Murray&ProwellMPE===Molecular Phylogenetics and Evolutionary

8/7/2019 Murray&ProwellMPE===Molecular Phylogenetics and Evolutionary

1/14

Molecular phylogenetics and evolutionary history of the neotropicalSatyrine Subtribe Euptychiina (Nymphalidae: Satyrinae)

Debra Murraya,*, Dorothy Pashley Prowellb

a 150S Dirac Science Library, School of Computational Science and Information Technology, Florida State University

Tallahassee, FL 32306-4120, USAb Department of Entomology, Louisiana State University, USA

Received 29 December 2003; revised 17 June 2004

Abstract

The Euptychiina is one of the more diverse lineages of satyrine butterflies, represented by over 300 species. The first phylogeneticanalyses of the subtribe is presented based on 2506 aligned nucleotide sequences obtained from 69 individuals spanning 28 ingroupgenera and nine outgroup genera. Two genes were used, the mitochondrial gene cytochrome oxidase 1 (1268 bp) and the nucleargene elongation factor-1a (1238 bp). The subtribe is never recovered as monophyletic in analyses using parsimony, maximum like-lihood, or Bayesian inference. Several euptychiine genera are placed basal to the ingroup, but support is found only for Euptychiaand Oressinoma. Three main lineages within the ingroup were clearly defined and many taxonomic groupings within the cladesstrongly supported. The majority of genera tested were paraphyletic or polyphyletic. Based on results presented here and novel hostuse, a close relationship of Euptychia to the Indo-Australian tribe Ragadiini is hypothesized. Origins of the group remain unclear,but the basal position of most of the Nearctic genera is discussed. 2004 Elsevier Inc. All rights reserved.

Keywords: COI; EF-1a; Molecular systematics; Butterflies; Euptychia; Selaginella

1. Introduction

Satyrinae is the second largest nymphalid butterflysubfamily with 25003000 species worldwide, yet has re-ceived little attention from systematists, and many tradi-tional taxonomic groups are untested. There has beenonly one comprehensive treatment of the Satyrinae(Miller, 1968), downranked here to reflect accepted clas-

sification of satyrines as a subfamily as opposed to afamily (Ackery, 1984; de Jong et al., 1996; Ehrlich,1958; Harvey, 1991; Kristensen, 1976). Miller (1968)provided few diagnostic characters for tribal and sub-tribal groupings, and his proposed phylogeny was notbased on an explicit data matrix or cladistic analysis.Martn et al. (2000) investigated phylogenetic relation-

ships among European satyrines and the validity ofMillers (1968) classification as it related to those taxa,and although regional in scope, found paraphyly atthe higher taxonomic levels. The question of monophylyof the subfamily is equally ambiguous (Harvey, 1991).Neither Miller (1968) nor authors following him wereable to delineate the Satyrinae with synapomorphies(Ackery, 1984; Garca-Barros and Martn, 1991; Har-

vey, 1991). The enlarged forewing costal vein and theclosed hindwing discal cell are often cited as the definingcharacteristics, however there are numerous exceptions,and these traits are not unique to satyrines (Ackeryet al., 1999). One genus has been moved from Satyrinaeto Morphinae, and the placement of other genera isquestioned (Ackery, 1984; DeVries et al., 1985). Re-cently two molecular studies found a non-monophyleticSatyrinae. Brower (2000), based on limited satyrineexemplars within a larger Nymphalidae study and using

1055-7903/$ - see front matter 2004 Elsevier Inc. All rights reserved.

doi:10.1016/j.ympev.2004.08.014

* Corresponding author. Fax: +850 645 1323.E-mail address: [email protected] (D. Murray).

Molecular Phylogenetics and Evolution 34 (2005) 6780

MOLECULAR

PHYLOGENETICS

AND

EVOLUTION

www.elsevier.com/locate/ympev
mailto:[email protected]:[email protected]


2/14

one gene, found a polyphyletic Satyrinae, although onlyhis successive weighting tree produced resolution amongsatyrine taxa. Wahlberg et al. (2003) reported similarfindings based on fewer satyrine taxa but more genes.However, the authors concluded that more sampling isneeded to resolve relationships among Satyrinae and

its sister groups.The majority of satyrine species are found in the neo-tropics, represented by a small ancestral tribe, Haeterini,and two diverse Satyrini subtribes, Euptychiina andPronophilina. Historically, the two latter subtribes weredelineated in part based on geography (Miller, 1968),with euptychiines occurring in the lowlands and prono-philines in the highlands. Neither subtribe has been thesubject of a published phylogenetic study. Euptychiina,the focus of this work, currently includes over 300 speciesgrouped into 43 genera, 12 of which are monotypic. Spe-cies range from central United States to Argentina, occur-ring in all habitat types from lowlands to cloud forests.

Like most all satyrines, euptychiine host plants are exclu-sively monocots with one exception found in Euptychia.

The subtribe was circumscribed based on a few wing,antennal, and leg characters (Miller, 1968), but none un-ique to Euptychiina. Most euptychiine genera wereerected by Forster (1964) in his study of the Bolivian fau-na. However, he did not delineate the genera with diag-nostic characters, but instead referred to line drawingsof male genitalia, leaving it up to the reader to deduce gen-eric differences. No structural detail was shown in his fig-ures, suggesting he examined only overall grossmorphology, ignoring potentially informative characters.

The lack of diagnostic characters for the subtribe Eupty-chiina is compounded by the fact that Miller placed For-sters ill-defined genera within the subtribe withoutexamination, citing time constraints. Based on the ques-tionable taxonomic history of the Euptychiina, someauthors instead use Euptychia sensu lato or Cissia ascatch-all genera (DeVries, 1987; Emmel and Austin,1990). In addition to poorly delimited genera, no workhas addressed euptychiine interrelationships. The fewrevisions published have focused on a single genus (Mill-er, 1972, 1974, 1976, 1978) or species group (Singer et al.,1983), without information on higher level classificationnor the use of rigorous phylogenetic methods. In an effortto clarify euptychiine taxonomy, Lamas (unpublished), aspart of a larger project on neotropical butterflies, assem-bled an annotated checklist of euptychiine species, synon-omizing species and placing some within genera thatForster did not. However, his work was not based onintensive morphological study or phylogenetic analysis.

In summary, little is known of evolutionary relation-ships within Euptychiina. The general goal of this workis to advance our understanding of a poorly studied, di-verse group of organisms, the satyrines, with an intensestudy of one of the more speciose subtribes, the Eupty-chiina. In doing so, this paper presents the first phyloge-

netic analysis for the subtribe. DNA sequence data wereused to infer relationships among euptychiine genera,investigate monophyly of the delimited genera, and testmonophyly of the subtribe.

2. Materials and methods

2.1. Taxon sampling

Fifty-eight species of the butterfly subtribe Euptychi-ina, representing 28 genera, were included in this study(Table 1). Because the taxonomic status of many eupty-chiine groups is questionable, more than one exemplarwas included from 14 genera to explore hypotheses ofmonophyly. Samples suitable for DNA extraction werenot obtained for some euptychiine groups, includingseveral monotypic genera with narrowly distributed spe-cies. Species names follow Lamas (unpublished). Speci-

mens listed as nr could not be accurately placedwithin known species and likely represent new species.Basic taxonomic work is lacking for most euptychiinegroups, and undescribed species, synonyms, and unre-solved species groups are common.

Several satyrine outgroups were used in this study,representing all major groups in the subfamily. Higher le-vel relationships within the subfamily have not beentested, and the sister group to the euptychiines is un-known. Morphological studies (Miller, 1968; Murray,2001a) suggested that Haeterini is an ancestral satyrinetribe. Two exemplars from this tribe were used to root

the tree, Cithaerias pireta and Haetera piera. The remain-ing outgroups were not designated as such in analyses.From the diverse Satyrini tribe, representatives of thehigh Andean subtribe Pronophilina and Old World sub-tribe Ypthimina were selected. Ypthimina was hypothe-sized to be closely related to the Euptychiina (Miller,1968; Ackery, 1988). Two exemplars, one Asian (Ypt-hima confusa) and one African (Y. doleta), were included.Two representatives from the Pronophilina, Nelianemyroides and Neomaneus monachus, were also selected,as both this group and the euptychiines have been sepa-rated in part due to their geographic location (Miller,1968). Finally, representatives from two other putativeancestral tribes were included, Bicyclus madetes, B. fune-bris, Enodia portlandia and Lethe mekara from Elymini-ini and Melanitis leda from Biini. Preliminary analysessuggested that at least two euptychiine genera, Euptychiaand Oressinoma, diverged early in satyrine evolution andthese outgroups were included to explore those results.

2.2. Molecular methods

For most samples, field collected tissues were storedin 95% EtOH, preserving whole bodies or only abdo-mens and legs. DNA was extracted using a QIAGEN

68 D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 6780


3/14

Table 1Species examined in this study, their localities, and GenBank accession numbers

Tribe (Subtribe) species Collecting locality COI EF-1a

Outgroup

Haeterini (Haeterina)

Cithaerias pireta (Cramer) Ecuador: Napo Province AY508517 AY509045Haetera piera (Linnaeus) Peru: Madre de Dos Province AY508518 AY509046

Biini (Melanitina)Melanitis leda (Linnaeus) Australia: Queensland AY508560 AY509086

Elyminiini (Lethina)Enodia portlandia Fabricius USA: Louisiana AY508536 AY509062

Lethe mekaraa Moore Malaysia AY508550 AY509076Elyminiini (Mycalesina)

Bicyclus funebrisa Gueria-Meneville Ghana: Ashanti Region AY508520 AY509048Bicyclus madetes Hewitson Ghana: Ashanti Region TreeBaseb Treebaseb

Satyrini (Ypthimina)Ypthima confusaaShirozu and Shima Thailand: Chiang Mai Province AY508584 AY509109

Ypthima doletaa Kirby Ghana: Ashanti Region AY508585 AY509110Satyrini (Pronophilina)

Nelia nemyroidesa (Blanchard) Chile: Los Lagos Region AY508562 AY509088Neomaenas monachusa (Blanchard) Chile: Los Lagos Region AY508563 AY509089

IngroupSatyrini (Euptychiina)

Caeruleuptychia nr. caerulea Peru: Madre de Dos Province AY508522 AY509050

Caeruleuptychia coelicaa (Hewitson) Ecuador: Napo Province AY508524 AY509051Caeruleuptychia umbrosa (Butler) Ecuador: Napo Province AY508523Caeruleuptychia sp. Peru: Madre de Dos Province AY508521 AY509049

Cepheuptychia cephus (Fabricius) Ecuador: Napo Province AY508525 AY509052

Chloreuptychia agathaa (Butler) Ecuador: Napo Province AY508526 AY509053Chloreuptychia arnaca (Fabricius) Ecuador: Napo Province AY508527 AY509054Chloreuptychia heresis (Godart) Ecuador: Napo Province AY508528 AY509055Cissia confusa (Staudinger) Costa Rica: Heredia Province AY508532 AY509059

Cissia myncea (Cramer) Peru: Madre de Dos Province AY508556 AY509082Cissia penelope (Fabricius) Ecuador: Napo Province AY508530 AY509057

Cissia similis (Butler) Belize: Orange Walk District AY508529 AY509056Cissia terrestris (Butler) Peru: Madre de Dos Province AY508531 AY509058

Cissia sp. Ecuador: Pichincha Province AY508533Cyllopsis gemma (Hubner) USA: North Carolina AY508534 AY509060

Cyllopsis rogersi (Godman and Salvin) Costa Rica: Heredia Province AY508535 AY509061Erichthodes erichtho (Butler) Peru: Madre de Dos Province AY508537 AY509063Euptychia picea Butler Ecuador: Napo Province AY508542 AY509068Euptychia westwoodi Butler Costa Rica: Heredia Province AY508543 AY509069

Euptychia sp. Ecuador: Pichincha Province AY508541 AY509067Euptychoides albofasciataa (Hewitson) Ecuador: Sucumbios Province AY508540 AY509066

Euptychoides nossis (Hewitson) Ecuador: Pichincha Province AY508539 AY509065Euptychoides eugenia (C Felder and R Felder) Ecuador: Pichincha Province AY508538 AY509064

Forsterinaria boliviana (Godman) Ecuador: Pichincha Province AY508545 AY509071Forsterinaria inornata (C Felder and R Felder) Ecuador: Pichincha Province AY508544 AY509070Harjesia sp. Ecuador: Napo Province AY508546 AY509072Hermeuptychia harmonia (Butler) Ecuador: Pichincha Province AY508549 AY509075

Hermeuptychia hermes (Fabricius) Costa Rica: Puntarenas Province AY508548 AY509074

Hermeuptychia sosybius (Fabricius) USA: Louisiana AY508547 AY509073Magneuptychia alcinoe (C Felder and R Felder) Ecuador: Pichincha Province AY508551 AY509077Magneuptychia fugitiva Lamas 1997 Peru: Madre de Dos Province AY508552 AY509078

Magneuptychia nr lea Peru: Madre de Dos Province AY508554 AY509080Magneuptychia moderata (Weymer) Ecuador: Napo Province AY508553 AY509079

Magneuptychia tiessa (Hewitson) Ecuador: Pichincha Province AY508557 AY509083Magneuptychia sp. Ecuador: Napo Province AY508555 AY509081Megeuptychia antonoe (Cramer) Ecuador: Napo Province AY508559 AY509085Megisto cymela (Cramer) USA: Louisiana AY508558 AY509084

Neonympha areolata (J.E. Smith) USA: Louisiana AY508564 AY509090

Oressinoma sorata Salvin and Godman Ecuador: Pichincha Province AY508561 AY509087Paramacera allyni L.D. Miller USA: Arizona AY508565 AY509091Parataygetis lineata (Godman and Salvini) Ecuador: Pichincha Province AY508569 AY509095

Pareuptychia hesionides Forster Ecuador: Napo Province AY508567 AY509093

(continued on next page)

D. Murray, D.P. Prowell / Molecular Phylogenetics and Evolution 34 (2005) 6780 69


4/14

DNeasy Tissue Kit (QIAGEN, Valencia, CA) fromeither the thorax or the anterior abdomen. The remain-ing body and wings were kept as voucher material. For afew butterflies where no fresh material was available,DNA was extracted from dried specimens.

Two genes were selected, a mitochondrial gene, cyto-chrome oxidase I (COI) and a nuclear gene, elongationfactor-1a (EF-1a). Both have been used extensively ininsect molecular systematics (Caterino et al., 2000; Si-mon et al., 1994). COI was amplified using olgionucleo-tide primers as published in Simon et al. (1994) (forward

Ron = CI-J-1751, reverse Nancy = CI-N-2191; forwardJerry = CI-J-2183) with the exception of Pat2 (reverse50 TCCATTACATATAATCTGCCATATTAG). EF-1a primers were taken from Cho et al. (1995) (M3,rcM51-1, M46-1, rcM4). Reactions contained 2.5 UTaq DNA polymerase, 1.5 mM MgCl2, 200 lM dNTP,0.5 lM of each primer, and 15 ll of template DNA.Thermal conditions were 1 min denaturing at 95 C,1 min annealing at 45 C, and 1.5 min extension at72 C for 26 cycles, with a 5 min final extension at72 C. Samples were purified using QIAGEN PCR Puri-fication kit (QIAGEN, Valencia, CA).

Cleaned products were cycle-sequenced using floures-cent dye-labeled terminators (ABI Big Dye TerminatorCycle Sequencing Kit, Applied Biosystems, PerkinEl-mer) and then run on an ABI 377 sequencer. Amplifica-tion profile was 96 C for 15 s, 50 C for 20 s, and 60 Cfor 4 min, cycled 25 times. The resulting samples werecleaned using recommended manufacturing protocolfor ethanol precipitation. Samples were sequenced inboth directions to minimize base calling errors andambiguities. Aligning and editing of sequences were per-formed in SeqEd 1.0.3 (Applied Biosystems 1992).BLAST searches were conducted on all sequences tocheck for possible contamination.

For three samples extracted from dried specimens,recovered DNA material was low and sequences couldnot be obtained from the nuclear gene EF-1a. Sampleswere retained in the partitioned COI analyses and codedas missing data for combined analyses.

2.3. Phylogenetic analyses

Data were analyzed using three approaches, maxi-mum parsimony (MP), maximum likelihood (ML),and Bayesian inference. Parsimony analyses were per-

formed in PAUP* 4.0b10 (Swofford, 2002) using heuris-tic searches with tree-bisection-reconnection (TBR)branch swapping and 1000 random-addition sequencereplicates with 10 trees held at each step. Initially datasets were not weighted, but preliminary results and pre-vious studies have shown potential problems with COI,including saturation and rate heterogeneity. Potentialsaturation in the data set was assessed visually, plottingtransitions and transversions for each codon positionagainst genetic distance. When rates curves suggestedsaturation at the third codon position for COI, MPsearches were conducted with these sites removed and,as suggested by previous authors (Barker and Lanyon,2000; Griffiths, 1997; Reeder, 1995), with differentiallyweighted transitions with respect to transversions (ti:tv),here weighted as 1:2 and 1:3. Differing rates of nucleo-tide substitution among the two genes and codon posi-tion were also explored using ML.

Prior to maximum likelihood analyses, best-fit mod-els of nucleotide substitution were selected with likeli-hood ratio tests as implemented by Modeltest (version3.06) (Posada and Crandall, 1998). Models of evolutionand parameters were estimated for data partitioned bygene and also combined. For each likelihood ratio test,Modeltest selected the general time reversible model

Table 1 (continued)

Tribe (Subtribe) species Collecting locality COI EF-1a

Pareuptychia metaleuca (Boisduval) Ecuador: Pichincha Province AY508566 AY509092

Pareuptychia ocirrhoe (Fabricius) Ecuador: Napo Province AY508568 AY509094Pindis squamistrigaa R Felder Mexico: Guanajuato AY508570 AY509096

Posttaygetis penelea (Cramer) Ecuador: Napo Province AY508571 AY509097Pseudodebis marpessa (Hewitson) Peru: Madre de Dos Province AY508573 AY509099

Pseudodebis valentina (Cramer) Ecuador: Napo Province AY508574 AY509100Satyrotaygetis satyrina (H.W. Bates) Costa Rica: Puntarenas Province AY508575 AY509101

Splendeuptychia ashna (Hewitson) Peru: Madre de Dos Province AY508576 AY509102Splendeuptychia itonis (Hewitson) Ecuador: Napo Province AY508577

Taygetis celia (Cramer) Ecuador: Pichincha Province AY508572 AY509098Taygetis laches (Fabricius) Ecuador: Napo Province AY508581 AY509106

Taygetis puritana (A.G. Weeks) Ecuador: Pichincha Province AY508578 AY509103Taygetis sosis Hopffer Ecuador: Napo Province AY508580 AY509105

Taygetis virgilia (Cramer) Belize: Orange Walk District AY508579 AY509104Yphthimoides erigone (Butler) Ecuador: Napo Province AY508583 AY509108

Yphthimoides renata (Stoll) Belize: Orange Walk District AY508582 AY509107

Vouchers held by primary author except where noted.a Vouchers at Oregon State Arthropod Collection.b From Monteiro and Pierce (2001) data matrix submitted to TreeBase.



5/14

with variable sites assumed to follow a discrete gammadistribution and some sites assumed to be invariable(GTR + I + C) (Yang, 1994). ML searches were imple-mented in PAUP* using model parameters and theTBR branch swapping.

Bayesian analyses were conducted in MrBayes (Huel-

senbeck and Ronquist, 2001) under the GTR + I + Cmodel, using four Markov Chain Monte Carlo(MCMC) chains, three heated and one cold, and a ran-dom starting tree. Parameter values were not specifiedbut estimated as part of the analyses. To assess coverageof tree space, duplicate analyses continued for either100,000 or 1 million generations, with trees sampledevery 10 generations. Log likelihoods were viewedgraphically, and all trees before stationary were dis-carded as burn-in. If the resulting consensus trees fromduplicate analyses were in agreement, no more runs wereinitiated.

Bootstrap support values and posterior probabilities

were used to assess the robustness of the findings. Boot-strap values were computed from 1000 pseudoreplicatesrandomized 10 times with TBR addition sequence. Dueto computational time, calculations of bootstrap valuesunder the maximum likelihood criterion were conductedwith fast heuristic searches replicated 100 times. Withlarge replicates, fast bootstrapping produces similar re-sults as full bootstrapping methods (DeBry and Olm-stead, 2000; Mort et al., 2000).

Dataset congruence between gene partitions wastested using the partition homogeneity test (Swofford,2002), also referred to as the incongruence length differ-

ence (ILD) test (Farris et al., 1994) as implemented inPAUP*. Several recent papers have pointed out prob-lems with this test (Cunningham, 1997; Dowton andAustin, 2002), but it can be a useful measure of incon-gruence for data sets of equal size, as they are in thisstudy.

The Shimodairan Hasegawa test statistic (Goldmanet al., 2000; Shimodaria and Hasegawa, 1999) was usedto compare alternative phylogenetic hypotheses. Foreach analysis all topologies obtained were comparedsimultaneously to statistically test whether or not theywere significantly worse than the optimal ML tree.The SH tests were conducted in PAUP* using the RELL

(resampling estimated log-likelihood) method and 1000bootstrap replicates.

3. Results

3.1. Molecular characterization

A 1291 bp fragment of COI and a 1263 bp fragmentof EF-1a were sequenced, with 25 ambiguous sites fromthe fragment ends excluded from the data set. Base paircomposition of COI showed a strong AT bias (71%),typical for insect mitochondrial DNA (Clary and Wol-stenholme, 1985; Crozier and Crozier, 1993). Significantbase composition heterogeneity was found only at thethird codon position of COI. Relative rates of nucleotidesubstitution were greater for COI than EF-1a (Table 2),and more than two times faster at the third codon posi-tion. Second codon position nucleotides of EF-1a

showed the slowest rate of substitution and had fewerinformative sites than any other position for either gene.Overall average mean sequence divergence among in-group taxa for COI was 8.9% (excluding paraphyletictaxa), with intrageneric divergences of monophyleticgenera ranging from 0.05% to 7.2%. For EF-1a, se-quence divergences among the ingroup range from 3%to 9% (excluding paraphyletic taxa) and 0.015% forintrageneric comparisons (monophyletic genera only).

3.2. Combined analyses

An ILD test of the two genes failed to reject the nullhypothesis of homogeneity (P= 0.30). In a combinedgene data set, the subtribe Euptychiina was not foundto be monophyletic (Figs. 1 and 2). Euptychia speciesand Oressinoma sorata were excluded from the ingroup,strongly supported in Bayesian analysis (Table 3). Theunweighted MP analysis resulted in a soft polytomy atthe basal ingroup node. When weighting schemes wereimplemented, this was resolved to paraphyly of Eupty-chiina with both genera basal to the remaining ingroupand nodal support of 99%. When euptychiine mono-phyly was constrained, the unweighted MP tree lengthincreased by only eight steps (TL = 6581, CI = 0.243,

Table 2Base composition and variable sites by codon position

Gene Position A C G T v2 P Informative sites % CI Relative rate

COI First 0.297 0.158 0.228 0.317 22.396 1.000 100 23.6 0.294 0.559Second 0.191 0.241 0.147 0.422 5.832 1.000 27 6.38 0.463 0.092Third 0.395 0.074 0.010 0.521 527.724 0.000 352 83.21 0.184 3.446All 0.295 0.157 0.128 0.420 102.714 1.000 479 38.00 0.209 1.300

EF-1a First 0.247 0.305 0.175 0.273 76.351 1.000 22 5.30 0.470 0.134Second 0.284 0.177 0.383 0.156 11.279 1.000 10 2.41 0.616 0.051Third 0.173 0.357 0.192 0.277 147.123 0.996 317 76.39 0.293 1.698All 0.259 0.263 0.245 0.233 56.451 1.000 349 28.01 0.314 0.700



6/14

RI = 0.383). However, this topology and the MP treewere significantly worse explanations of the data thanthe others (diff ln L = 42.48, P< 0.016; diff lnL = 92.42, P6 0.000 respectively).

Although the non-monophyly of Euptychiina was aconsistent result, relationships among outgroups, the ex-cluded euptychiine genera, and among the most basalmembers of the ingroup remained poorly resolved. Be-cause distant outgroups could be affected by longbranch attraction (Felsenstein, 1978; Smith, 1994),resulting in erroneous groupings, C. pireta, H. piera,M. leda, E. portlandia, and L. mekara were sequentiallyremoved and the data set re-analyzed. Results showedreduced resolution among basal taxa and to a lesser ex-tent, among the ingroup taxa, but did not change therespective topologies and both O. sorata and Euptychia

species remained paraphyletic with respect to the in-group. Distant outgroups, then, did not appear to influ-ence erroneous pairings, but instead added phylogeneticsignal to the overall results, and in particular to the ba-sal groups.

Eight of the 14 euptychiine genera represented bymore than one species were polyphyletic or paraphyleticin all analyses of the combined data set (Table 4). Sixspecies were included from a particularly large genus,Magneuptychia, and none formed a monophyletic groupwith any other member. Similar evidence for artificialgroupings was found for the genera Cissia and Eupty-choides. Five euptychiine genera were well supportedas monophyletic in all analyses (Table 4). The one areaof incongruence revolved around Caeruleuptychia,weakly suggested as monophyletic in MP and ML anal-

Fig. 1. Phylogram of the majority rule consensus tree of 8000 trees after burn-in from a 100,000 step MCMC simulation based on combinedCOI + EF-1a data matrix. Bayesian posterior probabilities are given above nodes. Values below nodes are posterior probabilities when taxa withmissing data are removed from analysis. Outgroup taxa shown in bold. Dark bar marks putative ingroup. Exemplars marked with (*) areparaphyletic taxa. Shaded boxes mark clades.



7/14

yses. Because the disagreement in gene topologies couldhave been affected by missing data for Caeruleuptychiaumbrosa, this taxon and the other two taxa with missingdata for EF-1a were removed and the data re-analyzed.

Removal of the taxa did not resolve the question ofCaeruleuptychia monophyly, but did affect results underthe Bayesian method. Posterior probabilities wereslightly higher for many nodes, suggesting that the miss-

Fig. 2. Strict consensus of four most parsimonious trees (tree length = 6573, CI = 0.243, RI = 0.383) based on COI + EF-1 a data matrix andunweighted analysis. Bootstrap values above 50% shown on nodes. Dark bar marks putative ingroup clade. Outgroups shown in bold. Exemplarsmarked with (*) are paraphyletic taxa. Shaded boxes mark clades.

Table 3Paraphyletic taxa by partition and analysis

Taxa COIMP

COIML

COIBayes

EF-1aMP

EF-1aML

EF-1aBayes

CombineMP

CombineML

CombineBayes

Oressinoma sorataa 26 19 60 71 31 91 99c 35 92

Euptychia species 31 29 100 71 31 91 99c

35 92Paramacera allynia 26 0b 67Cyllopsis species 26

Cissia penelopea 0b 0b 60

Bootstrap and posterior probabilities percentages given for node with highest value that supports the exclusion of the taxon from the ingroup.a Tested with more than one individual.b Not found paraphyletic in bootstrap consensus tree.c From weighted analysis.



8/14

ing data contributed to some noise in the data set. Sig-nificantly, basal nodes near where Splendeuptychia itoniswas placed increased to 1.00PP (Fig. 1) and the nodeseparating Caeruleuptychia sp. + Caeruleuptychia umb-rosa from the remaining Cissia clade increased from0.78PP to 0.97PP. Topologies remained mostly un-changed except the Chloreuptychia + Cepheuptychiagroup was found to be sister to the Pareuptychia clade,a result that was more consistent with morphology.Conversely, removal of the taxa had no affect on MPtopologies or bootstrap values.

Within the ingroup three large lineages were recov-

ered, referred to as the Cissia, Pareuptychia, andTaygetis clades. Clades contained identical membersin all analyses and branching patterns were largely con-gruent within the clades. The Taygetis clade was mostcongruent and the Cissia clade most divergent, due tothe variable placement of Cissia terrestris and Caer-uleuptychia spp. Support for clades ranged from weak(ML analyses) to strong (Bayesian, all 1.00 PP).

3.3. Phylogenetic analysis based on individual genes

Individual gene phylogenies were generally congruentwith respect to several findings. Euptychiina was recov-ered as polyphyletic, the majority of the euptychiine gen-era were not monophyletic, and the three named cladeswere monophyletic, with one exception discussed below(Figs. 3 and 4). Regions of notable conflict between thegene phylogenies revolved around genera excluded fromthe ingroup, the monophyly of Caeruleuptychia andPseudodebis, and the placement of Yphthimoides renataand Euptychoides eugenia.

All single gene analyses, except EF-1a MP analysis,found other genera in addition to Euptychia speciesand O. sorata excluded from the ingroup (Table 3).COI MP analysis was most incongruent (Fig. 3), and

neither weighted analyses nor removal of third codonposition sites improved results.

All analyses produced congruent well supported re-sults for the monophyletic euptychiine genera (Table4) except for Caeruleuptychia, monophyletic in COIbut not EF-1a analyses, and Pseudodebis, weakly sug-gested as monophyletic only in COI Bayesian analysis.No analyses found any of the remaining seven testedeuptychiine genera monophyletic.

All analyses found the Taygetis, Pareuptychia, andCissia clades monophyletic except again the COI parti-tion under MP unweighted criteria. Differences were

confined to two exemplars, Yphthimoides renata andEuptychoides eugenia (Fig. 3). The placement of bothtaxa was unique, especially Y. renata, typically foundnear the base of the ingroup clustered with Megisto cym-ela. Weighted trees produced a topology more consistentwith ML and Bayesian analyses in this regard.

4. Discussion

This study represents the first phylogenetic analysis ofthe satyrine butterfly subtribe Euptychiina. Indeed, thisis the first significant contribution to understanding neo-tropical satyrine evolution, where two hyperdiverse sub-tribes, Pronophilina and Euptychiina, compose themajority of satyrine species. Both groups were hypothe-sized to have moved into South America from Paleotrop-ical origins as two independent radiations. Findings fromthis study suggest a more complex evolutionary historyfor the lowland satyrines than previously thought. Ram-pant paraphyly and polyphyly among euptychiine generademonstrate the great need for a species level revision ofthese butterflies. Diversification of the group is found inthree main lineages and these clades can serve as the basisfor future systematic inquiry.

Table 4Assessment of monophyly of euptychiine genera where more than one species of the genus is present in data set

Taxa COI MP COI ML COI Bayes E F-1a MP EF-1a ML EF-1a Bayes Combine MP Combine ML Combine Bayes

Caeruleuptychia 36 16 81 0 0 0 28 0a 0

Chloreuptychia 0 0 0 0 0 0 0 0 0

Cissia 0 0 0 0 0 0 0 0 0Cyllopsis 88 86 100 91 92 100 93 100 95

Euptychia 72 72 100 98 92 100 99 96 100Euptychoides 0 0 0 0 0 0 0 0 0Forsterinaria 100 100 100 100 100 100 100 100 100

Hermeuptychia 100 100 100 100 100 100 100 100 100

Magneuptychia 0 0 0 0 0 0 0 0 0Pareuptychia 93 92 100 97 100 100 100 100 100Pseudodebis 0 0 51 0 0 0 0 0 0

Splendeuptychia 0 0 0 ? ? ? 0 0 0

Taygetis 0 0 0 0 0 0 0 0 0Yphthimoides 0 0 0 0 0 0 0 0 0

Bootstrap percentages or posterior probabilities presented for monophyletic genera. A 0 indicates no support for monophyly found (i.e., para-phyletic or polyphyletic). Posterior probabilities given as percentages. A? designates missing data.

a Not found monophyletic in bootstrap consensus tree.



9/14

4.1. Monophyly of Euptychiina

A monophyletic Euptychiina was not recovered un-der any optimality criteria, data partition, or weightingscheme. Moreover, a constrained monophyletic Eupty-chiina was a significantly worse explanation of thedata. However, evidence for evolutionary relationshipsamong basal taxa was weak, and topologies were char-acterized by short internodes with little branch sup-port. The difficulty lies in resolving relationships ofthe euptychiine genera not found as members of the in-group, but with unknown relationships to other saty-rines. Increased outgroup sampling was included inan effort to break up long branches among these taxa,but this did not greatly increase basal phylogenetic res-olution. Nonetheless, the data suggest Oressinoma andEuptychia do not share a common ancestor with theremaining subtribe. Strongest support comes from the

exclusion of the nominant genus, Euptychia, with highposterior probabilities found in all analyses. In evaluat-ing the results, Bayesian posterior probabilities wereviewed with caution as the possibility of overinflatedvalues has been suggested in the literature (Alfaroet al., 2003; Douady et al., 2003). However, combinedweighted parsimony (99%) also strongly supportedthese results. The Euptychia clade was typically foundwith only the distant outgroups the Haeterini and M.leda as more basal and are as distant from the ingroup(12%) as they are from the outgroups (1213%), sug-gesting that Euptychia diverged early in satyrine evolu-tion. Oressinoma sorata was also consistently basal tothe ingroup, with more support for this result providedby the EF-1a data. Oressinoma is a small genus com-posed of two closely related species and is morpholog-ically distinct from other euptychiines, and neotropicalsatyrines in general, by having swollen medial and sub-

Fig. 3. Strict consensus of 25 most parsimonious trees (tree length = 4309, CI = 0.209, RI = 0.334) based on COI data matrix. Results incongruentwith respect to all other analyses. Bootstrap values above 50% shown on nodes. Dark bar marks putative ingroup clade. Outgroups shown in bold.Taxa marked with (*) paraphyletic. Shaded boxes illustrate clades.



10/14

medial but not costal veins on the forewing (Miller,1968; DeVries, 1987). Results from Murray (2001a)suggested long-branch attraction between C. penelopeand O. sorata in the COI data set, and problematicplacement of C. penelope is seen here as well, whereit clusters with either pronophiline outgroups or withother euptychiine genera, including Oressinoma, withina clade containing outgroups. Previous work has alsosuggested that Oressinoma is not closely related tothe euptychiines. Huelsenbeck et al. (2001) appliedBayesian analysis to the data set of Brower (2000)and found a polyphyletic Euptychiina. Although thetaxon sampling of euptychiines was low, Oressinomaclustered with another basal satyrine Tisiphone(0.83PP), while the remaining euptychiines were part

of a more derived clade containing other Satyrini sub-tribes (0.99PP). Brower (2000) found similar results inweighted parsimony analysis.

Correct resolution of the basal nodes may depend onthe addition of critical southern taxa. In a morphologi-cal analysis containing partial characters for representa-tives of several large Brazilian genera, Parythimoides,Moneuptychia, and Pharneuptychia, the genera clusteredwith other basal ingroup taxa (Murray, 2001a). In addi-tion, Yphthimoides is a large genus with most species en-demic to southern Brazil, as are most Pharneuptychia,Parythimoides, and Moneuptychia species. Therefore,an important biogeographical area is absent from thisstudy, and these taxa are linked to the basal node ofthe subtribe where resolution is weakest.

Fig. 4. Phylogram of the majority rule consensus tree of 8000 trees after burn-in from a 100,000 step MCMC simulation based on EF-1a data matrix.Bayesian posterior probabilities are given above nodes. Outgroup taxa shown in bold. Dark bar marks putative ingroup. Paraphyletic taxa markedwith a (*). Shaded boxes illustrate clades.



11/14

4.2. Relationships within Euptychiina

With one exception, all analyses recovered three ma-jor lineages containing identical members, labeled Cis-sia, Pareuptychia, and Taygetis clades. Certainmonophyletic groups were consistently recovered within

these clades and were well supported with high posteriorprobabilities and bootstrap values. However, little canbe surmised of the relationships among the clades them-selves. The Taygetis clade was most often basal to themore derived Pareuptychia and Cissia clades, but inter-nodes were extremely short and poorly supported.

Branching patterns were most congruent within theTaygetis clade. All members of this clade were once in-cluded within Taygetis until Forster (1964) split theminto several genera. Although many of his genera areartificial (i.e. Magneuptychia), at least some of the Tay-getis clade genera appear valid based on morphologicaldata (Murray, 2003). However, placement of Taygetiscelia and T. puritana within Pseudodebis renders thegenus paraphyletic. Both Taygetis and Pseudodebis aremorphologically similar, supported by only a few syna-pomorphies (Murray, 2001b), but molecular results sug-gest two distinct clades. Genetic distance between thetwo clades is on average 6.3% and within the two clades4.6 and 3.8%. Although Miller correctly surmised thatneither T. celia nor T. puritana belong within Taygetis(Miller personal communication), his proposed newgenus for these two species would still leave Pseudodebisparaphyletic by these results. One other genus formerlywithin Taygetis, Satyrotaygetis, is clearly not related to

the remaining group, and at least the nominant speciesis closely related to Magneuptychia tiessa, which appearsto be its South American replacement.

The namesake of the Pareuptychia clade, Pareupty-chia, is consistently well supported as monophyletic.Addition of other species within the genus also resultsin a robustly supported clade (data not shown). Thisgenus is united morphologically by atypical black eggcoloration, not known from any other satyrine groupor perhaps any butterfly species. The eggs are actuallytranslucent white as most euptychiine eggs, but darkento opaque black within 24 h and become indistinguish-able from parasitized euptychiine eggs (Murray,2001a). Support for other branching patterns withinthe Pareuptychia clade is weaker, with the exception ofS. satyrina + M. tiessa. One surprising result was thepolyphyly of the Euptychoides, a genus composed of10 species which are superficially similar and one ofthe few groups which have invaded the Andean cloudforests. When preliminary results suggested non-mono-phyly of the original two species, a third member was in-cluded, but this species failed to form a monophyleticclade with either of the other species. E. albofasciata ismost often sister to S. satyrina + M. tiessa, also foundwithin cloud forests. However the remaining species

are sister to lowland groups, suggesting multiple inva-sions into the more atypical higher altitude habitats.

The Cissia clade encompasses some of the more spec-iose Euptychiina genera. The clade is characterized bynumerous short internodes and poor support for inter-nal branching, especially basal nodes, indicative most

likely of rapid diversification within the clade and/orthe inadequate amount of sampling and genes to cor-rectly resolve relationships. The clade does not containany monophyletic genera except possibly Caeruleupty-chia, where monophyly is not resolved by the results.All other genera have exemplars found outside the clade.Therefore, they may be only distantly related to othermembers of their respective genera, an indication ofthe complex taxonomic problems within the group. Cis-sia is perhaps not the most apt name for this clade, giventhat the type species for the genus Cissia, C. penelope, isnot a member of the clade, but until the genera are taxo-nomically revised, the name will hold as many of the

members of this clade are generally Cissia-like. Singeret al. (1983) recognized several sub-groups within Cissiabased on larval data. Although they did not discusswhether or not the genus was monophyletic, they sepa-rated C. penelope from other Cissia species, results cor-roborated here. The robustly supported C.confusa + Cissia sp. + C. myncea + M. fugitiva cladecorresponds to one of their other sub-groups. C. pseudo-confusa also falls within this clade (data not shown).

As mentioned, basal relationships within the ingroupare unclear, but there are a few well supported clades.Cyllopsis + Paramacera is consistently well supported

and placed most often as sister to the remaining in-group. M. cymela is often sister to Y. renata + C. penel-ope, but support for this is much weaker.Hermeuptychia, a well supported monophyletic genus,is also often basal within the ingroup, sister to the restof the ingroup or sister to the Taygetis clade. However,support is lacking and placement is not consistent.Placement of other non-clade members is even more var-iable. These include species of Chloreuptychia, Ceph-euptychia, Magneuptychia, and Splendeuptychia.

Splendeuptychia itonis is often linked with Pindissquamistriga, a surprising result morphologically, butthis relationship is not supported. However, S. itonis isclearly not closely related to S. ashna, a result supportedby morphological evidence (Murray, 2001a). Splen-deuptychia is the most speciose Euptychiina genus, withan estimated 50 species (Lamas, unpublished), and ap-pears composed of two disparate groups, representedhere by S. itonis and S. ashna. Splendeuptychia ashnais well supported as a member of the Cissia clade, butthe placement of S. itonis is uncertain. Although bothare specialized feeders on bamboo, S. ashna is a detriti-vore on dead bamboo leaves on the forest floor (Mur-ray, 2001a). A detritivorous feeding habit is notknown among other satyrine butterflies.



12/14

4.3. Evolutionary history

Currently our knowledge of satyrine relationships issketchy, and hypotheses on the evolutionary origins ofneotropical satyrines remain highly speculative (Viloria,2003). Satyrines are thought to have originated in the

Neotropics during the Cretaceous (Miller, 1968), basedlargely on the endemic distribution of the purportedancestral satyrine tribe, Haeterini, in the neotropicsand the neotropical distribution of close relatives theBrassolinae and Morphinae. Grasses, an important hostfor satyrines, are also thought to have originated duringthe Cretaceous period and then diversified in the earlyTertiary, 6525 mya (Clark et al., 1995; Judziewiczet al., 1999). Although grasses may have played a vitalrole in the subsequent diversification of satyrines, earlygroups such as the Haeterini utilize other monocotswhich arose earlier than grasses. Few satyrine fossilsare known, but the fossil record suggests that by the Oli-

gocene, satyrines had become well established. The ear-liest known satyrine, an undescribed species near thetribe Elyminiini, dates from the lower middle Eocene,4851 mya (Durden and Rose, 1978). Satyrines fromthe subtribe Lethina are well represented in eastern Eur-ope from the upper Oligocene (Nel et al., 1993). How-ever, lacking a phylogenetic analysis of the subfamilyand resolution of satyrine monophyly, a neotropical ori-gin for the group cannot be evaluated.

What are the likely origins for euptychiine butter-flies? Miller (1968) hypothesized that the group colo-nized the neotropics from distant relatives in the

Paleotropics, or more specifically, from the earliestYpthimina butterflies. Support for a sister relationshipof the euptychiines and ypthimines was not found inthis study, although sampling among satyrines otherthan the focal group was sparse. Surprisingly, pronophi-lines were suggested as sister to the remaining ingroup,although results were complicated by inconsistent place-ment of paraphyletic taxa, i.e., P. allyni+ pronophi-lines. A close relationship between euptychiines andpronophilines has not been given consideration in theliterature and is not supported by morphology (Miller,1968; Viloria, 2003). Most likely this sister relationshipis an artifact of inadequate sampling. However, bothBrower (2000) and Huelsenbeck et al. (2001) in a re-analysis of Browers data, found a euptychiine + pron-ophiline clade.

The data do suggest an interesting pattern among themore ancestral members of the ingroup. Basal taxa areoverwhelmingly Nearctic in distribution. The Nearcticeuptychiine genera are represented by Neonympha, Meg-isto, Paramacera, Pindis, Cyllopsis, and Hermeuptychia.The latter two speciose genera have broad distributionsinto Central and South America, but the majority ofCyllopsis species are found in northern Central America.In the combined analyses, Cyllopsis + Paramacera are

suggested to be the sister clade to the remaining ingroup.Only Neonympha occupies a more derived placement inthe phylogeny, clustered with other members of thePareuptychia clade where species are neotropical in dis-tribution. Although extensive floral and faunal exchangefrom South America across the isthmus began after the

Pliocene (Marshall, 1985; Stehi and Webb, 1985), eupty-chiines likely had already diversified by this time.Among these genera, secondary invasion of the Nearcticwith the connection of the land bridge may have oc-curred only within Neonympha.

The nominant genus, Euptychia, was found basal tothe ingroup. Robustly supported as monophyletic in thisstudy, the genus is also supported by larval synapomor-phies and a highly unusual host (DeVries, 1987; Murray,2001a; Singer et al., 1983). All known hosts for satyrinesare monocots, except for Euptychia species and membersof a small Indo-Australian tribe, Ragadiini. The major-ity of hosts for these groups are members of Selaginell-

aceae, with a few Euptychia species also recorded fromBryopsida (mosses) (DeVries, 1985, 1987; Fukuda,1983; Murray, 2001a; Singer et al., 1971; Singer andMallet, 1985). Lycopsida is an archaic plant order dom-inant from the late Devonian to late Carboniferous peri-ods and represented today primarily by Selaginella.Although many insect orders were present during theCarboniferous period and some are thought to havefed on lycopsids (Kukalova-Peck, 1991), few speciesare recorded on them today (Mound et al., 1994). Saty-rines are the only Lepidoptera recorded using Selagi-nella as larval food plants.

Miller (1968) pointed out several distinctive featuresof ragadiines that set them apart from other satyrines,but was unsure of their systematic placement, believingthe group was intermediate between more ancestralsatyrines, the Elymniini, and the Satyrini, and felt thatEuptychiina (including Euptychia) was only distantly re-lated to Ragadiini. Considering that the data suggestEuptychia is only distantly related to the remaining sub-tribe, the intriguing hypothesis can be proposed of aclose relationship between the euptychiines and the rag-adiines based on novel host use. There is some supportfor this from larval morphology. Satyrines worldwideare conserved not only in gross morphology, but alsoin mouthparts and setal arrangements (Garca-Barros,1987; Murray, 2001a,b, 2003; Sourakov, 1996), there-fore the presence of large tubercles on the dorsum inboth Euptychia and Ragadia species is striking. Othershared traits include the extremely large stemma 3 andthe shape of the adfrontal suture and mandibles. How-ever, these similarities could be explained by conver-gences associated with a unique diet and not due tocommon ancestry. A close relationship of the ragadiinesand Euptychia species would involve a more complexbiogeographical scenario to the colonization of the trop-ical Americas than is currently hypothesized, and this



13/14

pattern may represent a deep gondwanian relationship.However, a better understanding of the biogeographicalhistory of Euptychia must await a comprehensive studyof higher level satyrine relationships.

Acknowledgments

We appreciate the assistance and support fromnumerous colleagues. We thank Chris Carlton, FredSheldon, and Andy Brower for comments on an earlierdraft of the manuscript. The Organization of TropicalStudies, Ro Bravo Research Station, Yasuni BiologicalStation, and Maquipucuna Research Station providedexcellent support during field collecting trips. We thankLee Miller and Gerardo Lamas for useful discussion onsatyrine taxonomy and evolution. This project was sup-ported by funds from the Department of Entomology atLouisiana State University, the Rice Endowment at

Oregon State University, the Organization for TropicalStudies, American Women in Science, Sigma Xi, andthe US Peace Corps. Many people also provided DNAmaterial and we are grateful to Jim Tuttle, Dan Lang,Andy Brower, Susan Pell, Chris Carlton and VictoriaMoseley. Murray also greatly appreciates the generosityof Andre Freitas for allowing her to examine his collec-tion of larvae.

References

Ackery, P.R., 1984. Systematic and faunistic studies on butterflies. In:Vane-Wright, R.I., Ackery, P.R. (Eds.), The Biology of Butterflies.Princeton University Press, Princeton, pp. 921.

Ackery, P.R., 1988. Hostplants and classification: a review ofnymphalid butterflies. Biological Journal of the Linnean Society33, 95203.

Ackery, P.R., de Jong, R., Vane-Wright, R.I., 1999. The butterflies:Hedyloidea, Hesperioidea and Papilionoidea. Handbook of Zool-ogy 4, 263300.

Alfaro, M.E., Zoller, S., Lutzoni, F., 2003. Bayes or bootstrap? ASimulation study comparing the performance of Bayesian MarkovChain Monte Carlo sampling and bootstrapping in assessingphylogenetic confidence. Molecular Biology and Evolution 20,255266.

Barker, F.K., Lanyon, S.M., 2000. The impact of parsimony weighting

schemes on inferred relationships among toucans and neotropicalbarbets (Aves: Piciformes). Molecular Phylogenetics and Evolution15, 215234.

Brower, A.V.Z., 2000. Phylogenetic relationships among the Nymp-halidae (Lepidoptera) inferred from partial sequences of thewingless gene. Proceedings of the Royal Society of London, SeriesB 267, 12011211.

Caterino, M.S., Cho, S., Sperling, F.A.H., 2000. The current state ofinsect molecular systematics: A thriving tower of babel. AnnualReview of Entomology 45, 154.

Cho, S., Mitchell, A., Regier, J.C., Mitter, C., Poole, R.W.,Friedlander, T.P., Zhao, S., 1995. A highly conserved nuclear genefor low-level phylogenetics: elongation factor-1a recovers mor-phology-based tree for Heliothine moths. Molecular Biology andEvolution 12, 650656.

Clark, L.G., Zhang, W., Wendel, J.F., 1995. A phylogeny of the grassfamily (Poaceae) based on ndnF sequence data. Systematic Botany20, 436460.

Clary, D.O., Wolstenholme, D.R., 1985. The mitochondrial DNAmolecule of Drosophila yakuba: Nucleotide sequence, gene organi-zation, and genetic code. Journal of Molecular Evolution 22, 252271.

Crozier, R.H., Crozier, Y.C., 1993. The mitochondrial genome of thehoneybee Apis mellifera: Complete sequence and genome organi-zation. Genetics 133, 97117.

Cunningham, C.W., 1997. Can three incongruence tests predict whendata should be combined?. Molecular Biology and Evolution 14,733740.

DeBry, R.W., Olmstead, R.G., 2000. A simulation study of reducedtree-search effort in bootstrap resampling analysis. SystematicBiology 49, 171179.

de Jong, R., Vane-Wright, R.I., Ackery, P.R., 1996. The higherclassification of butterflies (Lepidoptera): problems and prospects.Entomologica Scandinavica 27, 65101.

DeVries, P.J., 1985. Hostplant records and natural history notes onCosta Rican butterflies (Papilionidae, Pieridae & Nymphalidae).Journal of Research on the Lepidoptera 24, 290333.

DeVries, P.J., 1987. The butterflies of Costa Rica and their naturalhistory, vol. I: Papilionidae, Pieridae, and Nymphalidae. PrincetonUniversity Press, Princeton.

DeVries, P.J., Kitching, I.J., Vane-Wright, R.I., 1985. The systematicposition of Antirrhea and Caerois, with comments on the classi-fication of the Nymphalidae (Lepidoptera). Systematic Entomol-ogy 10, 1132.

Douady, C.J., Delsuc, F., Boucher, Y., Doolittle, W.F., Douzery, E.,2003. Comparison of Bayesian and maximum likelihood bootstrapmeasures of phylogenetic reliability. Molecular Biology and Evo-lution 20, 248254.

Dowton, M., Austin, A.D., 2002. Increased congruence does notnecessarily indicate increased phylogenetic accuracy. The behaviorof the incongruence length difference test in mixed-model analyses.Systematic Biology 51, 1931.

Durden, C.J., Rose, H., 1978. Butterflies from the Middle Eocene: theearliest occurrence of fossil Papilionoidea. Pierce-Sellards Series ofthe Texas Memorial Museum 29, 125.

Ehrlich, P.R., 1958. The comparative morphology, phylogeny andhigher classification of the butterflies (Lepidoptera: Papilionoidea).University of Kansas Science Bulletin 39, 307370.

Emmel, T.C., Austin, G.T., 1990. The tropical rain forest butterflyfauna of Rondonia, Brazil: Species diversity and conservation.Tropical Lepidoptera 1, 112.

Farris, J.S., Kallersjo, M., Kluge, A.G., Bult, C., 1994. Testingsignificance of incongruence. Cladistics 10, 315320.

Felsenstein, J., 1978. Cases in which parsimony or compatibilitymethods will be positively misleading. Systematic Zoology 27, 401410.

Forster, V.W., 1964. Beitrage zur Kenntnis der Insektenfauna Boliv-

iens XIX. Veroffentlichungen der Zoologischen Staatssammlung,Munchen 8, 51188.Fukuda, H., 1983. Life histories of two satyrid butterflies feeding on

selaginellas. Tyo to Ga 33, 132144.Garca-Barros, E., 1987. Morphology and chaetotaxy of the first

larvae of six species of the Satyrus series (Lepidoptera: Nymphal-idae). Systematic Entomology 12, 332344.

Garca-Barros, E., Martn, J., 1991. Immature stages of HipparchiaFabricius and the systematics of the Satyrus series (Lepidoptera:Nymphalidae: Satyrinae). Systematic Entomology 16, 407426.

Goldman, N., Anderson, J., Rodrigo, A., 2000. Likelihood-based testsof topologies in phylogenetics. Systematic Biology 49, 652670.

Griffiths, C.S., 1997. Correlation of functional domains and rates ofnucleotide substitution in cytochrome b. Molecular Phylogeneticsand Evolution 7, 352365.



14/14

Harvey, D.J., 1991. Higher classification of the Nymphalidae. In:Nijhout, H.F. (Ed.), The Development and Evolution of ButterflyWing Patterns. Smithsonian Institution Press, Washington DC, pp.259274.

Huelsenbeck, J.P., Ronquist, F., 2001. MrBayes: Bayesian inference ofphylogenetic trees. Bioinformatics 17, 754755.

Huelsenbeck, J.P., Ronquist, F., Nielsen, R., 2001. Bayesian inferenceof phylogeny and its impact on evolutionary biology. Science 294,23102314.

Judziewicz, E.J., Clark, L.G., Londono, X., Stern, P., 1999. AmericanBamboos. Smithsonian Institution Press, Washington D.C.

Kristensen, N.P., 1976. Remarks on the family-level phylogeny ofbutterflies. Zeitschrift fuer Zoologische Systematic und Evolu-tionsforschung 14, 2533.

Kukalova-Peck, J., 1991. Fossil history and the evolution of hexapodstructures. In: The Insects of Australia. Melbourne UniversityPress, Melbourne, pp. 141179.

Marshall, L.G., 1985. Geochronology and land-mammal biochronol-ogy of the trans-American faunal interchange. In: Stehli, F.G.,Webb, S.D. (Eds.), The Great American Biotic Interchange.Plenum Press, New York, pp. 4985.

Martn, J.F., Gilles, A., Descimon, H., 2000. Molecular phylogeny andevolutionary patterns of the European satyrids (Lepidoptera:Satyridae) as revealed by mitochondrial gene sequences. MolecularPhylogenetics and Evolution 15, 7082.

Miller, L.D., 1968. The higher classification, phylogeny and zoogeog-raphy of the Satyridae (Lepidoptera). Memoirs of the AmericanEntomological Society 24, 1174.

Miller, L.D., 1972. Revision of the Euptychiini (Satyridae): 1.Introduction and Paramacera Butler. Bulletin of the AllynMuseum 8, 118.

Miller, L.D., 1974. Revision of the Euptchiini (Satyridae): 2. CyllopsisR. Felder. Bulletin of the Allyn Museum 20, 198.

Miller, L.D., 1976. Revision of the Euptychiini (Satyridae): 3. MegistoHubner. Bulletin of the Allyn Museum 33, 123.

Miller, L.D., 1978. Revision of the Euptychiini (Satyridae): 4. PindisR. Felder. Bulletin of the Allyn Museum 50, 112.

Mort, M.E., Soltis, P.E., Soltis, D.E., Mabry, M.L., 2000. Comparisonof three methods for estimating internal support on phylogenetictrees. Systematic Biology 49, 160171.

Mound, L.A., Martin, J.H., Polaszek, A., 1994. The insect fauna ofSelaginella (Pteridophyta: Lycopsida), with description of threenew species. Journal of Natural History 28, 14031415.

Murray, D.L., 2001. Systematics of euptychiine butterflies (Nymphal-idae: Satyrinae: Euptychiina) based on larval morphology andDNA sequence data and the evolution of life history traits. Ph.D.dissertation, Louisiana State University, Baton Rouge, LA.

Murray, D.L., 2001b. Immature stages and biology of TaygetisHubner (Lepidoptera: Nymphalidae). Proceedings of the Entomo-logical Society of Washington 103, 932945.

Murray, D.L., 2003. Immature stages and biology of Posttaygetispenelea Cramer (Lepidoptera: Nymphalidae: Satyrinae). Proceed-ings of the Entomological Society of Washington 105, 548554.

Nel, A., Nel, J., Balme, C., 1993. Un nouveau Lepidoptere Satyrinaefossile de lOligocene du Sud-Est de la France (Insecta, Lepidoptera,

Nymphalidae). Linneana Belgica 14, 2036.Posada, D., Crandall, K.A., 1998. Modeltest: Testing the model of

DNA substitution. Bioinformatics 14, 271275.Reeder, T.W., 1995. Phylogenetic relationships among Phrynosomatid

lizards as inferred from mitochondrial ribosomal DNA sequences:Substitutional bias and information content of transitions relativeto transversions. Molecular Phylogenetics and Evolution 4, 203222.

Shimodaria, H., Hasegawa, M., 1999. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. MolecularBiology and Evolution 13, 964969.

Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P.,1994. Evolution, weighting, and phylogenetic utility of mitochon-drial gene sequences and a compilation of conserved polymerasechain reaction primers. Annals of the Entomological Society ofAmerica 87, 651701.

Singer, M.C., Mallet, J., 1985. Moss-feeding by a Satyrinae butterfly.Journal of Research on the Lepidoptera 24, 392.

Singer, M.C., Ehrlich, P.R., Gilbert, L.E., 1971. Butterfly feeding onlycopsid. Science 172, 13411342.

Singer, M.C., DeVries, P.J., Ehrlich, P.R., 1983. The Cissia confusaspecies-group in Costa Rica and Trinidad (Lepidoptera: Satyrinae).Zoological Journal of the Linnean Society 79, 101119.

Smith, A.B., 1994. Rooting molecular trees: Problems and strategies.Biological Journal of the Linnean Society 51, 279292.

Sourakov, A., 1996. Notes on the genus Calisto with descriptions ofthe immature stages (Part 1) (Lepidoptera: Nymphalidae: Satyri-nae). Tropical Lepidoptera 7, 91112.

Stehi, F.G., Webb, S.D., 1985. A kaleidoscope of plates, faunal andfloral dispersals, and sea level changes. In: Stehi, F.G., Webb, S.D.(Eds.), The Great American Biotic Interchange. Plenum Press, NewYork, pp. 36.

Swofford, D.L., 2002. PAUP* Phylogenetic analysis using parsimonyand other methods. Test version 4.0b5. Sinauer, Sunderland, MA.Viloria, A., 2003. Historical biogeography and the origins of the

satyrine butterflies of the tropical Andes (Lepidoptera: Rhopalo-cera). In: Morrone, J.J., Bousquets, J.L. (Eds.), Una PerspectivaLatinoamericana de la Biogeografa. Las Prensas de Ciencias,Facultad de Ciencias Mexico City, pp. 247261.

Wahlberg, N., Weingartner, E., Nylin, S., 2003. Towards a betterunderstanding of the higher systematics of Nymphalidae (Lepi-doptera: Papilionoidea). Molecular Phylogenetics and Evolution28, 473484.

Yang, Z., 1994. Estimating the pattern of nucleotide substitution.Journal of Molecular Evolution 39, 105111.


Documents

Murray&ProwellMPE===Molecular Phylogenetics and Evolutionary