - There were a total of 118 cages in the lab. Each contained 1 gecko.


sitting 1 inch from a metal pan sitting on ice

in a cooling box. Th e ice took up half the box

and was set at approximately 5 ˚C. After every

0.5 ˚C temperature drop in the gecko’s body

temperature, the gecko was fl ipped over on its

back. If the gecko was able to turn over then

the experiment continued, leaving the gecko

in the cooling box until it drops another 0.5

˚C. If the gecko did not fl ip over, then that

temperature is recorded as its

critical temperature.

whether genetic or physiological changes took

place, as seen in Figure 3a. Th erefore, each

gecko was placed in the same size cage and

given the same substrate, water bowl, and

shelter in a pot, as seen in Figure 3b. Th ey

were all fed the same amount of crickets, had

their cages moistened with water every other

day, and had a heat pad placed under

their cages.

Critical Temperature Determination

Th e goal was to fi nd the coldest temperature

that will cause the gecko to be unable to right

itself (cannot fl ip over after being turned on

its back) which was considered its critical

temperature. Th e experiments did not go

below that temperature because the gecko

could reach its lethal temperature. Th e geckos

were put into a refrigerator that had the

temperature set to a cold temperature, which

was 10˚C, to ensure that all the geckos are

set at the same body temperature. Th ey were

left at this temperature for 30 minutes. Th e

geckos were then placed onto a metal mesh

Figure 3b - Equal living conditions - All the geckos received the same set up in their cages. Each cage was labeled with the location it came from.

Figure 4 - 10 ˚C Body temperature - The geckos were put into mesh bags for ventilation and to prevent them from running out of the refrigerator and getting lost.

Figure 5 - Cooling box - The geckos had a band placed around their waist connected to the thermometer to determine its body temperature. The mesh was also monitored and indicated the cooling box temperature. A barrier was needed to keep the gecko from running out and into the ice inside the box.

MURJ - VOLUME 332

Sprints

Th e goal was to compare the performance

of two geckos at certain temperatures. Two

geckos from diff erent regions were put onto

a track and they had to sprint across. Th e

track had several lasers at certain distances

that calculated the time the gecko passed

that mark on the track. Th ese numbers were

used to calculate how fast the gecko ran using

the time and distance at that mark. Th is

was conducted at night because that is when

geckos are most active. Th e experiment was

conducted with the track set at hot and cold

temperatures, which was done by changing

the temperature of the water running at the

bottom of the track.

Figure 6 - Righting themselves - When the gecko was turned over, a brush was used to tickle the gecko to create a response and coax the gecko to fl ip itself over and right itself. When they remained lying on their back and only moved their arms and fi ngers, the test was done.

ACKNOWLEDGEMENTS

I would like to thank my sponsor Dr. Robert

Espinoza for allowing me to work in his lab

and teaching me so much about herpetology.

It was defi nitely a memorable experience

and I learned so much from everyone I

met in the lab. I would also like to thank

Matthew Dickson for teaching me about the

experiments and allowing me to take part

in his research. I want to give thanks to Dr.

Stephen Brown for mentoring us and giving

advice on how to write our papers. I especially

want to give thanks to Dr. Mike Fenton

and the STEM program for providing the

opportunity to experience what it feels like to

work in a research lab.

REFERENCES

1. “Nonnatives - Mediterranean Gecko.”

Florida Fish and Wildlife Conservation

Commission. N.p., n.d. Web.

2. Gorin, Jerry. “Natural History Museum

Enlists Local Citizens to Discover New

Species.” Southern California Public Radio. N.p.,

n.d. Web.

3. Miguel. “Diff erence Between Adaptation

and Evolution.” Diff erence Between. N.p.,

n.d. Web.

4. Map Source for Figure 1: (http://

holapicasso.pbworks.com/w/page/18713750/

4%20Th e%20climates%20in%20the%20USA)


ZOG1 Gene Eff ects On Arabidopsis Cell Size

Vanessa Garcia Sponsored by Dr. Maria Elena Zavala, Department of Biology


INTRODUCTION

Plants have long been used by researchers to

study diff erent genes, and the eff ects those

genes have on the development of the plant.

Scientists use model organisms, organisms

that have been extensively studied, to make

new discoveries about other organisms.

Arabidopsis thaliana is a small fl owering plant

that is widely used as a model organism

in plant biology because it has a rapid life

cycle, produces many seeds and is easy to

cultivate1. Arabidopsis was also the fi rst plant

to have its entire genome sequenced. Th is

has allowed researchers to manipulate the

genes in the plant and study the changes in

morphology on a molecular level. Cytokinins

are a class of plant growth substances that

promote cell division and diff erentiation, in

plant roots and shoots. ZOG1 is a type of

cytokinin that is naturally produced in the

plant. To study the ZOG1 gene in Arabidopsis,

we created transgenic Arabidopsis plants that

expressed wild-type ZOG1 at higher levels.

Th e plant was then grown for 4 weeks. Th e

roots were collected and stained so they

could be examined and photographed under

a fl uorescence microscope. Measurements

of cells from the endodermis, cortex, and

epidermis were taken starting at every

100 μm from the tip of the root. In this

experiment, four cell lines were studied: C24

- the wild type of Arabidopsis, J571 - the wild

type with GFP (a marker protein that glows

green under fl uorescence light), J571+1 -

containing higher levels of ZOG1, GFP, and

YFP (a marker protein that glows yellow under

fl uorescence light), and J571+2 - containing

higher levels of ZOG1 and GFP with no YFP.

Th e area of cells from the endodermis, cortex,

and epidermis will be calculated to determine

the eff ects of higher levels of ZOG1 on the

plant. Cell size is expected to increase in

transgenic plants with higher levels of ZOG1.

RESULTS

In Figure 1, you can see pictures of the root

tip for each transgenic line. Figure 1A shows

C24, the wild type, and how the cells normally

look for Arabidopsis. Figure 1B shows J571,

which is essentially the wild type also, but

with added GFP. GFP does not aff ect cell size,

so the cells look very similar to C24. Figure

1C shows J571+1, containing the ZOG1

gene. Here, you can see that the cells look

MURJ - VOLUME 334

diff erent from the wild type. Th ey are longer in all 3 layers of cells. Figure 1D shows J571+2,

also containing the ZOG1 gene. J571+2 also looks diff erent than the wild type. J571+2 looks

more similar to J571+1, which is good because it indicates that the ZOG1 transgene is having

an eff ect in the plant. Th ese preliminary results show that the ZOG1 transgene is aff ecting the

root cell morphology of the plant.

Figure 1 - Images of the root tips for each of the following transgenic lines taken at 400X.A - C24, B - J571, C - J571+1, D - J571+2

A B

C D


DISCUSSION

To determine how much of an eff ect

overexpression of the ZOG1 gene has on

Arabidopsis plants, the area of a cell from each

cell layer at every 100 microns needs to be

calculated. Th e area is calculated by taking

the length and multiplying it by the width

of the cell. In order to have a good average,

a minimum of 6 measurements needs to be

taken for every 100 microns. Once an average

is obtained, a graph will be made with the

averages for all transgenic lines. Th e graph

will be able to show if the ZOG1 transgene

had a signifi cant or minor eff ect on the plant.


Growth of Plant Roots

Seeds of each cell line were sterilized by

adding a few seeds from each cell line into

microcentrifuge tubes. One milliliter of 95%

ethanol was added to the seeds and left for 5

minutes. Th e ethanol was drained and rinsed

out with 1.0 mL of deionized water which

was discarded. Four milliliters of 1:3 bleach

with 5 μL of Tween was mixed. One milliliter

of the bleach/Tween solution was added to

the seeds and left for 5 minutes and then

removed. Seeds were then rinsed with 1.0 mL

of deionized water 4 times. Seeds were then

planted in a 1% agarose gel plate and stored

in a 4 degree Celsius refrigerator for 4-7 days.

Plates were then transferred to a growth

chamber and subjected to 8 hours of light

and 16 hours of darkness per day. Roots were

allowed to grow for 4 weeks.

Staining Roots

Roots were stained with a staining solution

made with 9.9 mL of deionized water and

100 μL of stock 1.0 mg/mL propidium iodide.

Two and one half milliliters of the solution

was added to small dishes. Th ree to four

roots were placed in the staining solution

and left for 15 minutes. Two to three roots

were placed on a slide and examined under a

fl uorescence microscope.

Measurements

Th e photographs of the roots were measured

using the computer software ImageJ.

Measurements of the 3 layers of cells were

taken starting at 100 μm from the root tip

and at every 100 μm until 1000 μm.

Photographs

Photographs were taken using a fl uorescence

microscope at 400X. Five pictures were taken

of the root starting at the tip and going up

along the root. Pictures were taken of the

endodermis (innermost cell layer), cortex

(middle cell layer), and epidermal (outermost

cell layer) layers of cells.

ACKNOWLEDGMENTS

Special thanks to Dr. Maria Elena Zavala,

Sokuntheavy So, Dr. Stephen Brown and the

STEM Department at LAMC.

REFERENCES

1. “About Arabidopsis.” Th e Arabidopsis

Information Resource. 2014. Online.

MURJ - VOLUME 336

Neurofi bromatosis Type 1: Th e Race To Treating Optic Gliomas

Amy Heman Sponsored by Dr. Aida Metzenberg, Department of Biology


INTRODUCTION

Neurofi bromatosis Type 1 (NF1) was fi rst

discovered in 1882 by Friedrich Daniel

von Recklinghausen. NF1 is an autosomal

dominant trait that is passed from parent

to child. An infl icted individual is born with

one mutated copy of the NF1 gene which is

located on chromosome 17. NF1 can also

be present with no family history of the

disorder when there is a new mutation in the

NF1 gene[1]. Mutation of this gene results in

various conditions and no one with the same

exact mutation will have the same symptoms.

NF1 causes changes in skin pigmentation

which are known as café au lait spots, and

growth of tumors along nerves in the skin,

brain, and other parts of the body[2]. Th e NF1

gene codes for the protein neurofi bromin

which helps regulate the activity of the RAS

protein that is responsible for promoting cell

division[3]. When the NF1 gene is mutated

the RAS protein is no longer able to bind to

the mutated neurofi bromin and its activity

goes unregulated. With the RAS protein

unregulated, cells divide uncontrollably

resulting in tumor development. Th is

uncontrolled division leads to the formation

of tumors that can be malignant or benign.

Approximately one in every 3,000 individuals

are aff ected with Neurofi bromatosis Type

1[3]. Although NF1 causes changes in skin

pigmentation and growth of tumors along

nerves in the skin, brain, and other parts

of the body, our research will focus only on

tumors forming on the optic nerve. Th ese

tumors are called optic gliomas and can lead

to reduced vision or total vision loss. Th is

research will continue prior work which

includes the insertion of the pEPito vector,

which is a non-viral mammalian plasmid

vector into the NF1-GRD domain. Th e NF1-

GRD domain was specifi cally targeted in our

research because this region of the gene is

where most mutations occur and where the

protein neurofi bromin normally enhances the

de-phosphorylation of GTP-RAS using

neurofi bromin’s GTPase activating protein

(GAP) domain. Th e de-phosphorylation of

GTP-RAS turns into GDP-RAS which helps

control and shut off cell division. Our goal

was to amplify the amount of NF1-GRD

construct through transformation. Once

completed, we then can proceed to the

insertion of the lactoferrin gene, which will

allow the construct to cross the blood-brain

barrier. Th e lactoferrin gene has already been


RESULTS

To begin this project, we fi rst needed to

transform bacterial cells with the pEPito+NF1

GRD expression vector. Analysis of

transformation is shown in Figures 1 and 2.

Transformation was performed in order

for our construct to be incorporated into

previously made competent cells from a

colony of Top 10 Escherichia coli. By spreading

our samples onto agar plates containing

ampicillin, we were able to ensure the colonies

grown on the plates did in fact contain

our construct and the ampicillin resistant

gene. Ampicillin helped to ensure that no

satellite colonies were able to grow on the

plates. Figure 1 depicts the construct with

growth along the edge of the plate. Only the

100 μL plate had growth. Bacterial growth

was seen around the edge of the plate with

one isolated colony which is seen in Figure

2. Figure 4 and Figure 5, which present 2

plates used to grow our construct, shows 10

μL of the transformed bacteria and the rest

of the transformed bacteria, respectively.

Unfortunately, no growth was seen on either

plate. Our control transformation with

pUC19 is shown in Figure 3 with colonies

along the rim of the plate. Transformation

was unsuccessful and did not meet its

maximum potential in creating colonies

containing our construct. From the

transformation performed, we restreaked a

colony to help ensure that the colony picked

did have the construct being transformed.

After restreaking with a toothpick, we then

studied and proven to be capable of crossing

the blood brain barrier and possibly improve

gene therapy for those with NF1. Our hopes

are to insert the lactoferrin gene into the NF1-

GRD domain within the vector pEPito and use

the lactoferrin gene as a “Trojan horse” to get

past the blood brain barrier.

Figure 1 - After overnight incubation of transformed cell, growth is seen along

the rim of the 100 µL agar plate.

Figure 2 - From the same plate shown in Figure 1, an isolated colony is shown to have

grown in the middle of the 100 µL agar plate.

Figure 3 - Both plates show the control, pUC19, used for transformation. As shown the colonies are formed around the edge of plate.

MURJ - VOLUME 338

inoculated the colony by placing the toothpick

in 5 mL of LB containing 50 μg/mL ampicillin.

Th e restreak containing the pEPito+NF1 GRD

construct is shown in Figure 6 was successful.

Many colonies of our construct are shown on

the plate in a zig zag pattern. Restreaking

confi rmed that the colony growing on

the LB agar plate during transformation

contained the construct as the colony grew

and contained the ampicillin resistant gene

needed to thrive. Th is colony was used for a

plasmid miniprep.

After performing a plasmid miniprep from

a colony containing the pEPito+NF1 GRD

construct, we were then able to nanodrop

our samples to determine their DNA

concentrations. By nanodropping our samples

on the Th ermo Scientifi c NanoDrop 2000

which used pedestal measurements, we were

able to conserve our sample and only use 2

μL of sample to determine its concentration.

Pedestal measurements allowed for delivery

of our sample on the eye of the machine that

only required a couple of microliters. Other

techniques such as using a cuvette would

have caused more of our sample to be lost in

the process during these readings. Nanodrop

readings were consistently close to 135.9

ngμl as shown in Figure 7. Th e purity of the

DNA samples was revealed by a A260

/A280

ratio

between 1.80 and 1.90. Th e A260

/A280

reading

was 1.84 signifying that the sample attained

from the miniprep was pure and at a high

concentration that could be used for

further testing.

Figure 4 (above) & Figure 5 (below) - Both plates contained the construct pEPIto+NF1, however as shown no colonies were grown after overnight incubation on the designated 10 µL and rest plates.

Figure 6 - Restreaking of a colony obtained by transformation was done on an agar plate containing Ampicillin.


DISCUSSION

In our eff orts of amplifying the pEPito+NF1

GRD construct we were successful and created

the construct at a higher concentration

than expected. However, individual

transformations performed did not result

in colonies on the agar plates containing

ampicillin. Th e plate spread with 100 μL of

transformed bacteria contained colonies along

the edges, but did not provide accurate results

as to if the colonies did indeed contain the

construct with the ampicillin resistant gene.

Another student’s transformation gave better

results because isolated colonies were found in

the middle of his plate. Proceeding with this

colony, we were able to restreak onto another

plate containing ampicillin. Th ese results are

shown in Figure 6 with growth on the plate

proving that the E. coli cells did uptake our

construct. Many possibilities exist as to why

the construct did not grow on the agar plates

containing ampicillin. Th e transformation

results may have been due to an error in heat

shocking. Competent cells also may not have

been as competent as we had thought and did

not uptake our construct very well. Due to

an error in transformation we could not be

sure that the cells that grew along the edge

of the agar plate which contained 100 μl of

transformed cells contained our construct or

were just satellite colonies. Th e plate is shown

in Figure 1 and Figure 2 which clearly depicts

growth of the cells around the rim of the

plate. When sterilizing the spreader, leftover

ethanol in the pastor pipette could have killed

cells when being spread on to the agar plates

containing ampicillin. Due to these errors

we proceeded with the use of a colony from

another student’s agar plate. Th e colony was

then used to restreak and set up overnight

growth to perform a plasmid miniprep.

From the plasmid miniprep, no errors were

encountered. Nanodrop results were excellent

since the minimum concentration needed

was 20 ng/μL. A plasmid miniprep that was

performed gave a concentration of 135.9 ng/

μL. Having only started with 22 ng/μL,

the sample nanodrop results exceeded our

Figure 7 - Nanodrop reading is shown giving a reading of 135.9 ng/µL and A260/A280 number of 1.84.

MURJ - VOLUME 340

expectations. Th e A260

/A280

signifi es how

pure the DNA we retrieved was. Th is number

typically needs to be between 1.80 and 1.90.

Th e sample used from the mini prep gave a

A260

/A280

reading of 1.84 signifying that the

DNA was pure. If this ratio was lower than

1.80 it would have indicated that there were

contaminants such as the presence of protein,

phenol or other contaminants that absorb

strongly at or near 280 nm. Th e A260

/A230

reading was 1.23, however this number should

have been between 2.0 and 2.2. A low reading

indicated that there may be a presence of

contaminants which absorb at 230 nm[4].

Th is research was conducted over the course

of 11 weeks. While working on this project

many challenges were encountered, especially

when trying to create competent cells which

were important in helping the cells uptake

the pEPito+NF1 GRD construct. At the end

of the 11 weeks we were able to successfully

perform transformations and retrieve the

construct back through minipreps at a higher

concentration than before. Research for NF1

needs to be continued as the lactoferrin gene

still needs to be inserted in order for the

vector to get passed the blood brain barrier.

Future researchers will be able to use our

research in performing this task and move

forward to culture and tissue experiments

with zebrafi sh. Th e use of zebrafi sh will help

track how the vector is incorporating itself

within the organism. Th e vector will now be

within the brain and capable of helping to

treat optic gliomas caused by NF1.


Competent Cells

A colony of Top 10 Escherichia coli was

transferred to 5 mL of Luria Broth (LB) and

incubated in a shaker at 37 degrees Celsius

and 250 rpm overnight. One milliliter of

overnight growth was transferred to an

Erlenmeyer fl ask containing 50 mL of fresh

LB and placed in the shaker at 250 rpm and

37 degrees Celsius, checking for absorbance

at 600 nm with a spectrophotometer

approximately every 2 hours. Once the

absorbance (A600

) reached 0.6 to 0.7 the cells

were centrifuged at 5,098 x g at 4 degrees

Celsius for 10 minutes. Th e supernatant was

poured off and the pellet resuspended in cold

0.1 M CaCl2 keeping the cells on ice for 15

minutes. Th e cells were then centrifuged at

5,098 x g for 10 minutes at 4 degrees Celsius.

Th e supernatant was poured off and the pellet

was then resuspended in 1 mL 0.1 M CaCl2.

Competent cells were stored in 15% glycerol.

Four hundred fi fty microliters of 50% glycerol

was diluted by adding 50 microliters of diH2O

to 1 mL 0.1 CaCl2 to get a fi nal concentration

of 15% percent glycerol. Competent cells

were stored in 15% glycerol in aliquots of 200

microliters at -70 degrees Celsius until needed

for transformation.

Transformation

Two microliters of plasmid DNA was placed

on the side of a tube and washed down with

100 μL of competent cells (see above). Th e

cells were then placed on ice for 30 minutes

and heat shocked for 45 seconds at 42 degrees

Celsius. Nine hundred microliters of room


temperature SOC medium (0.5% yeast extract,

2% Tryptone, 10 mM NaCl, 2.5 mM KCl,

10 mM MgCl2, 10 mM MgSO

4, diH

2O, 1 M

glucose stored in 4 degrees Celsius) was added

to both the control, pUC19 and our construct.

Th e tubes were placed in the shaker at 37

degrees Celsius for 45 minutes at 225 rpm.

On LB agar plates previously made, used

sterile metal spreader to spread 25 microliters

of ampicillin (0.05 g/mL) to 6 plates.

Ampicillin was allowed to diff use into the

plates for 10 minutes. After the transformed

cells were fi nished shaking for 45 minutes,

various volumes were spread on plates and

incubated at 37 degrees Celsius overnight.

Plasmid Minipreps

Colonies were inoculated into 5 mL of LB

and 5 μL of ampicillin. Tubes were then

incubated in a shaker at 37 degrees Celsius

and 225 rpm overnight. One and one half

milliliters of each overnight culture was

transferred to a microcentrifuge tube and

spun for 10 seconds at 20,800 x g. One

hundred microliters of supernatant was left

with the pellet and vortexed to resuspend

the cells. Th ree hundred microliters of TENS

Buff er (1 mM EDTA pH 8.0, 0.1 M NaOH,

0.5% SDS, 10 mM Tris-HCl pH 8.0) and 150

microliters of 3 M Na Acetate were added

and the cells were mixed by vortexing. Each

sample was centrifuged for 4 minutes at

20,800 x g at room temperature, and 450

microliters of supernatant was transferred to

a new microcentrifuge tube. Samples were

mixed with 0.9 mL cold 95% ethanol which

was stored at -20 degrees Celsius until needed.

Th e samples were centrifuged for 2 minutes

at 20,800 x g at room temperature to pellet

plasmid DNA. Th e supernatant was discarded

and the pellet washed twice with room

temperature 70% ethanol. Th e pellet was then

air dried and resuspended in 200 microliters

of TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA).

DNA concentrations were determined by

Nanodrop. Samples were ultimately stored at

-20 degrees Celsius for future use.

ACKNOWLEDGEMENTS

I cannot express enough thanks to Dr.

Aida Metzenberg who was the principal

investigator. Without her continued support

and mentoring, this research would not have

been possible. She opened her heart to us and

with her guidance we were able to develop the

necessary skills needed to work in a genetic

laboratory setting.

A special thanks to Anamica Sood who day

in and day out allowed us to grow in the lab.

As we learned basic laboratory techniques

her passion for research was clearly shown.

Without her hard work this research would

not have been as successful as it was.

I would especially like to thank Andrea Cosco

whose three years of hard work towards his

master’s degree provided valuable research

in helping treat NF1. His creation of the

construct, pEPito+NF1 GRD, made this entire

research possible and I am grateful he allowed

us to continue his research.

MURJ - VOLUME 342

I wish to thank my fellow interns, Cindy

Barrios, Dylan Martin, and Sahil Khullar.

Over the course of our research, we shared

the same yearning for our experiments to

work. Th rough the ups and downs, we were

fi nally successful. Th anks for making this

experience memorable.

Last, but not least, I would like to thank Dr.

Brown for his continual support and guidance

throughout this internship. Without his

wisdom and mentoring, this research would

not have been as polished and concise as it

was. He was not only someone we could refer

to when in doubt, but he encouraged us to

persevere with our research when results

were stagnant.

REFERENCES

[1] “Neurofi bromatosis Type 1.” Genetics

Home Reference.N.p., n.d. Web. 16 July 2014.

[2] “Diagnosis of NF1.” Th e Children’s

Tumor Foundation Home. N.p., n.d. Web. 15

July 2014.

[3] University of Utah Health Sciences.

Genetis Science Learning Center, n.d. Web. 16

July 2014.

[4] T009 ‐ TECHNICAL BULLETIN NanoDrop

1000 & 800. N.p.: n.p., n.d. Print.


Advancing Research On Neurofi bromatosis Type 1

Sahil Khullar Sponsored by Dr. Aida Metzenberg, Department of Biology


INTRODUCTION

Neurofi bromatosis Type 1 (NF1) is a disorder

that allows for the excessive growth of

benign tumors known as neurofi bromas.

Th ese tumors primarily aff ect the peripheral

nervous system. Th ey are also notable for

their impairment of one’s vision.

Th e gene responsible for this disorder lies

on chromosome 17 of the human genome,

which encodes the protein neurofi bromin,

a tumor suppressor. Neurofi bromin is

responsible for the timely shutting off of

another protein, known respectively as RAS.

RAS acts as a promoter or stimulant of cell

division. Th e disorder arises when the NF1

gene mutates. Th e mutation of the gene

causes the formation of a shortened version

of the neurofi bromin protein which fails to

aptly bind to the RAS protein and shut it off .

Th e failure of neurofi bromin to bind with

RAS means that RAS is no longer controlled;

its activity is limitless. Consequentially, cells

exhibit uncontrolled growth, which causes the

formation of tumors known

as neurofi bromas.

Th e NF1 disorder is an autosomal dominant

disorder that is obtained in two ways. Th e

fi rst is by inheritance. Since NF1 is an

autosomal dominant disorder, only one

copy of the gene suffi ces for the phenotypic

expression of the genetic mutation; a child of

a heterozygote for the mutation has a 50%

chance of inheriting the disorder. Th e second

way of getting the NF1 disorder is by having a

mutation occur during the embryonic stage of

development. NF1 disorder commonly occurs

by mutation due to the rather large size of its

gene. Th e gene’s enormity instills it with a

higher probability for mutation. If a mutation

occurs in this gene within a sperm cell, an

individual produced from this cell will have a

50% chance of passing the disorder to his or

her off spring.

Th e disorder is most commonly physically

characterized by noticeable café-au-lait

spots on the surface of the skin. Th ese

spots are usually of a diff erent pigment

than surrounding skin and get bolder as the

carrier gets older; they are also present at

birth. Symptoms of the disorder range widely:

“high blood pressure, bone defects, scoliosis

(curvature of the spine), learning disabilities,

MURJ - VOLUME 344

lisch nodules (benign growths on the iris of

the eye), and optic gliomas (benign tumors on

the optic nerve that connects the eye to the

brain)” (Learn.Genetics). Unfortunately, no

current cure exists for the disorder.

In an eff ort to fi nd a cure for the disorder,

I am furthering the work done by Andrea

Cosco. Th e construct he made was created

by inserting a normal NF1-GRD domain

within a nonviral mammalian vector, namely

pEPito. Th e GRD domain is the site on the

neurofi bromin gene on chromosome 17

where most mutations are found to occur. It

is believed that by inserting the pEPito plus

NF1-GRD construct into those aff ected by the

NF1 disorder, cells will begin to express the

normal neurofi bromin gene. In theory, this

will reduce the symptoms of the disorder.

Before the construct can be used it must be

amplifi ed, hence the goal of this research.

Th e goal of producing a larger volume of the

construct is to have a larger, more signifi cant

volume available for future experimentation.

Without larger available amounts of the

construct, further research regarding this

form of gene therapy is impossible.

Th e amplifi cation will be done by creating

competent cells, transforming them, and

performing a miniprep. First, we will be

performing a transformation of the construct

into competent Escherichia coli cells. We will

then extract the copies of the construct found

in each E. coli cell by performing a

miniprep protocol.

RESULTS

Competent E. coli bacterial cells were

produced for the purpose of transforming

them with the pEPito-NF1-GRD construct.

Th e 200 microliter aliquots of competent

E. coli cells produced are shown in Figure 1.

Cells are stored in smaller quantities in

multiple aliquots due to their fragility.

Competent cells degrade the longer they are

left out of the -70 degrees Celsius freezer.

Two control plates were set up and run

alongside the sample plates. Two hundred

microliters of competent cells were pipetted

into each plate. Figure 2 indicates a

successful growth of transformed cells in the

control plates.

Figure 1 - 200 microliter aliquots of competent cells used for transformation.

Figure 2 - Control transformations Control plate: 25.0 mL LB Agar, Ampicillin (Agar 15.0 g/L, Luria Broth 25.0 g/L, Ampicillin 0.05 g/mL), 2.0 microliters plasmid DNA (10.0 pg/microliter), 100 microliters of Competent Cells. White dots are bacterial colonies containing plasmid DNA. The agar plate on the left contains 200 µL of transform control cells. The plate on the right contains the remaining amount of transformed control cells.


Figure 3 shows that the E. coli did accept the

pEPito plus NF1-GRD construct in plates A, B,

and C. Plate C contains numerous compacted

colonies, not ideal for plasmid preparation or

plate spreading. Th e placement of ampicillin

on the sample plates further strengthens the

presumption that colonies found on the plate

are in fact those containing the construct

since the inserted construct contains a gene

conferring resistance to ampicillin. Due to

our belief that the colony observed is in fact

that of a transformed E. coli cell, we picked a

colony from plate B and streaked it onto a new

plate. Multiple other colonies were picked for

plasmid miniprep.

Results from the plasmid minipreps indicate

the successful transformation of E. coli cells.

Plasmid minipreps were performed twice;

hence, two microcentrifuge tubes containing

initial volumes of 1.5 mL of incubated culture

were tested. A DNA concentration above 20

ng/mL is considered a positive result.

Figure 4/Table 1 and Figure 5/Table 2

respectively, indicate the observed

concentration of amplifi ed plasmid in each

microcentrifuge tube.

Figure 3 - Transformations with pEPito+NF1-GRD. Sample plate: 25.0 mL LB Agar, Ampicillin (Agar 15.0 g/L, Luria Broth 25.0 g/L, Ampicillin 0.05 g/mL), 100 microliters of competent bacterial cells were transformed with 1.0 microliter of pEPito+NF1-GRD, (22 pg/microliter). A: 10 microliters of transformed cells. B: 100 microliters of transformed cells. C: Remaining amount of transformed cells.

A B C

MURJ - VOLUME 346

Figure 4 - Nanodrop reading of Tube 1. Results from Nanodrop machine indicating concentration of cloned pEPito+NF1-GRD construct. Average Plasmid Concentration: 24.05 ng/microliterAverage 260/280 Reading: 1.85

Nanodrop Reading Number Plasmid Concentration (ng/microliter)

260/280 Reading

1st Reading 22.40 1.81

2nd Reading 25.70 1.88

3rd Reading 20.90 1.85

Average Reading 24.05 1.85

Table 1 - Nanodrop Measurements of the concentration of pEPito+NF1-GRD construct duplicated in Tube 1


Figure 5 - Nanodrop reading of Tube 2. Results from Nanodrop machine indicating concentration of cloned pEPito+NF1-GRD construct. Average Plasmid Concentration: 69.80 ng/microliter Average 260/280 Reading: 1.90

MURJ - VOLUME 348

Figure 6 shows streaks of bacterial colonies

on LB agar plates containing ampicillin. Plate

A is the fi rst streak, plate B is a restreak of a

colony on A. Th e presence of ampicillin in the

restreaked plates is designed to ensure that

the plasmid was successfully transformed into

the E. coli strain.

Neurofi bromatosis type 1 aff ects 1 in every

3,000 people. In an attempt to utilize gene

therapy as a potential for treatment, our

research plays a crucial role in pushing the

future goal in the right direction. Since

a small volume of the construct would be

insuffi cient to perform any further research,

our amplifi cation of the pEPito-NF1-GRD

plasmid is an essential step toward attaining a

cure of neurofi bromatosis.

We were able to attain positive results with

respect to plasmid amplifi cation in our

research. By successfully producing a greater

amount of the construct, further research

in fi eld of gene therapy for the disorder is

now possible. As shown in the results, two

tubes with concentrations of 69.80 ng/mL

and 24.05 ng/mL were produced as per the

nanodrop readings respectively.

Figure 6 - Restreaking bacterial colonies. A bacterial colony was picked and then streaked on a new LB agar plate with ampicillin. After incubating plate A overnight, a colony from plate A was picked and streaked on plate B which also contained ampicillin.

Nanodrop Reading Number Plasmid Concentration (ng/microliter)

260/280 Reading

1st Reading 70.40 1.91

2nd Reading 65.20 1.91

3rd Reading 69.20 1.89

Average Reading 69.80 1.90

Table 2 - Nanodrop Measurements of the concentration of pEPito+NF1-GRD construct duplicated in Tube 2

A

B


DISCUSSION

Despite obtaining conclusive results, there

were potential sources of error in the research.

Although it is likely that the transformed

and then extracted plasmid is believed to be

the construct, there is still a possibility that

it could be a diff erent amplifi ed plasmid.

Moreover, although ampicillin was used in the

plates, it could have been degraded and hence

did not weed out satellite bacterial colonies.

Th e fact that the picked colonies successfully

grew on new plates indicates that they are in

fact colonies of E. coli cells that accepted the

construct. However, a source of error could be

found in an earlier step. When colonies were

initially grown on the fi rst set of Agar plates,

ampicillin was not spread on the edges of the

plate. Hence, any colonies found on the edge

of the plate may or may not be colonies of the

desired bacteria depending on the manner in

which the ampicillin diff used into the

agar plates.

In the fi rst step of creating competent

cells, cells were shaken until they reached

an absorbance of 0.6 to 0.7, making them

competent. Competent cells were eventually

transformed with the construct. By running

a control of plasmid DNA alongside our

construct, we verifi ed the validity of our

results. Seeing that our technique did yield

colonies for the control, we were confi dent

that a bacterial colony formed on sample

plates was representative of a successful

transformation. Th e last step of carrying out

plasmid minipreps confi rms that we were able

to successfully transform bacteria with the

construct and eventually extract amplifi ed

copies of the construct from the E. coli cells.

With respect to use of the construct in

humans, we understand that although the

construct is currently unable to pass the blood

brain barrier in humans, by creating a greater

quantity of it through transformation, further

research on how to transport the construct

into the human brain is now possible. Th e

respective concentrations of the two tubes

being over 20 nanograms per microliter

indicates a successful amplifi cation of the

construct that can be used for performing

research on gene therapy.

Th e next step in research is to fi nd a way for

the construct to penetrate the blood brain

barrier in humans in order to reach the optic

chiasm. It is hypothesized that this could

be achieved by attaching a lactotransferrin

protein to the construct. Th is protein

codes for a gene that is permitted beyond

the blood brain barrier. Th e insertion of

this macromolecule may be the key to gene

therapy with this construct.

MURJ - VOLUME 350

MATERIAL AND METHODS

Preparation of Competent Cells

Fifty milliliters of Luria Broth was added to

an inoculated 1mL of E. coli TOP10 overnight

culture and incubated in a shaker at 37

degrees Celsius and 250 rpm for 2 hours. Th e

absorbance of the culture was verifi ed to be

between 0.6 and 0.7 at 600 nm. Th e culture

was then centrifuged at 5,098 x g for 10

minutes at 4 degrees Celsius. Th e supernatant

was discarded and the pellet resuspended in

5 mL of 0.1 M calcium chloride. Th e tube was

placed on ice for 15 minutes and centrifuged

again at 5,098 x g for 10 minutes at 4 degrees

Celsius. Th e supernatant was discarded and

the pellet resuspended in 1 mL of 0.1 M

cold calcium chloride. Four hundred fi fty

microliters of 50% glycerol and 50 microliters

of distilled water were added to the tube.

Finally, using a micropipette set at 200

microliters, the solution was aliquoted into

multiple microcentrifuge tubes.

Transformations

One microliter of plasmid DNA was added

to 100 microliters of competent cells and

placed on ice for 30 minutes. Th e cells were

heat shocked in a 42 degree Celsius water

bath for 45 seconds and placed on ice for 2

minutes. Nine hundred microliters of SOC

Medium (0.5% Yeast Extract, 2% tryptone,

10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2,

10 mM MgSO4, 20 mM Glucose) was added

to each tube which were placed into a shaker

at 37 degrees Celsius and 225 rpm for 45

minutes. Diff erent volumes of the culture (10

microliters, 100 microliters, and the rest of

the solution in the tube) were spread on LB

agar plates with 0.05 mg/mL ampicillin and

incubated overnight at 37 °C.

Plasmid Miniprep

Bacterial colonies were inoculated into 2 ml

of LB with 0.05 mg/mL ampicillin and shaken

overnight at 37 °C and 225 rpm. One and

one half milliliters of overnight culture was

centrifuged at 14,000 rpm (20,800 x g) for 10

seconds at room temperature. After decanting

the supernatant, the pellet was resuspended

in 100 microliters of leftover supernatant

by vortexing. Th ree hundred microliters of

TENS buff er 10 mM Tris-HCl PH 8.0, 1 mM

EDTA, 0.1 M NaOH, 0.5% SDS) was added

to each pellet and then vortexed on high for

5 seconds. One hundred fi fty microliters

of 3 M Na Acetate, pH 5.2 was added and

then vortexed on high for 5 seconds. Th e

samples were centrifuged for 4 minutes at

20,800 x g, forming a pellet of cell debris

and chromosomal DNA. Four hundred fi fty

microliters of the supernatant was transferred

to a new tube and 0.9 mL of precooled to -20

degrees celsius 95% EtOH was added and

mixed with the supernatant. Th e samples

were then centrifuged at 14,000 rpm (20,800

x g) for 2 minutes at room temperature and

the supernatant was discarded. Th e pellets

were washed twice with 500 microliters of

70% EtOH and each pellet resuspended in 200

microliters of TE (10 mM Tris-HCl PH 8.0, 1

mM EDTA PH 8.0).


ACKNOWLEDGEMENTS

I thank Dr. Aida Metzenberg for sponsoring

me and encouraging me to perform research

in the fi eld of genetics. I thank Anamica Sood

for her admirable guidance in the lab. I thank

Dr. Stephen Brown for his generous guidance

along the way. I thank my parents and sisters

for their relentless support. I thank my dear

grandmother, who recently passed away, for

always encouraging me. Without any of you,

none of this would have been possible.

REFERENCES

“Neurofi bromatosis Type 1.” Learn.Genetics.

Genetic Science Learning Center, n.d. Web.

June-July 2014. <http://learn.genetics.utah.

edu/content/disorders/singlegene/nf1/>.

“NF1.” Genetics Home Reference. N.p., n.d.

Web. June-July 2014. <http://ghr.nlm.nih.

gov/condition/neurofi bromatosis-type-1>.

MURJ - VOLUME 352

Progress For Neurofi bromatosis Type 1

Dylan Martin Sponsored by Dr. Aida Metzenberg, Department of Biology


INTRODUCTION

Neurofi bromatosis Type 1 (NF1) is a

dominant autosomal disorder which aff ects

about 1 in 3,000 to 4,000 people worldwide.

It is caused by a mutation in the NF1 gene

located on chromosome 17. In about 50% of

cases, the disorder is inherited by an aff ected

parent. Th e remaining cases result from

new mutations in the NF1 gene and occur

in people with no history of the disorder

in their family. Th e disorder is also highly

variable. Some people may show just a few

signs of NF1, while others have more severe

symptoms. Additionally, it seems to aff ect

both genders and ethnic groups equally

(Szudek et al., 2003). One of the most

common symptoms, which appear between

birth and 2 years of age, is the café-au-lait

spots. Other common symptoms include

freckles in between fi ngers, armpits and groin,

Lisch nodules, and neurofi bromas; which are

benign tumors, ranging from few to many,

growing cutaneous or subcutaneously. In

severe cases, NF1 suff erers could develop

learning disabilities, bone deformities,

and optic gliomas which could aff ect vision

(Murphy, 2013).

A normal functioning NF1 gene produces a

protein called neurofi bromin. Th is acts as

a tumor suppressor and negative regulator

to another protein called RAS. RAS is a

G protein that functions in intracellular

signaling, which ultimately turns on genes

involved in activities such as; cell growth,

diff erentiation, cell adhesion, apoptosis, and

cell migration. G Proteins, like RAS, have on

and off switches; when RAS is bound to GTP,

it is switched on, and when bound to GDP, is

off . Neurofi bromin aids RAS in the hydrolysis

of GTP to GDP and thereby inactivates it.

However, when the NF1 gene is mutated,

the neurofi bromin is shortened and cannot

bind to RAS. Th erefore, cells divide and grow

unregulated, which results in the formation of

tumors (King et al., 2003).

NF1 is generally not deadly unless tumors

become malignant, which is rare. As of today,

there is no cure for NF1. Th e problem is that

NF1 is a complex disorder with little research

conducted on it. Th e NF1 gene is a large

gene but most mutations occur in the NF1-

GRD region of it. Th e focus of the research

I am involved in is to try to produce a DNA

construct that can be introduced into patients


Figure 1 - Colony growth on LB agar with ampicillin with the pUC19 vector

Figure 2 - The control plate containing some transformed cells with pUC19

with neurofi bromatosis where it can express

normal NF1 protein to counter balance the

faulty NF1 genes, specifi cally in the NF1-

GRD domain. Th e goal is to acquire a DNA

concentration of 20 ng/μL or higher. Th is will

be achieved by using a plasmid named pEPito

that will contain a normal functioning NF1

gene. Th e idea is that with this increase, more

normal functioning neurofi bromin will be

produced, which will turn off the over-active

RAS-GTP, thus slowing down or eliminating

tumor growth.

RESULTS

Th ere were three main steps involved in

carrying out this research on NF1. Th ey were

making competent cells, transformation and

plasmid miniprep. Th e competent cells are

E. coli cells that have been treated in a way

so that they take up the construct, pEPito,

easier. If the competent cells are no good the

experiment cannot move forward. So before

moving on to transformation the competent

cells were tested. Using the plasmid, pUC19,

colonies of transformed cells were observed,

meaning the competent cells worked, as

illustrated in Figure 1.

Now that the competent cells were confi rmed

to be working, it was time to move onto

transforming them with pEPito containing

NF1-GRD and simultaneously do a

transformation with the pUC19 plasmid as a

control. During this procedure colonies grew

for both the control and the construct, pEPito.

But almost all the colonies grew on the sides

of the plates where there was no ampicillin

Figure 3 - E. Coli cells with the construct, pEPito, growing on the sides

MURJ - VOLUME 354

(the plate is shown in Figure 3; however, the

bacterial growth at the sides of the agar is

diffi cult to see in this image). Figure 2 shows

the control plate and Figure 3, the plate

with pEPito.

Next, a colony selected from the sample plate

was restreaked onto another plate treated

with ampicillin. Th is served as another

control that assured the cells were carrying

pEPito. As seen in Figure 4, the restreaking

was a success.

Lastly, a plasmid miniprep was done to

retrieve the multiplied pEPito with NF1-

GRD within the bacteria. Th e DNA collected

was nanodropped in order to obtain the

concentration of the DNA which is measured

in ng/μL (nanograms per microliter). A value

of 50.00 ng/μL was determined as shown

in Figure 5. Th is concentration is of good

quality and meets the goal of this research.

Th is can now be used for further research

purposes and possible gene therapy.

DISCUSSION

Over the span of 10 weeks, research

was conducted on the disorder called

Neurofi bromatosis type 1. Since NF1 is a

genetic disorder, the research focused on

working with a vector named pEPito and

transforming E. coli cells, which would carry

the normal version of the NF1 gene. Th e goal

was to successfully reproduce pEPito with

NF1-GRD so that it could possibly be used

for gene therapy. Before the E. coli cells could

take up the construct, they needed to become

competent to do so. Th is involved treating

them with various solutions as well as heat

shocking them to break down their cell walls.

Once this was achieved, accepting foreign

DNA such as a plasmid was made easier. For

the E. coli cells that took up the plasmid and

thus were “transformed,” they essentially

cloned the gene of interest each time they

grew, which was roughly every 20 minutes.

Now, all that was left was to extract the DNA

from these cells. Th e fi nal step, which is

called “plasmid miniprep,” destroys the cells

Figure 4 - Transformed colonies containing pEPito restreaked onto a plate Figure 5 - A recording of the DNA

concentration from the nano drop


leaving only the DNA behind. Th e DNA was

collected and the concentration of the DNA

was measured using a Nanodrop device. Any

sample that is 20 ng/μL and below is not

useful. However, when the sample was tested

the concentration was 50.00 ng/μL, which is

quite good. Th is same can now be used for

potential gene therapy or training.

Th roughout the research there were some

errors, doubts, and frustration. For starters,

lab-made competent cells like the ones made

during this research are of less quality than

commercially produced competent cells.

Couple this with the fact that transformation

can be hit or miss, which means some of

the time colonies do not grow on the plates.

Another issue was the technique of handling

of delicate materials. Initially, non-useable

materials and results were obtained due to

mistakes. So time was taken to work out the

kinks such as practicing and going through

the entire process of transformation and

doing minipreps using the control plasmid,

pUC19. Once confi dence was gained, work

resumed using the vector pEPito and the gene

of interest. A week before the fi nal week of

this internship none of the plates grew any

transformed colonies. So, it was decided to

make new competent cells, SOC medium, as

well as a few other solutions. Th e decision

proved to be wise because colonies did grow

and were usable to carry out the rest of the

research. In the end, plenty of pEPito with

the healthy NF1-GRD was reproduced. Th is

can now be used for potential gene therapy,

training and practice, as well as further

research for another student to carry out.


Competent Cell Preparation

Th ree test tubes containing 5 mL of Luria

broth (LB) were each inoculated with a colony

of Escherichia coli (Top10 strain) using a sterile

toothpick and placed into a shaker at 37 °C

and 250 rpm for 18 hours. One milliliter of

the overnight growth (inoculant from the

test tubes) was added to a fl ask containing

50 mL of LB and the fl ask was placed in a

shaker set at 37 °C and 250 rpm for 2 hours.

Th e absorbance at 600 nm was checked

periodically with a spectrophotometer until a

reading of 0.6-0.7 was achieved. Th e contents

of the fl ask were then centrifuged at 4 °C and

5,098 x g for 10 minutes. Th e supernantant

was discarded and the bacterial pellet was

resuspended in 5 mL of cold 0.1 M CaCl2. Th e

tube was vortexed briefl y then left on ice for

15 minutes. Th e tube was centrifuged again

at 4 °C and 5,098 x g for 10 minutes. Th e

supernatant was discarded and the pellet was

resuspended in 1 mL of cold 0.1 M CaCl2.

Th en, 450 μL of 50% glycerol and 50 μL of DI

water were added to the falcon tube. Finally,

200 μL aliquots and a single 100 μL aliquot

were made and stored at -70 °C.

MURJ - VOLUME 356

Transformation

Competent cells were removed from the -70

°C freezer and placed into the bucket of ice to

thaw. Approximately 50 ng of plasmid DNA

was added on the inside of a sterile tube and

washed down with 100 μL of the competent

cells. Th e tube was placed on ice for 30

minutes and then the cells were heat shocked

in a 42 °C water bath for exactly 45 seconds.

Th e tubes were immediately placed on ice for

2 minutes after which 900 μL of SOC medium

(0.5% yeast extract, 2% Tryptone, 10 mM

NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM

MgSO4, diH

2O, 1 M glucose) was added to

each tube. Th e tubes were placed in a shaker

to shake at 37 °C and 225 rpm for 45 minutes.

Ten microliters of the transformed cells was

spread on an LB agar plate to which 25 μL of

0.05 g/mL ampicillin had been spread on the

agar surface, that plate was allowed to sit for

10 minutes. Th is was repeated on two more

plates with 100 μL of transformed cells and the

remainder of the transformed cells. Th e plates

were then incubated at 37 °C for 18 hours.

Plasmid Minipreps

A transformed colony was chosen from a plate

grown the night before and added to a test

tube with 5 mL of LB and 5 μL of 0.05 g/mL

ampicillin. Th e tube was then placed at 37

°C and 225 rpm to shake overnight. Th e

following day 1.5 mL of the overnight growth

was added to a microcentrifuge tube and

spun at room temperature at 14,000 rpm in

a microcentrifuge for 10 seconds to pellet

the cells. Next, the supernatant was gently

removed leaving about 100 μL of medium

with the pellet. Th e tube with the pellet was

vortexed thoroughly to resuspend the cells.

Th en, 300 μL of TENS buff er (10 mM Tris-HCl

pH 8.0, 1 mM EDTA, 0.1 M NaOH, 0.5% SDS)

was added to the tube and vortexed on high

for 5 seconds. One hundred fi fty microliters

of 3M sodium acetate pH 5.2 was added to the

tube as well and vortexed on high 5 seconds.

Th e tube was placed into a microcentrifuge

and spun at room temperature for 4 minutes

at 14,000 rpm to obtain another pellet. Th en,

the supernatant (~450 μL) was transferred to

a fresh tube. Next, 0.9 mL of 95% ethanol (-20

°C) was added to the tube and mixed well. Th e

tube was centrifuged for 2 minutes at 14,000

rpm at room temperature. Th e supernatant

was discarded and the pellet was washed twice

with 500 μL of 70% ethanol and then left to

air dry for 30 minutes. Finally, the pellet was

resuspended in 200 μL of TE (10 mM Tris-

HCl pH 8.0, 1 mM EDTA pH 8.0). Th e DNA

concentration was then determined using

a Nanodrop 2000 unit as described by

the manufacturer.


ACKNOWLEDGEMENTS

I would fi rst like to thank my sponsor Dr. Aida

Metzenberg for helping make this opportunity

possible and for allowing me to use her lab

during this research. I really enjoyed getting

to know her as well as learning from her. I

would also like to thank Andrea Cosco for

providing the construct, pEPito. Additionally,

I would like to thank Anamica Sood, Cindy

Barrios, Amy Heman, and Sahil Khullar. I had

such a great time working with you all. Lastly,

I would like to send a big thanks to Professor

Stephen Brown, Professor Mike Fenton,

Professor Michael Reynolds, and the rest of

the people at STEM who helped make this

internship a reality.

REFERENCES

King, N., Hittinger, C.T. & Carroll, S.B., 2003.

Evolution of key cell signaling and adhesion

protein families predates animal origins.

Science (New York, N.Y.), 301(5631), pp.361–

3. Available at: http://www.ncbi.nlm.nih.gov/

pubmed/12869759 [Accessed August

22, 2014].

Murphy, B.M., 2013. Plexiform

Neurofi bromas. CHEST Journal, 144(2),

p.708. Available at: http://journal.

publications.chestnet.org/article.

aspx?doi=10.1378/chest.13-0046 [Accessed

August 23, 2014].

Szudek, J., Evans, D.G. & Friedman, J.M., 2003.

Patterns of associations of clinical features in

neurofi bromatosis 1 (NF1). Human genetics,

112(3), pp.289–97. Available at: http://www.

ncbi.nlm.nih.gov/pubmed/12596053 [Accessed

August 22, 2014].

MURJ - VOLUME 358

Using Small Subunit Ribosomal RNA (18S) Gene Sequences To

Identify Wild Nematodes Heilly Salinas

Sponsored by Dr. Ray Hong, Department of Biology


INTRODUCTION

Past research has shown a strong necromenic

association between scarab beetles and

Diplogastrid nematodes. Necromenic

nematodes use the beetle as transportation

and food. Nematodes live inside the beetles

in dauer stage, a form of hibernation until

they are able to feed off the carcass. Th e

relationship between the beetles and

nematodes has contributed to entomology.

Scarab beetles have only shown to yield

non-parasitic nematodes that are not

harmful, such as Pristionchus pacifi cus.

Entomopathogenic worms are very rare to

fi nd on these beetles. Entomopathogenic

nematodes are parasitic and kill the beetles in

order to eat. Our interests are on the family

Pristionchus because they are not harmful to

lab settings and are easy to maintain which

allows researchers to study their ecology.

Pristionchus are hermaphrodites and are

able to reproduce in abundance within

hours. Paul de Ley identifi ed 600 species of

nematodes by using 18S rDNA sequencing.

Th e small ribosomal subunit RNA gene (18S)

has allowed us to identify the species of

nematodes. In this lab we collected scarab

beetles and waited for nematodes to emerge

and used 18S rRNA gene sequences to identify

the diff erent species.

RESULTS

During this beetle season, 721 scarab beetles

were collected and dissected. All of the beetles

were placed in an NGM plate (see Materials

and Methods) with cholesterol to allow the

nematodes to emerge (Figure 1). Once the

nematodes were identifi ed on the beetle plate,

they were transferred onto another plate to

maintain them (Figure 2).

Figure 1 - Half of a beetle on an NGM plate with cholesterol


Figure 2 - Nematode plate 3 days after being transferred from beetle plate as shown on Figure 1

Figure 3 - 1.5 % agarose gel of PCR reactions for various nematodes. All lanes showed successful PCR amplifi cation. 1 kb refers to one kilobase DNA ladder.

Out of the 721 beetles, 74 nematodes

emerged. Even though more beetles were

used this year for this purpose, the infestation

rate (percent of beetles from which nematodes

emerged) was relatively low compared to

last year. Last year, the infestation rate

was about 11% and this year it was about

10%. We were able to identify the nematode

strains by PCR amplifi cation and sequencing

the 18S ribosomal RNA gene. After PCR

amplifi cation, the reactions were run on

a 1.5% agarose gel to detect a 900 bp PCR

product. As shown in Figure 3, the presence

of a 900 bp band confi rmed the desired PCR

Figure 4a - This pie chart shows the trend of species that were obtained last summer, 2013. Sample size was 188 beetles and 13 strains.

Figure 4b - This year’s trend is shown on this pie chart. Sample size was 721 and 72 strains.

product was present and therefore was ready

for purifi cation. PCR amplifi cations for two

of the nematodes were unsuccessful and

therefore could not be sequenced.

Th e majority of nematodes obtained from

each beetle were either P. maupasi or P.

pacifi cus. On one of the beetle plates two

strains were found, P. pacifi cus and P. maupasi.

Th is summer, we were able to analyze a variety

of nematode strains (Figures 4a and 4b). Th e

diff erent species were maintained and frozen

for future references.

8%

38%

23%

23%

8%

Nematodes 2013

Diplogasteroides magnus

Oscheius

Rhabditolamaimus

Pristionchus pacificus

Pristionchus maupasi

n=13

MURJ - VOLUME 360

DISCUSSION

Th e single worm lysis stopped working

towards the end of the experiment. Th e

proteinase K primer seemed to lose its quality

from thawing and freezing repeatedly. We

also found that adding mineral oil to the lysis

tampered with the results. Sometimes during

pipetting the DNA to the PCR mix, mineral

oil would go along with the DNA and lower

the concentration. To optimize results for

higher concentrations, a few changes were

made to the DNA Clean and Concentrator

protocol. Instead of using regular DI water,

we used heated nanopure water at 75 °C and

diluted 10 μL twice. A higher infestation rate

was expected but it stayed consistent at about

10%. Th e infestation rate has been consistent

for the past 4 years. Th e rate fl uctuated

between 10% and 12% regardless of the

sample size. Overall, the experiment

went well.


Beetle Collection

Scarab beetles were collected in eppendorf

tubes with gloves. Beetles are found around

urban lights close to greenery. Th e eppendorf

tubes were labeled with place and date and

stored in refrigerator.

Beetle Dissection

To cut the beetles in half, scissors, forceps and

5% sodium hypochlorite solution (to disinfect

materials) were used. Half of the beetle was

placed on a 1.5 cm NGM agar plate (NaCl,

Bacto-tryptone, KH2PO

4, K

2HPO

4, Bacto-agar,

5 mg/ml Cholesterol), then parafi lmed. Th e

other half was placed back in an eppendorf

tube then put in -20 °C.

Wild Nematode Culture

Once a nematode was identifi ed on beetle

plate about 5 nematodes were picked onto two

3 cm NGM plates. One unseeded NGM plate

labeled 16S, parafi lmed, and one seeded plate

with OP50 E. coli labeled 18S. After a couple

days, on a seeded 3cm NGM plate, a drop of

bleach was placed on one side of OP50 lawn

with at least 5 nematodes. Next day, eggs

hatched and J2 larvae emerged to OP50 lawn.

Larvaes were picked onto new seeded plate.

Isolation of Genomic DNA

Five worms were picked into 10 μL of single

worm lysis with Proteinase K in PCR tubes

and place in the PCR machine @ 65 °C for 1

hour, @ 95 °C for 10 minutes, and cool. After

the cycles, 70 μL of diH2O was added to the

tubes and stored at -20 °C. Use 2 μL for PCR.


18S SSU RNA PCR

Primers:

RH5401 SSU18A AAAGATTAAGCCATGCATG

RH5402 SSU26R CATTCTTGGCAAATGCTTTCG

RH5403 SSU9R AGCTGGAATTACCGCGGCTG

APEX 2X Taq. PCR mix, pink (with dNTP,

buff er and Taq)

(1X)

APEX 2x 12.5 μL

10 mM RH5401 1.5 μL

10 mM RH5402 1.5 μL

Nano pure H2O 7.5 μL

Worm gDNA 2 μL

______________________________________

25 μL per tube

PCR:

94°C 3 min

94°C 45 sec

58°C 45 sec 35X

72°C 1 min 15 sec

72°C 5 min

20°C indefi nitely

Samples were run on 1.5% gel/1X TBE buff er

with 1 kb gene ladder.

DNA Purifi cation

PCR product was cleaned using ZymoResearch

cat. DNA Clean and Concentrator-25 kit. For

optimal results, diH2O was heated to 75 °C

on a heat block. Clean PCR product was sent

to Laragen for sequencing using RH5403 as

primer. For every reaction, 5 μL (minimum

concentration 20 ng/μL) were added in a PCR

strip and 2.5 μL of 5 mM RH5403 primer per

reaction in one of the tubes.

ACKNOWLEDGEMENTS

I would like to thank Mike Fenton, Stephen

Brown and STEM for allowing me to partake

in this great opportunity. I learned many new

things and it changed the way I view science.

Research is very challenging and rewarding,

all at the same time. I now have a greater

appreciation for science and research. I would

also like to thank Dr. Ray Hong and the whole

lab staff for being extremely helpful and

welcoming. Th ey made my experience that

much better; I really felt a part of the team.

It was such a pleasure working alongside

Snehacom Koneru in this experiment. I want

to thank her for teaching me everything I

needed to know. Th e knowledge I obtained in

this lab will defi nitely help me in my future. I

have a great appreciation for the lab staff and

professor Fenton, again thank you.

REFERENCES

“A Quick Tour Of Nematode Diversity and the

Backbone of Nematode Phylogeny.” Paul De

Ley, Department of Nematology, University of

Riverside, USA.

MURJ - VOLUME 362

STEM-HSI Web Portal Sergio Gonzalez, Paulo Osuna, Edwin Salazar, Felix Villa

Sponsored by Dr. Gloria Melara, Department of Computer Science


INTRODUCTION

STEM-Hispanic Serving Institution (HSI)

grants are funded by the United States

Department of Education under Title III

STEM/Part F-HSI. Th e grants fund various

Science, Technology, Engineering and

Math projects in colleges and universities

throughout the country, but there has

never been a way for grant directors to

communicate with each other in a centralized

way. In order for ideas to be shared amongst

grantees, a communication channel between

them is needed. It is challenging for STEM

directors to obtain the objectives and the

strategies used by other grantees. Th us the

creation of a system that categorized STEM

grantee objectives into type of projects,

successful strategies and assessed versions of

successes and failures would provide valuable

information for all STEM grantees and

minimize redundancies collectively within the

programs. Additionally, successful objectives

and strategies can be collected as a group to

assess the overall productivity of all the STEM

programs. Th is information can be posted on

the Department of Education’s web site and

can be used to illustrate the productivity of

the grantees as a whole.

Th e purpose of the STEM-HSI web portal is

to serve as a form of communication between

STEM-HSI grantees. It would allow other

grantees and its directors to view grant

objectives and goals of the other grantees.

Th e grantees would be able to input their text

through a form built into the portal. Th e

portal will be viewed as a web page, web pages,

by the regular user, in which they would be

able to access educational institutions and

view the data that the schools have decided to

share with the public. Users can use a search

function that allows them to do quick look

ups by school name, or by data keywords and/

or sentences, they seek to information on.

Th ere would be a login function for directors

of programs and their staff which would have

a diff erent interface than the one a regular

looker sees.

TECHNOLOGIES REVIEWED AND SELECTION

Th e STEM-HSI web portal site was originally

slated to be created using node.js framework.

Going under that model, research was

performed on how node.js can be used to

create a dynamic web platform. Preliminary

results showed that node.js is a very fast and

capable platform, provided that there is ample

support for it. Further investigation yielded


little support information towards confi guring

the node.js-based server into a server that

would meet the needs of the request. After

investigating the server platform that the

web portal would be hosted on, it was found

that node.js would not be natively supported.

At that point, research was redirected towards

platforms that would be natively hosted

with the new restrictions, which led to the

decision of using the Drupal Content

Management System.

Th e Drupal CMS, which is module-based,

was already supported on the chosen hosting

platform. Th rough research about Drupal,

it was clear that it would be able to meet the

needs of the web portal not only immediately,

but also as the project grew in scope, adding

to scalability by the ease of implementing new

features. Due to the ease in implementation,

it was chosen as the platform to host the HSI

Web Portal.

Furthermore, Drupal is a free and open source

framework that was released in 2001 and

has since cultivated an immense developer

community. Today, Drupal is a powerful

framework which is used to support such

websites as Whitehouse.gov. Th e capability

that Drupal allows developers, to implement

a sophisticated programming interface on

a simple module based framework, is what

makes it such a powerful tool.

PORTAL FUNCTIONS

At the beginning of the project stakeholders

requested a list of functions to be included

in the web portal that would improve the

communications between grantees. Th e

original list included the following functions:

Search, multi-campus/multi-user login and

login management, data input, feedback,

customizable image carousel, chat room, chat

archive, pinpoint school locations map, and

video chat.

Due to time constraints and the time

involved in researching and testing the

diff erent technologies, the STEM-HSI Web

Portal was partially completed during the

summer 2014. Th e functions implemented in

this summer include:

Search: Th e search module allows users to

search for specifi c content, or data, entered

into the site. You can use the function

to search for keywords or users, and the

module has a built in Taxonomy/Query as

well as an advanced search which allows

you to use exclusionary searches including

signs, characters, and symbols.

Login: Th is module serves a vital role in

allowing individual users the access to the

system by identifying and authenticating

them through a credentials process. It

allows them to control the backend of their

personalized webpage.

MURJ - VOLUME 364

Data input: A customized form was created

to allow authenticated users the access to

input data into their own webpage, as well

as adding images and other multimedia.

Specifi cally, the form contains the status of

a project, the project’s owning institution,

the institution type, the project’s objective,

and its methodology and results. Th is

form is searchable and can be archived for

later use.

Feedback: Th e ability to give feedback or

post comments to archived projects is also

possible. To give feedback, a text box form

allows an authenticated user to post his

comments in reply to their, or someone

else’s, project form. Th e comments are

posted with the user’s login name. A

notifi cation email is also sent to the

project’s form owner alerting them of new

posted feedback.

Figure 1 - STEM-HSI Portal home page

Read more

User login

Username *

Password *

Create new account

Request new password

Log in

Who's online

HSI STEM Spring 2014Initial MeetingCalifornia State University, Northridge

HSI STEM spring meeting and introduction of the new members of the HSI STEMprogram. At this event the new members of the AIMS program were introduced to thefaculty and staff, as well as current students in the program. Current program goalswere also highlighted and future goals were also presented. Group pictures were takenas well.

Tell me more

HOME COLORADO FLORIDA NEW MEXICO TEXAS FEEDBACK FAQCALIFORNIA


Image carousel: Th e main portal page, which

may be viewed by anyone, includes an

announcement carousel. Th is carousel is

important because it will give HSI program

administrators the forum to present

important news, events, or project updates.

DISCUSSION

Currently the website is hosted by the CSUN

server at http://www.ecs.csun.edu/hsi. Th e

updated version of the STEM-HSI Web Portal

will include a full functioning chat module

that will allow logged in users to have a

conversation in a private one-on-one room, or

with multiple users logged into a public chat

room. Th e chat function will make a copy, and

retain the conversation for future use. It will

also have an improved integrated map that

will pinpoint the school locations for those

schools who input their data.

A linked website that shows grantees

how to use the HSI portal website will be

implemented as well. Th e linked website will

provide grantees with a menu containing

categorized information about the site’s

overview, navigation, and its features.

Additionally, bug reports and troubleshooting

issues will be addressed here. Finally, help

videos will also be made available.

ACKNOWLEDGEMENTS

I would like to thank Dr. Gloria Melara and

Dr. Mike Fenton for allowing me to work on

this project. It was a great learning experience

and the hands on training that the CSUN

team and I received will defi nitely help us

in our future endeavors. Th e project would

have never been possible without the rest of

the team: Edwin Salazar, Paulo Osuna, and

Felix Villa, thank you. Lastly, I would like to

thank Title III STEM-HSI and the Department

of Education for providing funding and the

project for us to work on.

MURJ - VOLUME 366

Flow Visualization Study Around an Air Foil Cesar Aliaga, Elifalet Garcia, and Sofiya Pascual

INTRODUCTIONHydrogen bubble flow visualization is a simple but powerful technique used to study flow patterns around various items of interest. Here, we utilize this technique to visualize the flow patterns around an air foil and identify the Laminar Separation Bubble (LSB) for various flight velocities at a given angle of attack.

The Air Foil:The Air Foil we are studying is interesting for a few reasons, with the most notable being its widespread use in Unmanned Aircraft Systems (UAS). Due to the increasing use and presence of drones and other UAS, our work takes on another layer of importance.

Hydrogen Bubble Electrolysis:Although Hydrogen Bubble Electrolysis is generally considered outmoded as a flow visualization technique, our use of it is justified for two reasons. Firstly, due to time constraints, it would be unreasonable to learn how to use more sophisticated flow visualization techniques. Secondly, the ease of using hydrogen bubble electrolysis as a flow visualization technique is well suited for use as an “introduction” to fluids and laboratory practices.

Some of our initial runs. We used background subtraction to clean up the image, and increased the contrast to better see the flow behavior.

METHODS Materials• UAS Airfoil• Relay• Tungsten wire, .001 in diameter• Basler acA2000-50gm Camera• National Instruments Labview• Water Tunnel Model 505

The experiments ran were straightforward, with the objective being to capture images of the point of LSB for analysis. To accomplish this, we used Labview to interface with the Basler camera, which captured images of flow behavior around the airfoil. We employed a relay to prevent hydrogen bubble quality deterioration, to prevent the bubbles from becoming too large and floating upward, and to pace separation between bubble segments. Most of the work we did lay in finding an adequate lighting setup that would better enable us to capture quality images. The difficulty in this stems from the near-transparency of hydrogen bubbles in water.

• First runs were concerned solely with finding the setup that would provide optimal bubble quality (small bubbles that would not tend to float upwards). We found that a thinner wire helps immensely when trying to produce smaller bubbles. A voltage in the range of 60-90 volts produces denser “lines”, as seen below, while still being able to stay relatively leveled. The runs below show the final results of these calibration runs.

First trials

Airfoil Water Tunnel Model 505

AIMOur research was intended to provide a groundwork for future researchers interested in studying similar UAS airfoils. We set out to capture good quality images which would illuminate some of the behavior of this airfoil. Future researchers should take our research and refine it, creating a more rigorous and precise study of the properties of this airfoil under more diverse conditions.

AIMS2014 FLUID MECHANICS


LSB Distances and the Reynolds Number at this State

Run043 Typical Photo

RESULTSThe behavior of the airfoil under various velocities turns out, unsurprisingly, to be very unpredictable. As illustrated in the Water Flow vs Average Distance Of Bubble Separation graph, going from 5 Hz setting on the variable frequency drive, to 6 Hz caused a sudden increase in the LSB distance, measured from the leading edge, then decreasing from 6 Hz to 8 Hz and then staying constant until 15 Hz. However, what complicates these results is the two very different averages for the LSB distance at 15 Hz. This may be attributed to movement of either the camera or the airfoil, but for this to be justified the experiment must be ran again for confirmation. Another key point of this experiment was the Reynolds Values, maximum occurring at 5080 (Run044 and Run043) and the minimum value at 3786 (Run040).

After these trial runs, we began our real experiment, which were runs 039-044. In these runs, we kept the airfoil at an angle of 12º while varying the velocity of the water (range of .32 m/s to .47 m/s). Once we captured ~500 images per run, we analyzed every image to find the pixel location of the separation bubble, as well as any interesting details like flow recirculation or varying LSB, like seen on Run 043-Image 8411

Varying LSB:The occurrence of varying LSB did not happen very often, but there are some notable runs where this did occur. Why this occurred is unknown and was random.Flow Recirculation:Is erratic, unpredictable, and does not appear to be periodic. No obvious correlation to water velocity observed. The phenomena is unknown but very intriguing.

CONCLUSIONS1 Although the purpose of our work was to provide a very

basic data set for future research into UAS airfoils, the program we participated in was meant to be an opportunity to learn and experience a research environment firsthand. In this, it was very successful because some of the tools learned was how to setup an experiment from scratch. Gather data and be able to analyze this data using fluid dynamics equations and software.

ACKNOWLEDGEMENTSWe would like to thank Dr. Durgesh for being our supervisor and mentor for this summer research event. If it was not for him and his guidance we would have not known how to approach the setup and analysis. We would also like to thank Dr. Ryan for being our director, AIMS, and STEM at LAMC for allowing us to be part of this great opportunity and experience.

RESULTS

Run039, LSB Distance Vs Time

Run Water Flow (hz) Reynolds Value Average Distance Of Bubble Separation (pixels) Standard Deviation Average Length of AirFoil39 5 3387 299 7.48 94940 8 3786 281 8.94 94841 12 4148 282 12.97 94442 15 4789 283 24.70 95343 15 5080 298 21.02 95244 6 5080 316 16.46 946

Total Average 293 9490.1524

AirFoil Length (m)0.15240.15240.15240.15240.1524

MURJ - VOLUME 368

Antifreeze As A Corrosion Inhibitor Of Steel Rebar

Gabriel Robles Sponsored by Dr. Behzad Bavarian, Department of

Manufacturing Systems Engineering and Management


INTRODUCTION

For many centuries concrete has been

the basis of major city structures such as

buildings, bridges and streets. Concrete

is the material of choice because it has the

capacity to hold relatively heavy loads (high

compression strength); however, it does not

attain the same strength when pulled apart

(weak tensile strength). Steel rebar is used

to reinforcement concrete and together they

make a suitable combination of materials for

heavy duty structures. Steel rebar is made by

melting together scrap metals (such as iron)

and mixing it with a specifi c concentration

of carbon in order to achieve the properties

necessary within the rebar material.

Properties such as the hardness and ductility

are determined by the rate at which the rebar

was cooled.

Unfortunately, when the rebar begins to

rust it decreases its tensile properties and it

expands. According to Dr. Behzad Bavarian

from the CSUN Department of Manufacturing

Systems Engineering and Management, steel

rebar can expand up to six times its original

size after completely corroding. When steel

rebar begins to expand, it can put settled

concrete under tensile forces, which has the

potential to crack and weaken the concrete.

Other factors which directly impact the

concrete’s durability are elements within the

environment. Elements such as chloride (Cl-)

and carbon dioxide (CO2) can cause concrete

to decay. One example of concrete decay

is known as concrete carbonation, which

is the reaction between the calcium (Ca) in

the concrete reacting with carbon dioxide

(CO2) while in the presence of an electrolyte

environment to produce calcium carbonate

(CaCO2). Th is decay weakens and cracks the

concrete, which allows for corrosive elements

such as water (H2O) and oxygen (O

2) to reach

the steel rebar and corrode the exposed metal.

Figure 1 - Corrosion of 1018 steel sample at 100x


One solution to help protect against corrosion

in the rebar is a Migrating Corrosion Inhibitor

(MCI), which is a chemical solution that is

applied on a concrete surface. Over time,

the MCI solution migrates down through

the cracks and imperfections of the concrete

and eventually reaches the steel rebar. Th e

inhibitor creates a hydrophobic layer over the

surface of the steel rebar which prevents the

steel from reacting with corrosive elements.

However, the protective barrier is not

permanent and periodic applications of the

MCI solution may be necessary.

Due to the long process of the MCI treatment,

the eff ectiveness of another inhibitor (antifreeze)

was tested and compared to the corrosion rate of

the steel in a corrosive environment.


Preparation of 1018 Steel 1018 Sample and Electrochemical Cell

Steel cross sectional area samples were

measured and prepared for corrosion testing.

Th e samples were grinded with 400 grit

sandpaper and 600 grit sandpaper, and then

polished with a one micron powder buff er to

remove any previous corrosion.

Beakers were used to prepare two

electrochemical cells, each with a diff erent

electrolyte. One beaker was fi lled with salt

water as the electrolyte and the other beaker

was fi lled with antifreeze as the electrolyte.

Each electrochemical cell had two electrodes

(one working electrode and one reference

electrode). Th e working electrode was

connected to the steel sample being tested

and the reference electrode was the saturated

calomel electrode (SCE).

Experiment

Steel samples were placed into an

electrochemical cell and the experiment was

performed with two diff erent electrolytes; salt

water (corrosive environment) and antifreeze

(corrosive inhibitor). Th e samples were tested

using the EG&G VersaStat machine.

RESULTS AND DISCUSSION

According to Table 1, the 1018 steel sample

tested in antifreeze had a dramatic decrease

in the mpy corrosion rate compared to the

corrosion rate of 1018 steel in salt water.

Antifreezes’ eff ectiveness is evident by the

862x decrease in mpy. Figure 2 shows the

1018 steel alloy in antifreeze decreasing in

corrosion density as time progressed whereas

the corrosion density of the 1018 steel

sample in salt water increased. Th e dramatic

diff erence in corrosion rates implies that the

antifreeze is an eff ective corrosion inhibitor

which creates a passive coating that interrupts

the electrochemical reaction which slows

down the corrosion rate. Th is decrease in

corrosion rate may be the diff erence between

a steel beam lasting ten years to fi fty years.

Table 1 - Milli-inch per year (mpy) and inhibiter effectiveness of 1018 steel

MURJ - VOLUME 370

However, sample preparation is critical and if

not done properly, results may vary.

Corrosion and corrosion related issues are

expensive problems which can be avoided if

proper maintenance of the steel structures

is addressed sooner than later. Chemical

solutions such as corrosion inhibitors have

proven to be eff ective and are vital to the

durability of steel designs. Continuing

corrosion research is important and essential for

a society highly reliant on metal materials and

could be used for future research in corrosion.

According to Table 1, the 1018 steel sample

tested in antifreeze had a dramatic decrease

in the mpy corrosion rate compared to the

corrosion rate of 1018 steel in salt water.

Antifreezes’ eff ectiveness is evident by the

862x decrease in mpy. Figure 2 shows the

1018 steel alloy in antifreeze decreasing in

corrosion density as time progressed, whereas

the corrosion density of the 1018 steel

sample in salt water increased. Th e dramatic

diff erence in corrosion rates implies that

the antifreeze creates a passive coating that

interrupts the electrochemical reaction which

slows down the corrosion rate. Th is decrease

in corrosion rate may be the diff erence between

a steel beam lasting ten years to fi fty years.

Corrosion and corrosion related issues are

expensive problems which can be decreased

if proper maintenance of the steel structures

is addressed early. Th erefore, solutions

such as corrosion inhibitors are vital to the

maintenance and durability of steel structures

and designs.

ACKNOWLEDGEMENTS

Figure 2 - Overlay of corrosion rate in salt water and antifreeze for 1018 steel


I would like to thank Marina Sangkavichai and

the LAMC STEM staff for all their support

and for providing me with this internship

opportunity. I would also like to thank Dr.

Behzad Bavarian and Yashar Ikder for all their

help and guidance in the lab. Th is experience

has helped me realize what it takes to be part

of a research project and the dedication which

it demands. Th ank you once again to those

who made this experience possible.

REFERENCES

D. Callister Jr, Materials Science and

Engineering An Introduction, J. Wiley & Sons,

NY, 8th Ed. 2010

Bavarian, Behzad, and Lisa Reiner.

“IMPROVING DURABILITY OF REINFORCED

CONCRETE STRUCTURES USING

MIGRATING CORROSION INHIBITORS.”

Corrosion 2004 (2004): n. pag. Print.

Jones, Denny A. “Principles and Prevention of

Corrosion.” (1996): n. pag. Print.

Esmaeilpoursaee, Amirreza. An Analysis

of the Factors Infl uencing Electrochemical

Measurements of the Condition of Reinforcing

Steel in Concrete Structures. Waterloo, Ont.: U

of Waterloo, 2007. Print.

MURJ - VOLUME 372

Th e C.O. Gene Of Arabidopsis Th aliana Functions As A Regulator Of Flowering In Response To Blue Light

Luis Corona Sponsored by Dr. Chentao Lin, Department of Molecular, Cell and Developmental Biology

University of California, Los Angeles

INTRODUCTION

Plants contain multiple photoreceptors to

control light responses, which in turn aff ects

growth and development. However, it is still

unclear how diff erent photoreceptors jointly

regulate a plant’s developmental processes.

An example of a plant’s physiological response

would be its fl owering time. Cryptochromes

are blue light-sensing receptors found in

plants which regulate photoresponses and

circadian clocks in plants and animals[2].

Th e Arabidopsis thaliana genome encodes

at least two cryptochromes, cryptochrome

1 (CRY1) and cryptochrome 2 (CRY2).

Cryptochrome 1 primarily mediates blue light

control of cell elongation. Cryptochrome

2 on the other hand mediates fl owering

signals[4]. In Arabidopsis thaliana, the

photoexcited cryptochrome 2 interacts with

the transcription factor CRYTOCHROME-

INTERACTING basic helix-loop-helix 1 (CIB1)

to activate transcription and fl oral initiation[1].

Specifi cally CIB1 activates transcription of

the fl owering integrator gene Flowering

Locus T (FT)[3].

Th e coaction of CIB1 protein expression has

been shown to be regulated by blue light.

Arabidopsis is a type of plant that is specifi cally

aff ected by blue light. When exposed to blue

light CIB1 is highly expressed in plants, and

in the absence of blue light levels of the CIB1

protein decrease[2]. Proteasomes are protein

degradation units within cells that can digest

a variety of proteins into short polypeptides

and amino acids, eliminating the protein’s

function. Proteasome 26S is the cause of

high levels of CIB1 degradation and blue

light actually hinders CIB1 degradation[1]. In

addition, under blue light, transcription factor

CIB1 triggers fl oral commencement[3]. Our

team has chosen to work with Arabidopsis due

to the fact that its genome has been entirely

sequenced, so biochemical techniques such as

western blots and polymerase chain reactions

are much easier to work with. Primarily,

we want to understand how blue-light

photoreceptor cryptochromes regulate cell

elongation and fl owering times. Th e coaction

mechanism of diff erent photoreceptors is the

fi eld of interest.


Genes are sequences of DNA that encode for

the production of particular proteins. Th e

current research done in the Lin laboratory

at UCLA involves the study of gene

expression in Arabidopsis thaliana. Another

aspect being covered for the Arabidopsis is

its genetic mechanisms. If more than one

gene is responsible, we plan to identify the

specifi c genes and investigate how they work

together. Polymerase chain reactions are

the biochemical techniques that have been

employed to better understand Arabidopsis

gene expression. Th e goal of this project is

to introduce PCR products of the C.O. gene

into mature Arabidopsis thaliana plants so that

when they begin pollinating, they will express

this recombinant DNA and we can determine

how this aff ects fl owering.


PCR is a biological technique used to generate

millions of copies of targeted sequences of

DNA. Th e goal of the project carried out in

this laboratory was to insert the C.O. gene

into a personalized vector called pDT7G and

transfer that vector from Escherichia coli to

Agrobacterium tumefaciens in order to infect

the mature Arabidopsis plant. Once the

host cell has been transformed with pDT7G

containing the C.O. gene, the recombinant

DNA will then be duplicated in the host cell’s

genome allowing the targeted gene to be

translated and copied.

Th e C.O. gene in Arabidopsis is in control of

the fl owering of the plant: when activated C.O.

initiates the fl oral stage, then afterwards the

pollinating stage of Arabidopsis. Transfer of

the C.O. gene to the Arabidopsis should initiate

a faster triggering of its fl oral stage.

Two gels with DNA were run for the C.O.

gene transfer experiment. Th e fi rst gel was

for purifying the PCR product and separating

pDT7G from a DNA insert it already

contained. An image of actual results was

not obtained, but the results were similar to

those shown in Figure 1. Th e DNA bands

corresponding to the PCR product and cut

vector were then identifi ed, excised and the

DNA purifi ed from the gel fragments. Th e

purifi ed pDT7G vector and PCR product

were then ligated and used to transform E.

coli cells which were spread on a Luria Broth

Kanamycin (LBK) plate which was incubated

overnight at 37 °C. Th e plate showed colonies

indicating successful growth (Figure 2).

Figure 1 - Electrophoresis of PCR product and plasmid vector. An image of the actual gel was not available. The gel shown here is a sample that is similar to the actual gel. Lane 1-DNA ladder, Lane 2-empty, Lane 3-PCR of C.O. gene, Lane 4-restriction enzyme cut pDT7G with insert to be removed.

Figure 2 - Kanamycin-resistant bacterial colonies. E. coli bacteria transformed with a ligation of the C.O. gene with pDT7G.

MURJ - VOLUME 374

Ten colonies were directly analyzed by PCR

to identify clones that had the highest

concentration of the C.O./pDT7G construct

(Figure 3).

Th e next step was to transform agrobacteria

with DNA from the PCR reaction with the

highest concentration. Out of the 8 positive

reactions, the sample shown in lane 2 had

the highest concentration of the PCR product

as seen under fl uorescent light (Figure 3).

Th is PCR sample was then used to transform

agrobacteria by electroshock treatment. After

electroshock treatment with the PCR sample,

the agrobacteria were spread on a Luria Broth

Kanamycin-Rifampicin (LBKR) plate. Figure

4 shows successful growth of colonies with

Kanamycin and Rifampicin resistance.

Agrobacteria clones positive for the C.O. gene

were identifi ed by PCR as described earlier

(data not shown). Positive agrobacteria clones

were then inoculated into 650 mL of the

LBKR medium and incubated in a shaker at

room temperature for a day. Th is particular

solution was then used for fl oral dipping the

genetically modifi ed CRY1-LUC/CRY2-LUC

Arabidopsis plants, ultimately causing the C.O.

gene transformation. Th e C.O. gene would

later recombine with the genomic DNA of

the seeds.

Agrobacteria gene transformation was

successful, since the seedlings generated

from the dipped plants showed traces of the

C.O. gene weeks later (data not shown). My

mentor now plans to observe what other

genes are working together with the C.O. gene

in order to have caused faster fl owering of the

plant. She will do this by utilizing a variety

of biochemical techniques to observe the

expression of targeted genes. Future tests can

only be done once the seeds become

mature plants.

Figure 4 - Kanamycin-Rifampicin-resistant agrobacteria. The agrobacteria colonies on this plate were transformed with PCR product obtained from E. coli clone lane number 2.

Figure 3 - PCR results from Kanamycin resistant bacteria. Under ultraviolet light, results from clone 2 showed a higher concentration of C.O. gene DNA. DNA from clone 2 was then used to transform agrobacteria.



Plasmid Vector

Th e plasmid vector used was a modifi ed

version of a vector made by Xu Wang called

pDT7. Th e modifi ed vector was named

pDT7G, an acronym for Dual Transgene Ti

vector 7 with Gypsy. Th e C.O. gene was cloned

into the SpeI site of the pDT7G vector.

PCR

Th e thermocycler utilized for the PCR

reactions was an Eppendorf Mastercycler

gradient. First, the PCR reactions were heated

at a temperature of 98 °C for 40 seconds.

Afterwards, the reactions were treated 30

seconds at 55 °C and fi nally for a minute at

a temperature of 72 °C. Th is sequence was

repeated 60 times.

Each PCR reaction had 12.9 μL of ddH20, 1 μL

of DNA template, 1 μL each of the Forward

and Reverse primers, 2 μL of dNTP for the

reaction system, 0.1 μL of the DreamTaq

DNA polymerase enzyme and 2 μL of

10X Dream Taq buff er. Th e C.O. forward

primer was 5’- TGACCTCGAG/ACTAGT/

ATGTTGAAACAAGAGAGTAA which contains

an SpeI site added near the 5’ end. Th e

C.O. reverse primer was 5’- GTCGCACCAT/

ACTAGT/ GAATGAAGGAACAATCC which

contains an SpeI site added near the 5’ end.

Th e apparatus utilized for DNA gel making

was the BIO-RAD DNA gel maker. Each well

consisted of 4 μL of double distilled water

and 1 μL of 6X loading buff er. Finally, 1 μL

of DNA PCR products were then run on a 1%

agarose gel with 1X TAE. Th e gel then ran

for approximately 20 minutes. Desired PCR

products were excised from an agarose gel

and then purifi ed using GeneJet Purifi cation

columns as described by the manufacturer.

DNA Cloning

Ligation of the C.O. gene and the pDT7G

vector was accomplished using the In-Fusion

enzyme as described by the manufacturer

(Clontech). E. coli was placed in ice to thaw for

30 minutes. After 30 minutes, the cells were

heat shocked at 42 °C for 1 minute and then

iced for 2 minutes. Five hunderd micriliters

of prepared L.B. medium (Tryptone 10 g/L,

Yeast extract 5 g/L and NaCl 10 g/L) was

then mixed with 40 μL of the transformed E.

coli and 4 μL of already prepared In-Fusion

solution. Th e sample was then incubated at

37 °C in a shaker for one hour after which

it was centrifuged at 27 °C in an Eppendorf

5415 R for 5 minutes at 4,000 rpm to pellet

the bacteria to the bottom of the tube. Th e

pelleted bacteria were then carefully spread on

a Luria Broth Kanamycin plate (Kanamycin

50 μg/μL).

Transformation of Agrobacteria

Th e transformation of agrobacteria was

accomplished by electroshock treatment.

Th e electroshock treatment was for only 1

minute at 120 volts. After the electroshock

treatment, the special electro-microtest tube

was centrifuged for 5 minutes at 10,000 rpm

at room temperature. Th e LBKR plate utilized

had antibiotic concentrations of 50 μg/μL

for Kanamycin and 50 ug/μL for Rifampicin.

After the centrifugation, the bacterial pellet

MURJ - VOLUME 376

was carefully mixed into the LBKR plate which

was then incubated at 28 °C for 24 hours.

Transformation of Arabidopsis Seeds

Transformed agrobacteria were grown in 500

mL of L.B. medium containing 5% sucrose,

50 μg/μL kanamycin, 50 ug/μL rifampicin to

which 150 mL of 0.03% silwet L-77 surfactant

(300 μL/1L) was added. Th e culture was

incubated at 27 °C for 24 hours. Th e seed-

bearing pods of mature CRY1-LUC/CRY2-LUC

Arabidopsis plants were then dipped in this

culture for 47 seconds. Th e plants were then

allowed to dry for 2 hours after which they

were placed in the greenhouse.

ACKNOWLEDGEMENTS

Special thanks to UCLA’s Dr. Chentao Lin

for having allowed me to participate during

the 2014 summer in his Arabidopsis’s blue-

light photoreceptor research. Also, thanks to

scholar Mingdi Bian for accepting to be my P.I.

and supervisor. I also wanted to give special

thanks to my college’s STEM program and

its head Dr. Mike Fenton. None of my work

and improvement would have been possible

without our mentor Dr. Stephen Brown. Final

thanks goes to undergraduate student Jessica

Ding for being a great lab partner.

REFERENCES

1. Liu B., Liu H., Zhong D., Lin C.,(2010).

Searching for a photocycle of the

cryptochrome photoreceptors. Science Direct,

13: 578-586.

2. Liu H., Wang Q., Liu Y., Zhao X., Imaizumi

T., Somers D., Tobin E., Lin C., (2013,

September 4). Arabidopsis CRY 2 and ZTL

mediate blue-light regulation of the

transcription factor CIB1 by distinct

mechanisms. Proceedings of the National

Academy of Sciences, 110 (43): 17582-17587.

3. Liu Y., Li X., Li K., Liu H., Lin C., (2013).

Multiple bHLH Proteins form Heterodimers

to Mediate CRY2-Dependent Regulation of

Flowering-Time in Arabidopsis. PLOS Genetics,

9 (10): e1003861.

4. Yu X., Liu H., Klejnot J., Lin C., (2010). Th e

Cryptochrome Blue Light Receptors. American

Society of Plant Biologists, 1-27. doi:10.1199/

tab.0135


Cryptochrome 2 Interaction Kinase 1 (Cik1) In Arabidopsis

Houman Tazhibi Sponsored by Dr. Chentao Lin, Department of Molecular, Cell and Developmental Biology


INTRODUCTION

Arabidopsis thaliana has been under intense

research particularly because it is the

fi rst plant to have its genome completely

sequenced. Because its genome has been

completely sequenced, researchers have

been able to use it as a model organism to

analyze gene expression. Arabidopsis possess

certain nuclear proteins called cryptochromes

that are of great importance to its life

cycle[1]. Th ese nuclear proteins are blue and

ultraviolet light receptors that are very much

structurally related to DNA photolyases,

light-driven repair enzymes[2]. Th ough

crypotochromes lack the repair activity that

DNA photolyases possess, they regulate gene

expression and thus infl uence morphogenesis

in Arabidopsis[2]. Some phenotypes found to

be aff ected by cryptochromes are: hypocotyl

(stem) elongation, fl owering, leaf growth,

the circadian clock and much more[3].

Arabidopsis possesses two genes that encode

cryptochrome proteins that this laboratory is

interested in: CRY1, and CRY2[3].

In particular, we seek to understand the signal

transduction pathways, genes, and proteins

that come into play during the plant’s life

cycle when reacting to specifi c wavelengths of

light. Currently, I am a part of an experiment

involved in studying Cryptochrome 2

Interaction Kinase 1 or CIK1. It is known that

Cryptochrome 2 interacts with a particular

kinase and is active after it is phosphorylated,

but the kinase responsible for its

phosphorylation is unclear. Understanding

the process of CIK1 and what functions it

performs that concern CRY2 will help unlock

more answers to signal transduction pathways

dealing with cryptochromes. Th rough

diff erent molecular biology techniques like

western blotting, and PCR we will attempt to

pinpoint diff erent genes that express CIK1

and truly understand the functionality and

purpose of CIK1.


At the start of the experiment Arabidopsis

thaliana seedlings were grown. When the

seedlings were fully grown and ready we

infected them with Agrobacterium tumefaciens

carrying a specially made vector. Th e vector

was called pActin2::Flag-CIK1Nano, where

Actin 2 is the promoter in the vector and

fl ag is an epitope tag used for antibody

signaling and Nano stands for Nanoluc

luciferase reporter dossier. Nanoluc or (Nluc)

MURJ - VOLUME 378

is a luciferase or a bioluminescence enzyme

that was derived from a deep-sea shrimp[4].

Luciferase was used to analyze transcriptional

activity within our transgenic seedlings. Th e

vector contains specifi c genes needed for

CIK1 protein expression. After the seedlings

were infected we collected leaves from 9

mature seedlings and prepared them to run

a western blot, a technique used to detect

protein expression. During the treatment of

the leaf samples specifi c antibodies were used.

Antibodies are substances used to attach to

a specifi c area of a protein and when labeled

broadcast a signal so it can be detected in

a western blot. Th e primary antibody used

was called anti-Flag. Th e anti-Flag antibody

specifi cally binds to the fl ag epitope on CIK1.

Often the primary antibody signal is weak, so

a secondary antibody was used called mouse

anti-Flag. Th e sole purpose of the secondary

antibody is to amplify the signal of the

primary antibody. Once the treatment was

done the samples were used to run a

western blot.

Figure 1 shows a western blot that explains

the experimental results. Lane 1 contains

the prestained protein ladder and lanes

2-10 contain seedling samples called 2 nano

cik1 cry1 cry2. Cry1 Cry2 indicates the

seedlings’ background, meaning they already

are transgenic for the CRY1 and CRY2 genes.

Notice in lanes 2-10 only lanes 2, 3, 4, and

7 show protein expression ranging from

100 to 130 kDa in size. Th is means that

these specifi c seedlings infected with the A.

tumefaciens are positive transgenic lines that

express CIK1 in addition to CRY1 and CRY2.

Lanes 5, 6, 8, 9 and 10 show no signs of CIK1

protein expression. Th rough the developed

fi lm from the western blot it is now known

which particular Arabidopsis thaliana seedlings

contain the CIK1 transgene. Th is is important

to know because further experimentation can

be done to reveal and understand the signal-

transduction pathways that involve CIK1. It

will also help to understand the role of CIK1

in seedling morphogenesis. Th e function and

structure of CIK1 is still unknown.

Figure 2 shows two Arabidopsis thaliana

seedlings that were treated diff erently. Th e

picture labeled CIK10X was a seedling that

produced excessive amounts of CIK1 protein.

Figure 1 - Western blot of 2 nano cik1 cry1 cry2 transgenic seedling samples, in lanes 2 -10. CIK1 transgene expression is seen as a band between 100 kDa and 130 kDa.

Figure 2 - Comparison between two Arabidopsis thaliana seedlings. The left seedling produced transgenic CIK1 protein and the seedling on the right is the wild-type.


Th e picture labeled Col4 was a wild-type

seedling. One can see that the seedling that

produced CIK1 had limp, weak, and curly

leaves and the wild-type seedling had fi rm and

strong leaves. Th is shows that too much CIK1

proves to be detrimental to the seedling. Th is

experiment was fairly new, so no conclusions

were made about the pathways and functions

of Cyptochrome-Interacting-Kinase 1

within the 10 weeks of my internship. Th e

experiment about CIK1 is still ongoing in Dr.

Lin’s laboratory.


WESTERN BLOT

SDS-PAGE

Medium sized Arabidopsis thaliana leaf

samples were placed into liquid nitrogen.

Once the leaves were fully frozen, they were

then ground into a fi ne powder. Th e next

step required Non-Grinding (NG) Buff er to be

added to the ground Arabidopsis leaf samples.

Th e NG Buff er solution contained 10 mL of

0.1 M EDTA at a pH of 8.0, 5 mL of 0.12 M

Tris-HCL at a pH of 6.8, 2.0 g of 4% SDS, 5 mL

of 2-meracptoethanol, 2.5 mL of 5% glycerol,

and 0.0025 g of 0.005% bromophenol blue.

Th e NG buff er liquefi ed the Arabidopsis leaf

powder so it can be used in the next step.

Just enough NG buff er was added to dissolve

the leaf powder.

Western Blot Transfer

After the electrophoresis, the gel was

transferred to a PVDF membrane. Th e

membrane was then placed in to a Wet/Tank

Blotting system and electrophoresis was done

for 90 minutes at 80 V. Ponceau Stain (made

from Ponceau powder and ddH20) was used

afterwards to check transfer to the membrane.

Treatment with Primary Antibody and Secondary Antibody

Th e membrane was washed with PBST (8 g of

NaCl, 0.2 g of KCl, 1.44 g of Na2HPO

4, 0.24

g of KH2PO

4, 2 mL of Tween-20 and 1 liter

ddH20). Th e membrane was then blocked with

5% powdered milk/PBST for 1-2 hours and

washed with PBST two times. Th e membrane

was then incubated with the primary antibody

(Anti-Flag antibody; 5 microliters and PBST)

for 1-2 hours and then washed with PBST 3

times for 10 minutes. Th is mouse antibody

binds to the protein in question. In this case,

it is a particular kinase that interacts with

cryptochrome. Afterwards, the membrane

was treated with the secondary antibody for

1-2 hours.

Plasmid Extraction

Plasmid extraction was done using a kit called

GeneJet Plasmid Miniprep kit as described by

the manufacturer (Th ermo Scientifi c). ddH20

heated to 70 degrees Celsius was used to elute

the DNA instead of elution buff er.

PCR

PCR reactions contained 1 μL of template

DNA, 5 units of DreamTaq, 0.2 μM of

each primer and 0.2 mM dNTPs. Th e

remaining components were as indicated

by the manufacturer (DreamTaq –

Th ermo Scientifi c). Th e primer sequences

were as follows: CRY2 forward primer

(5’-ATGAAGATGGACAAAAAGACTATAG-’3)

MURJ - VOLUME 380

and CRY2 reverse primer

(5’-TCATTTGCAACCATTTTTTC-’3). Once

the reactions were assembled, they were

placed into a thermal cycler. Th e program

cycle was specifi c to DreamTaq. Th e cycle

was at 95 degrees Celsius for 30 seconds, 55

degrees Celsius for 30 seconds, 72 degrees

Celsius for 2 minutes. Th is was done for 34

cycles. Th e PCR products were then analyzed

by agarose gel electrophoresis (1% agarose,

1X TAE).

ACKNOWLEDGEMENTS

During my time in Dr. Chentao Lin’s lab, I

indeed learned a lot about the type of research

done and the research fi eld in general. Of

course, I did meet some challenges. Th is

opportunity of working in a UCLA laboratory

was defi nitely outside of my comfort zone,

but I managed to conquer my fear in trying

new things. Th e second challenge I met

was understanding the biology that was

involved in the research. Th at was the

most diffi cult of all. Overall, I am glad I

participated in the internship provided by the

Los Angeles Mission College STEM program

and Dr. Chentao Lin. It has given me a new

perspective about the research fi eld and I

recommend it to everyone looking to pursue a

fi eld in biology or chemistry.

I would like to thank Dr. Chentao Lin for

granting me the opportunity to work in his

lab. I would like to also thank Dr. Qing Liu

for allowing me to participate in her work.

She was my lab supervisor during my time

working in Dr. Lin’s laboratory. She helped

me and oversaw my work in the lab. She,

also, helped me understand the diffi cult

biology that was in practice in her research.

Lastly, I would like to thank everyone in the

STEM program and its faculty for helping

me achieving this wonderful goal. I would

like to especially thank Dr. Stephen Brown.

He helped all of the summer interns with

diff erent challenges they faced during their

internship. Th is opportunity helped me

dive into an imperative part of my major

that I have never seen before and found

very fascinating. Th is opportunity helped to

reinforce my decision in choosing biology as

my major. Th ank you everyone for time and

assistance in this wonderful journey.

REFERENCES

1. Meyerowitz, Elliot M. “Prehistory and

History of Arabidopsis Research.” Prehistory

and History of Arabidopsis Research. Plant

Physiology, 2001. Web. 16 July 2014.

2. Lin, Chentao, and Takeshi Todo. “Th e

Cryptochromes.” Protein Family Review (2005):

n. pag. Web.

3. Lin, Chentao, and Dror Stalitin.

“CRYPTOCHROME STRUCTURE AND

SIGNAL TRANSDUCTION.” (2003): 469-

89. Web.

4. “Th e NanoLuc Luciferase Reporter Dossier.”

Reportergene. N.p., 22 Jan. 2013. Web. 13

Sept. 2014.


Research Of Novel Plant-Nodulating Bacteria

Firmin Dingue Tchiengue Sponsored by Dr. Ann Hirsch, Department of Molecular, Cell and Developmental Biology


INTRODUCTION

Plants, especially green plants, are one of the

most important living organisms on planet

Earth. Without them, there probably would

not be life on Earth. Th at is due to the fact

that green plants perform photosynthesis that

removes carbon dioxide from the atmosphere

and replenishes it with oxygen that other

living organisms need to live. Plants are

found in all the biomes around earth and they

require 16 chemical elements to survive and

growth. Th ree of those 16 are non-mineral,

and are oxygen, hydrogen and carbon. Among

the 13 mineral elements they need to thrive,

nitrogen is the most important. Plants utilize

the macronutrient nitrogen to make their

DNA, their proteins and their chlorophyll.

Nitrogen is also used by plants for rapid

growth, better seed and fruit production and

better forage crops and quality of leaf. Plants

get their nitrogen from the soil. However,

the soil is most of the time very poor in

nitrogen because plants extensively use it for

growth and survival. Nevertheless, not all

plants get their nitrogen from the soil. A very

interesting species of plants get their nitrogen

indirectly from the air/atmosphere, where

nitrogen is abundant (air is 78% nitrogen gas).

Th ese species of plants are called legumes.

A legume is a dicot plant of the Fabaceae/

Leguminosae family. Legumes have their

fruits or seeds contained in capsules called

pods. Certain legumes, such as soybean,

peanut, pea, siratro and alfalfa, are

edible plants and therefore mainly grown

agriculturally. Because of their special

nitrogen fi xing quality, legumes are also

grown as soil-fertilizers. Legumes are able

to fi x nitrogen from the air, thanks to their

symbiotic relationship with certain bacteria

called Rhizobia. Th e rhizobia are found in

areas of the root systems of the legumes called

nodules. Due to obvious and drastic climate

changes, lands are becoming arid and less

plant-friendly, like deserts. However, desert

plants have very interesting characteristics

and incredible resistance to the harsh

environmental conditions they live in. Th ose

characteristics and resistance are due to their

adaptations to the weather conditions and

the soil they live on. Soils contain bacteria;

some are benefi cial to plants and animals,

others are pathogens. We actually didn’t

check this, although it would have been

interesting. Th e soil we have used as an

inoculum came from the rhizosphere of Larrea

tridentate, a dominant shrub in the Mojave

desert (not a legume). We were curious to

MURJ - VOLUME 382

know whether a legume could survive and

grow in a desert environment, establishing

a symbiosis with the bacteria in desert soils,

and thus being able to acquire nitrogen. We

were also interested in creating a catalogue

of all the organisms in our soil samples using

eDNA (environmental DNA). We therefore

performed a metagenomic experiment

on our soil samples and we chose soy as

an experimental legume and set up a trap

experiment. A trap experiment is basically an

exercise where germinating seeds of a selected

plant are implanted in sterile growth pots and

inoculated with extract of a soil sample that is

then studied to see whether that soil contains

bacteria that engage in symbiosis with the

selected plant and enhance its growth. Our

research could contribute to the discovery

of potential new Plant Growth Promoting

Bacteria (PGPB).


Metagenomic Experiment

In order to see whether the eDNA of the

soil sample was extracted successfully, 10

μl of the solution collected after the eDNA

isolation step was run on 1% agarose gel

electrophoresis. We discovered that the eDNA

of the author’s soil sample was successfully

isolated (Figure 1). Using the High Mass

DNA ladder and his reading protocol, the 2

bands of eDNA in lanes 8 and 9 (Incubated

and non-Incubated), corresponded at the band

6 on the ladder and had the size of 10,000 bp.

Th erefore, according the protocol to determine

the mass, the eDNA sample collected had the

mass of 200 ng and the molality of 20 g/μL.

After we found that we had indeed collected

the eDNA of our soil sample, we continued by

running PCR to amplify our samples. Th en

we ran the PCR products on an agarose gel.

Figure 2 depicts the result of the gel. DNA

bands in lane 6 through 9 were used for the

continuation of the experiment. Th e bands

were about 1.6 kb in size.

Figure 1 - eDNA Isolation Gel resultLane 1: 1 kb High DNA Mass Maker; Lane 2: Non-Incubated sample of Alex (lab partner); Lane 3: Incubated sample of Alex (lab Partner); Lane 5: Non-Incubated sample of Spencer (Lab Partner); Lane 6: Incubated sample of Spencer (lab Partner); Lane 8: Non-Incubated sample of Author; Lane 9: Incubated sample of Author.

Figure 2 - PCR products Gel resultLane 1: 1 kb High DNA Mass Maker; Lanes 2, 3: Non-Incubated sample of Alex; Lanes 4, 5: Incubated sample of Alex; Lane 6, 7: Non-Incubated sample of Author; Lane 8, 9: Incubated sample of Author; Lane 10, 11: Non-Incubated sample of Spencer; Lane 12: Incubated sample of Spencer.

L1 L2 L3 L4 L5 L6 L7 L8 L9 L10 L11 L12

10k6k4k3k

1k

L1 L2 L3 L4 L5 L6 L7 L8 L9 L10 L11 L12

4k2k

1k


We then extracted the PCR products from

the gel and proceeded in purifying it. Th en

using competent cells, we selectively cloned

our eDNA fragments and later extracted and

collected the plasmids from our transformed

bacteria. We then performed Restriction

Enzyme reaction (RER) to see whether our

eDNA fragments were properly inserted. We

then ran the RER products on agarose gel

(Figure 3). We found out that our eDNA

fragments were properly inserted in certain

white colonies.

After collecting and purifying our eDNA

fragment from the RER gel, we added it

to a sequencing reaction cocktail and the

mixture was put in PCR machine. We then

removed the sequencing products from the

thermocycler, cleaned it and then took it to

UCLA School of Medicine DNA Sequencing

Room. Th e sequencing results were received

via email from the DNA sequencing Core

facility and were analyzed using the Database

16S Ribosomal RNA sequences (Bacteria and

Archaea) in the Basic Local Alignment Search

Tool (BLAST). BLAST program is a trademark

of the National Library of Medicine. Th e DNA

sequencing machine was unable to produce

a good sequence of our sample. Th erefore it

was impossible to determine a catalogue of

bacteria in the soil sample. Since all the steps

until the RER were positively conclusive, due

to the fact that very small amount of DNA

was used, DNA sample might have been lost

in pipetting or mixing during the sequencing

reaction and the sequencing reaction

purifi cation. Th erefore, in the future, we

will be very careful while adding our reaction

components, making sure there is nothing left

in the pipet tip. We also will be cautious while

mixing our reactions by making sure that after

mixing there is no liquid on or in the pipet tip.

Despite that fact we were not able to create

a catalogue of bacteria in our soil sample, we

found out that there were nodule-inducing

bacteria in the soil sample used. Th is is

proven by the presence of nodules on the

roots of the alfalfa plants from the trap

experiment of Spencer (laboratory partner).

After nodules collection and DNA sequencing,

it was discovered that the nodules were

created either by Bacillus aerius strain 24K,

or by Bacillus stratosphericus 41KF2a or by

Bacillus aerophilus 28K. Nine hundred twenty-

seven nucleotides sequenced matched the

DNA sequences of the above bacteria to 98%.

Th e above Bacillus strains were extracted

for the fi rst time from cryogenic tubes

that served to gather samples of air at high

altitudes. Th e air samples were collected using

a balloon that was send to the sky on January

Figure 3 - RER Gel Result. Lane 1: 1 kb High DNA Mass Maker; Lane 2, 4: White colonies plasmid.

L1 L2 L3 L4 L5 L6 L7 L8 L9 L10 L11 L12

10k6k4k3k2k

1k

MURJ - VOLUME 384

Figure 5 - Soy Growth pots 9 days after transplantation of seed and watering on the bench at the green house (growth location). From left to right, front to back: Pot (N-, Soil+); Pot (N-, Soil+); Pot (N-, Soil+); Pot (H2O, Soil-); Pot (N-, Soil-); Pot (N-, Soil+); Pot (N-, Soil+); Pot (N+, Soil-).

Figure 6 - Apparition of fi rst leaf. On July 21 (12 days after implantation), the fi rst leaf was observed in pot (N-, Soil+) on the right.

20, 2001 from the National Scientifi c Balloon

Facility of the Tata Institute of Fundamental

Research at Hyderabad, India. Bacillus aerius

strain 24K was gathered at 24 km altitude,

Bacillus stratosphericus 41KF2a was collected

at 41 km altitude and Bacillus aerophilus 28K

was obtained at 28 km altitude.

Trap Experiment

In our trap experiment, we set up a completely

sterilized environment and inoculated

sterilized germinating soybean seeds with

Mojave Desert soil. Th e seeds after being

sterilized were incubated in sterile H2O

(Figure 4). In this experiment, we wanted to

fi nd out whether our soil sample contained

bacteria able to have symbiosis relationship

with a legume and help the legume to fi x

nitrogen from the air.

Th e seed were incubated overnight before

being place on LB to germinate. After we

transplanted the germinating seeds in the

pots, we took the pots to the UCLA green

house (Figure 5). Despite the fact we

transplanted Germinating soybean seeds, very

few of them continued to develop.

Th e fi rst seed emerging from the pot was

observed after 12 days of watering (Figure 6).

Soybeans seeds that were used for this

experiment were from an inbred line and it

seemed like they were not good or they were

not strong enough to survive the sterilization

process. In the future, a new line of wild

type soy beans will be used, or seeds will

be sterilized with a less concentrate bleach

solution and for a less amount of time.

We regularly observed and watered our plants.

Figure 7 depicts how the pots looked and the

grow level of the seeds on the 28th day of

the experiment.

After 34 days in the experiment, 4 experimental

pots still did not have plants. By consequences,

those pots were then discarded and the

experiment continued with the 4 remaining

Figure 4 - Soybean seeds being incubated in sterile H2O


pots. Th e 4 remaining pots were constituted

of 1 experimental pot ( N-,Soil+), and the 3

control pots ( pot(H2O, Soil-), pot(N-, Soil-)

and pot(N+, Soil-)) (Figure 8).

We fi nally terminated our soy experiment on

September, 04, 2014. Th e experiment lasted

a total of 57 days. Figure 9 shows how the

plants in the 4 remaining pots looked before

they were harvested.

After we carefully removed the plants from

their pots, we cleaned the plants’ roots to

remove all the Vermiculite and Perlite. In

the control Pot (Soil-, N-) (Figure 10) we had

4 plants. We observed that the leaves of all

the plants were lightly green but they were

greener than the leaves of the plants in the

pot (soil, N-). Dry brown spots were observed

on the surroundings of the leaves. Th e roots

were long with a couple of principal roots

and a bunch of secondary roots. Th e heights

of the shoot/cotyledon of those plants were

respectively, front left to right on Figure 10,

7.80 cm, 6.60 cm, 14.30 cm and 8.25 cm. Th eir

dry weights were, also respectively from left

to right, 0.5028 g, 0.2018 g, 0.6198 g, 0.2666 g.

No nodules were observed on the roots of

all plants.

In the control Pot (Soil-, N+), we had only one

plant (Figure 11). Th e leaves were very green.

Th ey were greener and looked healthier than

all the other plants. It had one principal root

with few secondary roots. Th e height of the

cotyledon was 10.30 cm and it was dry weight

was 0.4442 g. No nodules were observed.

Figure 7 - Growth Pots Status on day 28 of the experiment. From left to right, front to back- Pot (N-, Soil+); Pot (N-, Soil+); Pot (N-, Soil+); Pot (H2O, Soil-); Pot (N-, Soil-); Pot (N-, Soil+); Pot (N-, Soil+); Pot N+, Soil-).

Figure 8 - Day 34-The 4 remaining Pots. Front only, from left to right- Pot (N-, Soil+); Pot (H2O, Soil-); Pot (N-, Soil-); Pot (N-, Soil+)

Figure 9 - Status of the 4 Remaining Growth Pots on the day of harvesting/last day of the experiment. Front only, from left to right- Pot (N-, Soil+); Pot (H2O, Soil-); Pot (N-, Soil-); Pot (N-, Soil+)

Figure 10 - Specimens Collected in control Pot (Soil-, N-)

MURJ - VOLUME 386

In the control Pot (Soil-, H2O) (Figure 12),

only one plant appeared and its leaves were

light green. Certain leaves had yellow spots

or are completely yellow. Th e plant had two

principal roots with many secondary roots.

Th e height of the cotyledon was 8.00 cm and

its dry weight was 0.3884 g. No nodules

were observed.

In experimental Pot (Soil+, N-) (Figure 13),

only one plant was present. Its leaves were

light green/almost yellow. A lot of dry brown

spots were observed on the surroundings of

the leaves. Th e plant had three principal roots

with few secondary roots. Th e height of the

cotyledon was 5.51 cm and its dry weight was

0.2330 g. We also did not see nodules on the

roots of this specimen.

Because of the absence of nodules on the roots

of the plant collected from the experimental

pot, the trap experiment ended at the plants

harvesting stage. Despite the fact that the soy

seeds germinated on the plate, most of them

did not continue their development after

transplantation. It was surprising to see the

control pot (soil-, N-) producing more plants

than the other pots, especially more than the

control pot (soil-, N+). It was later discovered

that the control pot (soil-, N-) had been

contaminated. Students were watering their

plants with a water-hose over that pot and

were therefore spilling water with nitrogen

and others nutrients in it. After the discovery

of the contamination, the pots were moved

to an area away from others’ experiments to

avoid any further watering contamination.

In the future, the location and settlement

of the experiment will be chosen more

carefully, taking into account the surrounding

experiments. A poster reading “DO NOT

SPILL TAP WATER IN THOSE POTS” can also

be put in the middle of the pots.

Metagenomic experiments and trap

experiments are two very good approaches to

discover what type of bacteria a soil sample

contains. Th e major diff erence is that with

one of these techniques, it is impossible to

Figure 11 - Specimen in control Pot (Soil-, N+) Figure 12 - Specimen in control Pot (Soil-, H2O)

Figure 13 - Specimen in control Pot (Soil-, H2O)


go back and use the bacteria discovered. In

a metagenomic experiment, transformed

colonies containing diff erent and maybe

unique plasmids are used for sequencing.

Th erefore, after discovering which bacteria

were in those colonies, it is not possible to

cultivate exactly the same colonies. While

with the trap experiment, the bacteria in

nodules are plated and the sequencing is

done from bacteria colonies. So, when an

interesting or novel bacterium is found after

sequencing, it is possible to go to the plate

and grow that specifi c colony for

further experimentations.


METAGENOMIC EXPERIMENT

eDNA Isolation: Th e soil sample used in this

experiment came from the Mojave Desert.

Th e Mojave Desert is located in California,

USA (northeast of Los Angeles, CA and close

to Nevada, USA). Th e soil samples were

collected in March 2014 and stored at 4 °C.

Two 0.25 g of soil sample were measured.

One sample was incubated at 30 °C overnight

(“Incubated Soil”) and the eDNA isolation of

the other was performed immediately (“Non-

Incubated Soil”). eDNA of both samples

was isolated using the DNA Isolation Kit

PowerSoil (MO BIO Laboratories) according to

the protocol of the manufacturer. Both eDNA

samples were stored at -20 °C.

Agarose Gel Electrophoresis: One half gram

of Agarose was added to 50.00 mL of 1X TAE

buff er. Th e mixture was then microwaved

several times at full power, avoiding boiling,

until it became completely homogeneous.

After the agarose-buff er mixture cooled down

for 10 minutes, 4 μL of ethidium bromide

were added. Two microliters of 6X loading dye

were added to 10 μL of each eDNA sample and

were mixed very well using pipet tips. Along

with 4 μL of 1 kb High DNA Mass Maker

loaded in the fi rst lane, 12 μL of each sample

was loaded on the gel which was run at 100

volts for 35 minutes.

Polymerase Chain Reaction (PCR): Two

microcentrifuge tubes were labeled respectively

Non-Incubated and Incubated and 25.03 μL

of a PCR stock solution was added in each of

them. A 25.03 μL of stock solution contained

2.5 μL of 10X Top Taq PCR buff er, 2.5 μL of 2

mM dNTPs, 5.0 μL of 5X Q solution, 1 μL of

fD1 primer, 1 μL of rD1 Primer, 12.9 μL of PCR

H2O and 0.13 μL of Top Taq DNA Polymerase.

fD1 primer had the sequence

5’-CCGAATTCGTCGACAACAGAGTTTGATCC

TGGCTCAG-3’ and rD1 primer had the sequence

5’- CCCGGGATCCAAGCTTAAGGAGGTGATCC

AGCC -3’. One microliter of Incubated and 1

μL of Non-Incubated eDNA was respectively

added to the labeled microcentrifuge tubes.

Th e tubes were then centrifuge at 12,000 rpm

to mix well all the reagents. Th en, they were

put in the thermocycler/PCR machine and

the HIRSCH Program was run. Th e HIRSCH

program was set as follows:

5’ @ 95 ºC

30” @ 95 ºC|

30” @ 50 ºC| x 30

60” @ 72 ºC|

hold @ 4 ºC

MURJ - VOLUME 388

Running the PCR Products: Th e PCR

products were subjected to 1% agarose gel

electrophoresis; 4 μL of 6X Orange dye were

added to each sample. Th e 4 μL of 1 kb

High DNA Mass Ladder were loaded with

the samples. A volume of 12.5 μL of each

sample was loaded twice. Th e electrophoresis

machine was set at 100 volts and ran for

35 minutes.

Purifi cation of PCR Products Using Gel

Extraction Kit: Bands in wells 6 and 7 (Non

Incubated bands) were cut together, as well

as bands in wells 8 and 9 (incubated bands),

using a sharp razor and were put in two

microcentrifuge tubes. Th ey were respectively

labeled Non-incubated and Incubated and

were stored at -20 °C overnight. Invitrogen

PureLink Quick Gel Extraction Kit by life

technologies was used for the dissolution

of the gel and purifi cation of the eDNA as

described by the manufacturer.

DNA Cloning and Transformation reaction:

Escherichia coli (E.coli) were used as competent

cells. Th e 2 μL of purifi ed eDNA was

cloned and transformed, according to the

manufacturer protocol, using TOPO® Cloning

Kit by Life technologies. A mixture of 300

μL of DMSO and 12mg of X-gal were added

to the cloning reaction. Th e reaction was

plated on LB plus ampicillin. Th e ampicillin

concentration was 100 μL/mL. Th e plate

produced blue and white colonies. Th en, two

white colonies (colonies with clone inside)

were each inoculated in 5 mL of LB and placed

in a 37 °C shaker overnight at 200 rpm.

Plasmid Isolation/Collection: Th e plasmid

isolation was performed using Invitrogen

Purelink™ Quick Plasmid Miniprep Kit

(by life Technologies) according to the

manufacturer’s protocol.

Restriction Enzyme Reactions (RER): Five

microliters of plasmid was added to a 15 μL

of a solution containing 2 μL of EcoRI buff er,

12.5 μL of sterile H2O and 0.5 μL of EcoRI.

Reaction was incubated at 37 °C for an hour,

then, 12 μL was run on 1% agarose. Th e DNA

fragment was collected from the gel, purifi ed

as above.

Sequencing Reactions: Five microliters of

plasmid purifi ed in the previous step was

added to cocktail containing 2 μL of 5X

Sequencing buff er, 1 μL of 10 μM F1 primer,

1 μL of sequencing H2O and 1 μL of Big Dye.

Th e reaction was put in the PCR machine and

the program called “Ann Hirsch Protocol/

BigDyeSeq/55°C-40 Cycles” was run. Th e

program ran for approximately 4 hours,

9 minutes.

Cleaning/Purifying Sequencing Reaction

samples and DNA Sequencing: A Dye Ex™

2.0 Spin Column was vortexed at medium

at speed and the bottom of the column was

opened. Th e Dye Ex™ 2.0 was introduced

in a 2 mL collection tube and centrifuged at

3,000 rpm for 3 minutes. Th e fl ow-through

was discarded and the Dye Ex™ 2.0 was placed

in a clean 2 mL microcentrifuge tube. Th e

sequencing reaction was then loaded in the

center of the inclined gel inside the Dye Ex™


2.0, holding the inclination away. Th en the

tube was centrifuged at 3,000 rpm for 3

minutes. Th e Dye Ex™ 2.0 was then discarded

and the purifi ed sample was collected in the

microcentrifuge. Th e purifi ed sequencing

reaction was taken to the DNA Sequencing

Room (room 30-125), on the 3rd fl oor of the

UCLA School of Medicine.

TRAP EXPERIMENT

Seed Sterilization: Soy seeds incubated in

70% Ethanol for 1 minute (min). Th en, they

were incubated in full strength bleach for 2

minutes and washed 5 times with sterile water

and incubated in sterile water overnight. All

the above steps were performed in a hood.

Germination: Th e seeds were then placed on

1% Luria Broth (LB) agar plates to germinate.

Th ey were incubated at 37 °C for 48 hours.

Growth Pot Preparation: Th e growth pots

were approximately 3 liters. Th ey were

washed with soap and water and autoclave

sterilized for 3 minutes (to avoid melting). A

mixture of 6 growth pots of vermiculite and

3 growth pots of perlite (2/3 vermiculite and

1/3 perlite) were sterilized in an autoclave

for 20 minutes. Th e growth pots were fi lled

with Ver-Per mixtures and feeder tubes were

inserted in the center of each pot (all pots

were prepared in a hood).

Seed Transplanting: Th e seeds that had

started to germinate were planted in the pots.

In a hood and using sterilized forceps, we

planted 6 to 8 seeds per pots.

Soil Preparation and Inoculation: Th e soil

sample used in this experiment came from

the Mojave Desert. Th e Mojave Desert is

located in California, USA (northeast of Los

Angeles, CA and close to Nevada, USA). Th e

soil samples were collected in March 2014

and stored at 4 degrees Celsius. Fifteen

microliters of soil was mixed with Millipore

water, forming a total volume of 50 mL, and

incubated at 30 °C overnight. Using a sterile

pipet, every pot was inoculated with 15 mL of

Mojave soil extract.

Experiment Location and Watering: Th e

surface of each pot was covered with plastic

beads to reduce contact with the exterior

environment. Th en they were transported to

the UCLA green house and watered through

the feeder tubes as follows: the fi ve pots

inoculated with soil (experimental samples

(Soil, N-)) were watered with Hoagland’s

medium without nitrogen (composition per

liter: 2 ml of 1 M magnesium sulfate, 1 mL

of 1 M potassium dihydrogen phosphate, 1

ml of iron ethylenediaminetetraacetic acid

stock (1 M FeEDTA), 1 ml of micronutrients

stock 5 mL of 1 M calcium chloride, 5

mL of 1 M potassium chloride, 984 ml

of Millipore purifi ed water); of the three

remaining pots (control pots), one was

watered with Hoagland’s medium without

nitrogen (No soil, N-), one (No soil, N+)

with Hoagland’s medium with nitrogen

(Hoagland’s medium with 5 mM potassium

nitrate), 1 mL of Micronutrients stock, 2

mL of 1 M magnesium sulfate, 984 mL of

MURJ - VOLUME 390

Millipore purifi ed water), and the last one

with sterilized water (no soil, H2O). Every pot

was watered with 300 mL of their respective

media (N-, N+, and sterilized H2O). Each pot

was watered as needed, typically twice per

week. Th e second week, the plants were fed

with 300 mL of their respective media and the

third week they were watered with 200 mL.

Plant Harvesting: Th e pots were brought back

to the laboratory and the plants were carefully

removed entirely with their roots, making

sure not to break them and not to cut roots

when possible. Th e roots of the plants were

then washed with tap water to remove all the

Perlite and Vermiculite. After the pictures

and height of the cotyledon were taken, the

plants were separately wrapped in paper towel

according to their pot of origin. Th en they

were incubated to dry at 67 °C overnight.

After incubation, their dry weight was taken.

ACKNOWLEDGEMENTS

I would like to thank Dr. Ann Hirsch for

giving me the opportunity to learn, work and

grow in her laboratory. I would like to thank

Dr. Maskit Maymon for all the teachings,

assistance, patience and advises. Th e

experience and knowledge I gained on your

sides is priceless. I would like to thank Title

III STEM program for providing and funding

internships like this for L.A. Mission College

students. I also would like to thank Professor

Stephen Brown for assisting me during all

the summer and in the writing of this paper.

Finally, but not least, I would thank to my

laboratory partners Alex Rahban and Spencer

Flynn for their support.

REFERENCES

1) Kaplan, D., Maymon M., Agapakis, C.M.

Lee, A., Wang, A., Prigge, B.A., Volkogon,

M. and Hirsch, A.M., “A survey of the

microbial community in the rhizosphere of

the dominant plant of the Negev Desert,

Zygophyllum dumosum Boiss., using

cultivation-dependent and ?independent

methods,” American Journal of Botany, 100 :

1713-1725 (2013)

2) Shivaji, S. “Bacillus aerius sp. nov.,

Bacillus aerophilus sp. nov., Bacillus

stratosphericus sp. nov. and Bacillus

altitudinis sp. nov., isolated from cryogenic

tubes used for collecting air samples from

high altitudes.” INTERNATIONAL JOURNAL

OF SYSTEMATIC AND EVOLUTIONARY

MICROBIOLOGY 56 (7): 1465–1473.(2006)

doi:10.1099/ijs.0.64029-0. ISSN 1466-5026

3) http://www.ncagr.gov/cyber/kidswrld/

plant/nutrient.htm


Eff ects Of Fluorinated Microporous

Active-Carbon In Th e Capacitance Of

Electrochemical Double-Layer Capacitors Jesus M. Lopez Baltazar, Huihui Zhou[a], Yunfeng Lu[a]

[a] Department of Chemical and Biomolecular Engineering


ABSTRACT – Carbon based electrochemical capacitors, also named supercapacitors, together with fuel cells

and batteries represent types of electrochemical energy storage devices. Compared with batteries and fuel cells,

supercapacitors deliver their stored energy in a few seconds, off ering higher power densities and long cycling life.

However, supercapacitors based on the electrochemical double-layer capacitance (EDLCs) have lower energy density

compared to batteries and fuel cells, which limits their application as energy storage devices. In this project, in order

to improve the energy density of EDLCs, fl uorination of the carbon-based electrodes was attempted to enhance the

wettability between electrode materials and the electrolyte and to fully utilize the carbon surface area, thus enhancing

the overall capacitance of carbon-based supercapacitors. Two types of commercialized active carbon (named as CAC

and SAC, respectively), used as electrode materials, were fl uorinated with HF by sonication at room temperature and

prepared for electrochemical tests. Although similar electrochemical responses were obtained from CAC and fl uorinated

CAC (F-CAC), the capacitance value for fl uorinated SAC (F-SAC) was found to be 121.42 Fg-1, which is slightly higher

than the capacitance value of 116.91 Fg-1 found for SAC, showing a trend of improvement in the capacitance value of

fl uorinated carbon-based EDLCs. Fluorination of the carbon materials CAC and SAC still needs further experimentation

to confi rm the possibility of promising features in the application of portable electronic devices and electric vehicles.

transmittance of energy in communication

devices and storage systems[11].

Electrochemical energy storage devices

(EESDs) could be of three diff erent types:

batteries, fuel cells, and electrochemical

capacitors. A common basic structure is

shared among EESDs. For instance, all EESDs

have at least two electrodes composed of

metal collectors and active material which is in

contact with an electrolyte solution separated

by a polymeric membrane denominated a

separator. Th e processes that provide certain

amounts of energy take place at the electrode/

electrolyte interface for these three types of

devices, but their nature diff ers in each device.

Redox reactions, for instance, take place

in batteries and fuel cells. Electrochemical

INTRODUCTION

Fossil fuels are currently the most common

type energy resources used to satisfy the high

demand for energy consumption in a variety

of mobile and stationary devices. Given

the limited nature of this natural organic

source of energy, fossil fuels are forecast to

be exhausted in the subsequent years, thus

highlighting the importance for the search

of new renewable energy sources that could

provide similar features possessed in fossil

fuels with reduced emissions of CO2. Th e

production of new environmentally-friendly

energy comprises the use of solar cells,

wind mills and hydroelectric turbines[3].

Nonetheless, electrochemical energy-storage

devices are the most suitable option for the

MURJ - VOLUME 392

capacitors, also known as supercapacitors,

store and deliver energy by the formation

of an electrical double layer formed in the

electrode/electrolyte interface due to the

orientation and position of electrolytic ions

when an external load is in contact with the

conducting electrodes[6, 13].

Supercapacitors can be classifi ed as

electrochemical double-layer capacitors

(EDLCs) and pseudocapacitors. Th e

diff erence between the last two lies in

the faradaic or redox processes that take

place in the outermost atomic layer of the

electrode surface of pseudocapacitors.

Energy storage and delivery in EDLCs rely

on pure electrostatic attractions between

the ions of the electrolyte solution and the

active material of the electrodes. During

the charging process, the electrodes of the

supercapacitor become electrically charged

due to the electromotive force provided by an

external source of energy, which generates

a potential diff erence between them[6].

Th e charge of the electrodes is of equal

magnitude, but diff erent sign. Th e negatively

charged electrode (negative electrode) and

the positively charged electrode (positive

electrode) generate a movement of the

electrolytic ions, attracting those of opposite

charge[2]. Figure 1 shows a representation

of the basic structure of an EDLC during the

charging process. Th e electrolytic ions are

retained on the surface area of the active

material of the electrode by coulombic forces

but do not react with it. Energy is therefore

stored on an electrolytic double layer that

forms on the electrode/electrolyte interfaces

of the supercapacitor. During the discharging

process, the electric potentials of the

electrodes are reversed in sign generating a

movement of the electrolytic ions towards the

opposite direction from their original location

attained in the charging process. Th is, in turn,

creates a parallel movement of electrons in the

outside connections, delivering energy in the

form of electric current.

Figure 1 - Representation of the basic structure of an EDLC used in this project during a charging cycle. The elements depicted in the image are the Aluminum metal collectors, fl uorinated microporous active carbon as the active material (black fi gures next to the metal collectors), the fi berglass used a separator and the electrolytic ions moving towards the oppositely charged electrodes. The formation of the double layer over the electrodes can be appreciated and is represented in the simplifi ed circuit diagram below the main image.


Batteries are the most widely used type

of EESD due to the considerable amounts

of energy (with specifi c energy density

values as high as 180 kWh/g compared

with other EESDs) that they can store in a

relatively small volume[1]. Supercapacitors

off er complementary advantages that are

void of batteries and fuel cells. EDLCs can

deliver their stored energy in the order

of seconds, providing high specifi c power

densities as high as 104 kW/g compared

with other EESDs. Furthermore, they off er

long cycle life of over 105 cycles as they do

not have the disadvantage of cumulative

irreversible capacity and loss of material

often found in batteries and fuel cells due to

redox reactions[1]. Th e terms specifi c energy

density and specifi c power density refer,

respectively, to the amount of energy stored

per mass and the amount of energy delivered

per second for every unit of specifi c mass of

active material. Figure 2 shows a Ragone plot

comparing specifi c power and energy densities

of combustion fuels, conventional capacitors

and EESDs. Compared with conventional

Figure 2 - Ragone plot comparing specifi c energy and power densities of different energy sources[6]

electrostatic capacitors, supercapacitors have

the highest values of specifi c energy density

and the highest values of specifi c power

density compared to batteries and fuel cells[13].

Hence, supercapacitors represent a promising

choice for a variety of applications ranging

from back-up memory systems, and portable

electronic devices to hybrid electric and

electric vehicles. One of the most important

current applications of supercapacitors lies in

the startup ignition of vehicles where specifi c

amounts of energy need to be delivered in

short amounts of time[1, 8, 9].

Th e main challenge faced by supercapacitors is

their limited energy density values compared

with batteries and fuel cells, which limits

their application as energy-storage devices.

Th e amount of energy that can be stored in

a supercapacitor depends on several factors

such as the active material used, the molecular

composition of the electrolyte and the

electrode/electrolyte interface[2, 3].

Th eoretically, the stored energy in a

supercapacitor is given by:

where, E is the energy stored, C is the

total capacitance of the double layer and V

represents the working voltage run across

the electrodes. According to this formula, it

is possible to increase the energy density of

supercapacitors by generating an increasing

in their working voltage, capacitance, or

both. Th e working voltage of supercapacitors

depends largely on the molecular structure

of the active materials and electrolytes being

MURJ - VOLUME 394

used. Th e last two factors, however, are

linked with each other, which makes it hard

to change the electrolyte being used without

aff ecting the electrode material[3, 13].

Increasing the capacitance of EDLCs

represents a practical way of enhancing their

energy density[9]. According to:

C= ε0εSA d

the capacitance of EDLCs depend on the

dielectric constants of the vacuum and (ε0)

materials (εS) between the electrochemical

double layers (EDLs), the surface area of the

active material available for charge storage

(A) and the thickness (d) of the EDLs. Most

research done focuses on increasing the

surface are by using carbon-based electrodes

due to the favorable properties of carbon

such as high surface are, high electrical

conductivity, chemical stability in a wide

range of pH media, versatile forms, stability

in a wide range of temperatures, availability,

nontoxic nature, and low cost[1, 2, 3, 4, 5, 10].

With the advance in nanotechnology, new

carbon materials such as carbon nanotubes,

carbon fi bers, carbon foams, and nanoporous

carbons have been explored to improve the

performance of EDLCs[1, 3, 4, 12, 13]. Activated

carbons, however, are the most widely carbon-

based electrodes to increase the capacitance

of EDLCs due to their extremely high specifi c

surface area (up to 3000 m2/g) and small pore

size (with diameters < 2 nm) [1, 7]. Because

certain functional groups in carbon materials

restrain the contact of certain portions of

the surface area of the electrode with the

electrolyte, increasing the wettability of

these materials is imperative in increasing

the capacitance. Fluorination is an eff ective

method to modify the chemistry surface of

the active material, controlling the percentage

of specifi c surface area of active material

participating in electrolytic-ion-attraction

interactions[5, 9, 10, 11]. In this project, the

chemistry surface of microporous activated

carbon was altered with the introduction

of fl uorine atoms in the carbon’s functional

groups in an attempt to increase the

wettability of the active material with an

organic electrolyte in order to optimize the

eff ective surface area participating in charge

storage, thus enhancing the capacitance and

energy density of EDLCs.

EXPERIMENTAL

A. Synthesis of Materials

Two diff erent types of commercialized

activated carbon, named CAC and SAC

respectively, were used as the carbon sources.

Th e fl uorination was carried out by stirring

~2.000 mg of each sample with a mix acid

combination of ~20 ml of 40% HF (Sigma-

Aldrich, HF puriss, p.a., reag. ISO, reag. Ph,

Eur., ≥40%) and ~20.0 ml of HNO3 (Safe-

Cote, HNO3, Certifi ed ACS plus 15.8 N). Th e

mixture was treated with sonic waves at room

temperature overnight. Fluorinated CAC and

fl uorinated SAC were labeled as F-CAC and

F-SAC respectively.

B. Electrochemical Measurements

For each sample F-CAC and F-SAC, rubber-

type electrodes were synthesized by using


the fl uorinated samples as the active

material, Carbon Black as the conductive

additive and polytetrafl uoroethylene (Sigma-

Aldrich, PTFE) as the binder. Th e electrode

comprised 80% wt. active material, 10% wt.

conductive additive, and 10% wt. binder.

Th e electrochemical test were carried out

by addition of 1.00 mg of the F-CAC and

F-SAC slurries to carbon coated aluminum

foil, and sealed by a coin-type cell in which

the electrolyte was tetrabutylammonium

tetrafl uoroborate (TBABF4) and the separator

was glass fi ber. Th e cyclic voltammetry (CV)

tests were conducted from 0.0 V to 2.7 V.

Th e galvanostatic charge/discharge tests

(GC) were conducted by running diff erent

constant currents of 0.3 A, 0.5 A, 1.0 A, 5.0 A,

10.0 A, 20.0 A, 40.0 A, and 60.0 A. Th e total

capacitance of the EDLC was calculated from

the GC tests by using the formula:

where I (mA) represents the current run

during the charge and discharge processes,

w (mg) represents 80% of the mass of active

material measured (only 80% of active

material contributes to the electrochemical

performance of the EDLC) ΔV (V) represents

the potential drop between the electrodes and

Δt(s) represents the time interval necessary

for the EDLC to drop from 2.7 V to 0.0 wV.

Because a double layer is formed, there are

two capacitor-like structures in series within

the same EDLC. From:

the total capacitance of the EDLC (Ctot) is

equal to the reciprocal of the addition of

the reciprocal of each one of the individual

capacitances of the layers. Assuming that C1

= C2, we know that

where Csl represents the capacitance of each

electrode/electrolyte interface[13].


To evaluate the eff ect of fl uorination on the

surface of SAC and CAC, impedance tests, CV

tests and GC tests were conducted. Figure

3 shows the graphs of the impedance tests

obtained. Figure 3a denotes the impedance

test at a full range of frequencies. It can be

seen that F-CAC and F-SAC have greater

slopes compared to the slopes of CAC and

SAC. Th is result can be interpreted as an

increase in the dominance of charge-storage

phenomena over the non-fl uorinated CAC

and SAC samples, which implies that there

is more activity in the electrode/electrolyte

interface. Figure 3b shows the impedance

test at high frequencies. Th e beginning of the

semicircle indicates the resistance associated

with the materials of the EDLC. Th e end

of the semicircle refers to the equivalent

series resistance (ESR) or total impedance

of the EDLC including electrode resistance,

interfacial resistance between the electrode

ad the collector, ionic diff usion resistance

through pores, resistance of ions while

moving through separators, and electrolyte

resistance[4]. It can be noticed that the F-CAC

and F-SAC samples presented lower material

MURJ - VOLUME 396

Figure 3 - Impedance tests of samples at: a) full range frequencies, b) high frequencies

Figure 4 - Cyclic Voltammetry tests of: a) CAC, b) SAC, c) F-CAC, d) F-SAC


resistance but larger ESR, which could

possibly be attributed with an increase in ion

diff usion activity.

Figure 4 denotes the CV tests run for all

samples from 0.0 V to 2.7 V at diff erent

current densities. From Figures 4a and 4c,

it is seen that there is a very small diff erence

in the voltage window of F-CAC compared

to CAC. Similarly, Figures 4b and 4d denote

a very similar voltage window for F-SAC

and SAC. Th ese results indicate that the

fl uorinated and non-fl uorinated samples

present similar stabilities in almost equal

working voltages.

Figure 5 represents the galvanostatic GC tests

conducted at diff erent constant currents. It

can be noticed by comparing Figure 5a with

Figure 5c and Figure 5b with Figure 5d

that there is no considerable diff erence

between the charge and discharge times of

the fl uorinated CAC and SAC with the non-

fl uorinated CAC and SAC. Th is result shows

that the electrochemical performance of all

the samples was similar regardless of the

fl uorination of the samples.

From formulas (1) and (2), the specifi c

capacitances of CAC, SAC, F-CAC and

F-SAC were calculated. CAC presented a

specifi c capacitance of 100.26 Fg-1, and

F-CAC presented a specifi c capacitance of

92.75 Fg-1. Although F-CAC shows a lower

capacitance compared with CAC, it can be

seen from Figure 6a that the electrochemical

performance throughout a wide range of

Figure 5 - Galvanostatic charge and discharge tests of: a) CAC, b) SAC, c) F-CAC, d) F-SAC

MURJ - VOLUME 398

current densities is very similar. Th erefore,

such diff erence in the capacitance of F-CAC

compared to CAC cannot be considered as

a detrimental eff ect of fl uorination on the

EDLC’s performance. Th e specifi c capacitance

of F-SAC was 121.42 Fg-1, and that of SAC was

116.91 Fg-1. Although the diff erence in the

last two capacitances is small, as represented

in Figure 6b, from Figure 6a, it can be

noticed that in a wide range of currents,

the capacitance of F-SAC showed a trend of

improvement over the capacitance of SAC.

Th us, this diff erence could be interpreted

as a possible eff ect of fl uorination on the

electrochemical performance of EDLCs.

CONCLUSION

Fluorination of commercialized active carbons

CAC, SAC, showed slightly positive eff ects

on the electrochemical performance of these

materials. Impedance tests showed that there

was an increased in the ion diff usion activity

for both F-CAC and F-SAC. CV-tests and

GC-tests showed that there was a similar

performance in fl uorinated and non-

fl uorinated samples. From the calculations

of the specifi c capacitances of all samples, it

is concluded that the project did not show an

enhanced eff ects for CAC after fl uorination.

However, a slightly signifi cant trend of

improvement was observed for the F-SAC

samples. Further experimentation needs

to be performed on these commercialized

active materials to demonstrate and confi rm

possible promising eff ects of fl uorination on

the electrochemical performance of EDLCs

for further application on portable electronic

devices and electric vehicles as substitutes

for batteries.

ACKNOWLEDGEMENTS

Th is project was made possible thanks to

the Transfer Student Summer Research

Program (TSSRP) at the Henry Samueli

School of Engineering and Applied Science

at Th e University of California, Los Angeles

(UCLA), the support from Lu Lab from the

Department of Chemical and Biomolecular

Engineering and the support and guidance

from the STEM program at Los Angeles

Mission College.

a)

b)

Figure 6 - Specifi c capacitances of tested samples at: a) wide range of current densities; b) fi nal specifi c capacitances of samples at scanning rates of 0.3 mV s-1


REFERENCES

[1] Zhai, Y. P., et al. “Carbon Materials

for Chemical Capacitive Energy Storage.”

Advanced Materials 23.42 (2011): 4828-4850.

[2] Frackowiak, Elzbieta, and François

Béguin. “Carbon‐Based Nanomaterials

for Electrochemical Energy Storage.”

Nanotechnology for the Energy Challenge

(2010): 177-204.

[3] Ghosh, Arunabha, and Young Hee Lee.

“Carbon‐Based Electrochemical Capacitors.”

ChemSusChem 5.3 (2012): 480-499.

[4] Zhang, Li Li, and X. S. Zhao. “Carbon-

based materials as supercapacitor electrodes.”

Chemical Society Reviews 38.9 (2009):

2520-2531.

[5] Jung, Min-Jung, et al. “Fluorination

eff ect of activated carbon electrodes on the

electrochemical performance of electric

double layer capacitors.” Journal of Fluorine

Chemistry 132.12 (2011): 1127-1133.

[6] Winter, Martin, and Ralph J. Brodd. “What

are batteries, fuel cells, and supercapacitors?”

Chemical reviews 104.10 (2004): 4245-4270.

[7] Lillo-Ródenas, M. A., D. Cazorla-Amorós,

and A. Linares-Solano. “Understanding

chemical reactions between carbons and

NaOH and KOH: an insight into the chemical

activation mechanism.” Carbon 41.2 (2003):

267-275.

[8] Schneuwly, Adrian, and Roland

Gallay. “Properties and applications of

supercapacitors: From the state-of-the-art to

future trends.” Rossens, Switzerland (2000).

[9] Lee, Young-Seak. “Syntheses and

properties of fl uorinated carbon materials.”

Journal of Fluorine Chemistry 128.4 (2007):

392-403.

[10] Kim, Mok-Hwa, et al. “Fluorinated

activated carbon with superb kinetics for the

supercapacitor application in nonaqueous

electrolyte.” Colloids and Surfaces A:

Physicochemical and Engineering Aspects 443

(2014): 535-539.

[11] Jung, Min-Jung, et al. “Physico-chemical

surface modifi cation of activated carbon

by oxyfl uorination and its electrochemical

characterization.” Colloids and Surfaces A:

Physicochemical and Engineering Aspects 389.1

(2011): 274-280.

[12] Lee, Jinwoo, Jaeyun Kim, and Taeghwan

Hyeon. “Recent progress in the synthesis of

porous carbon materials.” Advanced Materials

18.16 (2006): 2073-2094.

[13] Sharma, Pawan, and T. S. Bhatti.

“A review on electrochemical double-

layer capacitors.” Energy Conversion and

Management 51.12 (2010): 2901-2912.

STEMLOS ANGELES MISSION COLLEGE

SCIENCE TECHNOLOGY ENGINEERING MATH

13356 Eldridge Avenue Sylmar, California 91342 www.lamission.edu

Mission Undergraduate Research Journal

Printed on recycled paper with vegetable-based inks

Documents

MURJ - Los Angeles Mission College · MURJ Volume 3 January 2015 Published by ... Sahil Khullar, Dylan Martin, Heilly Salinas, Houman Tazhibi, Firmin Dingue Tchiengue, and Jesus M