Embed Size (px)
Citation preview
UNIVERSIDADE FEDERAL DO RIO GRANDE DO SUL
CENTRO DE BIOTECNOLOGIA
PROGRAMA DE PÓS-GRADUAÇÃO EM BIOLOGIA CELULAR E MOLECULAR
A chiquimato desidrogenase de Mycobacterium tuberculosis:
mutagênese sítio-direcionada, expressão, purificação e
caracterização da enzima mutante K69A
Valnês da Silva Rodrigues Junior
Orientador: Prof. Dr. Luiz Augusto Basso
Dissertação submetida ao Programa de Pós-graduação em Biologia Celular e Molecular do Centro de Biotecnologia da UFRGS como pré-requisito para a obtenção do grau de Mestre.
Porto Alegre, junho de 2008
2
Este trabalho foi desenvolvido no Centro de Pesquisas em Biologia
Molecular e Funcional (CPBMF) da Pontifícia Universidade Católica do Rio
Grande do Sul.
Agências Financiadoras:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES);
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq);
Programa Millennium, Ministério da Ciência e Tecnologia – CNPq;
Ministério da Saúde – Departamento de Ciência e Tecnologia – UNESCO.
3
AGRADECIMENTOS
Aos meus orientadores, Diógenes Santiago Santos e Luiz Augusto
Basso pela confiança depositada e pelo apoio intelectual sempre prestado;
À minha comissão de acompanhamento, Professora Jeniffer Saffi e, em
especial, ao Professor Giancarlo Pasquali, pela atenção e pela cuidadosa
revisão desta dissertação;
Aos Professores Arthur G. Fett Neto e Jeverson Frazzon pela revisão
dos manuscritos e sugestões;
Aos colegas e amigos do CPBMF, pela amizade, companheirismo, e por
serem exemplo concreto de equipe de trabalho: Ana Letícia, Ana Paula, Anne,
Adriana, Adriano, Ardala, Bruna, Cândida, Christiano, Cristiane, Cristopher,
Clarissa, Cláudia, Daiana, Ekaterine, Eraldo, Fábio, Fernanda, Gaby, Gisele,
Glecy, Heique, Isabel, Jacqueline, Jocelei, Jordana, Juleane, Léia, Leonardo,
Luís, Nani, Igor, Paula, Paulo, Priscila, Raquel, Renilda, Rodrigo, Sara, Thiago,
Zé Eduardo;
À Sílvia e ao Luciano pela gentileza e atenção;
A todos os meus amigos e familiares pelas sinceras demonstrações de
apoio e carinho;
Por fim, e mais importante, aos meus pais, Dilza e Valnês, por todo o
amor e dedicação.
4
ÍNDICE
1 INTRODUÇÃO........................................................................................10
1.1 Tuberculose................................................................................10
1.2 Via do ácido chiquímico.............................................................16
1.3 Chiquimato desidrogenase........................................................18
2 OBJETIVOS............................................................................................24
3 MÉTODOS E RESULTADOS.................................................................25
3.1 Planejamento das mutações.....................................................26
3.2 Manuscrito 1................................................................................28
3.3 Manuscrito 2................................................................................61
4 DISCUSSÃO...........................................................................................73
4.1 Mutagênese sítio-direcionada do gene aroE...........................73
4.2 Super-expressão das proteínas mutantes...............................75
4.3 Purificação da enzima mutante K69A.......................................78
4.4 Caracterização da enzima mutante K69A.................................80
5 REFERÊNCIAS BIBLIOGRÁFICAS.......................................................84
6 ANEXOS.................................................................................................94
6.1 Alinhamentos de sequências de chiquimato
desidrogenases................................................................................................94
6.2 Seqüência de aminoácidos da MtbSD......................................99
6.3 Seqüência de nucleotídeos do gene aroE..............................100
6.4 Géis de agarose a 2 % com as mutações realizadas............101
6.5 Carta de submissão do artigo “Screening of experimental
conditions to express soluble shikimate dehydrogenase mutants from
5
Mycobacterium tuberculosis H37Rv” à revista Protein Expression and
Purification.....................................................................................................102
6.6 Carta de submissão do artigo “The conserved Lysine 69
residue plays a catalytic role in Mycobacterium tuberculosis shikimate
dehydrogenase” à revista Journal of Bacteriology....................................103
6
LISTA DE ABREVIATURAS
DHQ-SD – desidroquinato desidratase-chiquimato desidrogenase;
DHS – 3-desidrochiquimato;
DNA – ácido desoxirribunucléico;
DOTS - Directly Observed Treatment Short-course;
HIV – vírus da imunodeficiência humana;
IPTG – isopropil-beta-D-tiogalactopiranosídeo;
Kcat – constante catalítica;
Kcat/Km – eficiência catalítica;
Kd – constante de dissociação;
kDa – quilodaltons;
Km – constante de Michaelis-Menten;
LB – Luria-Bertani;
MDR-TB – cepa de Mycobacterium tuberculosis resistente a múltiplas drogas;
MtbSD – chiquimato desidrogenase de Mycobacterium tuberculosis;
NADP+ - nicotinamida adenina dinucleotídeo fosfato, forma oxidada;
NADPH – nicotinamida adenina dinucleotídeo fosfato, forma reduzida;
OMS – Organização Mundial da Saúde;
PCR – reação em cadeia da DNA polimerase;
SD – chiquimato desidrogenase;
SDS-PAGE – eletroforese em gel de poliacrilamida sob condições
desnaturantes com dodecil sulfato de sódio;
SHK – chiquimato ou ácido chiquímico;
TB – tuberculose;
7
Vmáx – velocidade máxima de reação;
XDR-TB – tuberculose extensivamente resistente;
8
RESUMO
As enzimas da via do chiquimato são alvos atraentes para o
desenvolvimento de agentes para tratar a tuberculose já que esta via é
essencial para Mycobacterium tuberculosis e está ausente em humanos. A
enzima chiquimato desidrogenase de M. tuberculosis (MtbSD), codificada pelo
gene aroE, catalisa a quarta reação na via do chiquimato. Estudos de estrutura
tridimensional, de perfis de pH e de mutagênese sítio-direcionada envolvendo
muitas chiquimato desidrogenases sugerem a participação da Lisina-69 e do
Aspartato-105 (numeração de acordo com a seqüência da MtbSD) na catálise
e/ou na ligação ao substrato. A determinação das propriedades cinéticas de
enzimas mutantes pode permitir importantes proposições acerca do papel
destes resíduos para a enzima MtbSD. A mutagênese foi realizada usando
uma técnica de amplificação por PCR para as seguintes proteínas mutantes:
K69A, K69H, K69I, K69Q, D105A, D105N. Testes de diversas condições
experimentais foram feitos para obter a expressão das proteínas MtbSD
mutantes na fração solúvel. Além disso, empregamos um protocolo de
purificação otimizado para obter as enzimas MtbSD não mutante e K69A
aparentemente homogêneas. Realizamos ensaios cinéticos em estado
estacionário e medidas espectrofluorimétricas destas duas enzimas, e os
resultados indicam que o resíduo conservado Lisina-69 tem função catalítica e
não está envolvido na ligação ao substrato para a MtbSD. Estudos estruturais,
de mutagênese sítio-direcionada e de cinética enzimática podem trazer
importantes contribuições para o desenho racional de novos e efetivos
fármacos para tratar a tuberculose.
9
ABSTRACT
The shikimate pathway is an attractive target for the development of
antitubercular agents because it is essential in Mycobacterium tuberculosis but
absent in humans. Mycobacterium tuberculosis aroE-encoded shikimate
dehydrogenase (MtbSD) catalyzes the forth reaction in the shikimate pathway.
Three-dimensional structure studies, pH-rate profiles and site-directed
mutagenesis studies involving many shikimate dehydrogenases have
suggested participation of Lysine-69 and Aspartate-105 (M. tuberculosis
numbering) in catalysis and/or substrate binding. Importantly, investigation of
the kinetic properties of mutant enzymes can bring important insights about the
role of these residues for the MtbSD enzyme. Mutagenesis was performed
using a PCR-amplification technique for the following mutant proteins: K69A,
K69H, K69I, K69Q, D105A, D105N. Screening of experimental conditions has
been performed to obtain the expression of the MtbSD mutant proteins in the
soluble fraction. In addition, an improved purification protocol was used to
obtain homogeneous wild-type MtbSD and K69A mutant enzymes. We have
carried out steady-state kinetic assays and spectrofluorimetric measurements
for the wild type and the K69A enzymes. Results indicate that the conserved
Lysine-69 residue in MtbSD plays a catalytic role and is not involved in
substrate binding. Enzyme kinetics, site-directed mutagenesis and structural
studies provide a framework on which to base the rational design of new and
effective agents to treat tuberculosis.
10
1 INTRODUÇÃO
1.1 Tuberculose
A tuberculose (TB) humana é uma doença infecto-contagiosa causada
principalmente pelo bacilo Mycobacterium tuberculosis, uma bactéria aeróbica
que causa infecção usualmente nos pulmões (COLE et al., 1998). A TB foi
responsável por milhões de mortes no passado, quando não existia tratamento
adequado para a doença e se desconhecia seu agente causal. No século XIX,
a TB foi uma doença avassaladora, com altas taxas de transmissão e que
levava a um número de mortes muito elevado. Esta época corresponde ao
início da revolução industrial, onde houve o surgimento dos aglomerados
urbanos, muitas vezes sem estruturas de higiene e habitação, o que
colaborava para a disseminação e o estabelecimento de inúmeras doenças,
dentre elas a TB (DORMANDY, 2002). Na Inglaterra vitoriana, a TB foi
romantizada e suas vítimas se tornaram padrão de beleza dada a esqualidez e
a brancura pálida e também porque já não era uma doença exclusiva das
camadas pobres, atingindo, inclusive, muitos intelectuais da época (DUCATI et
al., 2006).
Somente em 1882, o médico e bacteriologista alemão Robert Koch
tornou pública a identificação do M. tuberculosis como agente etiológico da TB,
durante o IV Congresso Mundial de TB (KAUFMANN et al., 2003). O M.
tuberculosis é geralmente transmitido entre os indivíduos através do ar por
aerossóis que contêm o bacilo. Essas pequenas gotículas podem permanecer
por longos períodos de tempo em ambientes fechados. Quando inalada, a
micobactéria é fagocitada pelos macrófagos alveolares nos bronquíolos
11
respiratórios e nos alvéolos. O bacilo inalado poderá ou não estabelecer a
infecção e isso dependerá da virulência bacteriana e da capacidade bactericida
dos macrófagos do hospedeiro (DUNLAP et al., 2000).
A descoberta da estreptomicina, em 1944, marcou a era de ouro no
desenvolvimento de drogas para tratar a TB; a seguir, outros fármacos usados
atualmente no tratamento da doença foram introduzidos, são eles: ácido p-
aminosalicílico (1946), isoniazida (1952), ciclosserina (1955), canamicina
(1957), rifampicina (1965), etionamida (1966), etambutol (1968) e pirazinamida
(1970) (DUNCAN, 2003). O desenvolvimento destes fármacos e o emprego de
medidas profiláticas proporcionaram uma diminuição no número de mortes, que
se manteve por algumas décadas (BLOOM e MURRAY, 1992; DANIEL, 1997)
Contudo, a TB ressurgiu com força e é, atualmente, considerada a
principal causa de morte devido a um único agente infeccioso (ENARSON e
MURRAY, 1996). A epidemia do vírus da imunodeficiência humana (HIV), a
deterioração dos programas de saúde pública visando o controle da TB, a
multiplicação de aglomerados urbanos sem estrutura sanitária e o número
elevado de pessoas sem moradia são alguns dos fatores apontados como
responsáveis pelo aumento dos números de TB em muitos países, inclusive
desenvolvidos (BLOOM e MURRAY, 1998). Em 1993, a Organização Mundial
da Saúde (OMS) declarou a TB como emergência de saúde global, estimando-
se que um terço da população humana esteja infectada pelo bacilo e que na
última década 30 milhões de pessoas morreram desta doença (CORBETT et
al., 2003; DYE et al., 1999). Outros números mostram que 9 milhões de
pessoas são infectadas com o bacilo anualmente, o que leva a 2 milhões de
mortes, principalmente na África e na Ásia (WHO, 2006).
12
Assim, a TB permanece como uma das principais causas de morte em
todo o mundo devido, também, à grande capacidade de adaptação do bacilo,
que consegue sobreviver a variadas condições dentro e fora do hospedeiro
humano. O M. tuberculosis tem sido apontado como o patógeno de maior
sucesso no planeta, de todos os tempos, conseguindo muitas vezes
permanecer silencioso e latente dentro do hospedeiro, desviando das defesas
do sistema imune (ENSERINK, 2001; WICKELGREN, 2000). O bacilo pode
permanecer dormente até que as defesas do hospedeiro sejam diminuídas
como no caso da infecção pelo HIV e por imunossupressão por fármacos. Com
o aumento no número de infectados com o HIV, torna-se preocupante o
numero de hospedeiros ativamente contaminados e capazes de transmitir a
doença (MANABE e BISHAI, 2000).
TB e HIV são tão proximamente relacionados que o termo co-epidemia
tem sido usado para descrever sua relação. A taxa de reativação da TB latente
em pessoas imunocompetentes é de 0,2 % por ano. Já em pacientes com HIV,
este risco de reativação da TB latente pode chegar até 13,3 % ao ano,
dependendo do nível de imunossupressão (KNIGGE et al., 2000). Pacientes
HIV-poitivos que são infectados com TB desenvolvem a TB ativa em uma tava
de 37 % nos primeiros 6 meses; já nos pacientes imunocompetentes, essa taxa
é de até 5 % nos dois primeiros anos. Além disso, pacientes HIV-positivos
apresentam mal-absorção de algumas drogas, talvez devido à enteropatia
relacionada ao HIV, o que pode comprometer os tratamentos da TB e também
levar ao surgimento de cepas resistentes a fármacos usados para tratar a TB
(SEPKOWITZ, 1995).
13
O tratamento da TB teve melhoria significativa com a expansão do
programa Directly Observed Treatment Short-course (DOTS), que combina
compromisso político, serviços de microscopia, suprimento de medicamentos,
sistemas de monitoramento e observação direta ao tratamento (PASQUALOTO
e FERREIRA, 2001). Atualmente, o tratamento recomendado pela OMS
consiste na administração combinada dos fármacos isoniazida, rifampicina,
pirazinamida e etambutol durante dois meses. O tratamento deve prosseguir
por mais quatro meses, quando se administra isoniazida e rifampicina.
Infelizmente, alguns países não conseguem implantar o programa DOTS para
a totalidade dos seus pacientes, reforçando a hipótese de que tratamentos
mais curtos e com menores efeitos colaterais melhorariam a adesão do
paciente e isso levaria a uma maior eficácia no tratamento da TB (DUNCAN,
2003).
De fato, tratamentos inapropriados e a não adesão do paciente ao
tratamento são comumente associados com a emergência de cepas de TB
resistentes a múltiplas drogas (MDR-TB), cujos isolados são resistentes a pelo
menos isoniazida e rifampicina, dois dos principais fármacos usados no
tratamento padrão da TB (DUNCAN, 2003; BASSO e BLANCHARD, 1998).
Pacientes com MDR-TB devem ser tratados com uma combinação de
drogas de segunda linha que, além de serem significativamente mais caras,
possuem mais efeitos tóxicos e são menos efetivas que as drogas de primeira
linha (O’BRIEN e NUNN, 2001). Em países industrializados, o tratamento
normal custa em torno de 2.000 dólares por paciente, mas alcança 250.000
dólares para pacientes com MDR-TB (PASQUALOTO e FERREIRA, 2001).
14
Casos de coinfecção de HIV e MDR-TB alcançam taxas de mortalidade
próximas a 100 %, e esta é definida como a infecção oportunista mais maligna
associada à AIDS (FÄTKENHEUER et al., 1999). Cerca de 300.000 novos
casos de MDR-TB são diagnosticados a cada ano, sendo que de 4 a 20 %
destes são classificados como TB extensivamente resistente (XDR-TB),
definida como casos de TB cujos isolados são resistentes à isoniazida,
rifampicina e a pelo menos três das seis principais classes de drogas de
segunda linha (aminoglicosídeos, polipetídeos, fluoroquinolonas, tiamidas,
ciclosserina e ácido p-aminosalicílico) (DORMAN e CHAISSON, 2007; CDC,
2006). XDR-TB está sendo relatada em todo o mundo, inclusive nos Estados
Unidos, onde a TB estava sendo considerada sob controle. A ocorrência já
difundida de XDR-TB traz discussões sobre a drástica situação de casos de TB
virtualmente incuráveis e aponta para a urgente necessidade de introduzir
novos e eficazes fármacos anti-TB (DORMAN e CHAISSON, 2007).
Já se passaram quase 40 anos desde a introdução da última droga para
tratar a TB. Estima-se que o desenvolvimento completo de uma nova droga
anti-TB custe de 100 a 800 milhões de dólares (DUNCAN, 2003).
Considerando-se que 95 % dos casos de TB ocorram em países
subdesenvolvidos e em desenvolvimento, a indústria farmacêutica parece não
estar suficientemente atraída, em termos financeiros, para o desenvolvimento
de novos fármacos para tratar a TB (O’BRIEN e NUNN, 2001).
Em 1998, Stewart Cole e colaboradores publicaram a seqüência
completa do genoma de M. tuberculosis (COLE et al., 1998) proporcionando
novas abordagens de pesquisas sobre este microrganismo e, até mesmo,
15
abrindo perspectivas para o futuro desenvolvimento de fármacos para tratar a
TB.
16
1.2 Via do ácido chiquímico
A via do ácido chiquímico (Figura 1) liga o metabolismo dos carboidratos
com a biossíntese de compostos aromáticos, convertendo eritrose-4-fosfato em
corismato, que é o precursor para a síntese de metabólitos importantes como
aminoácidos aromáticos, ubiquinona e folato (PARISH e STOKER, 2002). Esta
via é essencial no metabolismo de algas, plantas, bactérias, parasitos do filo
Apicomplexa e fungos, mas é ausente em mamíferos (BENTLEY, 1990;
ROBERTS et al., 1998). Assim, as enzimas desta via recebem muita atenção
como potenciais alvos para o desenvolvimento de fármacos antimicrobianos
não tóxicos, herbicidas e drogas antiparasitárias (COGGINS et al., 2003). Um
grande exemplo do emprego exitoso de inibidores específicos desta via é o
glifosato, inibidor da 5-enolpiruvilchiquimato-3-fosfato sintase e um dos
herbicidas de amplo espectro mais usados em todo o mundo. Este composto
também demonstrou atividade inibitória do crescimento de parasitos do filo
apicomplexo in vitro (AMRHEIN et al., 1980; ROBERTS et al., 1998). É
comprovado que a via do chiquimato é crucial para a viabilidade de M.
tuberculosis (PARISH e STOKER, 2002). Já que esta via está ausente no
hospedeiro humano e é essencial para a micobactéria, suas sete enzimas são
alvos atrativos para o desenvolvimento de agentes que possam tratar a TB
(PARISH e STOKER, 2002; BENTLEY, 1990). Com o objetivo de desenhar
racionalmente novas e efetivas drogas antimicobacterianas, muitos estudos de
caracterização molecular e bioquímica têm envolvido as enzimas da via do
chiquimato de M. tuberculosis como, por exemplo, 3-desóxi-D-arabino-
heptulosonato-7-fosfato sintase (RIZZI et al., 2005), desidroquinato sintase
(MENDONÇA et al., 2007), chiquimato quinase (PEREIRA et al., 2004), 5-
17
enolpiruvilchiquimato-3-fosfato sintase (OLIVEIRA et al., 2003) e corismato
sintase (DIAS et al., 2004; FERNANDES et al., 2007).
Figura 1: A via do ácido chiquímico, mostrando seus sete passos enzimáticos (BASSO et al., 2005).
18
1.3 Chiquimato desidrogenase
A quarta reação enzimática da via do ácido chiquímico é catalisada pela
chiquimato desidrogenase (SD, EC 1.1.1.25), que é codificada pelo gene aroE
de M. tuberculosis e catalisa a redução reversível do 3-desidrochiquimato
(DHS) em chiquimato (SHK), na presença do NADPH como o doador de
hidreto (Figura 2; BENTLEY, 1990).
Figura 2: Reação catalisada pela enzima chiquimato desidrogenase (MtbSD).
Em plantas, a SD é parte de uma enzima bifuncional, a desidroquinato
desidrogenase-chiquimato desidrogenase (DHQ-SD) (DEKA et al., 1994;
SINGH e CHRISTENDAT, 2006). Em fungos e leveduras, a SD compõe um
complexo enzimático pentafuncional (CHARLES et al., 1986; DUNCAN et al.,
1987). Em bactérias, estudos bioquímicos e filogenéticos identificaram a
existência de três subclasses de SD, até então: AroE, YdiB e SD-like. AroE é a
SD de ocorrência mais ampla e é uma enzima monofuncional. YdiB e SD-like
foram identificadas em um número reduzido de microorganismos; YdiB é uma
SD bifuncional que também catalisa a redução reversível do desidroquinato a
quinato. Até então, a SD-like é uma enzima não muito bem caracterizada, e foi
sugerida como monofuncional em H. influenzae, catalisando a oxidação do
19
SHK a DHS com uma constante catalítica bastante reduzida se comparada
com a da AroE (MICHEL et al., 2003; SINGH et al., 2005). Recentemente, um
estudo relatou inibidores específicos da SD de Helicobacter pylori, o que
reforça a importância do desenvolvimento de novos agentes antimicrobianos e
da diversificação de alvos para novas drogas (HAN et al., 2006).
A enzima SD de M. tuberculosis (MtbSD), codificada pelo gene aroE
(Rv2552c), possui 269 aminoácidos e pertence à superfamília das
oxirredutases dependentes de NAD(P)H, que atuam em rotas anabólicas e
catabólicas (BENACH et al., 2003); além disso, encontra-se na forma de
dímero em solução (FONSECA et al., 2006).
Em 2002, foi publicada a clonagem do gene aroE da cepa M.
tuberculosis H37Rv em vetor de expressão pET23a(+) (Novagen®) e a
expressão da enzima recombinante na fração solúvel, em células de
Escherichia coli BL21(DE3) (MAGALHÃES et al., 2002). Em seguida, nosso
grupo publicou a purificação da enzima recombinante, sua caracterização
cinética e estudos estruturais (FONSECA et al., 2006; ARCURI et al., 2008).
Além disso, foram propostos os mecanismos cinético e químico da reação
catalisada pela MtbSD (FONSECA et al., 2007). Entretanto, as bases
moleculares da ligação ao substrato DHS e da redução catalítica ainda não
foram completamente elucidadas.
Estudos de alinhamento de várias seqüências de SDs demonstram que
os aminoácidos lisina (Lis, K) da posição 69 e aspartato (Asp, D) da posição
105 (Lis69 e Asp105, numeração de acordo com a seqüência da AroE de M.
tuberculosis) são, entre outros resíduos, completamente conservados nas
cadeias polipeptídicas das seguintes enzimas: AroE de M. tuberculosis, E. coli,
20
H. influenzae, Methanococcus jannaschii, Thermus thermophilus, Neisseria
meningitides, H. pylori, Archaeoglobus fulgidus, Aquiflex aeolicus, Bacillus
subtilis, Staphylococcus aureus, Streptococcus pneumoniae, Pseudomonas
aeruginosa, YdiB de E. coli, Corynebacterium glutamicum, SD-like de
Haemophilus influenzae, DHQ-SD de Arabidopsis thaliana e Lycopersicon
esculentum (MICHEL et al., 2003; HAN et al., 2006; FONSECA et al., 2007; YE
et al., 2003; BAGAUTDINOV e KUNISHIMA, 2007, Anexo 6.1). A seguir,
referir-se-á aos números dos resíduos sempre de acordo com a numeração da
seqüência polipeptídica da MtbSD.
Estudos das estruturas cristalinas das enzimas AroE e YdiB de E. coli
sugerem que Lis69 e Asp105 estejam localizados no sítio de ligação ao
substrato destas enzimas e que estes resíduos provavelmente tenham um
papel fundamental na catálise acido-básica da reação da SD neste organismo
(MICHEL et al., 2003). Ainda em 2003, outro estudo de cristalografia reforçou
esta nova proposição para a YdiB de E. coli, onde o resíduo conservado
Asp105 possivelmente atue como catalisador ácido-básico durante a
transferência de hidreto (BENACH et al., 2003).
As estruturas tridimensionais da AroE de H. influenzae e de M.
jannaschii sugerem Lis69 e Asp105, dentre outros resíduos, como parte do sítio
ativo destas enzimas e que estes aminoácidos possam contribuir para a
catálise (YE et al., 2003; PADYANA e BURLEY, 2003). Muito importante foi a
determinação dos complexos ternários da AroE de T. termophilus e A. aeolicus
com o cofator NADP+ e o substrato SHK; estas estruturas permitiram uma boa
compreensão sobre o mecanismo enzimático (Figura 3; BAGAUTDINOV e
KUNISHIMA, 2007; GAN et al., 2007).
21
Figura 3: Visão do SHK ligado ao complexo ternário AroE de Thermus termophilus:NADP(H):SHK (BAGAUTDINOV e KUNISHIMA, 2007).
Todas essas estruturas revelaram uma arquitetura geral bem
conservada para estas enzimas, composta de dois domínios: o domínio
catalítico N-terminal, onde Lis69 e Asp105 estão localizados, e o domínio C-
terminal, de ligação ao NAD(P); estes dois domínios estão separados por um
grande sulco central, onde está localizado o sítio catalítico destas enzimas
(Figura 4).
A determinação da estrutura cristalina, estudos de mutagênese e de
efeito de pH indicam que Lis69 e Asp105 estão criticamente envolvidos na
catálise na enzima SD-like de H. influenzae (SINGH et al., 2005). Entretanto,
um trabalho de mutagênese sítio-direcionada envolvendo a enzyma YdiB de E.
coli sugere que estes dois aminoácidos são muito importantes para a ligação
ao substrato e que a catálise não ocorre por um mecanismo geral ácido-básico,
como fora inicialmente sugerido (LINDNER et al., 2005). Recentemente, outra
22
análise de enzimas mutantes mostrou que o resíduo que corresponde à Lis69 e
ao Asp105 da enzima DHQ-SD de A. thaliana tem grande importância na
atividade catalítica desta enzima (SINGH e CHRISTENDAT, 2006). Estudos do
efeito do pH com a SD de A. aeolicus também indica que um resíduo,
provavelmente a Lis69, funciona como uma base durante a catálise (GAN et
al., 2007). Nosso grupo publicou a determinação dos mecanismos cinético e
químico da MtbSD, incluindo os efeitos do pH, e os dados são consistentes
com a provável participação de um resíduo lisina tanto na catálise quanto na
ligação ao substrato (FONSECA et al., 2007).
Figura 4: Modelo estrutural do monômero da enzima MtbSD em complexo com o NADP+, composta pelos domínios catalítico e de ligação ao NADP+ (ARCURI et al., 2008).
Com base nestes estudos, os resíduos Lis da posição 69 e Asp da posição 105
da enzima SD de M. tuberculosis foram escolhidos para investigação da sua
23
importância, se alguma, na ligação do substrato e/ou na catálise enzimática,
por meio da técnica de mutagênese sítio-direcionada.
24
2 OBJETIVOS
Este trabalho foi desenvolvido com vistas a determinar o papel da cadeia
lateral de aminoácidos do sítio ativo da enzima SD de M. tuberculosis,
buscando o melhor entendimento do seu mecanismo cinético e, assim, a
caracterização refinada deste alvo molecular. Os nossos resultados poderão
servir como base para o desenho racional de fármacos para o tratamento da
tuberculose.
Para tanto, alguns objetivos específicos foram traçados:
I. Planejamento das mutações e projeção de oligonucleotídeos
iniciadores específicos para as mutações desejadas;
II. Mutagênese sítio-direcionada do gene aroE de M. tuberculosis
H37Rv;
III. Seqüenciamento do gene aroE após a técnica de mutagênese;
IV. Super-expressão e purificação das proteínas mutantes;
V. Caracterização cinética da proteína mutante K69A e comparação
com o perfil da enzima não mutante.
25
3 MÉTODOS E RESULTADOS
Incialmente, idealizamos as mutações a serem realizadas. Este
planejamento inicial do trabalho está apresentado na próxima seção, intitulada
“Planejamento das mutações”.
As seções de métodos e de resultados serão apresentadas na forma de
manuscritos, intitulados “Screening of experimental conditions to express
soluble shikimate dehydrogenase mutants from Mycobacterium
tuberculosis H37Rv” e “The conserved Lysine 69 residue plays a catalytic
role in Mycobacterium tuberculosis shikimate dehydrogenase”, já
submetidos (Anexos 6.5 e 6.6).
No primeiro manuscrito constam os métodos e resultados referentes à
mutagênese sítio-direcionada, à super-expressão das enzimas MtbSD
mutantes na fração solúvel e à purificação da proteína mutante K69A. No
segundo manuscrito está descrita a caracterização cinética da MtbSD mutante
K69A.
26
3.1 Planejamento das mutações
Quatro resíduos foram escolhidos para substituir a Lis, totalizando quatro
enzimas mutantes distintas (Figura 5):
- Alanina (Ala, A): com esta mutação se consegue retirar a cadeia carbônica
e também o grupamento amino da Lis;
- Histidina (His, H): assim como a Lis, é um aminoácido básico; pode-se
investigar, portanto, se o grupamento básico da Lis tem algum papel importante
para esta enzima;
- Glutamina (Gln, Q): possui uma cadeia lateral com três carbonos e um
grupamento amida que permite que este resíduo mantenha a propriedade de
realizar interações por meio de pontes de hidrogênio, assim como a Lis pode
realizar pelo seu grupamento amino;
- Isoleucina (Ile, I): assim como a Lis, possui em sua cadeia lateral quatro
carbonos unidos por ligações simples; logo, possui a propriedade de fazer
interações do tipo van der Waals.
Duas enzimas mutantes foram idealizadas para estudar o papel do
aminoácido Asp, são os seguintes resíduos substituintes (Figura 6):
- Ala: retira-se o grupamento carboxílico do Asp;
- Asparagina (Asn, N): possui uma cadeia lateral com dois carbonos e um
grupamento amida que permite que este resíduo mantenha a propriedade de
realizar interações através de pontes de hidrogênio, assim como o Asp pode
realizar pelo seu grupamento carboxílico.
27
Figura 5: Resíduos idealizados para substituir a Lisina 69 da MtbSD.
Figura 6: Resíduos idealizados para substituir o Aspartato 105 da MtbSD.
28
3.2 Manuscrito 1
Screening of experimental conditions to express soluble shikimate
dehydrogenase mutants from Mycobacterium tuberculosis H37Rv
Valnês S. Rodrigues-Junior1,2, Luiz A. Basso1,*, and Diógenes S. Santos1,*
1Centro de Pesquisas em Biologia Molecular e Funcional, Pontifícia
Universidade Católica do Rio Grande do Sul (PUCRS), Porto Alegre – RS,
90619-900, Brazil. 2Programa de Pós-graduação em Biologia Celular e
Molecular, Centro de Biotecnologia, Universidade Federal do Rio Grande do
Sul (UFRGS), Porto Alegre – RS, Brazil.
Keywords: Mycobacterium tuberculosis, shikimate pathway, shikimate
dehydrogenase, site-directed mutagenesis, protein expression, protein
purification
*Corresponding authors: Luiz A. Basso or Diógenes S. Santos
Mailing address: Av. Ipiranga 6681 – Tecnopuc – Prédio 92ª
90619-900, Porto Alegre, RS, Brazil
Phone/Fax: +55 51 33203629
E-mail addresses: [email protected] or [email protected]
Short title: Mycobacterium tuberculosis shikimate dehydrogenase
29
ABSTRACT
The shikimate pathway is an attractive target for the development of
antitubercular agents because it is essential in Mycobacterium tuberculosis, the
causative agent of tuberculosis, but absent in humans. Mycobacterium
tuberculosis aroE-encoded shikimate dehydrogenase (MtbSD) catalyzes the
forth reaction in the shikimate pathway. Three-dimensional structure studies,
pH-rate profiles and site-directed mutagenesis studies involving many shikimate
dehydrogenases have suggested participation of Lysine and Aspartate amino
acid side chains in catalysis and/or substrate binding. Importantly, investigation
of the kinetic properties of mutant enzymes can bring important insights about
the role of these residues for the MtbSD enzyme. Mutagenesis was performed
using a PCR-amplification technique for the following mutant proteins: K69A,
K69H, K69I, K69Q, D105A, D105N. Screening of E. coli strains, growth
temperature, hours of growth, and the need for isopropyl β-D-
thiogalactopyranoside (IPTG) induction, cell disruption methods, and additives
were employed to optimize MtbSD production yield. In addition, an improved
purification protocol to obtain homogeneous MtbSD is presented. The kinetic
parameters for the wild type enzyme were also determined. Enzyme kinetics,
site-directed mutagenesis and structural studies provide a framework on which
to base the rational design of new agents with antitubercular activity. However,
the availability of sufficient amounts of proteins of M. tuberculosis still remains
an essential and laborious step. The results presented here show that
optimization of expression, disruption and purification protocols resulted in a
30
higher yield of functional MtbSDs enzyme, which is an essential step towards
target-based development of chemotherapeutic agents to treat tuberculosis.
31
ABREVIATIONS USED
TB, tuberculosis; MDR-TB, multi-drug resistant strains of Mycobacterium
tuberculosis; XDR-TB, extensively-drug resistant tuberculosis; SD, shikimate
dehydrogenase; MtbSD, Mycobacterium tuberculosis shikimate dehydrogenase;
DHS, 3-dehydroshikimate; SHK, shikimate; NADPH, reduced form of
nicotinamide adenine dinucleotide phosphate; DHQ-SD, dehydroquinate
dehydratase-shikimate dehydrogenase; PCR, polymerase chain reaction; DNA,
deoxyribonucleic acid; LB, Luria-Bertani; IPTG, isopropyl β-D-
thiogalactopyranoside; OD600, optical density at 600 nm; SDS-PAGE, sodium
dodecyl sulfate polyacrylamide gel electrophoresis.
32
INTRODUCTION
Tuberculosis (TB), caused by Mycobacterium tuberculosis, continues to
be a threat to human health worldwide. It has been estimated that one-third of
the world population is infected with the tubercle bacilli and that in the last
decade 30 million people died from this disease [1]. Among the possible factors
involved in the resurgence of TB are the epidemic of the human
immunodeficiency virus, the increase in the homeless population, and the
decline in health care structures and national surveillance [2]. Inappropriate
treatment regimens and patient noncompliance in completing the therapies are
commonly associated with the emergence of multi-drug resistant TB (MDR-TB),
whose isolates are resistant to at least isoniazid and rifampicin, two pivotal
drugs used in the standard treatment of TB [3,4]. More recently, the emergence
of extensively drug resistant TB (XDR-TB) strains were also described [5],
which are also a contributing factor to the alarming emergence of TB cases
worldwide. XDR-TB is defined as resistant to isoniazid and rifampicin and at
least three of the six main classes of second-line drugs (aminoglycosides,
polypeptides, fluoroquinolones, thioamides, cycloserine, and para-
aminosalicylic acid) and its high occurrence raises the prospect of virtually
incurable TB [5,6]. Hence, the alarming rise of strains of M. tuberculosis
resistant to current drugs stimulates an urgent need to discover novel
antitubercular agents acting on new drug targets.
The shikimate pathway links the metabolism of carbohydrates to the
biosynthesis of aromatic compounds, converting erythrose 4-phosphate in
chorismate, which is the precursor for the synthesis of important metabolites,
33
such as aromatic amino acids, ubiquinone and folate [7]. This pathway is
essential for algae, higher plants, bacteria, and fungi, but it is absent in
mammals [8]. Importantly, the shikimate pathway has been shown to be
essential for the viability of M. tuberculosis [7]. Since this pathway is absent in
human host and is essential for mycobacteria, its seven enzymes are attractive
targets for the development of antitubercular agents [7,8]. With a view to the
design of effective antimycobacterial drugs, efforts have been made to
characterize at the molecular and biochemical levels many enzymes from this
pathway in Mycobacterium tuberculosis, such as 3-deoxy-D-arabino-
heptulosonate 7-phosphate synthase [9], dehydroquinate synthase [10],
shikimate kinase [11], 5-enolpyruvylshikimate-3-phosphate synthase [12] and
chorismate synthase [13,14].
The fourth reaction of the shikimate pathway is the aroE-encoded
shikimate dehydrogenase (SD, EC 1.1.1.25) in M. tuberculosis that catalyzes
the reversible reduction of 3-dehydroshikimate (DHS) to shikimate (SHK) in the
presence of NADPH as the hydride donor [8] (Figure 1).
Figure 1: The shikimate dehydrogenase-catalyzed reaction.
34
In plants, SD is part of a bifunctional dehydroquinate dehydratase-
shikimate dehydrogenase (DHQ-SD) enzyme [15,16]. In fungi and yeast, SD
participates of a pentafunctional enzyme complex [17,18]. In bacteria,
biochemical and phylogenetic studies have identified the existence of three
subclasses of SD to date: AroE, YdiB, and SD-like. AroE is a widely distributed
monofunctional enzyme. YdiB and SD-like enzymes have been identified in a
lower number of organisms. The ydiB-encoded protein is a bifunctional SD
enzyme that also catalyses the reversible reduction of dehydroquinate to
quinate. SD-like is not well characterized, and was suggested to be
monofunctional in Haemophilus influenzae, catalyzing the oxidation of SHK with
a lower rate when compared with that of AroE [19,20]. Recent report of specific
inhibitors against the shikimate dehydrogenase from Helicobacter pylori has
reinforced the importance of the target diversity and the introduction of novel
effective antimicrobial agents [21]. Our group has previously reported cloning,
expression, purification, kinetic properties and structural studies of the aroE-
encoded shikimate dehydrogenase from M. tuberculosis (MtbSD) [22-25].
However, the molecular basis of DHS recognition and the catalytic mechanism
for MtbSD are not yet known.
Multiple sequence alignment studies showed that the amino acids lysine
in the position 69 and aspartate in the position 105 (Lys69 and Asp105, M.
tuberculosis numbering) are, amongst other residues, fully conserved in the
polypeptide chain of the following aligned enzymes: AroE from M. tuberculosis,
Escherichia coli, Haemophilus influenzae, Methanococcus jannaschii, Thermus
thermophilus, Neisseria meningitides, Helicobacter pylori, Archaeoglobus
fulgidus, Aquiflex aeolicus, Pseudomonas aeruginosa, YdiB from Escherichia
35
coli, Corynebacterium glutamicum, SD-like from Haemophilus influenzae, SD
parts of Arabidopsis thaliana and Lycopersicon esculentum DHQ-SDs
[19,21,24,26,27]. In the following, we will refer to residues according to the M.
tuberculosis AroE numbering. Crystal structure determination of AroE and YdiB
proteins from E. coli suggest that a lysine and an aspartate (Lys69 and Asp105
in MtbSD) residues are located in the substrate binding site and probably play
critical roles in the acid-base catalysis of the SD reaction in this organism [19].
In the same year, other crystallographic work reinforced this novel proposal for
YdiB from E. coli, in which the conserved aspartate residue (Asp105 in MtbSD)
is supposed to act as the acid-base catalyst during the hydride transfer [28].
Three-dimensional structures of both H. influenzae and M. jannaschii AroE
suggest conserved lysine and aspartate, amongst other residues, as part of the
active site of these enzymes and that these amino acids may contribute to
catalysis [26,29]. Importantly, ternary complexes for AroE from both Thermus
termophilus and Aquiflex aeolicus in complex with NADP+-SHK were
determined and provided important insights into the enzymatic mechanism
[27,30]. These structures have revealed a common overall architecture of these
enzymes, comprising two domains: the N-terminal catalytic domain, where the
conserved lysine and aspartate residues (Lys69 and Asp105 in MtbSD) are
located, and the C-terminal NAD(P)-binding domain. Mutagenesis studies,
determination of the crystal structure and pH-rate profiles indicate important
roles in catalysis for the lysine and aspartate residues in the SD-like enzyme
from H. influenzae [20]. However, a site-directed mutagenesis work on the YdiB
enzyme from E. coli suggests important roles for these amino acids in substrate
binding and that catalysis does not occur through a general acid-base
36
mechanism, as initially thought [31]. More recently, another mutational analysis
has shown that the corresponding lysine and aspartate residues play critical
roles in the catalytic activity of Arabidopsis thaliana DHQ-SD enzyme [16]. The
pH-rate profile of the A. aeolicus SD also indicates that a residue, probably a
lysine, functions as a general base during catalysis [30]. We have recently
reported determination of kinetic and chemical mechanisms for MtbSD,
including pH-rate profiles, and the data are consistent with the probable
participation of a lysine residue in catalysis and/or substrate binding [24].
In an attempt to probe the role, if any, of Lys69 and Asp105 residues in
MtbSD, we replaced Lys69 residue by alanine, isoleucine, histidine and
glutamine, and Asp105 by alanine and asparagine. Here, we describe site-
directed mutagenesis and an expression protocol to obtain both wild type and
mutant enzymes in soluble form. In addition, we developed a new and improved
purification protocol to obtain homogeneous wild type MtbSD. We have also
used this protocol to purify the K69A mutant.
Enzyme kinetics and structural studies provide a framework on which to
base the target-based rational design of new agents with antitubercular activity.
However, the availability of sufficient amounts of proteins of M. tuberculosis still
remains an essential and laborious step. Unfortunately, even when a genome
can be sequenced, only up to 20 % of the protein targets can produce soluble
proteins under very basic experimental conditions [32]. Thus, expression of
proteins in soluble form has been identified as an important bottleneck in efforts
to determine biological activity and crystal structure of M. tuberculosis proteins
[33]. It should be pointed out that expression of MtbSD in soluble and active
form proved to be laborious to achieve [22]. Accordingly, the results here
37
described represent an important step towards providing recombinant MtbSD
proteins to allow functional and structural efforts on which to base the rational
design of antitubercular agents.
38
MATERIALS AND METHODS
Site-directed mutagenesis of the aroE gene
Mutagenesis experiments were performed using the QuickChange site-
directed mutagenesis kit from Stratagene, according to the manufacturer’s
instructions. This technique consists of a PCR-amplification procedure that uses
the PfuTurbo® DNA polymerase and a pair of specific antiparallel primers,
carrying codons for the required substitutions. The oligonucleotide primers were
individually designed, and both primers must contain the desired mutation as
given in Table 1. The recombinant vector, pET23a(+)::aroE, was used as
template since the method allows specific mutations in virtually any double-
stranded plasmid. The PCR amplification program was as follows: one step of
95º C for 30 s, 16 cycles at 95º C for 30 s, 55º C for 1 min, and 68º C for 10
min, followed by a final extension step at 68º C for 10 min. The PCR products
were treated with DpnI endonuclease to select for the mutation-containing
synthesized DNA. The mutant aroE genes were entirely sequenced to both
confirm the insertion of the desired mutation and to ensure that no unwanted
mutations were introduced by the PCR step.
39
Table 1
Designed primers for the desired mutations
3.2 In bold are the nucleotides corresponding to the substituting amino acid
Overexpression and release of the mutant MtbSD
Recombinant protein expression tests were carried out at various
experimental conditions including screening of E. coli strains, growth
temperature, hours of growth, and the need for isopropyl β-D-
thiogalactopyranoside (IPTG) induction. In addition, we tried to solubilize the
insoluble aggregates with 50 mM Tris-HCl, pH 7.8 buffer containing the agents
sarcosyl, triton X-100, zwittergent 3-14 or urea. The concentrations employed
were as follows: 0.2, 1 or 2 % for sarcosyl; 0.1, 1 or 2 % for triton X-100; 0.1, 1,
3 or 6 M for urea; 0.1, 0.5 or 5 % for zwittergent 3-14. The solubilization test
consisted of treating the insoluble fraction with each agent for 30 minutes of
stirring at 4 ºC. Finally, the disruption methods of French press and freeze-thaw
Mutant Mutagenic primer*
K69A forward 5’ ggtgtttcgg tgaccatgcc gggcgcgttc gccgccctgc ggttcg 3’
K69A reverse 5’ cgaaccgcag ggcggcgaac gcgcccggcat ggtcaccga aacacc 3’
K69I forward 5’ ggtgtttcgg tgaccatgcc gggcatcttc gccgccctgc ggttcg 3’
K69I reverse 5’ cgaaccgcag ggcggcgaag atgcccggcat ggtcaccga aacacc 3’
K69H forward 5’ ggtgtttcgg tgaccatgcc gggccacttc gccgccctgc ggttcg 3’
K69H reverse 5’ cgaaccgcag ggcggcgaag tggcccggcat ggtcaccga aacacc 3’
K69Q forward 5’ ggtgtttcgg tgaccatgcc gggccagttc gccgccctgc ggttcg 3’
K69Q reverse 5’ cgaaccgcag ggcggcgaac tggcccggcat ggtcaccga aacacc 3’
D105A forward 5’ ggctggcggg ccgacaacac cgcgatcgac ggggtggccg gggcg 3’
D105A reverse 5’ cgccccggcc accccgtcga tcgcggtgtt gtcggcccgc cagcc 3’
D105N forward 5’ ggctggcggg ccgacaacac caacatcgac ggggtggccg gggcg 3’
D105N reverse 5’ cgccccggcc accccgtcga tgttggtgtt gtcggcccgc cagcc 3’
40
were tested. Satisfactory results were obtained with the E. coli C41 (DE3)
strain, grown at 37 ºC for 24 h with IPTG induction. The optimized protein
expression protocol and release of the soluble recombinant proteins are given
hereafter. The recombinant plasmid pET23a(+)::aroE (either wild-type or
mutants) was transformed into E. coli C41 (DE3) electrocompetent cells by
electroporation, and selected on LB agar plates containing 50 µg mL-1
ampicillin. Single colonies were used to inoculate 2 L of LB medium containing
50 µg mL-1 ampicillin, and 1 mM IPTG was added to cultures reaching an OD600
of 0.4 – 0.6. The cells were grown for additional 24 h at 37º C at 180 rpm, after
induction. Cells (5 g) were harvested by centrifugation at 14,900g for 30 min at
4º C, and stored at -20 ºC. The freeze-thaw method was used to release the
proteins in the soluble fraction [34]. Cells were placed into metal containers,
allowing fast temperature equilibrium to be reached, and placed into a dry-
ice/ethanol bath for 2 min and transferred to an ice-water bath for 8 min, and
this cycle was repeated 5 times. These cells were dissolved in 25 mL of 50 mM
Tris-HCl, pH 7.8 and placed on ice for additional 30 min. The sample was
centrifuged at 4 ºC for 1h at 48,000g and the soluble fraction containing the
protein of interest was collected and employed in the optimization of
recombinant protein purification protocols.
Purification steps
The sample containing the soluble enzyme was incubated with 1 % (w/v)
of streptomycin sulfate for 30 min and centrifuged at 48,000g for 30 min. The
supernatant was dialyzed against 50 mM Tris-HCl, pH 7.8 (buffer A), using a
41
dialysis tubing with molecular weight exclusion limit of 12-14 kDa. Ammonium
sulphate was added to a final concentration of 1 M. The sample was clarified by
centrifugation and the supernatant was loaded on a Phenyl-Sepharose Fast
Flow hydrophobic interaction column pre-equilibrated with 50 mM Tris-HCl, pH
7.8, 1 M (NH4)2SO4 (buffer B). The column was washed with 10 column
volumes of buffer B and the bound proteins were fractionated with a 20-column
volume linear gradient from 1 to 0 M (NH4)2SO4. The fractions containing
MtbSD were pooled, concentrated to 10 mL and loaded on a Sephacryl S-200
HR column pre-equilibrated with buffer A. Fractions containing the recombinant
protein were pooled and loaded on a MonoQ anion exchange column previously
equilibrated with buffer A. The column was washed with 5 column volumes of
buffer A and the adsorbed proteins were eluted using a 20-column volume
linear gradient (0- 100%) of 50 mM Tris-HCl, 0.5 M NaCl, pH 7.8 buffer. The
fractions containing the purified protein were pooled, concentrated and dialyzed
against the enzymatic assay buffer. All the purification steps were performed at
4 ºC. Samples of the purification steps were analyzed by SDS-PAGE [35] and
the protein content was determined by the Bradford method [36], using the Bio-
Rad protein assay kit (Bio-Rad) and bovine serum albumin as standard.
42
RESULTS AND DISCUSSION
Sequence alignment analysis of many shikimate dehydrogenase
polypeptide chains showed that, amongst other amino acids, lysine and
aspartate residues (Lys69 and Asp105 in MtbSD) are fully conserved, and it has
been suggested that these residues are of fundamental importance in catalysis
and/or substrate binding [19,21,26,27]. Three-dimensional structure
determination of shikimate dehydrogenase enzymes (AroE, YdiB and SD-like)
from several organisms have also suggested the involvement of these amino
acids in catalysis and/or substrate binding and have revealed the conserved
overall architecture of the shikimate dehydrogenase family, composed by a
catalytic domain and a NAD(P)-binding domain [19,20,26,27,29-31]. In addition,
site-directed mutagenesis results have confirmed the importance of lysine and
aspartate for catalysis (in SD-like from H. influenzae and A. thaliana DHQ-SD)
and for substrate binding (in YdiB from E. coli) [16,20,31]. Based on structural
and functional studies, it is likely that the conserved lysine in the position 69 and
aspartate in the position 105 of the MtbSD enzyme may play an important role
either in catalysis or binding or both. To investigate the functional role of these
residues, we have replaced Lys69 with alanine, isoleucine, histidine or
glutamine, and Asp105 with alanine or asparagine by site-directed
mutagenesis. The PCR-amplification mutagenesis technique proved to be an
effective procedure, allowing mutation in the double-stranded recombinant
plasmid, pET23a(+)::aroE. It should be pointed out the importance of treating
the PCR product with the DpnI endonuclease that specifically digests the
43
methylated DNA template, and selects for the mutation-containing synthesized
DNA.
After sequencing of the recombinant genes in their entirety, the mutant
plasmids were transformed in E. coli for protein expression tests. Recombinant
protein expression of MtbSD has proved to be a difficult task to achieve [22].
Thus, a range of variable experimental conditions were tried to improve
recombinant protein expression. Tests in LB medium using various E. coli
strains, at different cultivation temperatures, either with or without IPTG
induction (Table 2) as well as cell growth for additional 3, 6, 12, 18, 24, or 36
hours of cultures after reaching an OD600 of 0.4 – 0.6. Disappointingly, these
attempts to express the wild-type and mutant MtbSDs in soluble form were
unsuccessful. The best recombinant protein expression protocol of MtbSD
K69A mutant in insoluble form was using E. coli C41(DE3) strain, grown at 37
ºC for 24 hours after induction with 1 mM IPTG, and cell disruption by
sonication (Figure 2). The need for the presence of IPTG to allow expression is
consistent with the use of the vector pET23a(+). The pET expression system
uses the powerful T7 RNA polymerase, under control of IPTG-inducible lacUV5
promoter, to transcribe genes of interest [37].
44
Table 2
Expression tests for the MtbSD mutant enzymes
E. coli strain Strain characteristics Temperature tested (º C)
1 mM IPTG induction
BL21(DE3) 37 Yes
BL21(DE3) 37 No
BL21(DE3) 30 Yes
BL21(DE3) 30 No
BL21(DE3) 20 Yes
BL21(DE3)
Deficiency of the protease lon e ompT,
reducing the degradation of the expressed
recombinant proteins
20 No
C41(DE3) 37 Yes
C41(DE3) 37 No
C41(DE3) 30 Yes
C41(DE3)
Derived from BL21(DE3); prevents cell death
associated with expression of many recombinant toxic
proteins 20 Yes
C43(DE3) 37 Yes
C43(DE3) 37 No
C43(DE3) 30 Yes
C43(DE3)
Derived from C41(DE3); express a different set of
toxic proteins as compared with C41(DE3)
20 Yes
C41(DE3)pLysS 37 Yes
C41(DE3)pLysS 37 No
C43(DE3)pLysS 37 Yes
C43(DE3)pLysS
Express T7 lysozyme, natural inhibitor of T7
RNA polymerase; stabilize recombinant encoding mainly toxic
proteins 37 No
45
Figure 2: SDS-PAGE analysis of protein extracts from the mutant SD K69A in
E. coli C41(DE3) host cells grown at 37 ºC for 24 h. Lane 1, molecular weight
marker Low Range (Bio-Rad); Lanes 2-5, soluble fractions: 2, control without
IPTG; 3, K69A without IPTG; 4, control with 1 mM IPTG; 5, K69A with 1 mM
IPTG; Lanes 6-9, insoluble fractions: 6, control without IPTG; 7, K69A without
IPTG; 8, control with 1 mM IPTG; 9, K69A with 1 mM IPTG.
After cellular growth under the conditions determined above, we tried to
solubilize the insoluble bodies using the detergents sarcosyl, triton X-100,
zwittergent 3-14, or with the chaotropic agent urea. Solubilization of
recombinant wild-type and K69A MtbSD enzymes in inclusion bodies was
achieved by either treating the pellet with the denaturant agent urea (3 or 6M) or
by treating with the non ionic detergent zwittergent 3-14 (5 %). These soluble
fractions were dialyzed against Tris HCl 50 mM pH 7.8 buffer and the protein of
interest remained in the soluble fraction after in vitro refolding (Figure 3).
46
Figure 3: SDS-PAGE analysis of total protein extracts from the K69A SD mutant
after solubilization using 5 % zwittergent 3-14. Lane 1, soluble protein fraction
after disruption by sonication; 2, insoluble protein fraction after sonication; 3,
soluble protein fraction after zwittergent 3-14 treatment; 4, insoluble protein
fraction after zwittergent; 5, soluble protein fraction after in vitro refolding; 6,
insoluble protein fraction after refolding; 7, Bench Mark Protein Ladder
(Invitrogen).
However, the control experiment in which wild-type MtbSD was
solubilized by urea or zwittergent 3-14 showed that no measurable enzyme
activity could be detected. Although inclusion body formation can greatly
simplify protein purification, there is no guarantee that the in vitro refolding will
yield large amounts of biologically active product. Moreover, inclusion body
purification schemes present a number of problems such as: use of denaturants
that are expensive and can cause irreversible modifications of protein structure
that will elude all of the most sophisticated analytical tests, refolding usually
must be done in very dilute solution and the protein reconcentrated, and
refolding encourages protein isomerization leading to precipitation during
47
storage [38]. Since we aim at comparing steady-state kinetic parameters of the
mutant enzymes with those of the wild-type to determine the catalytic
mechanism of MtbSD, the use of these solubilizing agents should be avoided.
Accordingly, efforts were made to express recombinant MtbSD proteins in its
soluble form. The use of French press (Cell Disrupter System, Constant
Systems Ltd, UK) as the cell disruption method, unfortunately, led to
recombinant proteins in the insoluble fraction at all pressures tested: 20, 24, 27,
32 and 40 kpsi (40 kpsi = 2700 bar for 18 mm cylinder diameter). On the other
hand, the freeze-thaw method was able to yield K69I, K69Q, K69H and D105N
mutant proteins in soluble form (Figure 4). This method had previously been
described to be an efficient procedure in releasing the soluble and active wild-
type MtbSD [22]. The freeze-thaw is not a lysis method and release of soluble
proteins is through transient pores in the cellular envelope [34]. No differences
were observed when 5, 10 or 15 cycles of the freeze-thaw procedure were
tested (data not shown), and 5 cycles was then chosen. SDS-PAGE with
Coomassie blue staining analysis showed a protein band with an apparent
molecular mass of approximately 27 kDa, which is in agreement with the
expected molecular mass value [23].
48
Figure 4: SDS-PAGE analysis of soluble protein extracts after 5 cycles of the
freezing-and-thawing disruption method. Lanes 1, 3, 5, 7, control; 2, SD K69I
mutant; 4, K69Q; 6, K69H; 8, D105N; 9, Bench Mark Protein Ladder
(Invitrogen).
A purification protocol using four chromatographic steps was previously
described [23]. Here, we describe optimization of recombinant MtbSD protein
purification protocol using three chromatographic steps (Table 3). This
optimized protocol resulted in increased homogeneous recombinant protein
yield (13.5 %) as compared to a previous protocol (8.9 %). Moreover, the
protocol here described resulted in an 11.8-fold purification as compared to 8.5-
fold purification as previously described. The latter needed 49 g of E. coli
BL21(DE3) host cells harboring the recombinant pET23a(+)::aroE gene to yield
10.8 mg of homogeneous MtbSD (0.2 mg MtbSD/g cells). The protocol here
described yields 1.5 mg of homogeneous MtbSD protein from 5 g of E. coli
C41(DE3) host cells (0.3 mg MtbSD/g cells) that represents an improvement of
approximately 50 % in the recombinant protein yield. The optimized protein
purification protocol here described removed the first anion-exchange Q-
49
Sepharose Fast Flow column step and thus the supernatant of streptomycin
precipitation step was loaded on a hydrophobic interaction Phenyl Sepharose
Fast Flow column.
Table 3
Improved purification protocol for MtbSD
The results presented are for a purification protocol from 5 g of E. coli host cells a U mL-1 mg-1.
It should be pointed out that the purification protocol described here does
not depend on a histidine tag for the purification purpose of recombinant
proteins. The strategies to obtain homogeneous shikimate dehydrogenases
from H. pylori [21] and H. influenzae [26], YdiB protein from E. coli [28], SD-like
enzyme from H. influenzae [20] employed recombinant proteins with histidine
tags. Recombinant MtbSD has also been tagged to a histidine tract to facilitate
protein purification [39]. Although many protocols use histidine tags to facilitate
protein purification by the nickel-affinity chromatography strategy, adding
histidine tags may alter the protein structure and the biological activity [40,41].
Although addition of histidine tags to recombinant proteins facilitate purification
protocols, we have made efforts to produce recombinant MtbSD without any
Purification step
Total protein (mg)
Total activity (U)
Specific activitya (U mg-1)
Purification (fold)
Yield (%)
Crude extract 130.3 156.5 1.2 1 100 Phenyl-
Sepharose FF 25.1 113.0 4.5 3.8 72.2
Sephacryl S-200 8.9 81.9 9.2 7.7 52.3
Mono-Q HR 1.5 21.2 14.1 11.8 13.5
50
fusion partner to avoid any possible effect that the latter may have on the
enzyme. Thus improvement of protocols previously described was the strategy
of choice, which proved fruitful because homogeneous recombinant K69A
(Figure 5) and wild-type (data not shown) MtbSD proteins were obtained by a
three-step purification protocol, as assessed by SDS-PAGE, with increased
protein yield (Table 3).
Figure 5: SDS-PAGE analysis of the protein fractions from purification steps of
the mutant K69A MtbSD. Lane 1, crude protein extract, injected on Phenyl
Sepharose FF; 2, pooled protein fractions injected on Sephacryl S-200; 3,
pooled protein fractions injected on Mono-Q HR; 4, Bench Mark Protein Ladder
(Invitrogen); 5, purified K69A MtbSD enzyme.
To ascertain that the apparent steady-state kinetics parameters of
recombinant MtbSD proteins were comparable with the ones using a previously
reported protocol [23], determination of Km and Vmax were carried out for wild-
type MtbSD. All kinetic experiments were performed in potassium phosphate
100 mM buffer since in phosphate [24] the catalytic rate value for this enzyme
seems to be larger than when the assay is carried out in Tris-HCl buffer [23].
51
The values obtained for the apparent steady-state kinetic parameters were as
follows: Km = 29 (±2 µM) for DHS, Km = 11 (±1 µM) for DHS, kcat = 50 (±1) s-1.
These values are in agreement with previously reported parameters [23,24]. It
should be noted that here we determined apparent steady-state kinetic
parameters and not true parameters as described elsewhere [24]. These data
provide a solid foundation on which to base analysis of recombinant MtbSD
mutant enzymes to determine the amino acid residues that are essential for
catalysis and/or binding of the substrates.
Here we report, to the best of our knowledge, the first site-directed
mutagenesis work on MtbSD. We also describe an efficient expression protocol
and an improved recombinant protein purification protocol that should be
employed to obtain homogeneous MtbSD mutant proteins. It should be pointed
out that expression and purification of functional wild-type and mutants of
MtbSD have proved a laborious goal to achieve. This is probably the reason for
only a scarce number of papers having appeared on studies of MtbSD
mechanism of action. A thorough characterization of wild-type and mutants of
MtbSD should provide a better understanding of the catalytic and chemical
mechanisms of this enzyme. However, these studies hinge on the availability of
MtbSD proteins in soluble and functional forms. We thus hope that the results
here presented will pave the way for the target-based rational design of novel
effective antimicrobial agents.
52
ACKNOWLEDGMENTS
Financial support for this work was provided by Millennium Initiative Program
MCT-CNPq, Ministry of Health-Department of Science and Technology (Brazil)
to D.S.S. and L.A.B. D.S.S. and L.A.B. also acknowledge grants awarded by
CNPq, FINEP, and PRONEX/FAPERGS/CNPq. D.S.S. (CNPq, 304051/1975-
06) and L.A.B. (CNPq, 520182/99-5) are research career awardees from the
National Council for Scientific and Technological Development of Brazil. We are
grateful to Professor John W. Frost, Department of Chemistry of Michigan State
University, for his generous gift of 3-dehydroshikimate substrate.
53
REFERENCES
[1] C. Dye, S. Scheele, P. Dolin, V. Pathania, M.C. Raviglione, Global burden of
tuberculosis: estimated incidence, prevalence, and mortality by country, JAMA
282 (1999) 677-686.
[2] R.B. Bloom, C.J.L. Murray, Tuberculosis: commentary on a reemergent
killer, Science 257 (1998) 1055-1064.
[3] K. Duncan, Progress in TB drug development and what is still needed,
Tuberculosis 83 (2003) 201-207.
[4] L.A. Basso, J.S. Blanchard, Resistance to antitubercular drugs, Adv. Exp.
Med. Biol. 456 (1998) 115-144.
[5] CDC (Centers for Disease Control and Prevention), Emergence of
Mycobacterium tuberculosis with extensive resistance to second-line drugs-
worldwide, Morb. Mortal. Wkly. Rep. 55 (2006) 301-305.
[6] S.E. Dorman, R.E. Chaisson, From magic bullets back to the Magic
Mountain: the rise of extensively drug-resistant tuberculosis, Nat. Med. 13
(2007) 295-298.
54
[7] T. Parish, N.G. Stoker, The common aromatic amino acid biosynthesis
pathway is essential in Mycobacterium tuberculosis, Microbiology 148 (2002)
3069-3077.
[8] R. Bentley, The shikimate pathway – a metabolic tree with many branches,
Crit. Rev. Biochem. Mol. Biol. 25 (1990) 307-384.
[9] C. Rizzi, J. Frazzon, F. Ely, P.G. Weber, I.O. Fonseca, M. Gallas, J.S.
Oliveira, M.A. Mendes, B.M. Souza, M.S. Palma, D.S. Santos, L.A. Basso,
DAHP synthase from Mycobacterium tuberculosis H37Rv: cloning, expression,
and purification of functional enzyme, Protein Expr. Purif. 40 (2005) 23-30.
[10] J.D. Mendonça, F. Ely, M.S. Palma, J. Frazzon, L.A. Basso, D.S. Santos,
Functional charaterization by genetic complementation of aroB-encoded
dehydroquinate synthase from Mycobacterium tuberculosis H37Rv and its
heterologous expression and purification, J. Bacteriol. 189 (2007) 6246-6252.
[11] J.H. Pereira, J.S. Oliveira, F. Canduri, M.V. Dias, M.S. Palma, L.A. Basso,
D.S. Santos, W.F. de Azevedo Jr, Structure of shikimate kinase from
Mycobacterium tuberculosis reveals the binding of shikimic acid, Acta
Crystallogr. D Biol. Crystallogr. 60 (2004) 2310-2319.
[12] J.S. Oliveira, M.A. Mendes, M.S. Palma, L.A. Basso, D.S. Santos, One-
step purification of 5-enolpyruvylshikimate-3-phosphate synthase enzyme from
Mycobacterium tuberculosis, Protein Expr. Purif. 28 (2003) 287-292.
55
[13] M.V. Dias, F. Ely, F. Canduri, J.H. Pereira, J. Frazzon, L.A. Basso, M.S.
Palma, W.F. de Azevedo Jr, D.S. Santos, Crystallization and preliminary X-ray
crystallographic analysis of chorismate synthase from Mycobacterium
tuberculosis, Acta Crystallogr. D Biol. Crystallogr. 60 (2004) 2003-2005.
[14] C.L. Fernandes, A. Breda, D.S. Santos, L.A. Basso, O.N. Souza, A
structural model for chorismate synthase from Mycobacterium tuberculosis in
complex with coenzyme and substrate, Comput. Biol. Med. 37 (2007) 149-158.
[15] R.K. Deka, I.A. Anton, B. Dunbar, J.R. Coggins, The characterisation of the
shikimate pathway enzyme dehydroquinase from Pisum sativum, FEBS Lett.
349 (1994) 397-402.
[16] S.A. Singh, D. Christendat, Structure of Arabidopsis dehydroquinate
dehydratase-shikimate dehydrogenase and implications for metabolic
channeling in the shikimate pathway, Biochemistry 45 (2006) 7787-7796.
[17] I.G. Charles, J.W. Keyte, W.J. Brammar, M. Smith, A.R. Hawkins, The
isolation and nucleotide sequence of the complex AROM locus of Aspergillus
nidulans, Nucleic Acids Res. 14 (1986) 2201-2213.
[18] K. Duncan, R.M. Edwards, J.R. Coggins, The pentafunctional AroM
enzyme of Saccharomyces cerevisiae is a mosaic of monofunctional domains,
Biochem. J. 246 (1987) 375-386.
56
[19] G. Michel, A.W. Roszak, V. Sauvé, J. Maclean, A. Matte, J.R. Coggins, M.
Cygler, A.J. Lapthorn, Structures of shikimate dehydrogenase AroE and its
paralog YdiB, J. Biol. Chem. 278 (2003) 19463-19472.
[20] S. Singh, S. Korolev, O. Koroleva, T. Zarembinski, F. Collart, A.
Joachimiak, D. Christendat, Crystal structure of a novel shikimate
dehydrogenase from Haemophilus influenzae, J. Biol. Chem. 280 (2005) 17101-
17108.
[21] C. Han, L. Wang, K. Yu, L. Chen, L. Hu, K. Chen, H. Jiang, X. Shen,
Biochemical characterization and inhibitor discovery of shikimate
dehydrogenase from Helicobacter pylori, FEBS J. 273 (2006) 4682-4692.
[22] M.L. Magalhães, C.P. Pereira, L.A. Basso, D.S. Santos, Cloning and
expression of functional shikimate dehydrogenase (EC 1.1.1.25) from
Mycobacterium tuberculosis H37Rv, Protein Expr. Purif. 26 (2002) 59-64.
[23] I.O. Fonseca, M.L.B. Magalhães, J.S. Oliveira, R.G Silva, M.A. Mendes,
M.S. Palma, D.S. Santos, L.A. Basso, Functional shikimate dehydrogenase
from Mycobacterium tuberculosis H37Rv: purification and characterization,
Protein Expr. Purif. 46 (2006) 429-437.
57
[24] I.O. Fonseca, R.G. Silva, C.L. Fernandes, O.N. de Souza, L.A. Basso, D.S.
Santos, Kinetic and chemical mechanisms of shikimate dehydrogenase from
Mycobacterium tuberculosis, Arch. Biochem. Biophys. 457 (2007) 123-133.
[25] H.A. Arcuri, J.C. Borges, I.O. Fonseca, J.H. Pereira, J.R. Neto, L.A. Basso,
D.S. Santos, W.F. de Azevedo Jr, Structural studies of shikimate 5-
dehydrogenase from Mycobacterium tuberculosis, Proteins 7 February 2008.
�ói:10.1002/prot.21953.
[26] S. Ye, F. von Delf, A. Brooun, M.W. Knuth, R.V. Swanson, D.E. McRee,
The crystal structure of shikimate dehydrogenase (AroE) reveals a unique
NADPH binding mode, J. Bacteriol. 185 (2003) 4144-4151.
[27] B. Bagautdinov, N. Kunishima, Crystal structures of shikimate
dehydrogenase AroE from Thermus thermophilus HB8 and its cofactor and
substrate complexes: insights into the enzymatic mechanism, J. Mol. Biol. 373
(2007) 424-438.
[28] J. Benach, I. Lee, W. Edstrom, A.P. Kuzin, Y. Chiang, T.B. Acton, G.T.
Montelione, J.F. Hunt, The 2.3-Å crystal structure of the shikimate 5-
dehydrogenase orthologue YdiB from Escherichia coli suggests a novel
catalytic environment for an NAD-dependent dehydrogenase, J. Biol. Chem.
278 (2003) 19176-19182.
58
[29] A.K. Padyana, S.K. Burley, Crystal structure of shikimate 5-dehydrogenase
(SDH) bound to NADP: insights into function and evolution, Structure 11 (2003)
1005-1013.
[30] J. Gan, Y. Wu, P. Prabakaran, Y. Gu, Y. Li, M. Andrykovitch, H. Liu, Y.
Gong, H. Yan, X. Ji, Structural and biochemical analyses of shikimate
dehydrogenase AroE from Aquiflex aeolicus: implications for the catalytic
mechanism, Biochemistry 46 (2007) 9513-9522
[31] H.A. Lindner, G. Nadeau, A. Matte, G. Michel, R. Ménard, M. Cygler, Site-
directed mutagenesis of the active site region in the quinate/shikimate 5-
dehydrogenase YdiB of Escherichia coli, J. Biol. Chem. 280 (2005) 7162-7169.
[32] S.A. Lesley, P. Kuhn, A. Godzik, A.M. Deacon, I. Mathews, A. Kreusch, G.
Spraggon, H.E. Klock, D. McMullan, T. Shin, J. Vincent, A. Robb, L.S. Brinen,
M.D. Miller, T.M. McPhillips, M.A. Miller, D. Scheibe, J.M. Canaves, C. Guda, L.
Jaroszewski, T.L. Selby, M.A. Elsliger, J. Wooley, S.S. Taylor, K.O. Hodgson,
I.A. Wilson, P.G. Schultz, R.C. Stevens, Structural genomics of the Thermotoga
maritima proteome implemented in a high-throughput structure determination
pipeline. Proc. Natl. Acad. Aci. USA 99 (2002) 11664-11669.
[33] R. Vicentelli, C. Bignon, A. Gruez, S. Canaan, G. Sulzenbacher, M. Tegoni,
V. Campanacci, C. Cambillau, Medium-scale structural genomics: strategies for
protein expression and crystallization, Acc. Chem. Res. 36 (2003) 197-225.
59
[34] B.H. Johnson, M.H. Hecht, Recombinant proteins can be isolated from E.
coli cells by repeated cycles of freezing and thawing, Biotechnology 12 (1994)
1357-1360.
[35] U.K. Laemmli, Cleavage of structural proteins during the assembly of the
head of bacteriophage T4, Nature 227 (1970) 680-685.
[36] M.M. Bradford, R.A. McRorie, W.L. Williams, A rapid and sensitive method
for the quantitation of microgram quantities of protein utilizing the principle of
protein-dye binding, Anal. Biochem. 72 (1976) 248-254.
[37] K.C. Kelley, K.J. Huestis, D.A. Austen, C.T. Sanderson, M.A. Donoghue,
S.K. Stickel, E.S. Kawasaki, M.S. Osburne, Regulation of sCD4-183 gene
expression from phage-T7-based vectors in Escherichia coli, Gene 156 (1995)
33-36.
[38] C.H. Schein, Production of soluble recombinant proteins in bacteria,
Biotechnology 7 (1989) 1141-1149.
[39] X. Zhang, S. Zhang, F. Hao, X. Lai, H. Yu, Y. Huang, H. Wang, Expression,
purification and properties of shikimate dehydrogenase from Mycobacterium
tuberculosis, J. Biochem. Mo. Biol. 38 (2005) 624-631.
[40] A. Chant, C.M. Kraemer-Pecore, R. Watkin, G.G. Kneale, Attachment of a
histidine tag to the minimal zinc finger protein of the Aspergillus nidulans gene
60
regulatory protein AreA causes a conformational change at the DNA-binding
site, Protein Expr. Purif. 39 (2005) 152-159.
[41] I. Fonda, M. Kenig, V. Gaberck-Porekar, P. Prostovaek, V. Menart,
Attachment of histidine tags to recombinant tumor necrosis factor-alpha
drastically changes its properties, Sci. World J. 2 (2002) 1312-1325.
61
3.3 Manuscrito 2
The conserved Lysine 69 residue plays a catalytic role in Mycobacterium
tuberculosis shikimate dehydrogenase
Valnês S. Rodrigues-Junior1,2, Diógenes S. Santos1,* and Luiz A. Basso1,*.
1Centro de Pesquisas em Biologia Molecular e Funcional, Pontifícia
Universidade Católica do Rio Grande do Sul (PUCRS), Porto Alegre - RS,
90619-900, Brazil. 2Programa de Pós-graduação em Biologia Celular e
Molecular, Centro de Biotecnologia, Universidade Federal do Rio Grande do
Sul (UFRGS), Porto Alegre - RS, Brazil.
Keywords: Mycobacterium tuberculosis, shikimate pathway, shikimate
dehydrogenase, site-directed mutagenesis
*Corresponding authors: Luiz A. Basso or Diógenes S. Santos
Mailing address: Av. Ipiranga 6681 – Tecnopuc – Prédio 92A
90619-900, Porto Alegre, RS, Brazil
Phone/Fax: +55 51 33203629
E-mail addresses: [email protected] or [email protected]
Short title: Role of Lysine 69 in MtbSD
62
ABSTRACT
The Mycobacterium tuberculosis shikimate dehydrogenase (MtbSD) is a
target for the development of antitubercular agents. Structural and functional
studies indicate that Lysine69 may be involved in catalysis and/or substrate
binding in MtbSD. Here we show that this residue plays a catalytic role and is
not involved in substrate binding.
63
Tuberculosis (TB) remains a major global health concern. It has been
estimated that one-third of the world population is infected with Mycobacterium
tuberculosis, the causative agent of TB, and that 30 million people died from
this disease in the last decade (1). Among the possible factors involved in the
resurgence of TB are the epidemic of the human immunodeficiency virus, the
increase in the homeless population, and the decline in health care structures
and national surveillance (2). Inappropriate treatment regimens and patient
noncompliance in completing the therapies are commonly associated with the
emergence of multi-drug resistant TB (MDR-TB), defined as strains of M.
tuberculosis resistant to at least isoniazid and rifampicin, two pivotal drugs used
in the standard treatment of TB (3, 4). More recently, it has been reported the
emergence of extensively drug-resistant (XDR) TB cases, defined as cases in
persons with TB whose isolates are resistant to isoniazid and rifampicin as well
as resistant to any one of the fluoroquinolone drugs and to at least one of the
three injectable second-line drugs (5). XDR-TB is widespread raising the
prospect of virtually incurable TB worldwide (6). There is thus an urgent need
for new drugs to improve the treatment of MDR- and XDR-TB, and to provide
more effective drugs to shorten the duration of TB treatment.
The shikimate pathway is an attractive target for the development of
herbicides and antimicrobial agents because it is essential in algae, higher
plants, bacteria, and fungi, but absent from mammals (7). The mycobacterial
shikimate pathway leads to the biosynthesis of precursors of aromatic amino
acids, naphthoquinones, menaquinones, and mycobactins (8). This pathway
has been shown to be essential for the viability of M. tuberculosis (9).
Accordingly, the enzymes of the shikimate pathway represent promising targets
64
for the development of non-toxic antimycobacterial agents. Shikimate
dehydrogenase (SD; EC 1.1.1.25), the fourth enzyme of this pathway, catalyzes
the NADPH-dependent reduction of 3-dehydroshikimate (DHS) to shikimate
(SHK). We have previously reported the cloning and expression of functional
aroE-encoded SD from M. tuberculosis H37Rv strain (MtbSD) (10). We have
also reported purification to homogeneity of recombinant functional MtbSD, N-
terminal amino acid sequencing, electrospray ionization mass spectrometry
analysis, size exclusion chromatography, determination of the apparent kinetic
parameters for all substrates, thermal stability, and activation energy for the
enzyme-catalyzed chemical reaction (11). More recently, we have described the
kinetic and chemical mechanisms of recombinant MtbSD (12). Multiple
sequence alignment, homology modeling, and pH-rate profiles suggest that the
side chain of Lys-69 in the DHS/SHK binding site of MtbSD may play a role in
substrate binding and/or catalysis (12, 13). Here we describe site-directed
mutagenesis, steady-state kinetics and fluorimetric measurements to probe the
role of Lys-69 in MtbSD and provide insight into the molecular basis of
DHS/SHK recognition and/or catalysis.
A previously constructed pET-23a(+)::aroE recombinant vector (10) was
used as a template for site-directed PCR-based mutagenesis using a Quick
Change site-directed mutagenesis kit (Stratagene, La Jolla, CA). Mutagenesis
primers were designed to change AAG (encoding a lysine residue) to GCG
(encoding an alanine residue). The synthetic oligonucleotides employed as
primers were as follows: 5’ ggtgtttcggtgaccatgccgggcgcgttcgccgccctgcggttcg 3’
(forward) and 5’ cgaaccgcagggcggcgaacgcgcccggcatggtcaccgaaacacc 3’
(reverse) (in bold is the codon for alanine). The PCR amplification program
65
using PfuTurbo® DNA polymerase was as follows: one step of 95º C for 30 s, 16
cycles at 95º C for 30 s, 55º C for 1 min, and 68º C for 10 min, followed by a
final extension step at 68º C for 10 min. The PCR product was treated with DpnI
endonuclease that specifically digests the methylated DNA template, and
selects for the mutation-containing synthesized DNA. Sequencing of mutagenic
aroE gene in pET-23a(+) vector from a single colony confirmed that the
mutation was introduced into the expected site and that no unwanted mutations
were introduced by the PCR amplification step (data not shown). This
recombinant plasmid was introduced into E. coli C41 (DE3) host cells
(Novagen, Madison, WI) by electroporation. Single colonies were used to
inoculate 2 L of LB medium containing 50 µg mL-1 ampicillin, and 1 mM
isopropyl β-D-thiogalactopyranoside (IPTG) was added to cultures reaching an
OD600 of 0.4 - 0.6, and grown for 24 h at 37º C at 180 rpm. Cells (5 g) were
harvested by centrifugation at 14,900g for 30 min at 4º C, and stored at -20º C.
The freeze-thaw method was used to release the proteins in the soluble fraction
as previously described (10). The purification protocol was essentially as
previously described (11) except for removal of the first anionic exchange
chromatographic step (a thorough description of this improved protocol will be
described elsewhere – manuscript in preparation). Samples of the purification
steps were analyzed by SDS-PAGE (14) and the protein content was
determined by the Bradford method (15), using the Bio-Rad protein assay kit
(Bio-Rad) and bovine serum albumin as standard.
Steady-state kinetics measurements of homogeneous MtbSD K69A mutant
activity were carried out for the forward direction at 25º C in 100 mM potassium
phosphate buffer, pH 7.3, by monitoring the decrease in absorbance at 340 nm
66
(ε=6220 M-1cm-1 for NADPH) accompanying the conversion of NADPH and
DHS to NADP+ and SHK. The K69A activity was measured at various final
concentrations of DHS (20, 50, 70, 100, 150, 200, 250, 300 µM) while NADPH
was maintained at a saturating level (200 µM), and various concentrations of
NADPH (20, 30, 50, 70, 100, 150, 200, 250 µM) while DHS was maintained at a
saturating level (250 µM). The wild-type (WT) SD activity was measured at
various concentrations of DHS (10, 20, 30, 40, 50, 80, 100 µM) while NADPH
was maintained at a saturating level (200 µM), and various concentrations of
NADPH (5, 10, 15, 20, 40, 50 µM) while DHS was maintained at a saturating
level (250 µM). All measurements were in duplicate. Kinetic constants were
obtained by non-linear regression analysis of the kinetic data using the
SigmaPlot software (SPSS, Inc) and the Michaelis-Menten equation (v = Vmax x
[S]/Km + [S]). The apparent steady-state kinetic parameters (Table 1) show that
the catalytic constant (kcat) value for wild-type MtbSD (50 s-1) is 68-fold larger
than K69A (0.73 s-1). There was a modest increase in the Km values for DHS
(K69A=76 μM; WT MtbSD=29 μM) and NADPH (K69A=30 μM; WT MtbSD=11
μM). The apparent second-order rate constant (kcat/Km) values for DHS
(K69A=9.6 x 103 M-1s-1; WT MtbSD=1.7 x 106 M-1s-1) and NADPH (K69A=24 x
103 M-1s-1; WT MtbSD=4.5 x 106 M-1s-1) may apparently indicate that the mutant
has a lower specificity constant for both substrates. However, it should be noted
that the dominant feature is a decrease in the catalytic constant and only a
modest decrease in the Michaelis-Menten constants for both substrates. These
results suggest that the Lysine69 residue in MtbSD is involved in catalysis and
plays a minor role in substrate binding. To confirm this proposal,
spectrofluorimetric assays were carried out to determine the dissociation
67
constant for enzyme-substrate binary complex formation. Fluorescence titration
of substrate was carried out at 25 ºC making microliter additions of
concentrated substrate solutions to 2 mL of 1 µM of MtbSD monitoring the
intrinsic protein fluorescence (λexc=300 nm; 310 ≤ λem ≤ 450nm; maximum
λem at 340 nm). The fluorescence intensity at varying DHS concentration (2-
450 µM) yielded dissociation constant (Kd) values of 32 (± 4) µM for WT MtbSD
and 134 (± 21) µM for K69A mutant (Table 1).
TABLE 1
Apparent steady-state kinetic parameters and equilibrium binding constants for wild type and
K69A mutant MtbSD
a steady-state kinetic parameters
b spectroscopic measurements of intrinsic protein fluorescence
Interestingly, measurements of changes in nucleotide fluorescence upon
NADPH binding to WT MtbSD (λexc=370 nm; 380 ≤ λem ≤ 600nm; maximum
λem at 445 nm) did not show any saturation, which indicates a very large Kd
value. This is consistent with a steady-state ordered bi-bi mechanism with DHS
binding first followed by NADPH binding to MtbSD active site (12). The steady-
Parameter Wild type K69A
Vmax (U mg-1)a 110 ± 2 1.61 ± 0.03
Km DHS (µM)a 29 ± 2 76 ± 4
Km NADPH (µM)a 11.0 ± 0.6 30 ± 2
kcat (s-1)a 50 ± 1 0.73 ± 0.01
kcat/Km DHS (M-1 s-1)a 1.7 (± 0.1) x 106 9.6 (± 0.5) x 103
kcat/Km NADPH (M-1 s-1)a 4.5 (± 0.2) x 106 24 (± 2) x 103
Kd DHS (µM)b 32 ± 4 134 ± 21
68
state kinetics and spectrofluorimetric measurements indicate that the conserved
Lys69 residue in MtbSD plays a critical role in catalysis, but plays no role in
substrate binding.
Analysis of the three-dimensional structures for the ternary complexes of
SDs from Thermus termophilus (16) and Aquifex aeolicus (17) in complex with
NADP+ and SHK suggest that the protonated lysine residue (Lys64 in T.
termophilus and Lys70 in A. aeolicus) interacts with carbon-3 of DHS, thereby
acting as an acid-base catalytic group that donates a proton to the carbonyl of
DHS during reduction and that removes a proton during oxidation of SHK. The
Lys67 in Haemophilus influenzae SD (18) and Lys385 in Arabidopsis thaliana
dehydroquinate dehydratase-SD (19) play a critical role in catalysis.
Interestingly, substitution of the conserved lysine residue (Lys71) in E. coli
quinate/shikimate dehydrogenase YdiB with alanine caused only a modest
decrease in kcat and a large increase in Km for SHK (20). These results
demonstrate that enzymes that catalyze the same chemical reaction may do so
by employing different catalytic mechanisms. Based on double isotope effects
and pH-rate profiles, we have previously proposed that the chemical
mechanism for MtbSD involves hydride transfer and solvent proton transfer in a
concerted mechanism, and an amino acid residue with pKa value of 8.9 is
involved in catalysis. Here we demonstrate that the MtbSD Lys69 is important
for catalysis and is likely involved in stabilization of the developing negative
charge at the hydride-accepting C-3 carbonyl oxygen of DHS for the forward
reaction. This knowledge should assist in the rational design of antitubercular
agents.
69
ACKNOWLEDGMENTS
This work was supported by Millennium Initiative Program MCT-CNPq, Ministry
of Health-Department of Science and Technology (Brazil) to D.S.S. and L.A.B.
D.S.S. and L.A.B. also acknowledge grants awarded by CNPq, FINEP, and
PRONEX/FAPERGS/CNPq. D.S.S. (CNPq, 304051/1975-06) and L.A.B.
(CNPq, 520182/99-5) are research career awardees from the National Council
for Scientific and Technological Development of Brazil. We are grateful to
Professor John W. Frost, Department of Chemistry of Michigan State University,
for his generous gift of 3-dehydroshikimate substrate.
70
REFERENCES
1. Dye, C., S. Scheele, P. Dolin, V. Pathania, and M. C. Raviglione, 1999.
Global burden of tuberculosis: estimated incidence, prevalence, and
mortality by country. JAMA 282:677-686.
2. Bloom, B. R. and C. J. L. Murray. 1998. Tuberculosis: commentary on a
reemergent killer. Science 257:1055-1064.
3. Duncan, K. 2003. Progress in TB drug development and what is still
needed. Tuberculosis 83:201-207.
4. Basso, L.A., and J. S. Blanchard. 1998. Resistance to antitubercular
drugs. Adv. Exp. Med. Biol. 456:115-144.
5. Centers of Disease Control and Prevention. 2006. Emergence of
Mycobacterium tuberculosis with extensive resistance to second-line drugs-
worldwide. MMWR Morb. Mortal. Wkly. Rep. 55:301-305.
6. Dorman, S. E., and R. E. Chaisson. 2007. From magic bullets back to the
Magic Mountain: the rise of extensively drug-resistant tuberculosis. Nat.
Med. 13:295-298.
7. Bentley, R. 1990. The shikimate pathway – a metabolic tree with many
branches. Crit. Rev. Biochem. Mol. Biol. 25:307-384.
8. Ducati, R .G., L. A. Basso, and D. S. Santos. 2007. Mycobacterial
shikimate pathway enzymes as targets for drug design. Current Drug
Targets. 8:423-435.
9. Parish, T., and N. G. Stoker. 2002. The common aromatic amino acid
biosynthesis pathway is essential in Mycobacterium tuberculosis.
Microbiology. 148:3069-3077.
71
10. Magalhães, M. L. B., C. P. Pereira, L. A. Basso, and D. S. Santos. 2002.
Cloning and expression of functional shikimate dehydrogenase (EC
1.1.1.25) from Mycobacterium tuberculosis H37Rv. Prot. Expr. Purif. 26:59-
64.
11. Fonseca, I. O., M. L. B. Magalhães, J. S. Oliveira, R. G. Silva, M. A.
Mendes, M. S. Palma, D. S. Santos, and L. A. Basso. 2006. Functional
shikimate dehydrogenase from Mycobacterium tuberculosis H37Rv:
purification and characterization. Prot. Expr. Purif. 46:429-437.
12. Fonseca, I. O., R. G. Silva, C. L. Fernandes, O. N. de Souza, L. A. Basso,
and D. S. Santos. 2007. Kinetic and chemical mechanisms of shikimate
dehydrogenase from Mycobacterium tuberculosis. Arch. Biochem. Biophys.
457:123-133.
13. Arcuri, H.A., J. C. Borges, I. O. Fonseca, J. H. Pereira, J. R. Neto, L. A.
Basso, D. S. Santos, and W. F. de Azevedo. 7 February 2008. Structural
studies of shikimate 5-dehydrogenase from Mycobacterium tuberculosis.
Proteins. doi:10.1002/prot.21953.
14. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of
the head of bacteriophage T4. Nature 227:680-685.
15. Bradford, M. M., R. A. McRorie, and W. L. Williams. 1976. A rapid and
sensitive method for the quantitation of microgram quantities of protein
utilizing the principle of protein-dye binding, Anal. Biochem. 72:248-254.
16. B. Bagautdinov, B., and N. Kunishima. 2007. Crystal structures of
shikimate dehydrogenase AroE from Thermus thermophilus HB8 and its
cofactor and substrate complexes: insights into the enzymatic mechanism.
2007. J. Mol. Biol. 373:424-438.
72
17. Gan, J., Y. Wan, P. Praakaran, Y. Gu, Y. Li, M. Andrykovitch, H. Liu, Y.
Gong, H. Yan, and X. Ji. 2007. Structural and biochemical analyses of
shikimate dehydrogenase AroE from Aquiflex aeolicus: implications for the
catalytic mechanism. Biochemistry. 46:9513-9522.
18. Singh, S., S. Korolev, O. Koroleva, T. Zarembinski, F. Collart, A.
Joachimiak, and D. Christendat. 2005. Crystal structure of a novel
shikimate dehydrogenase from Haemophilus influenzae. J. Biol. Chem.
280:17101-17108.
19. Singh, S. A., and D. Christendat. 2006. Structure of Arabidopsis
dehydroquinate dehydratase—shikimate dehydrogenase and implications
for metabolic channeling in the shikimate pathway. Biochemistry. 45:7787-
7796.
20. Lindner, H. A., G. Nadeau, A. Matte, G. Michel, R. Ménard, and M.
Cygler. 2005. Site-directed mutagenesis of the active site region in the
quinate/shikimate 5-dehydrogenase YdiB of Escherichia coli. J. Biol. Chem.
280:7162-7169.
73
4 DISCUSSÃO
4.1 Mutagênese sítio-direcionada do gene aroE
Estudos de alinhamentos de seqüências de muitas SD mostram que,
dentre outros aminoácidos, os resíduos Lis e Asp (Lis69 e Asp105 da MtbSD)
são completamente conservados e sugerem a provável importância destes
aminoácidos para a catálise e/ou ligação ao substrato (MICHEL et al., 2003;
HAN et al., 2006; FONSECA et al., 2007; YE et al., 2003; BAGAUTDINOV e
KUNISHIMA, 2007). A determinação da estrutura tridimensional de enzimas SD
(AroE, YdiB e SD-like) de muitos organismos também sugere o envolvimento
destes aminoácidos na catálise e/ou ligação ao substrato e revela a
conservação do padrão estrutural dentre as enzimas da família da SD (MICHEL
et al., 2003; SINGH et al., 2005; YE et al., 2003; BAGAUTDINOV e
KUNISHIMA, 2007; PADYANA e BURLEY, 2003; GAN et al., 2007; LINDNER
et al., 2005). Além disso, estudos de mutagênese sítio-direcionada confirmaram
a importância destes dois resíduos para a catálise (na SD-like de H. influenzae
e na DHQ-SD de A. thaliana) e para a ligação ao substrato (na YdiB de E. coli;
LINDNER et al., 2005; SINGH e CHRISTENDAT, 2006; SINGH et al., 2005).
Baseados em estudos estruturais e funcionais, é provável que os resíduos
conservados Lis69 e Asp105 tenham importância na catálise, na ligação ao
substrato, ou em ambos, na enzima MtbSD. Para investigar a importância, se
existir alguma, destes resíduos nós substituímos a Lis69 por Ala, Ile, His ou
Gln, e o Asp105 por Ala ou Asn através da técnica de mutagênese sítio-
direcionada. Primeiramente, projetamos os pares de oligonucleotídeos
iniciadores para as mutações desejadas, seguindo as instruções do fabricante:
74
ambos devem conter a mutação e anelar à seqüência oposta de cada fita do
plasmídeo; devem possuir de 25 a 45 bases; a trinca correspondente ao
aminoácido substituinte deve estar aproximadamente no meio da seqüência
iniciadora; cada oligonucleotídeo iniciador deve ter um conteúdo mínimo de 40
% de citosina e guanina (Tabela 1 do Manuscrito 1). A técnica de mutagênese
através de amplificação por PCR foi um procedimento eficaz, que permitiu
mutação no plasmídeo recombinante dupla fita, pET23a(+)::aroE. Cabe
ressaltar a importância de tratar o produto da amplificação por PCR com a
endonuclease DpnI. Esta enzima cliva especificamente o DNA metilado que
fora usado como molde, selecionando, assim, o DNA sintetizado possivelmente
contendo a mutação e excluindo o DNA não mutado. Após os procedimentos
de mutagênese, clones de cada mutação tiveram seu DNA plasmidial clivado
com as enzimas de restrição NdeI e BamHI, flanqueando o gene de interesse,
para verificar a presença do plasmídeo recombinante possivelmente mutado
(Anexo 6.4).
Na seqüência, alguns dos clones cujos plasmídeos liberaram o inserto
adequadamente foram enviados para o seqüenciamento de DNA. As
seqüências dos genes aroE mutantes foram verificadas para confirmar a
alteração dos nucleotídeos desejados e também para certificar que nenhuma
outra mutação indesejada tenha sido introduzida aleatoriamente durante o
passo de PCR (dados não mostrados).
75
4.2 Super-expressão das proteínas mutantes
Após os resultados do seqüenciamento, os plasmídeos mutantes foram
eletroporados em células de E. coli para testes de expressão protéica. Um
protocolo de expressão da enzima MtbSD recombinante havia sido descrito
usando a cepa de E. coli BL21 (DE3), sem indução com IPTG (MAGALHÃES et
al., 2002). Infelizmente, não foi observada a expressão das proteínas mutantes
na fração solúvel, nem na insolúvel, seguindo este protocolo. Então, testamos
outras condições de crescimento como temperaturas reduzidas de cultura,
outras cepas de E. coli, com e sem indução por IPTG (Tabela 2 do Manuscrito
1), além de diferentes tempos de crescimento. Conseguimos a expressão
destas proteínas na cepa E. coli C41 (DE3), com crescimento por 24 h a 37º C
e a 180 rpm, depois da indução com 1 mM de IPTG e rompimento celular por
sonicação (Figura 2 do Manuscrito 1). A necessidade da adição de IPTG para
favorecer a expressão é consistente com o uso do vetor pET23a(+). O sistema
de expressão pET utiliza a T7 RNA polimerase, sob controle do promotor
lacUV5 induzido por IPTG, para transcrever genes de interesse (KELLEY et al.,
1995).
Depois da multiplicação celular nas condições determinadas acima,
testamos a solubilização das proteínas de interesse, insolúveis, usando os
detergentes sarcosil, triton X-100, zwittergent 3-14 ou o agente caotrópico
uréia. Assim, conseguimos obter uma fração da proteína mutante K69A na
fração solúvel após tratar o agregado insolúvel com o agente desnaturante
uréia (3 e 6 M) e com o detergente não-iônico zwittergent 3-14 na concentração
de 5 %; a proteína de interesse permaneceu na fração solúvel após refolding in
vitro (Figura 3 do Manuscrito 1). Entretanto, os procedimentos de unfolding e
76
refolding podem causar modificações irreversíveis na estrutura protéica,
inclusive podem afetar a sua atividade biológica (SCHEIN, 1989).
De fato, quando testamos a atividade da enzima MtbSD sem mutação
após utilizar os protocolos de solubilização que utilizam uréia e zwittergent 3-
14, esta enzima não apresentou atividade mensurável (dados não mostrados).
Já que o nosso objetivo é comparar os perfis cinéticos das proteínas mutantes
com o da não mutante, o uso destes agentes que podem modificar a atividade
enzimática deve ser evitado. Então, os nossos esforços foram focalizados no
sentido de obter a expressão destas proteínas na fração solúvel.
O método de rompimento celular que utiliza a prensa de French levou as
proteínas recombinantes de interesse à fração insolúvel após testes com
variadas pressões (dados não mostrados). Felizmente, o método de
congelamento e descongelamento foi testado e, com sucesso, conseguiu
liberar uma fração das proteínas de interesse do citoplasma da célula (Figura 4
do Manuscrito 1).
Este método havia sido previamente usado para obter a enzima MtbSD
não mutada na fração solúvel e em sua forma ativa (MAGALHÃES et al., 2002).
Cabe ressaltar que este não é um método de lise como a sonicação e a prensa
de French; as proteínas solúveis são liberadas através de poros transientes
que se formam na membrana celular durante os ciclos de congelamento e
descongelamento (JOHNSON e HECHT, 1994).
De uma maneira geral, dificuldades na expressão de proteínas na fração
solúvel são consideradas importantes empecilhos aos estudos bioquímicos e
cristalográficos das proteínas de M. tuberculosis (VICENTELLI et al., 2003).
Anteriormente, a expressão da MtbSD na fração solúvel havia sido uma tarefa
77
difícil de atingir (MAGALHÃES et al., 2002). O protocolo de expressão
estabelecido aqui representa um importante passo para conseguir as proteínas
mutantes na fração solúvel e que permitirá os estudos funcionais desejados.
78
4.3 Purificação da enzima mutante K69A
Conseguimos purificar a enzima mutante K69A até a aparente
homogeneidade utilizando um protocolo otimizado em relação ao descrito
anteriormente (FONSECA et al., 2006). Este novo protocolo envolve três
etapas cromatográficas, enquanto o anterior possui quatro. Com o protocolo
otimizado obteve-se aumentos de 8,9 para 13,5 % no rendimento da
purificação e de 8,5 para 11,8 na taxa de purificação (Tabela 3 do Manuscrito
1).
O protocolo anterior produzia 10,8 mg de MtbSD homogênea a partir de
49 g de células E. coli BL21(DE3) (0,2 mg MtbSD/g célula). O protocolo
utilizado neste trabalho produz 1,5 mg da proteína MtbSD a partir de 5 g de
células E. coli C41(DE3) (0,3 mg MtbSD/g célula), o que representa um
aumento próximo a 50 % na produção desta proteína recombinante. Além
disso, deve-se ressaltar que este protocolo de purificação não utiliza a adição
de cauda de histidina a fim de facilitar a purificação de proteínas
recombinantes. As estratégias para purificar as enzimas AroE de H. pylori
(HAN et al., 2006), AroE de H. influenzae (YE et al., 2003), YdiB de E. coli
(BENACH et al., 2003), SD-like de H. influenzae (SINGH et al., 2005) resultam
em proteínas recombinantes com caudas extras de histidina. Um protocolo de
purificação que adiciona cauda de histidina à SD recombinante de M.
tuberculosis já foi publicado (ZHANG et al., 2005).
Embora muitos protocolos que utilizam esta estratégia de cromatografia
de afinidade por níquel compreendam uma única coluna de purificação, a
adição de cauda de histidina pode alterar significativamente a estrutura protéica
e sua atividade biológica (CHANT et al., 2005; FONDA et al., 2002). Tendo isto
79
em mente, evitou-se utilizar técnicas que pudessem alterar o perfil protéico e
impedir que nossos objetivos de caracterização enzimática fossem alcançados.
Assim, as enzimas MtbSD sem mutação e a mutante K69A (Figura 5 do
Manuscrito 1) foram purificadas até a aparente homogeneidade usando o
protocolo de apenas três passos cromatográficos. Determinamos os
parâmetros cinéticos aparentes da enzima MtbSD não mutante após
purificação utilizando o protocolo otimizado (Tabela 1 do Manuscrito 2). Os
valores de Km e Vmáx determinados neste trabalho são muito semelhantes às
constantes aparentes já publicadas para esta enzima (FONSECA et al., 2006),
provando que o protocolo de purificação otimizado resulta na enzima MtbSD
ativa e permitindo futuras análises funcionais das proteínas mutantes após
purificação por este protocolo.
80
4.4 Caracterização da enzima mutante K69A
Depois da purificação da enzima MtbSD K69A, realizamos
imediatamente os experimentos de caracterização enzimática, determinando as
constantes cinéticas aparentes, Km e Vmáx desta enzima mutante, no sentido
direto da reação.
Os parâmetros cinéticos aparentes (Tabela 1 do Manuscrito 2) mostram
que o valor da constante catalítica (Kcat) da enzima MtbSD sem mutação é 68
vezes maior do que o valor da K69A. Foram observados aumentos modestos
nos valores de Km para o DHS e para o NADPH. A enzima mutante apresentou
diminuição de 182 vezes na eficiência catalítica (Kcat/Km) para o substrato
DHS e de 189 vezes para o cofator NADPH. A diminuição na eficiência
catalítica foi devida predominantemente ao valor de Kcat diminuído, com pouco
efeito dos ligeiros aumentos nas constantes de Michaelis-Menten para ambos
os substratos. De fato, o valor de Kcat para a enzima mutante permaneceu
apenas 1,46 % daquele da enzima não mutante.
Estes resultados sugerem que a o resíduo Lis69 da MtbSD está
envolvido na catálise e que tem pouca ou nenhuma importância na ligação ao
substrato. Para confirmar essa proposição, ensaios de espectrofluorimetria
foram realizados para determinar a constante de dissociação (Kd) para a
formação do complexo binário enzima-substrato. Os resultados destes
experimentos apontam diferenças modestas nos valores de Kd para as
enzimas MtbSD não mutante e K69A (Tabela 1 do Manuscrito 2). Assim,
ensaios cinéticos em estado estacionário e medidas espectrofluorimétricas
indicam que o resíduo conservado Lis69 tem importante função na catálise e
que não está envolvido na ligação ao substrato na enzima MtbSD.
81
Análise de estruturas tridimensionais dos complexos ternários de SDs de
Thermus termophilus (BAGAUTDINOV e KUNISHIMA, 2007) e de Aquifex
aeolicus (GAN et al., 2007) complexados com NADP+ and SHK sugerem que o
resíduo protonado Lis (Lis64 de T. termophilus and Lis70 in A. aeolicus)
interage com o carbono-3 do DHS, atuando, então, como um grupo catalítico
ácido-básico que doa um próton para o grupamento carbonila do DHS durante
a redução e que remove um próton durante a oxidação do SHK.
A Lis67 da SD-like de Haemophilus influenzae (SINGH et al., 2005) e a
Lis385 da DHQ-SD de Arabidopsis thaliana (SINGH e CHRISTENDAT, 2006)
têm função crítica na catálise. Interessantemente, a substituição do resíduo Lis
conservado (Lis71) na quinato/SD YdiB de E. coli por Ala causou apenas uma
pequena diminuição no Kcat e um grande aumento no Km do SHK (LINDNER
et al., 2005). Estes resultados demonstram que enzimas que catalisam as
mesmas reações químicas podem usar mecanismos catalíticos diferentes.
Aqui, demonstramos que a Lis69 da MtbSD é importante para a catálise e que
provavelmente esteja envolvida na estabilização da carga negativa gerada no
átomo oxigênio da carbonila do DHS, na reação direta.
De certa forma, parecia intrigante que os resultados de mutagênese
sítio-direcionada para as enzimas SDs, até então, sugeriam papéis diferentes
para este resíduo nestas enzimas: a Lis69 (numeração de acordo com a
sequência da MtbSD) é crucial para a catálise na enzima DHQ-SD de A.
thaliana (SINGH e CHRISTENDAT, 2006) e na SD-like de H. influenzae
(SINGH et al., 2005), mas é importante somente para a ligação ao substrato na
YdiB de E. coli (LINDNER et al., 2005).
82
As enzimas AroE, YdiB e SD-like têm estruturas tridimensionais muito
similares mas suas propriedades bioquímicas como especificidade por
substratos e parâmetros cinéticos são muito distintos (SINGH et al., 2005).
Embora AroE, YdiB e SD-like consigam catalisar a reação de chiquimato
desidrogenase, esta pode ser somente uma atividade secundária para YdiB e
SD-like; YdiB possui outros substratos específicos, catalisando a redução
reversível do desidroquinato a quinato; os valores de Kcat para YdiB de E. coli
e para SD-like de H. influenza são muito baixos comparados aos Kcat das
enzimas AroE. (LINDNER et al., 2005; SINGH et al., 2005). Estas diferenças
funcionais e bioquímicas podem estar relacionadas com os prováveis distintos
papéis que o resíduo Lis69 possa ter dentre as enzimas da família chiquimato
desidrogenase.
Os nossos resultados estão de acordo com os estudos de mutagênese
envolvendo a enzima bifuncional DHQ-SD de A. thaliana e a SD-like de H.
influenzae, já que os valores de Kcat estão bastante diminuídos e mudanças
insignificantes são observadas nos valores de Km e nos resultados de
fluorimentria, comparando a enzima mutante K69A com a não mutante.
(SINGH et al., 2005; SINGH e CHRISTENDAT, 2006).
Este trabalho apresentou a primeira identificação de um aminoácido
cataliticamente importante para a enzima MtbSD, através da técnica de
mutagênese sítio-direcionada. A purificação e os ensaios cinéticos das outras
enzimas mutantes K69I, K69H, K69Q, D105A, D105N poderão ajudar a melhor
caracterizar o mecanismo catalítico desta enzima de M. tuberculosis. Um
entendimento mais detalhado, a nível molecular, das enzimas da via do
83
chiquimato pode servir como base para o desenho racional de novos e efetivos
agentes antimicrobianos.
84
5 REFERÊNCIAS BIBLIOGRÁFICAS
Amrhein, N.; Deus, B.; Gehrke, P.; Steinrucken, H.C. The site of the inhibition of
the shikimate pathway by glyphosate. II. Interference of glyphosate with
chorismate formation in vivo and in vitro, Plant Physiol. 66 (1980) 830-834.
Arcuri, H.A.; Borges, J.C.; Fonseca, I.O.; Pereira, J.H.; Neto, J.R.; Basso, L.A.;
Santos, D.S.; de Azevedo Jr, W.F. Structural studies of shikimate 5-
dehydrogenase from Mycobacterium tuberculosis, Proteins 7 February 2008.
doi:10.1002/prot.21953.
Bagautdinov, B. & Kunishima, N. Crystal structures of shikimate dehydrogenase
AroE from Thermus thermophilus HB8 and its cofactor and substrate
complexes: insights into the enzymatic mechanism, J. Mol. Biol. 373 (2007)
424-438.
Basso, L.A. & Blanchard, J.S. Resistance to antitubercular drugs, Adv. Exp.
Med. Biol. 456 (1998) 115-144.
Basso, L.A.; da Silva, L.H.; Fett-Neto, A.G.; de Azevedo Jr, W.F.; Moreira, I.S.;
Palma, M.S.; Calixto, J.B.; Astolfi Filho, S.; dos Santos, R.R.; Soares, M.B.;
Santos, D.S. The use of biodiversity as source of new chemical entities against
defined molecular targets for treatment of malaria, tuberculosis, and T-cell
mediated diseases – a review, Mem. Inst. Oswaldo Cruz 100 (2005) 475-506.
85
Benach, J.; Lee, I.; Edstrom, W.; Kuzin, A.P.; Chiang, Y.; Acton, T.B.;
Montelione, G.T.; Hunt, J.F. The 2.3-Å crystal structure of the shikimate 5-
dehydrogenase orthologue YdiB from Escherichia coli suggests a novel
catalytic environment for an NAD-dependent dehydrogenase, J. Biol. Chem.
278 (2003) 19176-19182.
Bentley, R. The shikimate pathway – a metabolic tree with many branches, Crit.
Rev. Biochem. Mol. Biol. 25 (1990) 307-384.
Bloom, R.B. & Murray, C.J.L. Tuberculosis: commentary on a reemergent killer,
Science 257 (1992) 1055-1064.
CDC (Centers for Disease Control and Prevention), Emergence of
Mycobacterium tuberculosis with extensive resistance to second-line drugs-
worldwide, Morb. Mortal. Wkly. Rep. 55 (2006) 301-305.
Chant, A.; Kraemer-Pecore, C.M.; Watkin, R.; Kneale, G.G. Attachment of a
histidine tag to the minimal zinc finger protein of the Aspergillus nidulans gene
regulatory protein AreA causes a conformational change at the DNA-binding
site, Protein Expr. Purif. 39 (2005) 152-159.
Charles, I.G.; Keyte, J.W.; Brammar, W.J.; Smith, M.; Hawkins, A.R. The
isolation and nucleotide sequence of the complex AROM locus of Aspergillus
nidulans, Nucleic Acids Res. 14 (1986) 2201-2213.
86
Coggins, J.R.; Abell, C.; Evans, L.B.; Fredrickson, M.; Robinson, D.A.; Roszak,
A.W.; Lapthorn, A.P. Experiences with the shikimate pathway-enzymes as
targets for rational drug design, Biochem. Soc. Trans. 31 (2003) 548-552.
Cole, S.T.; Brosch, R.; Parkhill, J.; Garnier, T.; Churcher, C.; Harris, D.; Gordon,
S.V.; Eiglmeier, K.; Gas, S.; Barry, C.E.; Tekaia, F.; Badcock, K.; Basham, D.;
Brown, D.; Chillingworth, T.; Connor, R.; Davies, R.; Devlin, K.; Feltwell, T.;
Gentles, S.; Hamlin, N.; Holroyd, S.; Hornsby, T.; Jagels, K.; Krogh, A.;
McLean, J.; Moule, S.; Murphy, L.; Oliver, K.; Osborne, J.; Quail, M.A.;
Rajandream, M.A.; Rogers, J.; Rutter, S.; Seeger, K.; Skelton, J.; Squares, R.;
Squares, S.; Sulston, J.E.; Taylor, K.; Whitehead, S.; Barrell, B.G. Deciphering
the biology of Mycobacterium tuberculosis from the complete genome
sequence, Nature 393 (1998) 537-544.
Corbett, E.L.; Watt, C.J.; Walker, N.; Maher, D.; Williams, B.G.; Raviglione,
M.C.; Dye, D. The growing burden of tuberculosis, Arch. Intern. Med. 163
(2003) 1009-1021.
Daniel, T.M. Captain of death: the story of tuberculosis, University of Rochester
Press, New York, 1997.
Deka, R.K.; Anton, I.A.; Dunbar, B.; Coggins, J.R. The characterisation of the
shikimate pathway enzyme dehydroquinase from Pisum sativum, FEBS Lett.
349 (1994) 397-402.
87
Dias, M.V.; Ely, F.; Canduri, F.; Pereira, J.H.; Frazzon, J.; Basso, L.A.; Palma,
M.S.; de Azevedo Jr, W.F.; Santos, D.S. Crystallization and preliminary X-ray
crystallographic analysis of chorismate synthase from Mycobacterium
tuberculosis, Acta Crystallogr. D Biol. Crystallogr. 60 (2004) 2003-2005.
Dorman, S.E. & Chaisson, R.E. From magic bullets back to the Magic Mountain:
the rise of extensively drug-resistant tuberculosis, Nat. Med. 13 (2007) 295-298.
Dormandy, T. The white death: a history of tuberculosis, New York University
Press, 2002.
Ducati, R.G.; Ruffino-Neto, A.; Basso, L.A.; Santos, D.S. The resumption of
comsumption – a review on tuberculosis, Mem. Inst. Oswaldo Cruz 101 (2006)
679-714.
Duncan, K. Progress in TB drug development and what is still needed,
Tuberculosis 83 (2003) 201-207.
Duncan, K.; Edwards, R.M.; Coggins, J.R. The pentafunctional arom enzyme of
Saccharomyces cerevisiae is a mosaic of monofunctional domains, Biochem. J.
246 (1987) 375-386.
Dunlap, N.E.; Bass, J.; Fujiwara, P.; Hopewell, P.; Horsburgh Jr., C.R.;
Slafinger, M.; Simone, P.M. Diagnostic standards and classification of
tuberculosis in adults and children, Am. J. Respir. Crit. Care Med. 161 (2000)
1376-1395.
88
Dye, C.; Scheele, S.; Dolin, P.; Pathania, V.; Raviglione, M.C. Global burden of
tuberculosis: estimated incidence, prevalence, and mortality by country, JAMA
282 (1999) 677-686.
Enarson, D.A. & Murray, J.F. Global epidemiology of tuberculosis. In WM Rom,
S Garay (eds) Tuberculosis, Little, Brown and Co., Boston, (1996) 57-75.
Enserink, M. Driving a stake into resurgent TB, Science 293 (2001) 234-235.
Fätkenheuer, G.; Taelman, H.; Lepage, P.; Schwenk, A.; Werzel, R. The return
of tuberculosis, Diagn. Microbiol. Infect. Dis. 34 (1999) 139-146.
Fernandes, C.L.; Breda, A.; Santos, D.S.; Basso, L.A.; Souza, O.N. A structural
model for chorismate synthase from Mycobacterium tuberculosis in complex
with coenzyme and substrate, Comput. Biol. Med. 37 (2007) 149-158.
Fonda, I.; Kenig, M.; Gaberck-Porekar, V.; Prostovaek, P.; Menart, V.
Attachment of histidine tags to recombinant tumor necrosis factor-alpha
drastically changes its properties, Sci. World J. 2 (2002) 1312-1325.
Fonseca, I.O.; Magalhães, M.L.B.; Oliveira, J.S.; Silva, R.G.; Mendes, M.A.;
Palma, M.S.; Santos, D.S.; Basso, L.A. Functional shikimate dehydrogenase
from Mycobacterium tuberculosis H37Rv: purification and characterization,
Protein Expr. Purif. 46 (2006) 429-437.
89
Fonseca, I.O.; Silva, R.G.; Fernandes, C.L.; de Souza, O.N.; Basso, L.A.;
Santos, D.S. Kinetic and chemical mechanisms of shikimate dehydrogenase
from Mycobacterium tuberculosis, Arch. Biochem. Biophys. 457 (2007) 123-
133.
Gan, J.; Wu, Y.; Prabakaran, P.; Gu, Y.; Li, Y.; Andrykovitch, M.; Liu, H.; Gong,
Y.; Yan, H.; Ji, X. Structural and biochemical analyses of shikimate
dehydrogenase AroE from Aquiflex aeolicus: implications for the catalytic
mechanism, Biochemistry 46 (2007) 9513-9522.
Han, C.; Wang, L.; Yu, K.; Chen, L.; Hu, L.; Chen, K.; Jiang, H.; Shen, X.
Biochemical characterization and inhibitor discovery of shikimate
dehydrogenase from Helicobacter pylori, FEBS J. 273 (2006) 4682-4692.
Johnson, B.H. & Hecht, M.H. Recombinant proteins can be isolated from E. coli
cells by repeated cycles of freezing and thawing, Biotechnology 12 (1994)
1357-1360.
Kaufmann, S.H.E. A short history of Robert Koch’s fight against tuberculosis:
Those who do not remember the past are condemned to repeat it, Tuberculosis
83 (2003) 86-90.
Kelley, K.C.; Huestis, K.J.; Austen, D.A.; Sanderson, C.T.; Donoghue, M.A.;
Stickel, S.K.; Kawasaki, E.S.; Osburne, M.S. Regulation of sCD4-183 gene
90
expression from phage-T7-based vectors in Escherichia coli, Gene 156 (1995)
33-36.
Knigge, A.; Morr, H.; Killian, A. Tuberculosis and HIV/AIDS. Epidemics:
Opportunities for cross support. Disease Control (Tuberculosis) and Health
Promotion AIDS Control in Developing Contries. Deutsche Gesellschaft für
Technische Zusammenarbeit (GTZ) GmbH, 2000.
Lindner, H.A.; Nadeau, G.; Matte, A.; Michel, G.; Ménard, R.; Cygler, M. Site-
directed mutagenesis of the active site region in the quinate/shikimate 5-
dehydrogenase YdiB of Escherichia coli, J. Biol. Chem. 280 (2005) 7162-7169.
Magalhães, M.L.; Pereira, C.P.; Basso, L.A.; Santos, D.S. Cloning and
expression of functional shikimate dehydrogenase (EC 1.1.1.25) from
Mycobacterium tuberculosis H37Rv, Protein Expr. Purif. 26 (2002) 59-64.
Manabe, Y.C. & Bishai, W.R. Latent Mycobacterium tuberculosis-persistence,
patience, and winning by waiting, Nat. Med. 6 (2000) 1327-1329.
Mendonça, J.D.; Ely, F.; Palma, M.S.; Frazzon, J.; Basso, L.A.; Santos, D.S.
Functional charaterization by genetic complementation of aroB-encoded
dehydroquinate synthase from Mycobacterium tuberculosis H37Rv and its
heterologous expression and purification, J. Bacteriol. 189 (2007) 6246-6252.
91
Michel, G.; Roszak, A.W.; Sauvé, V.; Maclean, J.; Matte, A.; Coggins, J.R.;
Cygler, M.; Lapthorn, A.J. Structures of shikimate dehydrogenase AroE and its
paralog YdiB, J. Biol. Chem. 278 (2003) 19463-19472.
O’Brien, R.J. & Nunn, P.P. The need for new drugs against tuberculosis, Am. J.
Respir. Crit. Care Med 162 (2001) 1055-1058.
Oliveira, J.S.; Mendes, M.A.; Palma, M.S.; Basso, L.A.; Santos, D.S. One-step
purification of 5-enolpyruvylshikimate-3-phosphate synthase enzyme from
Mycobacterium tuberculosis, Protein Expr. Purif. 28 (2003) 287-292.
Padyana, A.K. & Burley, S.K. Crystal structure of shikimate 5-dehydrogenase
(SDH) bound to NADP: insights into function and evolution, Structure 11 (2003)
1005-1013.
Parish, T. & Stoker, N.G. The common aromatic amino acid biosynthesis
pathway is essential in Mycobacterium tuberculosis, Microbiology 148 (2002)
3069-3077.
Pasqualoto, K.F & Ferreira, E.I. An approach for the rational design of new
antituberculosis agents, Curr. Drug Targets 2 (2001) 427-437.
Pereira, J.H.; Oliveira, J.S.; Canduri, F.; Dias, M.V.; Palma, M.S.; Basso, L.A.;
Santos, D.S.; de Azevedo Jr, W.F. Structure of shikimate kinase from
92
Mycobacterium tuberculosis reveals the binding of shikimic acid, Acta
Crystallogr. D Biol. Crystallogr. 60 (2004) 2310-2319.
Rizzi, C.; Frazzon, J.; Ely, F.; Weber, P.G.; Fonseca, I.O.; Gallas, M.; Oliveira,
J.S.; Mendes, M.A.; Souza, B.M.; Palma, M.S.; Santos, D.S.; Basso, L.A. DAHP
synthase from Mycobacterium tuberculosis H37Rv: cloning, expression, and
purification of functional enzyme, Protein Expr. Purif. 40 (2005) 23-30.
Roberts, F.; Roberts, C.W.; Johnson, J.J.; Kyle, D.E.; Krell, T.; Coggins, J.R.;
Coombs, G.H.; Milhous, W.K.; Tzipori, S.; Ferguson, D.J.; Chakrabarti, D.;
McLeod, R. Evidence for the shikimate pathway in apicomplexan parasites,
Nature 393 (1998) 801-805.
Schein, C.H. Production of soluble recombinant proteins in bacteria,
Biotechnology 7 (1989) 1141-1149.
Sepkowitz, K.A.; Raffalli, J.; Riley, L.; Kiehn, T.E.; Armstrong, D. Tuberculosis in
the AIDS era, Clin. Microbiol. Rev. 8 (1995) 180-199.
Singh, S.; Korolev, S.; Koroleva, O.; Zarembinski, T.; Collart, F.; Joachimiak, A.;
Christendat, D. Crystal structure of a novel shikimate dehydrogenase from
Haemophilus influenzae, J. Biol. Chem. 280 (2005) 17101-17108.
93
Singh, S.A. & Christendat, D. Structure of Arabidopsis dehydroquinate
dehydratase-shikimate dehydrogenase and implications for metabolic
channeling in the shikimate pathway, Biochemistry 45 (2006) 7787-7796.
Vicentelli, R.; Bignon, C.; Gruez, A.; Canaan, S.; Sulzenbacher, G.; Tegoni, M.;
Campanacci, V.; Cambillau, C. Medium-scale structural genomics: strategies for
protein expression and crystallization, Acc. Chem. Res. 36 (2003) 197-225.
WHO (World Health Organization). Global tuberculosis control: surveillance,
planning, financing. WHO report 2006. World Health Organization, Geneva,
Switzerland, 2006.
Wickelgren, I. New clues to how the TB bacillus persists, Science 288 (2000)
1314-1315.
Ye, S.; von Delf, F.; Brooun, A.; Knuth, M.W.; Swanson, R.V.; McRee, D.E. The
crystal structure of shikimate dehydrogenase (AroE) reveals a unique NADPH
binding mode, J. Bacteriol. 185 (2003) 4144-4151.
Zhang, X.; Zhang, S.; Hao, F.; Lai, X.; Yu, H.; Huang, Y.; Wang, H. Expression,
purification and properties of shikimate dehydrogenase from Mycobacterium
tuberculosis, J. Biochem. Mo. Biol. 38 (2005) 624-631.
94
6 ANEXOS
6.1 Alinhamentos de sequências de chiquimato desidrogenases
Alinhamento múltiplo de seqüências das enzimas AroE de E. coli, Vibrio cholerae,
QutB de E. nidulans, Qa-3 de N. crassa, YdiB de E. coli e L. monocytogenes, DHQ-SD
de Lycopersicon esculentum (MICHEL et al., 2003).
95
Alinhamento de seqüências de SD de várias bactérias: E. coli, H. influenzae, N.
meningitidis, M. jannaschii, A. fulgidus, M. tuberculosis e H. pylori (HAN et al., 2006).
96
Alinhamento múltiplo de seqüências das enzimas AroE de Mycobacterium
tuberculosis, AroE de E. coli e YdiB de E. coli (FONSECA et al., 2007).
97
Alinhamento múltiplo de seqüências de AroE dos seguintes organismos: H. influenzae,
Helicobacter pylori, Aquifex aeolicus, Bacillus subtilis, Staphylococcus aureus,
Streptococcus pneumoniae, Thermotoga marítima, E. coli, Pseudomonas aeruginosa,
Neisseria gonorrhoeae, Methanococcus jannaschii e Pyrococcus furiosus (YE et al.,
2003).
98
Alinhamento múltiplo de seqüências das enzimas AroE de Thermus thermophilus, E.
coli, H. influenzae e M. jannaschii, YdiB de E. coli e Corynebacterium glutamicum, SD-
like de H. influenzae, DHQ-SD de A. thaliana (BAGAUTDINOV e KUNISHIMA, 2007).
99
6.2 Seqüência dos resíduos de aminoácidos da MtbSD #
MSEGPKKAGV LGSPIAHSRS PQLHLAAYRA LGLHDWTYER IECGAAELPV
VVGGFGPEWV GVSVTMPGKF AALRFADERT ARADLVGSAN TLVRTPHGWR
ADNTDIDGVA GALGAAAGHA LVLGSGGTAP AAVVGLAELG VTDITVVARN
SDKAARLVDL GTRVGVATRF CAFDSGGLAD AVAAAEVLVS TIPAEVAAGY
AGTLAAIPVL LDAIYDPWPT PLAAAVGSAG GRVISGLQML LHQAFAQVEQ
FTGLPAPREA MTCALAALD
# Os resíduos em vermelho foram mutados
100
6.3 Seqüência de nucleotídeos do gene aroE de M. tuberculosis *
1 atgagcgaag gtcccaaaaa agccggcgtg cttggttcgc cgatcgcgca ttcccgctcc
61 ccgcagctgc acctggccgc ctaccgggcg ttggggctgc acgactggac ctatgagcgc
121 atcgaatgcg gtgcggccga gttgcccgtc gtggtcggtg gtttcggacc ggagtgggtc
181 ggtgtttcgg tgaccatgcc gggcaagttc gccgccctgc ggttcgccga cgagcgcacc
241 gcacgcgcgg accttgtcgg ttcggccaac accctggttc ggacgccgca tggctggcgg
301 gccgacaaca ccgacatcga cggggtggcc ggggcgttgg gggcggctgc tggacacgcg
361 ctggtgctgg ggtccggggg gaccgcaccg gcggccgtgg tggggctggc cgaactcggg
421 gtcaccgaca tcaccgtggt ggcgcgcaac tcggacaagg cggcccggct ggtggacctg
481 ggcacacggg tcggcgtggc gacccggttc tgcgcgttcg acagcggtgg gttggccgat
541 gcggtggccg ccgcggaagt gctggtcagc accattccag cggaggtggc cgcggggtat
601 gccggcacct tggccgcgat cccggtgctg ttggacgcca tctacgatcc gtggcccaca
661 ccgctggccg ccgcggtcgg atcggcgggc gggcgggtga tcagcgggct gcagatgttg
721 ctgcatcagg cgttcgcgca ggtggagcag ttcaccgggc tacccgcccc ccgcgaagcg
781 atgacttgcg cgctggccgc gttggactag
* Em negrito estão as seqüências definidas como base para o desenho do par de
oligonucleotídeos iniciadores para cada mutação: de 181 a 226 para as mutações da
lisina 69 e de 292 a 336 para as mutações do aspartato 105; em vermelho estão as
duas trincas de nucleotídeos mutadas.
101
6.4 Géis de agarose a 2 %
A B C
D E F
Eletroforese em gel de agarose a 2 % do vetor pET23a(+) contendo
ou não o inserto de interesse, aroE, após a mutagênese sítio-direcionada e
após clivagem com as enzimas de restrição NdeI e BamHI. Possíveis
mutações: A, K69A; B, K69I; C, K69H; D, K69Q; E, D105A; F, D105N. N = não
clivado; C = clivado; M = marcador 1 Kb plus DNA Ladder.
N C M C C C C N N N N N C C C C C N N N N M N C C C C C N N N N M
5000 pb
2000 pb
1000 pb
850 pb
N C M C C C C N N N N N C N C NC M C C C C N N N N N C N C N C N C N C N C N C N C M
102
6.5 Carta de submissão do artigo “Screening of experimental conditions to
express soluble shikimate dehydrogenase mutants from Mycobacterium
tuberculosis H37Rv” à revista Protein Expression and Purification
From: PEP (ELS) [mailto:[email protected]] Sent: Tue 5/13/2008 10:59 AM To: Luiz Augusto Basso Subject: Protein Expression and Purification: Submission Confirmation
Title: Screening of experimental conditions to express soluble shikimate dehydrogenase mutants from Mycobacterium tuberculosis H37Rv Corresponding Author: Dr. Luiz Augusto Basso Authors: Valnês S Rodrigues-Junior, MSc; Diogenes S Santos, PhD Dear Dr. Basso, This is to confirm that the above-mentioned manuscript has been received for consideration in Protein Expression and Purification. You will be able to check on the progress of your manuscript by logging on to the Elsevier Editorial System for Protein Expression and Purification as an author: http://ees.elsevier.com/prep/ Your username is: LBASSO Your password is: Your paper will be given a manuscript number shortly and you will soon receive an e-mail with this number for your reference. Thank you for submitting your manuscript to Protein Expression and Purification. Should you have any questions, please feel free to contact our office. Kind regards, Susan Ikeda Protein Expression and Purification Journal Manager Elsevier 525 B Street, Suite 1900 San Diego, CA 92101-4495 USA Phone: 619 699 6793 Fax: 619 699 6211 E-mail: [email protected]
103
6.6 Carta de submissão do artigo “The conserved Lysine 69 residue plays a
catalytic role in Mycobacterium tuberculosis shikimate dehydrogenase” à revista
Journal of Bacteriology
From: [email protected] [mailto:[email protected]] Sent: Wed 4/30/2008 11:23 AM To: Luiz Augusto Basso Subject: Manuscript submission (JB00598-08 Version 1)
Dr Luiz A. Basso Pontificia Universidade Catolica do Rio Grande do Sul - PUCRS Faculdade de Biociências - Centro de Pesquisas em Biologia Molecular e Funcional Av. Ipiranga, 6681 TECNOPUC - Predio 92A Porto Alegre, Rio Grande do Sul 90619-900 Brazil
Re: The conserved Lysine 69 residue plays a catalytic role in Mycobacterium tuberculosis
shikimate dehydrogenase (JB00598-08 Version 1)
Dear Dr. Basso:
You have successfully submitted your manuscript via the Rapid Review system. The control
number of your manuscript is JB00598-08 Version 1. Take note of this number, and refer to it in
any correspondence with the Journals Department or with the editor. You may log onto the
Rapid Review system at any time to see the current status of your manuscript and the name of
the editor handling it. The URL is http://www.rapidreview.com/ASM2/author.html, and your user
name is labasso. To find contact information for the editor handling your manuscript, go to the
following URL: http://www.asm.org/journals/editors.asp
In submitting your manuscript to the Journal of Bacteriology (JB), the author(s) guarantees that
a manuscript with substantially the same content has not been submitted or published
elsewhere and that all of the authors are aware of and agree to the submission.
104
By publishing in the journal, the authors agree that any DNAs, viruses, microbial strains, mutant
animal strains, cell lines, antibodies, and similar materials newly described in the article are
available from a national collection or will be made available in a timely fashion, at reasonable
cost, and in limited quantities to members of the scientific community for noncommercial
purposes. The authors guarantee that they have the authority to comply with this policy either
directly or by means of material transfer agreements through the owner.
Similarly, the authors agree to make available computer programs, originating in the authors'
laboratory, that are the only means of confirming the conclusions reported in the article but that
are not available commercially. The program(s) and suitable documentation regarding its (their)
use may be provided by any of the following means: (i) as a program transmitted via the
Internet, (ii) as an Internet server-based tool, or (iii) as a compiled or assembled form on a
suitable medium (e.g., magnetic or optical). It is expected that the material will be provided in a
timely fashion and at reasonable cost to members of the scientific community for
noncommercial purposes. The authors guarantee that they have the authority to comply with
this policy either directly or by means of material transfer agreements through the owner.
If your manuscript is accepted for publication, a condition of acceptance is that you assign
copyright to the American Society for Microbiology. A copyright transfer agreement is sent with
each letter of acceptance after the manuscript has been scheduled for publication.
If your manuscript is accepted for publication in a 2008 issue, page charges (subject to change
without notice) will be assessed at $65 per printed page for the first eight pages and $200 for
each page in excess of eight for a corresponding author who is an ASM member or $75 per
printed page for the first eight pages and $250 for each page in excess of eight for a
nonmember corresponding author. A corresponding author who is not a member may join ASM
to obtain the member rate. If the research was not supported, you may send a request for a
waiver of page charges to the Director, Journals. For more details, including type of articles not
charged, see the Instructions to Authors.
105
IMPORTANT NOTICE: For its primary-research journals, ASM posts online PDF versions of
manuscripts that have been peer reviewed and accepted but not yet copyedited. This feature is
called “JB Accepts” and is accessible from the Journals website. The manuscripts are
published online as soon as possible after acceptance, on a weekly basis, before the
copyedited, typeset versions are published. They are posted “As Is” (i.e., as submitted by the
authors at the modification stage), and corrections/changes are NOT accepted. Accordingly,
there may be differences between the JB Accepts version and the final, typeset version. The
manuscripts remain listed on the JB Accepts page until the final, typeset versions are posted, at
which point they are removed from the JB Accepts page and become available only through
links from the final, typeset version. They are under subscription access control until 4 months
after the typeset versions are posted, when access to all forms becomes free to everyone. Any
supplemental material intended, and accepted, for publication is not posted until publication of
the final, typeset article.
Thank you for submitting your manuscript for consideration.
Jack Kenney
Production Editor
Journal of Bacteriology (JB)
106
CURRICULUM VITÆ
RODRIGUES-JUNIOR, V. R.
1. DADOS PESSOAIS Nome: Valnês da Silva Rodrigues Junior Local e data de nascimento: São Borja, Rio Grande do Sul, Brasil, 12 de setembro de 1982 Endereço profissional: Av. Ipiranga, 6681; TecnoPUC prédio 92ª Telefone profissional: (51) 3320-3629 E-mail: [email protected] 2. FORMAÇÃO Farmácia (Universidade Federal do Rio Grande do Sul, 2001-2005); Mestrado em Biologia Celular e Molecular (Universidade Federal do Rio Grande do Sul, 2006-2008) 3. ESTÁGIOS Laboratório de Parasitologia, Departamento de Microbiologia, Instituto de Biociências, Universidade Federal do Rio Grande do Sul. Orientação: Profa. Dra. Marilise B. Rott e Profa. Dra. Márcia B. Mentz Período: Mar 2002 – Mar 2003 Iniciação Científica – Voluntário Projeto de pesquisa: “Levantamento epidemiológico de parasitas em areias de recreação de parques públicos da cidade de Porto Alegre, RS”. Laboratório de Erros Inatos do Metabolismo, Departamento de Bioquímica, Instituto de Biociências, Universidade Federal do Rio Grande do Sul. Orientação: Prof. Dr. Clovis Milton Duval Wannmacher Período: Abr 2003 – Dez 2005 Bolsista de Iniciação Científica – CNPq Projeto de pesquisa: “Estudo dos mecanismos de neurotoxicidade de aminoácidos em aminoacidopatias”.
107
4. ARTIGOS COMPLETOS PUBLICADOS
RECH, V. C., FEKSA, L. R., FLECK, R. M. M., ATHAYDES, G. A., DORNELLES, P. K. B., RODRIGUES-JUNIOR, V. S., WANNMACHER, C. M. D. Cysteamine prevents inhibition of thiol-containing enzymes caused by cystine or cystine dimethylester loading in rat brain cortex. Metabolic Brain Disease 11111, p.PMID: 18418703, 2008. OLIVEIRA, P. R. P., RODRIGUES-JUNIOR, V. S., RECH, V. C., WANNMACHER, C. M. D. Cystine inhibits creatine kinase activity in pig retina. Archives of Medical Research 38 : 164-169, 2007. RECH, V. C., ATHAYDES, G. A., FEKSA, L. R., DORNELLES, P. K. B., RODRIGUES-JUNIOR, V. S., DUTRA FILHO, C. S., WYSE, A. T. S., WAJNER, M., WANNMACHER, C. M. D. Inhibition of creatine kinase activity by cystine in the kidney of young rats. Pediatric Research 60 : 190-195, 2006. CORNELIO, A. R., RODRIGUES-JUNIOR, V. S., RECH, V. C., WYSE, A. T. S., DUTRA FILHO, C. S., WAJNER, M., WANNMACHER, C. M. D. Inhibition of creatine kinase activity from rat cerebral cortex by 3-hydroxykynurenine. Brain Research 1124 : 188-196, 2006. FLECK, R. M. M., RODRIGUES-JUNIOR, V. S., GIACOMAZZI, J., PARISSOTO, D., DUTRA FILHO, C. S., WYSE, A. T. S., WAJNER, M., WANNMACHER, C. M. D. Cysteamine prevents and reverses the inhibition of creatine kinase activity caused by cystine in rat brain cortex. Neurochemistry International 46 : 391-397, 2005. MENTZ, M. B., ROTT, M. B., VIEIRA, S. J., BALDO, G., RODRIGUES-JUNIOR, V. S. Freqüência de ovos de Toxocara spp. Em três parques públicos da cidade de Porto Alegre, Rio Grande do Sul, Brasil. Revista de Patologia Tropical 33 : 105-112, 2004. CORNELIO, A. R., RODRIGUES-JUNIOR, V. S., WYSE, A. T. S., DUTRA FILHO, C. S., WAJNER, M., WANNMACHER, C. M. D. Tryptophan reduces creatine kinase activity in the brain cortex of rats. International Journal of Developmental Neuroscience 22 : 95-101, 2004. 5. RESUMOS E TRABALHOS APRESENTADOS EM CONGRESSOS DOCKHORN, P. E., SELBACH, B. P., RODRIGUES-JUNIOR, V. S., SANTOS, D. S., BASSO, L. A. Mutagênese sítio-direcionada do gene guaC e das proteínas mutantes In: XIX Salão de Iniciação Científica UFRGS, 2007, Porto Alegre, Brasil.
108
RODRIGUES-JUNIOR, V. S., FONSECA, I. O., SANTOS, D. S., BASSO, L. A. Purification and initial characterization of the mutant shikimate dehydrogenase K69A from Mycobacterium tuberculosis H37Rv In: IX Reunião Anual do Programa de Pós-Graduação em Biologia Celular e Molecular da UFRGS, 2007, Porto Alegre, Brasil. RODRIGUES-JUNIOR, V. S., BASSO, L. A., SANTOS, D. S. Site-directed mutagenesis of the aroE-encoded shikimate dehydrogenase from Mycobacterium tuberculosis H37Rv and expression of the mutant proteins In: XXXVI Annual Meeting of the Brazilian Society for Biochemistry and Molecular Biology (SBBq) and X International Union of Biochemistry and Molecular Biology (IUBMB) Conference, 2007, Salvador, Brasil. RODRIGUES-JUNIOR, V. S., BASSO, L. A., SANTOS, D. S. Site-directed mutagenesis of the aroE-encoded shikimate dehydrogenase from Mycobacterium tuberculosis H37Rv In: VIII Reunião Anual do Programa de Pós-Graduação em Biologia Celular e Molecular do Centro de Biotecnologia da UFRGS, 2006, Porto Alegre, Brasil. ATHAYDES, G. A., RECH, V. C., STEFANELLO, A., DORNELLES, P. K. B., RODRIGUES-JUNIOR, V. S., FEKSA, L. R., WANNMACHER, C. M. D. A administração crônica de cistina e de éster de dimetilcistina altera as atividades da creatinaquinase e da piruvatoquinase de rim de rato In: XVII Salão de Iniciação Científica UFRGS, 2005, Porto Alegre, Brasil. DORNELLES, P. K. B., STEFANELLO, A., RODRIGUES-JUNIOR, V. S., CÉ, N., FEKSA, L. R., RECH, V. C., WANNMACHER, C. M. D. Atividade da piruvatoquinase e creatinaquinase em coração de ratos submetidos a modelo de cistinose In: XVII Salão de Iniciação Científica UFRGS, 2005, Porto Alegre, Brasil. CÉ, N., FLECK, R. M. M., RODRIGUES-JUNIOR, V. S., RECH, V. C., ATHAYDES, G. A., DORNELLES, P. K. B., WAJNER, M., WANNMACHER, C. M. D. Chronic administration of cystine or dimethylcistine reduces creatine kinase activity in rat brain cortex In: Reunião Anual da Sociedade Brasileira de Bioquímica e Biologia Molecular (SBBq), 2005, Águas de Lindóia, Brasil. DORNELLES, P. K. B., FEKSA, L. R., RECH, V. C., RODRIGUES-JUNIOR, V. S., ATHAYDES, G. A., WYSE, A. T. S., DUTRA FILHO, C. S., WAJNER, M., WANNMACHER, C. M. D. Chronic administration of cystine reduces pyruvate kinase activity in rat heart In: Reunião Anual da Sociedade Brasileira de Bioquímica e Biologia Molecular (SBBq), 2005, Águas de Lindóia, Brasil. KOCH, G. D. W., FLECK, R. M. M., FEKSA, L. R., STEFANELLO, A., RODRIGUES-JUNIOR, V. S., WANNMACHER, C. M. D. Efeito da administração crônica de cistina e do éster de dimetilcistina sobre as atividades da creatinaquinase e da piruvatoquinase em córtex cerebral de ratos jovens In: XVII Salão de Iniciação Científica UFRGS, 2005, Porto
109
Alegre, Brasil. RODRIGUES-JUNIOR, V. S., CORNELIO, A. R., CÉ, N., RECH, V. C., WANNMACHER, C. M. D. Efeito da 3-hidróxiquinurenina sobre a atividade da creatinaquinase de córtex cerebral de ratos jovens In: XVII Salão de Iniciação Científica UFRGS, 2005, Porto Alegre, Brasil. RODRIGUES-JUNIOR, V. S., CORNELIO, A. R., WYSE, A. T. S., DUTRA FILHO, C. S., WAJNER, M., WANNMACHER, C. M. D. Inhibition of creatine kinase activity from rat cerebral córtex by 3-hydroxykynurenine In: Reunião Anual da Sociedade Brasileira de Bioquímica e Biologia Molecular (SBBq), 2005, Águas de Lindóia, Brasil. RODRIGUES-JUNIOR, V. S., RECH, V. C., OLIVEIRA, P. R., WANNMACHER, C. M. D. Cistina inibe in vitro a atividade da creatinaquinase em retina de porcos In: XVI Salão de Iniciação Científica UFRGS, 2004, Porto Alegre, Brasil. RODRIGUES-JUNIOR, V. S., OLIVEIRA, P. R., WAJNER, M., RECH, V. C., DUTRA FILHO, C. S., WYSE, A. T. S., WANNMACHER, C. M. D. Cystine inhibits in vitro creatine kinase activity in retina from pig In: Reunião Anual da Sociedade Brasileira de Bioquímica e Biologia Molecular (SBBq), 2004, Caxambu, Brasil. RECH, V. C., ATHAYDES, G. A., DORNELLES, P. K. B., RODRIGUES-JUNIOR, V. S., GANTÚS, C. B., STEFANELLO, A., DUTRA FILHO, C. S., WYSE, A. T. S., WAJNER, M., WANNMACHER, C. M. D. Cystine inhibits the in vitro creatine kinase activity in rat kidney probably by oxidation of thiol groups In: Society for the Study of Inborn Errors of Metabolism 41st Annual Symposium, 2004, Amsterdam. Journal of Inherited Metabolic Disease. Kluwer Academic Publishers, 2004. v.27. p.63 - 63 CORNELIO, A. R., GANTÚS, C. B., RODRIGUES-JUNIOR, V. S., ATHAYDES, G. A., WYSE, A. T. S., WANNMACHER, C. M. D. Tryptophan reduces creatine kinase activity in rat brain cortex In: Reunião Anual da Sociedade Brasileira de Bioquímica e Biologia Molecular (SBBq), 2004, Caxambu, Brasil. RODRIGUES-JUNIOR, V. S., CORNELIO, A. R., WANNMACHER, C. M. D. 3-Hidóxiquinurenina inibe a atividade da creatinaquinase de córtex cerebral de ratos jovens In: XXX Semana Acadêmica de Estudos Farmacêuticos, 2004, Porto Alegre, Brasil. MENTZ, M. B., ROTT, M. B., VIEIRA, S. J., BALDO, G., RODRIGUES-JUNIOR, V. S. Levantamento epidemiológico de parasitos em areias de recreação de 3 parques públicos do município de Porto Alegre, RS In: XXXIX Congresso da Sociedade Brasileira de Medicina Tropical, 2003, Belém, Brasil.
110
RODRIGUES-JUNIOR, V. S., CORNELIO, A. R., ATHAYDES, G. A., WANNMACHER, C. M. D. Triptofano inibe a atividade da creatinaquinase em córtex cerebral de ratos jovens In: XV Salão de Iniciação Científica UFRGS, 2003, Porto Alegre, Brasil. CORNELIO, A. R., RODRIGUES-JUNIOR, V. S., ATHAYDES, G. A., DUTRA FILHO, C. S., WYSE, A. T. S., WAJNER, M., WANNMACHER, C. M. D. Tryptophan reduces creatine kinase activity in rat brain cortex In: IV Congresso Latinoamericano de Errores Innatos del Metabolismo y Pesquina Neonatal, 2003, Puerto Iguazú, Paraguai. ROTT, M. B., MENTZ, M. B., VIEIRA, S. J., BALDO, G., RODRIGUES-JUNIOR, V. S. Estudo parasitológico das areias utilizadas para recreação em 3 parques públicos do município de Porto Alegre-RS In: XIV SALÃO DE INICIAÇÃO CIENTÍFICA, 2002, Porto Alegre, Brasil.
