THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 266, No. 6, Issue of February pp. 3547-3553,1991 Printed in U.S.A.

Mutations That Alter the Charge of Type I Regulatory Subunit and Modify Activation Properties of Cyclic AMP-dependent Protein Kinase from S49 Mouse Lymphoma Cells*

(Received for publication, February 5, 1990)

Robert A. Steinberg#$, Karen B. Gorman8, Dagfinn Bgreidn, Stein 0. Daskelandn, and Irene T. Weber 11 From the $Department of Biochemistry and Molecular Biology, the University of Oklahoma Health Sciences Center, Oklahoma City, Oklahoma 73190, the (Cell Biology Research Group, Institute of Anatomy, University of Bergen, N-5009 Bergen, Norway, and the 11 Crystallography Laboratory, National Cancer Institute-Frederick Cancer Research Facility, Advanced Bioscience Laboratories-Basic Research Program, Frederick, Maryland 21 701

Mutations in regulatory (R) subunit of CAMP-de- pendent protein kinase were analyzed from CAMP- resistant mutants of 549 mouse lymphoma cells by direct sequencing of amplified regions of mutant R subunit cDNAs. Eight distinct single base-change le- sions were identified in 24 independent mutants that were hemizygous for expression of mutant R subunits with altered protein charge. CG+TA transitions pre- dominated, but AT+GC transitions and GC+TA trans- versions were also observed. Four of five spontaneous mutants had identical C+T transitions at CG causing substitution of Trp for Arg-334. Sites mutated in iso- lates obtained after mutagenesis with ethyl methane- sulfonate or N-methyl-N’-nitro-N-nitrosoguanidine were more varied. Six of the lesions (two in binding site A and four in site B) were at amino acid residues that are highly conserved among CAMP-binding sites of R subunits and the Escherichia coli catabolite acti- vator protein. These mutations all either prevented or strongly hindered binding of cyclic nucleotides to the mutated site. One of the remaining lesions (at Arg-242) also prevented cyclic nucleotide binding to the mutated binding site; the other (at Gly-170) had only minimal effects on binding of cyclic nucleotides but, neverthe- less, increased the apparent constant for CAMP-de- pendent kinase activation. These results are discussed with reference to a model for the CAMP-binding sites of R subunit based on the crystal structure of the E. coli catabolite activator protein.

The CAMP-sensitive S49 mouse lymphoma cell line has been used extensively for selection of mutants with defects in the cAMP response system. Most common among mutants selected for resistance to the cytolytic effects of CAMP analogs

* This work was supported by Grant DK37583 from the National Institute of Diabetes and Digestive and Kidney Diseases (to R. A. S.), by grants from the Norwegian Cancer Association (to D. 9. and S. 0 . D.), by the National Cancer Institute Contract N01-C01-74101 with Advanced Bioscience Laboratories (to I. T. W.), and by a NATO collaborative research grant (to R. A. S. and D. 9.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “adver- tisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

3 To whom correspondence should be addressed Dept. of Biochem- istry and Molecular Biology, University of Oklahoma Health Sciences Ctr., P. 0. Box 26901, Oklahoma City, OK 73190.

are those with lesions in the regulatory (R)’ or CAMP-binding subunit of type I CAMP-dependent protein kinase that in- crease apparent constants (Ka values) of the enzyme for CAMP-dependent activation. Such “K,” mutants have been isolated in S49 sublines that are either diploid or functionally haploid for expression of R subunit genes (1-3). Since many of the lesions in these mutants altered the isoelectric point of R subunit, it was possible to use high resolution two-dimen- sional gel electrophoresis both to resolve mutant from wild- type forms of the protein and to map many of the lesions to peptides resulting from partial proteolysis of R subunit (2-4); several of the lesions were also localized by RNase mismatch analysis (5). These studies suggested that a variety of lesions, mostly mapping in or near highly conserved regions thought to form part of the binding pockets for CAMP, could produce K, phenotypes. Lesions were localized to both binding sites “ A (the more amino-terminal) and “B” (the more carboxyl- terminal). From a total of 84 independent mutants of sublines thought to be functionally hemizygous for expression of R subunit, 25 mutants (24 of which have survived for the present studies) were confirmed to be functionally hemizygous for expression of mutant R subunits by two-dimensional gel analysis; these have served as sources of mutant protein kinases for analysis of the functional consequences of specific mutational changes (Refs. 5 and 6; this report).

The present studies were undertaken to characterize the precise molecular changes underlying the lesions in these mutants and to correlate specific lesions with distinct func- tional deficits. Regions of cDNAs implicated as potential sties for mutation by peptide mapping experiments were amplified by polymerase chain reaction (7) and sequenced either directly or after subcloning into an M13 bacteriophage vector. To assess the phenotypic effects of the various mutations, kinases from representative mutants were analyzed by a panel of assays using cAMP and cAMP analogs to study cyclic nucleo- tide binding and kinase activation. The positions of altered amino acids were analyzed using a model structure of the CAMP-binding domains based on the crystal structure of the homologous Escherichia coli catabolite gene activator protein (CAP) (8). A revised model for CAMP-binding site A is proposed to account for observations that implicate Arg-242 in CAMP-binding.

The abbreviations used are: R subunit, regulatory subunit of CAMP-dependent protein kinase; RI subunit, R subunit of type I kinase; CAP, catabolite gene activator protein of E. coli; EMS, ethyl methanesulfonate; MNNG, N-methyl-N’-nitro-N-nitrosoguanidine; PCR, polymerase chain reaction.

3547

3548 Mutations in Type I Kinase Regulatory Subunit TABLE I1

Distribution of R subunit lesions amow hemizygous K,, isdates

Amino acid change

Gly’70+Glu GlyZoo+G1u GluZa’+Lys ArP-Ser Gly3”-Asp Gl~~’~-Gly Arg”4-Leu Are334+Tr~

Sequence change

G-A G-A G-A G+T G-A A-+G G-T C-+T

Context

TGAAGGGGATA CTTTGGAGAGC TTGGA G AGCTG AAGAG G AAGAT TTTTG G TGAAA TGGTG A AATTG TCCTCGGGCTG GTCCT C GGGCT

Independent isolates

SPONT” EMS MNNG

SPONT, spontaneous mutants.

EXPERIMENTAL PROCEDURES’

RESULTS

Table I1 shows the 8 sequence changes found in 24 inde- pendent “hemizygou~”~ mutants with charge alterations in R subunit. Four of five spontaneous mutants had the same GC+ AT transition causing substitution of Trp for Arg-334; the remaining spontaneous isolate had an AT-GC transition in the codon for Glu-325. All of the mutations induced by N-methyl-N’-nitro-N-nitrosoguanidine (MNNG) involved GC+AT transitions, and they clustered at 4 sites that in- cluded the strong hotspot for spontaneous mutations. The ethyl methanesulfonate (EMS)-induced mutations were more widely distributed and included GC-AT transitions, GC- T A transversions, and the AT-GC transition found in one spontaneous mutant. The eight lesions were found at 7 differ- ent amino acid residues, of which 5 have been implicated in CAMP-binding by models based on sequence homologies be- tween R subunits and CAP (Refs. 13 and 17 and below).

Cytosols from representative mutants with each of the lesions found above were screened for sensitivity to CAMP- dependent kinase activation (Ref. 3 and data not shown). Apparent Ka values of the mutant kinases were all increased from the wild-type value of 0.1 PM (range: 0.3-13 PM). The greatest variability in K, values was among mutants with lesions in site B; the two mutations at residue 334 (+Leu or Trp) differed by more than &fold in their effects on kinase activation. Cytosols were also screened for rates of dissocia- tion of [3H]cAMP at moderate (0.15 M) and high (3.2 M) concentrations of sodium chloride (Ref. 5; and data not shown). High salt accelerates cAMP dissociation from site A and retards dissociation from site B of wild-type R subunits (5, 18). For 7 of the 8 mutants, [3H]cAMP dissociation was monophasic as expected for binding of cAMP only to non- mutated binding sites: high salt slowed dissociation from preparations with Glu-200, Lys-201, or Ser-242 mutations indicating binding to site B; high salt accelerated dissocia- tion from preparations with Asp-324, Gly-325, Leu-334, or Trp-334 mutations, indicating binding to site A. From prep- arations with the Glu-170 mutation, however, [3H]cAMP dissociation was biphasic: the slower component was indistin- guishable from wild-type site B; the faster component was about %fold faster than wild-type site A at low salt and 2-

Portions of this paper (including “Experimental Procedures,” part of “Results,” Figs. 1 and 2, and Table I) are presented in miniprint at the end of this paper. Miniprint is easily read with the aid of a standard magnifying glass. Full size photocopies are included in the microfilm edition of the Journal that is available from Waverly Press.

‘We use the term “hemizygous” for convenience in describing mutants that express only a mutant form of R subunit. So far as we know, these cells remain diploid for most loci and, indeed, appear to have genomic DNA for both R subunit alleles (R. A. Steinberg, unpublished results).

fold slower than wild-type site A at high salt. Table I11 compares the abilities of 8 cAMP analogs to

compete with [3H]cAMP for binding to sites A and B of R subunits from mutant CM14.1.3 (Glu-170) with their poten- cies (relative to CAMP) as activators of mutant kinase. (Val- ues for wild-type preparations are provided for comparison (from Ref. 5, with a correction in values for thiopropyl- CAMP), and analogs are listed in order of decreasing selectiv- ity for site A of wild-type R subunit.) The relative affinities (K;A and B) of the analogs for the mutant’s CAMP-binding sites were reasonably close to those for wild-type sites, differ- ing by less than 3.6-fold. Relative potencies (K; values) of the analogs as activators of mutant kinase approximated the geometric means of their relative affinities for sites A and B (K;AB values). Thus, kinase with the Glu-170 mutation, like wild-type kinase, appeared to be activated through cyclic nucleotide-binding to both sites A and B. Nevertheless, its K, for CAMP-dependent activation was almost 10 times that of wild-type kinase (data not shown).

Table IV summarizes binding and activation data using the same analogs on preparations from mutants with the Ser-242, Asp-324, Gly-325, and Leu-334 mutations. (Similar data for mutants with Glu-200, Lys-201, and Trp-334 mutations has been published previously (5).) Preparations with the Ser-242 mutation showed highest relative affinities (K; values) for site B-selective analogs, consistent with inactivation of CAMP-binding site A by this mutation. Preparations with Asp-324, Gly-325, or Leu-334 mutations, on the other hand, had their highest K; values with site A-selective analogs, suggesting that these mutations inactivated site B. For prep- arations with Ser-242, Asp-324, or Leu-334 mutations, the close correspondence between relative binding affinities (K; values) and activation potencies (KL values) confirmed that activation of the mutant kinases was through nonmutated CAMP-binding sites. For preparations with the Gly-325 mu- tation, however, K; values were not well correlated with KL values. The discrepancies were most dramatic for the site B- selective analogs (8-(furan-2-yl-methylamino)-cAMP, 8-ami- nohexylamino-CAMP, and 2-chloro-8-methylamino-CAMP) and for W-aminopropylphenyl-CAMP, where the mutant Ki values were closer to wild-type Ki values (Table 111) than to mutant K; values. These discrepancies (and the monophasic cAMP dissociation described above) suggested that direct binding assays detected only cAMP bound to site A of R subunits with the Gly-325 mutation, but that kinase assays detected residual interactions of cyclic nucleotides with the mutated site B that contributed to kinase activation. This suggestion was supported by the experiment shown in Fig. 3 (below).

For wild-type kinase with functional sites A and B, cAMP analogs that select opposite binding sites complement one another as kinase activators. Mutant kinases lacking function

Mutations in Type I Kinase Regulatory Subunit 3549

TABLE I11 Binding affinities and activation potencies of cyclic nucleotides for protein kinase from S49 cell mutant CM14.1.3 Cyclic AMP and eight cAMP analogs were tested for their abilities to inhibit binding of [3H]cAMP to sites A

and B and to activate protein kinase in extracts of mutant cells. Relative affinities (I(; values) and activation potencies (KL values) were determined as described previously (5). Values for wild-type kinase (from Ref. 5) are included for comparison.

S49 subline

Compound CM14.1.3 (GluI7") Wild-type

K;A K; B K; AB K: Ki A K; B K; AB K:

cAMP 1.00 1.00 1.00 1.00 1 .oo 1.00 1.00 1 .oo 8-Piperidino-CAMP 0.84 0.046 0.20 0.52 3.00 0.082 0.50 0.44 N'"Aminopropylpheny1-CAMP 1.95 0.074 0.38 0.47 2.30 0.08 0.43 0.42 N6-Phenyl-CAMP 3.25 0.28 0.95 1.35 7.60 0.35 1.63 1.10 8-Thiopropyl-CAMP 1.94 0.71 1.17 1.82 2.10 0.86 1.34 2.40 8-Bromo-CAMP 2.14 0.65 1.18 1.90 1.40 1.20 1.30 1.30 8-(Furan-2-yl-methylamino)-cAMP 0.028 0.91 0.16 0.55 0.062 1.40 0.29 0.36 8-Aminohexylamino-CAMP 0.024 5.62 0.37 1.65 0.086 2.70 0.48 0.66 2-Chloro-8-methylamino-CAMP 0.068 3.96 0.52 1.05 0.035 4.90 0.41 0.74

TABLE IV Binding affinities and activation potencies of cyclic nucleotides for protein kinases from mutant sublines CM14.5.2

(Ser-242), CM17.02.1 (Asp-324), CM11.1.31 (Gly-325), and CM14.3.3 (Leu-334). The relative affinities of cAMP analogs for binding to R subunits in extracts from mutant Cells (K; values) and

the relative potencies of these compounds as activators of mutant protein kinases (I(; values) were determined as described previously.

Mutation

Compound Ser2'2 Asp3'' GIYTZS Leu3:i4

K; K: K; K: K; K: K; K:

cAMP 1.00 1.00 1 .oo 1.00 1.00 1.00 1.00 1.00 8-Piperidino-CAMP 0.35 0.40 2.16 1.26 1.40 1.15 0.96 1.10 N6-Aminopropylphenyl-CAMP 0.25 0.38 3.30 5.04 1.68 0.14 2.85 2.40 N'-Phenyl-cAMP 0.65 1.13 2.81 10.0 6.14 2.63 4.84 3.50 8-Thiopropyl-CAMP 1.11 2.40 3.00 3.94 1.57 0.55 1.71 1.52 8-Bromo-CAMP 1.26 2.70 1.92 1.60 0.58 0.29 1.08 2.13 8-(Furan-2-yl-methylamino)-cAMP 1.11 0.86 0.071 0.079 0.032 0.44 0.043 0.087 8-Aminohexylamino-CAMP 2.09 3.70 0.066 0.10 0.032 0.77 0.048 0.13 2-Chloro-8-methylamino-CAMP 2.06 1.29 0.077 0.088 0.025 0.75 0.048 0.090

of either of the two binding sites do not show any comple- mentation between cAMP analogs (Refs. 5 and 6 and data not shown). Fig. 3 shows that the site A-selective NG-phenyl- cAMP and the site B-selective 2-chloro-8-methylamino- cAMP acted synergistically in activating kinase with the Gly- 325 mutation implying involvement of the mutated site B in activation. The direct CAMP-binding assays used for these studies used up to 0.5 p~ [3H]cAMP ( 5 ) , which should have been sufficient to detect binding sites with dissociation con- stants up to a few tenths of micromolar. Our failure to detect binding to site B by direct assays might reflect either a yet lower affinity or an instability under our assay conditions. No additional binding to the mutant preparation could be de- tected by lowering incubation temperatures to 0 "C or by using termination conditions that allow detection of the low affinity binding site of cGMP-dependent protein kinase (ie. 4 M ammonium sulfate a t -5 "C (20)). Nevertheless, interac- tion of cAMP with the mutated site could be demonstrated at micromolar concentrations by its ability t o retard dissociation of [3H]cAMP from site A in the presence of C ~ u b u n i t . ~

DISCUSSION

All of the lesions identified here involved single nucleotide base substitutions, and, consistent with previous analyses (2, 3), the distributions of mutations differed for spontaneous,

S. 0. D$skeland, unpublished results.

EMS-induced, and MNNG-induced isolates. Previous studies showed that only mutant forms of R subunit protein were expressed in hemizygous mutant sublines (3,21); the absence of wild-type sequences in DNA amplified from mutant R subunit cDNAs demonstrated further that mRNA was ex- pressed only from mutant alleles. All of the MNNG-induced, and most of the spontaneous and EMS-induced, mutations involved GC-AT transitions. One each of spontaneous and EMS-induced mutants had the same AT-GC transition, and two EMS-induced mutants had GC-TA transversions. The preponderance of GC-AT transitions underlying mutagene- sis with the alkylating mutagens EMS and MNNG is consist- ent with results from other systems and supports a mechanism based on mispairing of thymine with 06-alkyl guanine (re- viewed in Refs. 22 and 23). Nearest neighbor effects have been reported for mutagenesis in a number of systems (e.g. Ref. 24). Of the eight mutagenic target sites identified in this study, five had guanine immediately 5' to the mutated purine base and seven had a purine (generally adenine) immediately 3' to the target purine.

Hydrolytic deamination of cytosine (25) has been thought to contribute in large measure to spontaneous mutagenesis since frequencies of GC+AT mutations are elevated in E. coli mutants defective in uracil N-glycosylase (26), and 5-meth- ylcytosine residues serve as hotspots for spontaneous muta- genesis in wild-type E. coli (presumably because deamination of 5-methylcytosine produces thymine, which is not recog-

3550 Mutations in Type I Kinase Regulatory Subunit

$ Concentration of 2-Ci, 8-MA-CAMP [MI

Concentration of N6-phenyl-cAMP [MI

FIG. 3. Synergistic activation of protein kinase from mu- tant subline CM11.1.31 incubated with mixtures of w- phenyl- and 2-chloro-8-methylamino-CAMP. Activation of pro- tein kinase from mutant subline CM11.1.31 was assayed with varying concentrations of 2-chloro-8-methylamino-CAMP ( A ) or P-phenyl- cAMP ( B ) in the absence (open squares) or presence (filled squares) of fixed concentrations of p-phenyl-CAMP ( A ) or 2-chloro-8-meth- ylamino-CAMP ( B ) sufficient to activate about 25% of the total enzyme. Data are expressed relative to values for maximal activation.

nized by the uracil glycosylase (27)). Since 5-methylcytosine residues occur predominantly at CG dinucleotides in mam- malian cells (28), spontaneous mutational hotspots are ex- pected at such sequences. In studies of spontaneous mutations in the Chinese hamster ovary cell adenine phosphoribosyl- transferase locus, the only endogenous locus for which exten- sive sequence data on spontaneous missense mutations is available, only 2 of 82 single base pair substitutions resulted from C+T transitions at CG (29, 30). The present study, on the other hand, revealed a major hotspot for spontaneous mutagenesis at a CG in the codon for Arg-334 of R subunit; this mutation was found in about half the spontaneous mu- tants from our hemizygous collection (3). Although Arg-210 plays a role in CAMP-binding site A similar to that of Arg- 334 in site B, no mutations were found at the codon for this Arg; this mutational bias between sites A and B probably reflects the use of AGA instead of CGN as the codon for Arg- 210.6

The DNA sequencing results of this report confirmed the amino acid substitutions in five mutants described previously (5) as well as identifying the mutations in 18 additional isolates. Eight different lesions were found, of which four are described for the first time. Recombinant R subunit genes containing the Glu-200 and/or Asp-324 mutations have been expressed in several laboratories for analysis of the effects of these lesions (32-34). Results with the recombinant subunits were consistent with results from hemizygous mutant cell extracts: mutations at Gly-200 and Gly-324 prevented binding of cyclic nucleotides, respectively, to CAMP-binding sites A and B; and kinase holoenzymes containing the mutant R subunits could be activated, albeit with elevated K, values, through interactions of cyclic nucleotides with the nonmu-

‘Substitution of Arg-210 with Lys by in oitro mutagenesis has been shown to inactivate site A in an R subunit fusion protein expressed in E. coli (31).

tated CAMP-binding sites. Properties of several of the mutant R subunits have also been confirmed by studies with purified material from the hemizygous cells (351).~

The CAMP-binding domains of R subunit show similarities in amino acid sequence with the CAMP-binding domain of CAP, and the amino acids that interact with cAMP are conserved (17). Computer modeling based on the crystal struc- ture of CAP complexed with cAMP has been used to show that the CAMP-binding domains have a conserved three- dimensional structure in R subunits (8, 13). In CAP residues Gly-71, Glu-72, and Arg-82 are critical elements of the CAMP- binding pocket: Arg-82 forms a salt bridge with the negatively charged phosphate of CAMP; Glu-72 forms a hydrogen bond with the 2”hydroxyl of CAMP; and Gly-71 interacts with the 2“hydroxyl and 3”oxygen of CAMP (Fig. 4A). The equivalent residues in type I murine R subunit (Gly-200, Glu-201, and Arg-210 in CAMP-binding site A (Fig. 4B) and Gly-324, Glu- 325, and Arg-334 in site B) are identical in all R subunit CAMP-binding domains for which sequences are available and in cGMP-binding domains of cGMP-dependent protein ki- nase (36). I t is not surprising, therefore, that mutations a t these residues interfered with binding of CAMP. Of the mu- tations described here, six (Glu-200, Lys-201, Asp-324, Gly- 325, Leu-334, and Trp-334) are in this category.

Because the positive 6 torsion angle a t Gly-71 of CAP is energetically unfavorable for any other amino acid, substitu- tions at this position would be expected to distort the CAMP- binding pocket. The observed mutations at the equivalent residues in R subunit (Glu-200 and Asp-324) introduce, in addition, large side chains that might interfere sterically with binding of cAMP and negatively charged groups that might tend to repel the negatively charged cAMP molecule.

Two mutations were found at positions equivalent to Glu- 72 in CAP: Lys-201 and Gly-325. The Lys substitution in site A essentially inactivated the site for binding of cyclic nucle- otides, but the Gly substitution in site B permitted sufficient residual interaction for detection by assays of kinase activa- tion. Both substitutions would eliminate the hydrogen bond interaction between Glu and cAMP shown in Fig. 4. Lys at this position might cause unfavorable steric and electrostatic effects that could explain its apparent abrogation of CAMP- binding. Gly-325, on the other hand, would cause no addi- tional unfavorable interactions except, perhaps, for an in- creased flexibility. This might account for the residual inter- action of the mutant site B with cAMP despite loss of a hydrogen bond between Glu-325 and the 2’-hydroxyl of CAMP. Studies with 2’-deoxy cAMP also suggest that weak binding of cyclic nucleotides may be possible without this hydrogen bond interaction (37).‘j

Arg-82 in CAP forms an important salt bridge to the phosphate of CAMP, and substitution of Leu for this Arg prevents binding of cAMP to CAP (38). Similarly, substitu- tions of Leu or Trp for Arg-334 effectively prevented binding of cyclic nucleotides to mutated site B in R subunit, which is consistent with elimination of a salt bridge between Arg-334 and the phosphate moiety of CAMP. The nearly 10-fold greater effect of the Trp than of the Leu substitution on kinase activation parameters is probably the result of distor- tions caused by the larger side chain of Trp.

Two new mutations were observed that lie outside the CAMP-binding pocket described in the original R subunit model (13). The first, Glu-170, does not prevent CAMP-

2’-Deoxy-cAMP activates kinase only about 0.00025 as well as cAMP (37), but the analog inhibits CAMP-binding to each site of kinase about 0.001 as well as cAMP (D. qgreid and S. 0. D$skeland, unpublished results).

Mutations in Type I Kinase Regulatory Subunit Ala

3551

FIG. 4. Schematic drawings of the occupied CAMP-binding site of CAP from its crystal structure and the modeled CAMP-binding site A from murine RI subunit in similar repre- sentations. Amino acid residues form- ing the CAMP-binding pocket are indi- cated by circles at positions of the a- carbon atoms, and sizes of the circles indicate distances from the viewer. Res- idues 61-64 of CAP ( A ) and the corre- sponding residues (191-194) of Rr sub- unit ( B ) are omitted for clarity. Side chains are shown only for residues that are conserved or interact with CAMP. Charged residues are indicated by plus and minus signs, and hydrogen bonds are indicated by dotted lines. A , cyclic AMP- binding site of CAP (from Ref. 8): cAMP is bound in the “anti” conformation; Ser- 128’ is from the C a-helix in the other subunit of the CAP dimer; residues 35- 37 in /3-strand 3 are shown for compari- son with the corresponding residues of RI. B, site A of RI subunit: the C a-helix is shown on the right in the newly mod- eled position suggested by the mutation at Arg-242 and consistent with photo- labeling of Tyr-245 (see text); the posi- tions of the mutated Gly-170 and its adjacent residues are shown at the left of the figure. It remains possible that resi- dues from other domains or subunits of the holoenzyme also interact with CAMP.

A

B

Glu

o-( % - 0

P7 LI

83 II Ser k r Ser

72

Ala

binding to R subunit but has subtle effects on the dissociation behavior of site A. Gly-170 is equivalent to Ala-36 in p-strand 3 of CAP (Fig. 4A), which lies at the protein surface in a region rich in conserved acidic residues (Asp-168, Glu-169, Asp-171, and Asp-226 in R subunit). Gly-170 is also close to Arg-210, which forms a salt bridge with CAMP. The observed effect of the Glu-170 mutation on CAMP-binding, therefore, may be an indirect effect transmitted through Arg-210. The more substantial effect of this mutation on kinase activation may result from introduction of an additional acidic residue near Arg-210 and the acidic surface region. This mutation implicates P-strand 3 in the allosteric activation produced by cAMP and suggests that this region may be involved in an interdomain or intersubunit contact in kinase holoenzyme.

In the original model of R subunit Arg-242 was considered to be equivalent to Met-114 in CAP, a hydrophobic residue in the C a-helix about two turns away from the CAMP-binding site. Nevertheless, conservation of Arg-242 and its surround- ing amino acids in the A domains of all known R subunits suggests that it has an important function. The Ser-242 substitution should not perturb the a-helix, so its strong effect on site A function suggests some direct role of Arg-242 in CAMP-binding.

The amino acid sequences of CAP and R subunits are not very similar for the region corresponding to the C heIix in CAP; there are no identical residues between CAP and the A domains in this region. Despite interactions of Thr-127 and

. .” 21 2

201

Ser-128 in CAP with CAMP, no corresponding interactions were predicted for the CAMP-binding sites of R subunit; the original sequence alignments also precluded a salt bridge homologous to that between Arg-123 and Glu-72 of CAP. Although the C helix in CAP extends to residue 130, the A domains of several R subunits have a helix-disrupting Pro residue at a position corresponding to residue 125 in CAP. Thus the R subunits appear to differ from CAP in this region and may have shorter helices than that in CAP. We have rebuilt the R subunit model with a shortened C helix so that Arg-242, consistent with its importance for CAMP-binding, would take the role of Arg-123 in CAP (described under “Experimental Procedures”). the new model has the added virtues that it moves Arg-240 from an energetically unfavor- able internal position to the surface of the domain and permits additional hydrogen bond interactions (between Ser-237 and Glu-114 and between Thr-238 and Tyr-230) to stabilize the domain structure.

In the new model structure (Fig. 4B), Arg-242 forms a salt bridge with Glu-201 and, thereby, maintains the CAMP-bind- ing conformation of Glu-201. Elimination of cAMP binding by the Ser-242 mutation would result from a distortion of the binding pocket due to elimination of this salt bridge. The new position of the C helix in site A also places Tyr-245 near the adenine ring of CAMP; this could explain the photolabeling of Tyr-245 by 8-azido-CAMP in a mutant RI subunit truncated for site B (39). Amino acid sequences for regions correspond-

3552 Mutations in Type I Kinase Regulatory Subunit

ing to the C helix differ markedly for A and B domains of R subunit. In site B, Try-372, which is photolabeled by 8-azido- CAMP, was originally aligned with Met-120 of CAP or Phe- 248 of site A (about one helical turn from Tyr-245 (13)). It is possible that Lys-366 is equivalent to Arg-242 in site B, but there is presently no evidence to support modification of the model for site B.

Acknowledgments-We gratefully acknowledge the outstanding technical assistance of Robert Cauthron and Torild Ellingsen.

REFERENCES 1. Friedrich, U., and Coffino, P. (1977) Proc. Natl. Acad. Sci.

2. Murphy, C. S., and Steinberg, R. A. (1985) Somat. Cell Mol. Genet. 11,605-615

3. Steinberg, R. A., Murphy, C. S., Russell, J . L., and Gorman, K. B. (1987) Somat. Cell Mol. Genet. 13,645-659

4. Steinberg, R. A. (1984) Mol. Cell. Bid. 4, 1086-1095 5. qgreid, D., D#skeland, S. O., Gorman, K. B., and Steinberg, R.

6. Steinberg, R. A., Russell, J. L., Murphy, C. S., and Yphantis, D. A. (1987) J. Biol. Chem. 262, 2664-2671

7. Saiki, R. K., Scharf, S., Faloona, F., Mullis, K. B., Horn, G. T., Erlich, H. A., and Arnheim, N. (1985) Science 230,1350-1354

8. Weber, I. T., and Steitz, T. A. (1987) J. Mol. Biol. 198, 311-326 9. Steinberg, R. A., and Agard, D. A. (1981) J. Biol. Chem. 256,

10. Maniatis, T., Fritsh, E. F., and Sambrook, J. (1982) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

11. Gorman, K. B., and Steinberg, R. A. (1989) BioTechniques 7,

12. Struhl, K. (1985) BioTechniques 3,452-453 13. Webert, I. T., Steitz, T. A,, Bubis, J., and Taylor, S. S. (1987)

14. Jones, T. A. (1978) J. Appl. Crystallogr. 11, 268-272 15. Clegg, C. H., Correll, L. A., Cadd, G. G. , and McKnight, G. S.

16. Clegg, C. H., Cadd, G. G., and McKnight, G. S. (1988) Proc. Natl.

U. S. A. 74, 679-683

A. (1988) J. Biol. Chem. 263, 17397-17404

10731-10734

326-331

Biochemistry 26,343-351

(1987) J. Bid. Chem. 262, 13111-13119

Acad. Sci. U. S. A. 85, 3703-3707

17. Weber, I. T., Takio, K., Titani, K., and Steitz, T. A. (1982) Proc.

18. D#skeland, S. 0. (1978) Biochem. Biophys. Res. Commun. 83,

19. D$skeland, S. O., and qgreid, D. (1984) J. Bid. Chem. 259,

20. D#skeland, S. O., Vintermyr, 0. K., Corbin, J. D., and Pgreid, D.

21. van Daalen Wetters, T., and Coffino, P. (1983) Mol. Cell. Bid. 3,

22. Schendel, P. F. (1981) Crit. Reu. Toxicol. 9, 311-362 23. Yarosh, D. B. (1985) Mutat. Res. 145, 1-16 24. DuBridge, R. B., Tang, P., Hsia, H. C., Leong, P.-M., Miller, J .

H., and Calos, M. P. (1987) Mol. Cell. Bid. 7, 379-387 25. Lindahl, T., and Nyberg, B. (1974) Biochemistry 13, 3405-3410 26. Duncan, B. K., and Miller, J. H. (1980) Nature 287, 560-561 27. Coulondre, C., Miller, J. H., Farabaugh, P. J., and Gilbert, W.

28. Doerfler, W. (1981) J. Gen. Virol. 57, 1-20 29. de Jong, P. J., Grosovsky, A. J., and Glickman, B. W. (1988)

Proc. Natl. Acad. Sci. U. S. A. 85, 3499-3503 30. Phear, G., Armstrong, W., and Meuth, M. (1989) J. Mol. Bid.

209,577-582 31. Bubis, J., Neitzel, J. J., Saraswat, L. D., and Taylor, S. S. (1988)

J. Biol. Chem. 263,9668-9673 32. Kuno, T., Shuntoh, H., Takeda, T., Ito, A., Sakaue, M., Hirai,

M., Ando, H., and Tanaka, C. (1989) Eur. J. Pharmacol. 172, 263-271

33. Woodford, T. A,, Correll, L. A., McKnight, G. S., and Corbin, J. D. (1989) J. Biol. Chem. 264,13321-13328

34. Correll, L. A., Woodford, T. A., Corbin, J. D., Mellon, P. L., and McKnight, G. S. (1989) J. Bid. Chem. 264, 16672-16678

35. Houge, G., Steinberg, R. A., qgreid, D., and D#skeland, S. 0.

36. Weber, I. T., Shabb, J . B., and Corbin, J . D. (1989) Biochemistry

37. vgreid, D., Ekanger, R., Suva, R. H., Miller, J. P., Sturm, P., Corbin, J. D., and D#skeland, S. 0. (1985) Eur. J. Biochem. 150, 219-227

38. Gronenborn, A. M., Sandulache, R., Gartner, S., and Clore, G.

39. Ringheim, G. E., Saraswat, L. D., Bubis, J., and Taylor, S. S.

Natl. Acad. Sci. U. S. A. 79, 7679-7683

542-549

2291-2301

(1987) J. Biol. Chem. 262, 3534-3540

250-256

(1978) Nature 274, 775-80

(1990) J. Biol. Chem. 265, 19507-19516

28,6122-6127

M. (1988) Biochem. J . 253,801-807

(1988) J. Biol. Chem. 263, 18247-18252

EXPERIWEUTAL PROCEDURES Plus-Strand Primers: 5PR: GCTAAACAATCTAGAGGACC 1-40 tO -21)

mtsnals-- DeOxylibonvcleDtideE, dideoxyribonucleotidee, and Olig0-dT12-i8 were from Pharmacia IKB Biotechnology 1°C.; oligo-(dl)-cellulose Was from Collaborative Research; and urea (ultrapure) was from Schwarz/Uann Biotech. M-MLV Reverse Transcriptase, and nuclease-free bovine serum albumin were from Bethesda Research Laboratories; ThermuS aquaticus (Taq) DNA POlYneraSe Was

and Kenptide were from Sigma Chemical Co.; and ammonium sulfate Was from from New England Biolabs or Perkin Elmer/Cetus; ribonuclease A (Type 111-A)

Uerck Chemical CO. (Darmrtadt, Federal Republic of Germany). Restriction (Numbers in parentheses are nucleotide positions relative to the endonucleases were from Bethesda Research Laboratories. Promega Biotec, or New England Biolabs. [a-32P]dCTP (3000 Ci/mmole) Was from DUPOnt-New England Nuclear; [5',8-3H]cAMP (56 Ci/mol) and [I-32P]ATP (2200 ci/mmole) Were from Isolation and Purification of p o l y A' RNA" Washed pellets Of S49 cella were the Radiochemical Centre (Amersham, United Kingdom). Nusieve GTG agarose vas from M C Corp.; electrophoresis grade acrylamide, and methylenebiEacrylaloide

Solubilized by suspending at 5 Y 107/ml in ice-cold buffer containing 10 mM

Were from Eastman KOdak Co. or Research Organics, 1°C.; X-ray film (XAR) Was

Trrs-HC1, pH 7.6, 0.1 M sodium chloride, 2 MI magnesium chloride, I 8 v / v 2-mercaptoethanol, and 0 . 0 5 % u/v Triton X-100; nuclei were pelleted by

from Eastman KOdak; and mixed cellulose ester filters (HAWP, 0.45-Wm pore size) were from Millipore Corp. Cyclic nucleotides were obtained a5

centrifuging for 3 min at 1200q; and supernatant fractions were mixed immediately with equal volumes of buffer containing 10 MI Tris-HCI, pH 7.6.

described previously (5). 0.1 H sodium chloride, 25 nM EDTA. and 28 u/v sodium dodecyl sulfate. Samples were heated for 5 min at 60'C. chilled. made up to 0.4 U in lithium chloride,

Cell Culture" Wild-type and mutant sublines Of S19 mouse lymphoma cells and purified by oligo-(dT)-cellulase chromatography as described by uaniatis were grown in suspension culture in DUlbeCCO'S modified Eagle's Medium supplemented with 10% heat-inactivated horse serum (9). Isolation and

et al. (10). but using lithium chloride in place Of sodium chloride.

partial characterization of mutants hemizygous for expreesion of R SUbUnltS with lesions affecting R subunit charge have been described previously ( 3 ) .

Synthesis of cDNAS-- Reactions contained. in 250 p1: 50 mn Trir-HC1, pH 8.3; 75 nM potassium chloride; 10 mM dithiothreitol; 3 mM magnesium Chloride; 0.5 mM each. dATP, dCTP, dGTP, dTTP; 0.1 mg/ml nuclease-free bovine serum

OIigonucleotides-- Oliqonvcleot~des were synthesized and purified by the Molecular Biology Resource Facility of the University Of Oklahoma Health

albumin; 2.5 pg uliqo-(dT); 10 ,pg poly A* RNA; and 2000 Units of U-ULV

Sciences Center using an Applied Biorystems 3808 DNA synthesizer for Reverse Transcriptase. After lncubatlng 1 hour at 37OC. mixturee were

synthesis and high performance liquid chromatography for purification. Stock extracted Once wlth a mixture of phenol and chloroform. and products Were

solutions were dialyzed against three changes Of water before Use. precipitated from the aqueous phase with ethanol.

BCL: CTATGTGATTGATCAAGGAG It522 to t541) PST: CAGCTGCTGTGCTGCAGCGT It896 to t915)

Complementary Primers: TAQ: TAGCTGTCTCGGTCGATGCC (+692 to 1673) MLU: GGRCGCCTTCAAACCGAGGC (+I075 to 11056) 3PR: GAAGCGCCGCTCACACGCAC (+I156 to +1137)

first base of the initiator ATG codon as tl.)

Mutations in Type 1

sequence amplification by PC+- Initially, PCR reactions were carried out manually as described previously (11). Later, the procedure Vas automated usinq a Techne thermal cycler (Teshne Inc.), and reaction Conditmns were modlfled by increaslnq VOlUDeS from 50 C o LOO "1. chanqlnq to buffer Conditions recommended by Perkin ElnerICetus (10 mn TriS-HCl, pH 8 . 3 , 1.5 nn magnesium chlorlde, 50 pOtaSSIum shlorlde, and 0.01% [VIVI gelatin), and reducmq Concentrations of dATP, dCTP. dGTP, and dlTP to 0.2 m each. Each

of amplification prmers, and 100 yqlnl DNase-free ribonuclease A (101. reectlon contslned =DNA f m n 1.7 pq Of poly A' RNA; 0.3 uq each 1-50 pmolesl

era1 oil. heated 7 mln at 100DC to melt R!IA-CDNA coaplexes. and then InCuba- Before startmq polymerlration steps, salples were overlaid Ylth 100 pl mln-

merase were added; samples were incubated at 45-55'C and 72OC as described ted 5 man at 37OC to allow annealinq Of primers. Pave units of Taq DNA poly-

and polymerization us1nq the follovlnq proqram Sett1nqs: 1.7 min at 94'Ci 2.5 below; and then samples were subTected t o 25-38 rounds O f rneltinq, anneallnq,

m ~ n at 45-55OC (Calculated to be about 1O'C below ol~qonucleotide T.'SI; and 2.0-9.9 mi" at 72- (salsulatad a5 about 1 nln per 8 0 base-pairs to be ampli-

and preclpztates washed once each vlth 7 0 1 and 95% ethanol before dlssolvlnq fied). Samples were made 2.5M in arnnonlun acetate. precipitated with ethanol,

and runnxnq on gels of 21 NuS~eve GTG agarose as described previously (11) . After s t a m m q qels with 5 pqlml ethidium bromide, bands of amplified DNA were excised and stored at 4'C I" foll-wrapped tubes. For subcloning Into the Mllum21 vector (Bethesd.3 Research Laboratories), arnplifled DNAs were diqested vlth EcoRI and MluI or BClI restriction endonucleases before purifyinq on Nu- Sleve GTG ilqarose gels. Replrcative form Vector DNA vas cut with ECORI and elther HluI or BamHI restrictLon endonucleases and liqated with fragments of amplified DNAs uslnq the "in-gel" method Of Struhl (12).

D.YA Sequence Determinations-- Double-stranded, gel-purified PCR PrcdUCtS Yere sequenced usinq Taq polymerase and dideoxynucleotide triphosphates in a two- staqe reaction procedure (111. Sinqle-stranded MI3 DNAs were sequenced usinq a Scquenase 11 kit (Unlted States Blochenlcal) follovlnq the manufacturer's protOCO1S except that labeling was Wlth [12P)dCTP and unlabeled dNTPs were 4-

acrylaln.de and were run at 2000V in an I81 STS45 apparatus with 0 . 4 mm fold more dilute than recommended. sequencinq gels (lo) were 81 in poly-

spacers. Denatured, end-labeled HpaIt fraqments of pTZ19R (Unlted States

autoradioqraphy for up to 10 days. Blachemical) were used as slze markers. Gels were drled and subjected to

&says of CAMP Dissociation Rates, cAUP Analog Affinities f o r Binding sites of Mutant Protein Klnilses, and Abilities of SAUP Analogs to Activate Hutant Protein Ilnases-- Cytosol fractions were prepared and assayed for binding and dlssocistion Of I1H]CMP, abilltles of CAMP analoqs to lnhiblt blndinq Of IIH;CM.lP, and abilitles of cyclic nucleotides to stmulate phosphotransferase activity as described previously (5). Replicate determinations were made on at least 3 preparations from each mutant, and kinetic parameters were deter- mined from assays vlth 10 or nore different concentrations Of CAIIP Or CAIIP analogs. Relative activation constants (K'a values) of analogs for wild-type or mutant enzymes were calculated as the ratios Ka(cAMP)lKa(analoq); rslatlve afrinities ( K ' ~ values) for mutant enzymes or CAMP-bindinq sites were ca lcu-

affmitaa of a compound for Slte A and site 8; K',AB i: the'mean affinity for lated as the ratios K,(cAMP)/K,(analoq). K'IA and K' B are respectively, the

the two sitas ( 5 ) . cyclic nucleotides used are llsted in Tables 111 and IV.

Computer nodeling-- The original model of the cm-bindinq domains built by homoloqy to the crystal Structure of CAP (13) was examined on an Evans and Sutherlmd PS390 computer graphics system usinq the proqram FROW (14). Because there is little sequence similarity between CAP and the A domains of R Subunits in the reqlon Of the C a-helix, the Correct positloninq Of the C helix in A domains has been problematical. For the revised model, the helix

to a helix-breakmq Pro residue in type I1 R Subunits. Residues 239 to 252 Of has been presumed to terminate at Ser-253, whlch 18 at a pD5itiOn equivalent

charqed sxde chain of Arq-242 to form an ionic interaction with Glu-201 the C helix were moved by about one-and-a-half turns to allow the positively

similar to that between Arq-123 and Glu-72 ~n the CAP structure. Residues 235 to 238 were then adjusted to reconnect the 8 helix with the end of the C helix. Since G1Y-236 and Ser-237 are flexible residues that are Often found in turns between-elements of secondary Structure, this adjustment appeared to be reasonable. The new mcdel olaces Ara-240. which had been in an eneraeti- cally Unfavorable Internal position, on <he &.face of the A domain; it-also allows the slde-chain of Arq-242 to fors a hydrogen bond with the hydrozyl of Ser-198 (equivalent to Asp-68 in CAP) similar to that in CAP between Arq-123 and Am-68. The modeled conformation Of the sonnectina residues 235 to 238 slloveb the further possibility Of hydroqen bond mte;actlons between the

Tyr-230. This Suggested that, although it may yet differ from the correct slde chains of Ser-237 and Glu-114 and between the hydroxyls of Thr-238 and

conformation, the newly modeled structure vas energetically favorable.

RESULTS

complementary DNA from mutant cells Was prepared, amplified, and se- quenced as described under Experimental Procedures. For five mutants, se- quences of PCR products were confirmed by subsloninq into an MI3 bacterio- phage vector. The reqions amplified and sequenced are shown in Flqure l slonq

_1 I - 4-

.n " + 2.'

i E' , .' ' e .

\ 2"

C-C,"""" . : . . , . , " e. .I 9 8 .x 0. .% .* 0 , .. .. .. ,, ,,

KILOBASE PAIRS

Fiqure 1. Diaqr'U of the IIUrin. RI SU8Unit EDNI Bb0Wi.q R.gionS used for Sequence Analysis of 6 4 9 K Mutants. The shaded bar represents the RI subunit codinq sequenc: drawn to the scale shown at the bottom Of the figure. Representative restriction Sites are indicated by endonuclease name (TaqI, BclI, EccoRI, PStI, and MluI), and positions of Codons for residues found mutated in these studies are Indicated by larqe arrows and names. Short. filled bars repre- sent PCR prlmers: sequences Of prmers are listed by the alphanu- meric designations Shown under Expermental Procedures: arrows in- dicate their priminq dlrestlons. Segment lines in the lover part of the fiqure (labeled A, 8, A'. B', AB, and AB') show reqions ampli- fied far sequence analysis. A* and 8. indlcste seqments generated

shown for subclonins into an Ml3 Vector. from the AB' PCR product by restriction endonuclease diqestlon as

with the positions of several restriction Sites and of codons for the various residues found mutated. Sequence analysis was directed initially to small reqlons (A and 8 or 8') centered on hqhly conserved sequences that were implicated as mutational tarqets by prevlous peptide mapplnq studies. Where necessary. analysis was extended either to AB or to A' reqlons.

Fiqure 2 Shows portions of sequencinq gel patterns for three S49 mutant sublines with site A lesions. Sublines cM13.2.2 and Cn19.09.1 are hemiryqous

Unlt more acidic, respectively, than wild-type ( 1 ) . Subline Cn6.6.4 2s het- for expression of mutant R subunits that are about 2 units nore basic and 1

eroryqous for expression of wild-type R Subunit and a mutant R Subunit with GlU Substituted for Gly-200 (2.15). The sequenslnq patterns confirmed the

strain cM19.09.1 (Fig. 2). The lesion in strain CM11.2.2 was a GC-.AT tran- lesion found prevmusly in strain cM6.6.4 and revealed the same lesion in

Eitim in the ccdon for Glu-201. The peedlcted amino acid substitution

Units. In contrast to the pattern from mutant cM6.6.4, which had label in (Glu-rLys) explained the 2-charqe basic Shhft Observed in the mutant R sub-

both A and G tracks at the mutated posltion (c and T in the minus-strand se- quence). those from the '*hemizyqous" mutants had label only I" A (or TI tracks at the mutated positions.

Kinase Regulatory Subunit 3553

WT CM13.2.2 CM6.6.4 CM19.09.1

" "" " A C G 1 A C G T A C G I A C G r .. - O C A -

' $ G - E - r- - G.A - :G'

- " .. - " _-

- - == .. 1'

+ STRAND

~ O U W ana mtmrozyqeu. 6 4 9 K. Mutants. *%~qion A- (Fiq. 1) was Fiqure 2. Dir.ct sequ.no. Analysi. or Amplified CDM. frem " B u i s y -

amplified from vlld-type (WI or mutant (0413.2.2, cM6.6.4, cM19.09.1) cDNAs u s m q BCL and TAQ primers. (sublines Cn11.2.2 and 0419.09.1 are hemizygous for expreaslon of mutant R subunits. while Subline 6.6.4 is heterozygous.) The rasultinq 171-bp DNA Was pur-

or TAQ ( - strand) olwmucleotides as sequencinq primers. Portions ified and used in sequencinq reactions with either BCL (+ strand1

of sequencing qel patterns Shown are those that contain mutated residues (Indicated by asterisks in wld-type sequences at the riqht of the fiqure); arrowheads Indicate positions Of mutations.

qous mutants with charqe alterations in R Subunit (3). For each mutant a Table I summarizes sequence analysis of our entire collection of hemizy-

minimum stretch of 120 base-pairs Was sequenced from both strands and. in

cept for lesions indicated. the sequences were all identical to wild-type. most cases, additional regions were sequenced from one or both strands. EX-

None of these mutants showed any evidence for wild-type R subunit m A ex- pression. Only a Slnqle base Substitution was observed for each mutant; all nucleotide SUbstitUtlOnS predicted amino acid substitutions; and a11 amino acid shsnqes were consistent with charge-shifts Observed in mutant R SUbUnlt proteins and ulth map pOSltion5 detemlned by two-dimensional gel aleotro- phoresls of partial proteolysis peptides (3). Because the double-stranded sequencinq procedure Usad pooled PCR-amplified DNA as template. mutatmns

ampllfled molecuies were cloned lnto n13 for sequencinq, however, additional introduced by =DNA synthesis or PCR were not detestable. when individual PCR-

mutatmns were found at a frequency of about 1 per 2000 bases sequenced. These "PCR-mdUCed" mutations were easily dlstinqulfhed from the orlqlnal cellular mutations because they Were limited to slnqle M13 subslones.

Table I

Hemizygous for Expression Of R Subunits with Altered Charge Sequence Analysis of R Subunit Lesions in Ka nutants

sequence Mutant Chanqe nutagen Chanqe seqmenta Primersb sequencec

m i n o acid PCR da Sequencing M13

Cn10.1.22 C-rT Cn11.1.23 C-rT Cn11.1.31 A-rG

Cn26.1.1 C--rT Cn15.4.1 C-.T

CM13.2.2 G-.A

CM13.4.3 &-A cMl4.1.1 G-rA Cnl4 . 3 . 3 G-lT Cn14.4.1 G-.A Cnl4 .I. 3 A - 4

CM14.6.4 0.A "4.5.2 G.T

Cn16.05.1 G-PA Cn16.08.1 G-.A Cn17.02.1 G-.A Cn17.04.1 C-rT Cn17.05.1 G-.A Cn17.07.2 C-.T CnlS.Ol.1 C-.T cM18.01.1 C-.T 0418.08.1 G-rA cM19.09.1 G-.A

SPONT SPONT SPONT

SPONT SPONT M S

M S M S M S EMS M S M S

UNNG M S

MNNG MNNG UNNG HNNG MNNG

UNNG UNNG

MNNG HNNG

8' 8 B' A B' 8' A B' 8' A* 8' A B' AB 8' 8' A 8' 8' A 8'

8' 8'

A' A 8'

PST, MLU PST,MLU

"

"

PST,MLU,3PR s*,(+strandl BCL.TAQ PST,MLU s*I+strandl PST,MLU "

8CL.TAQ "

PST,MLU PST,MLU

SPR,BCL,TAQ -- "

8CL.TAQ PST,MLU B*(+strandI

PST.3PR "

"

BCL,TAQ,MLU A*(-strandI PST.IILU "

PST. ULU "

BCL,TAQ "

PST.MLU.3PR B*(+strandl PST,MLU "

BCL,TAQ "

PST,HLU "

PST.MLU "

PST.MLU 5PR,BCL,TAQ -- 8CL.TAQ "

PST,MLU

"

cM20.06.1 G-.A MNNG GlyI2,-.Asp 8' PST,MLU "

'Letters refer to regions Of the R Subunit =DNA sequence shown in Fig. 1. Where the desiqnations "A"' and "AB" are used. both these

scquensinq was with PCR prlmer-5. In several cases desiqnated with larqe regions and the smaller A reqion were amplified, and

and sequenced from PST and elther MLU or 3PR prmers. Where two "E'," both B and 8' reqlons were amplified in separate experments

containinq the mutation is listed first. nonoverlsppinq intervals were amplified and sequenced, the interval

b S e q ~ e n ~ ~ ~ could be read for about 100 nucleotides (or into opposite strand PC8 primer sequence) starting about 26-10 bases

mutant sequences were all identical to wild-type and (except for from primer 5-prime ends. Except for the mutations indicated. the

occasional ambLquities Of a few bases) to the published murine Rr

EDesignsted frsqments (Fig. 1) Were subcloned into EEORI and either subunit CDNA sequence (16).

BaaHI or MluI sites of M13um21. Phage DNA from several independent isolates was sequenced from an 1113 universal primer (to give + or - strand sequences as indicated). Several qel runs were used so that the entire insert sequences (from just past the EFORI site1 could be read. Since all three restriction sites in the ampliried DNAs were Shown to be intact by digestion, this subclonmq and sequencing covered 217 and 332 bases, respectively, for A* and 8' sequences. In a l l cases the mutations indicated were confirmed. and the flanking sequences Were wild-type.