Myeloproliferative Disorders ARTICLES

haematologica | 2013; 98(7)

ARTICLES

1073

Myeloproliferative Disorders

The transcription factor nuclear factor erythroid-2 is over-expressed in patients with myeloproliferative neoplasmsirrespective of the presence of the JAK2V617F mutation. Our transgenic mouse model over-expressing nuclear factorerythroid-2, which recapitulates many features of myeloproliferative neoplasms including transformation to acutemyeloid leukemia, clearly implicates this transcription factor in the pathophysiology of myeloproliferative neo-plasms. Because the targets mediating nuclear factor erythroid-2 effects are not well characterized, we conductedmicroarray analysis of CD34+ cells lentivirally transduced to over-express nuclear factor erythroid-2 or to silencethis transcription factor via shRNA, in order to identify novel target genes. Here, we report that the cytokine inter-leukin 8 is a novel target gene. Nuclear factor erythroid-2 directly binds the interleukin 8 promoter in vivo, andthese binding sites are required for promoter activity. Serum levels of interleukin 8 are known to be elevated inboth polycythemia vera and primary myelofibrosis patients. Recently, increased interleukin 8 levels have beenshown to be predictive of inferior survival in primary myelofibrosis patients in multivariate analysis. Therefore,one of the mechanisms by which nuclear factor erythroid-2 contributes to myeloproliferative neoplasm pathologymay be increased interleukin 8 expression.

Transcription factor nuclear factor erythroid-2 mediates expression of the cytokine interleukin 8, a known predictor of inferior outcome in patients with myeloproliferative neoplasmsJulius Wehrle, Thalia S. Seeger, Sven Schwemmers, Dietmar Pfeifer, Alla Bulashevska, and Heike L. Pahl

Department of Hematology/Oncology, Center for Clinical Research, University Hospital Freiburg, Freiburg, Germany

ABSTRACT

©2013 Ferrata Storti Foundation. This is an open-access paper. Haematologica 2013;98. doi:10.3324/haematol.2012.071183The online version of this paper has a Supplementary Appendix. Manuscript received on June 24, 2012. Manuscript accepted on February 12, 2013. Correspondence: [email protected]

Introduction

The molecular etiology of myeloproliferative neoplasms(MPN) remains incompletely understood despite recentadvances achieved through the detection of various muta-tions in MPN patients, especially the JAK2V617F (Janus Kinase2V617F) mutation found in a large majority of affected individu-als.1 However, there are several lines of evidence to suggestthat somatic changes in MPN patients precede the acquisitionof the JAK2V617F mutation and that several alterations maycoincide to contribute to the MPN phenotype.2-7 In addition, alarge proportion of patients with primary myelofibrosis(PMF) and essential thrombocythemia (ET) display no knownmolecular aberration, hence, their molecular pathologyremains unknown.We have recently reported that the transcription factor

‘nuclear factor erythroid 2’ (NF-E2), is over-expressed in thevast majority of patients with all three MPN subtypes.8,9 NF-E2 is a tissue specific transcription factor expressed inhematopoietic stem cells as well as in the myeloid, erythroidand megakaryocytic lineage.10 NF-E2 overexpression in poly-cythemia vera (PV), ET and PMF is independent of the pres-ence or absence of the JAK2V617F mutation.8,9 In a murinemodel, NF-E2 overexpression causes an MPN phenotypeincluding thrombocytosis, leukocytosis, erythropoietin (Epo)-independent colony formation, characteristic bone marrowhistology, expansion of stem- and progenitor compartments,and spontaneous transformation to acute myeloid leukemia.11

This observation establishes a role for aberrant NF-E2 expres-sion in the pathophysiology of MPN.

Despite the well documented functions of NF-E2 in chro-matin remodeling and gene transcription,12-15 few direct targetgenes of this transcription factor are known. We, therefore,conducted gene expression analysis of CD34+ cells, lentiviral-ly transduced to over-express NF-E2 or to silence endogenousNF-E2 expression via shRNA, in order to characterize novelNF-E2 target genes.

Design and Methods

Lentiviral constructsThe lentiviral pLeGO-iG vector16 was modified by exchanging the

murine U6 promoter for its human counterpart, as previouslydescribed for the pLeGO-G plasmid.17 Briefly, the following primerswere used to amplify the human U6 promoter: forward primer: 5' atctag aga ggg cct att tcc cat g 3'; reverse primer 5' agt taa cgt cct ttc cacaag ata t 3'. The resulting fragment was digested with XbaI and HpaIand used to replace the murine U6 promoter in pLeGO-iG. The mod-ified pLeGO-iG was named pLEGO-iG-hU6.

Lentiviral transduction of CD34+ cellsBuffy coats of healthy volunteer blood donors were obtained from

the University Hospital Freiburg Center for Blood Transfusion. Thestudy protocol was approved by the local ethics committees(University Hospital Freiburg). CD34+ cells were isolated byimmunoselection (MACS Miltenyi). Lentiviral transduction of CD34+

cells using either the empty pLEGO-iG-hU6 or a vector expressing thehuman NF-E2 cDNA was performed as previously described.17 Briefly,cells were pre-stimulated for 2 h in serum-free medium (StemSpanSFEM, 09650, Stem Cell Technologies, Vancouver, BC, Canada) con-

© Ferrata

Stor

ti Fou

ndati

on.

No com

mercial

use i

s allo

wed

taining 100 ng/mL rhSCF (300-07, PeproTech, Rocky Hill, NJ,USA), 100 ng/mL rhFLT-3 ligand (300-19, PeproTech), 20 ng/mLrhIL6 (200-06 PeproTech) as well as 200 ng/mL rhTPO (300-18,PeproTech). Subsequently, CD34+ cells were lentivirally infectedusing MOIs between 7 and 10 without addition of a transductionfacilitator. Forty-eight hours after transduction, GFP expressingcells were FACS sorted to obtain pure populations.

RNA extractionRNA was extracted using the RNeasy Mini Kit (#74104, Qiagen,

Hilden, Germany) and subsequently analyzed for quality andintegrity on an Agilent Bio-Analyzer 2100 (RNA 6000 NanoAssay). Total cellular RNA samples with an RIN (RNA integritynumber) over 7.4 were subjected to purification of mRNA usingthe Ribo-Minus-Kit (Invitrogen, Carlsbad, USA; #K1550-01)according to standard protocols (Affymetrix GeneChip WholeTranscript Sense Target Labeling Assay Manual).

Microarray analysisGene expression analyses were conducted using the Human

Exon Array 1.0 ST (Affymetrix Santa Clara, CA, USA).Hybridization, washing, and scanning were performed accordingto standard protocol (Affymetrix Human Exon 1.0 ST).The raw microarray data were pre-processed using Affymetrix

Power Tools (APT, version 1.10.2, Affymetrix) by applying the GCRobust Multi-array Average (GC-RMA) and the detection abovebackground (DABG) methods. Metaprobe sets included in thecore annotation (HuEx1.0/v2/hg18) were further analyzed withthe R (R-project for statistical computing, version: 2.10.1;http://www.r-project.org18) and Bioconductor (version 2.6.1;http://www.bioconductor.org19) softwares. The analysis of differentialexpression was performed using the Linear Models for MicroarrayData Package (limma)20 after applying a filter for the DABG P valueof 0.01 or under. A linear model representing the matched pairedstructure of the experiment was fitted for each gene by applyingthe lmFit function. Differences in gene expression were rankedaccording to the eBayes function. To control for multiple testing,the P values obtained were adjusted by calculating the false dis-covery rate (fdr) using the method of Benjamini and Hochberg.21

Genes were considered to be differentially expressed if the fdr-adjusted P value was less than 0.05.

Quantitative real-time polymerase chain reaction Quantitative real-time polymerase chain reaction (RT-PCR)

experiments were performed using the following Assay onDemand (Applied Biosystems, Foster City, CA, USA) products forgene expression analysis:Human IL-8 Assay on demand (Hs00187842_m1) Human Beta-2-Microglobulin Assay on demand

(Hs00187842_m1)Human NF-E2 Assay on demand (Hs00232351_m1)Reverse transcription of 50 ng of total RNA of CD34+ cells was

performed using the TaqMan Reverse Transcription Kit (AppliedBiosystems). Quantitative PCR assays were conducted in dupli-cate in an ABI PRISM 7000 Cycler. Relative quantification of IL-8mRNA expression was performed using the ΔΔCT-methodemploying beta 2 (b2)-microglobulin as the reference gene.22

Lentiviral transduction of cell linesHuman erythroleukemia (HEL) cells were maintained in RPMI

1640 medium (Invitrogen) supplemented with 10% fetal bovineserum (FBS), L-glutamine, and penicillin/streptomycin (all fromInvitrogen). UKE-1 cells were cultured in Iscove’s modifiedDulbecco medium (Invitrogen) supplemented with 10% FBS, 10%horse serum (Biological Industries), 1 mM hydrocortisone (Sigma-

Aldrich), and penicillin/streptomycin. Culture medium for SET-2cells consisted of RPMI 1640 medium (Invitrogen) supplementedwith 20% fetal bovine serum (FBS) and penicillin/streptomycin (allfrom Invitrogen).Cell lines were transduced with lentiviral particles at an MOI of

4, resulting in more than 97% GFP-positive cells.

Intracellular IL-8 FACS-stainingCells were treated with brefeldin A (BFA, 10ug/ml) for 4 h and

subsequently labeled using the FastImmune Anti-Hu–IL-8 PEDetection Kit (#340510, Becton-Dickinson Biosciences, San Jose,CA, USA) according to the manufacturer’s recommendations.Intracellular cytokine expression was analyzed on a FACSCalibur(BD Biosciences) using the FlowJo software (Tree Star).

IL-8 ELISA Cell supernatents were assayed for IL-8 using the Quantikine IL-

8-ELISA (R&D Systems, #D8000C).

Plasmid constructsThe IL-8 promoter constructs were generated by PCR amplifi-

cation of the -5kb upstream enhancer and the IL-8 promoterregion from total cellular DNA of purified granulocytes fromhealthy donors by using the following primers:-5k-enhancer: fwd 5’-GCTGGTACCCCAAGGCCAAAGTGAGGA-3’, rev 5’-GCTGCTAGCGAAGTTTAGGTTTAGGGGAAGAC-3’280bp-promoter-region: fwd 5’-CCGGCTAGCCAAATTGT-3’ rev 5’-CGCCTCGAGCTTGTGTG-3’ The promoter and enhancer elements were cloned into the

pGL4.10 luciferase reporter vector (Promega, Mannheim,Germany). Mutations of the NF-E2 binding site constructs wereperformed using GeneArt Site-Directed Mutagenesis system(Invitrogen, Karlsruhe, Germany). NF-E2 binding sites at position -5k (TTAGTCA / from -5235bp to -5228bp relative to TTS) and at-120bp (TGACTCA) were mutated to GTCGGAC and TTGC-GAC, respectively.

Transient transfections and luciferase assays293T cells were transiently transfected using the CaCl2-BES

Method. A total of 3x105 293T cells were transfected using 0.05 mgof the various IL-8-promoter-luciferase reporter constructs. Inaddition, 0.68 mg of either an NF-E2-pRC-CMV expression vectoror an empty pRC-CMV control vector and 0.17 mg of a MafGpCMV6XL4 (Origene) or an empty pCMVXL4 control vectorwere co-transfected. As an internal control, 0.1 mg of pRL-TK-Renilla vector (E2241, Promega) were used for each reaction. Cellswere harvested 24 h after transfection and luciferase activity wasdetermined using the Dual Luciferase Reporter Assay System(Promega) within a Microplate Luminometer LB 96 V (Berthold).Luciferase activity was normalized to the Renilla internal controlto compensate for variations in transfection efficiency.

Chromatin immunoprecipitation Chromatin immunoprecipitation (ChIP) assays were performed

following a modified protocol previously described by Shang etal.23 HEL cells were treated with formaldehyde (1%) for 10 min atroom temperature and subsequently washed two times with coldphosphate buffered saline (PBS). The cell pellets were flash frozenin liquid nitrogen and stored at -80°C. For the immunoprecipita-tion, cell pellets were thawed on ice and resuspended in 200 mLlysis buffer (50mM Tris pH 8.0; 10mM EDTA; 1% SDS) per 2x106

cells. Subsequently, lysate was incubated for 10 min on ice andsonicated five times at 30 s each at maximal output. The lysate

J. Wehrle et al.

1074 haematologica | 2013; 98(7)

© Ferrata

Stor

ti Fou

ndati

on.

No com

mercial

use i

s allo

wed

was centrifuged 10 min at 13,000 rpm and 4°C, 180 mL of thelysate were diluted in 720 mL dilution buffer (20 mM Tris pH 8.0;2 mM EDTA; 150 mM NaCl; 0.01% SDS; 1% Triton X100). Thepre-clearing reaction was performed at 4°C for 2 h, using 50 mL ofa protein-A agarose slurry including salmon sperm DNA (16-157;Milipore). Antibody binding was obtained by an over-night incu-bation at 4°C using 2 mg of anti-NF-E2 antibody (sc-291-X, SantaCruz) as well as an anti-IgG control (#2729; Cell Signaling).Immuncomplexes were precipitated at 4°C for 2 h, using 50 mL ofa protein-A agarose slurry including salmon sperm DNA (16-157;Milipore). The sepharose beads were washed once using 1 mLdilution buffer, two times with 1 mL low salt buffer (20 mM TrispH 8.0; 2 mM EDTA; 150 mM NaCl; 0.1% SDS; 1% Triton X100),once with 1 mL high salt (20 mM Tris pH 8.0; 2 mM EDTA; 500mM NaCl; 0.1% SDS; 1% Triton X100) as well as LiCl buffer (10mM Tris pH 8.0; 1 mM EDTA; 250 mM LiCl; 1% NP40; 1% NaDeoxycholat) followed by two washes using 1 mL TE Buffer (10mM Tris pH 8.0; 1 mM EDTA). The extraction was performedtwo times, using 250 mL of elution buffer (0.1 M NaHCO3; 1%SDS). Eluates were pooled and heated at 65°C for 4h after additionof 0.2 M NaCl. Following elution, a Proteinase K digestion wasperformed at 45°C for 30 min, using 20 mg Proteinase K. The DNAwas purified by phenol-chloroform extraction and precipitatedovernight at -20°C. The DNA pellets were washed in 70% ethanoland resuspended in water. The following primer pairs were usedfor DNA amplification:–5.3kb to -5.1kb of the human IL-8 promoter:sense 5’-ACATATCACTACAGAATCATAAC-3’ antisense 5’-AAGTTGCTATGTTAGAAATGAC-3’

bp -240bp to -30bp of the human IL-8 promoter:sense 5’-TCACCAAATTGTGGAGCTTCAG-3’ antisense 5’-AGAGAACTTATGCACCCTCATC-3’

-2.7kb to -2.5 kb of the human IL-8 promoter:sense 5’- GAATGGGACGTAAATAAACAG -3’, antisense 5’- GAGTCCTTGCATAATGAGTAG -3’

-13.4kb to -13.2kb of the human IL-8 promoter:sense 5’- CTAGGAAGGGGAAGGGTCTC -3’, antisense 5’- CTGCCTATCTCACTTTCCAATCTC -3’

human myogenin control: sense 5’-AGGGGCTGCTGAGAAATGAAAAC-3’ antisense 5’-ATATAGCCAACGCCACAGAAACCT-3’

Statistical analysisStudent's one sample t-test and paired t-test were applied to

determine whether there was a significant (P<0.05) differencebetween two groups. When comparing more than two groups, aone-way ANOVA with post hoc Tukey’s Multiple Comparison Testwas conducted. These analyses were performed using theGraphpad Prism software (version 5.3 for Windows, GraphpadSoftware).

Results

Novel NF-E2 target genesBecause NF-E2 has been demonstrated to play a substan-

tial role in the pathogenesis of MPN, but few target genesof this transcription factor are known, we sought to identi-fy novel NF-E2 targets. To this end, we transduced purifiedhealthy control CD34+ hematopoietic stem cells with threedifferent lentiviruses, an empty control (pLeGO-iG-hU6), a

pLeGO-iG expressing the NF-E2 cDNA (pLeGO-iG-hU6-NF-E2) and a pLeGO-iG expressing an shRNA against NF-E2 (pLeGO-iG-hU6-shNF-E2), whose efficiency we havepreviously demonstrated.17 Following FACS purification oftransduced CD34+ cells, RNA was harvested and subjectedto microarray analysis on an Affymetrix human exon array(Figure 1A). For each viral construct, 4 independent, match-paired replicates were analyzed. Quantitation of NF-E2mRNA demonstrated that the transcription factor wasindeed over-expressed in CD34+ cells transduced with thecDNA and suppressed in cells transduced with the NF-E2shRNA (Figure 1B).Gene expression analysis revealed a set of genes inverse-

ly regulated by elevated NF-E2 levels and diminished NF-E2 levels (Online Supplementary Table S1). In this group,mRNA expression of the cytokine IL-8 was increased 2.9-fold by NF-E2 cDNA expression and decreased 2-fold byNF-E2-shRNA expression (Figure 1C and D). Becauseabnormally elevated IL-8 levels have been reported inMPN patients,24 we chose to analyze this potential novelNF-E2 target in more detail.To verify the microarray gene expression data, we used

qRT-PCR to measure CD34+ cells independently trans-duced with the same three lentiviruses. Again, transduc-tion of CD34+ cells with an NF-E2 cDNA statistically sig-nificantly elevated IL-8 mRNA expression by a mean of3.1-fold over the empty control virus, whereas the NF-E2shRNA decreased IL-8 mRNA expression below theempty virus control (Figure 1D).

NF-E2 expression modulates IL-8 protein levelsIn order to study the effect of NF-E2 on IL-8 protein lev-

els, we used the myeloid cell line U937, which expresseslow amounts of NF-E2 and elaborates very low levels ofendogenous IL-8.25 U937 cells were lentivirally transducedwith the empty pLeGO-iG vector or the vector expressingthe NF-E2 cDNA construct. Western blot analysis demon-strated that NF-E2 is indeed over-expressed in cDNA trans-duced U937 cells (Figure 2A). Intracellular IL-8 levels weredetected by intracellular FACS staining. While untrans-duced and empty virus transduced U937 cells display verylittle intracellular IL-8, transduction with the NF-E2 cDNAcaused a statistically significant increase in intracellular IL-8 staining (Figure 2B and C). Supernatants from transducedU937 cells were investigated for IL-8 secretion by ELISA.Again, untransduced or empty virus transduced cells elab-orate very low levels of IL-8 protein; however, expressionof the NF-E2 cDNA is sufficient to induce a significant, 5.3-fold increase in IL-8 protein secretion (Figure 2D).Having demonstrated that elevated NF-E2 levels are suf-

ficient to increase IL-8 expression, we investigatedwhether a decrease in NF-E2 expression similarly causes areduction in IL-8 protein expression. We used three differ-ent hematopoietic cell lines, HEL, SET2 and UKE1, the lat-ter two of which are derived form MPN patients. All threecell lines express high levels of NF-E29 and secrete high lev-els of IL-8 when transduced with an empty control vectoror a vector expressing a scrambled, inactive shRNA (Figure3A-C). Transduction with the NF-E2 shRNA significantlyreduces IL-8 protein secretion in all three lines (Figure 3A-C). These data strongly suggest that NF-E2 is required forIL-8 expression.

NF-E2 binds and transactivates the IL-8 promoterIn silico analysis of whole genome NF-E2 chromatin

NF-E2 regulates IL-8

haematologica | 2013; 98(7) 1075

© Ferrata

Stor

ti Fou

ndati

on.

No com

mercial

use i

s allo

wed

immunoprecipitation experiments26 revealed two potentialNF-E2 binding sites in the IL-8 promoter region andupstream sequences, one at bp -120 and one 5 kb upstreamof the transcriptional start site. We, therefore, cloned theseregions upstream of a luciferase reporter gene (Figure 4A)and transfected the resulting construct into 293T cells in thepresence or absence of expression vectors encoding NF-E2and MafG. As previously shown for other NF-E2 targetgenes, expression of NF-E2 or MafG alone is insufficient toinduce transcriptional activation (Figure 4B). Co-transfec-tion of both NF-E2 and MafG, however, resulted in a 7-foldincrease in IL-8-promoter-driven luciferase activity (Figure

4B), demonstrating that NF-E2 is able to transactivate theIL-8 promoter.In order to delineate the contribution of the two potential

binding sites to NF-E2 mediated IL-8 promoter activation,we mutated each of the two putative NF-E2 binding sites inthe IL-8 promoter, individually or in trans. The resulting con-structs were again evaluated in luciferase assays followingtransient transfection into 293T cells in the presence ofexpression vectors for NF-E2 and MafG (Figure 4C).While mutation of each of the putative NF-E2 binding

sites individually reduced IL-8 promoter transactivation byaround 45%, mutation of both sites simultaneously virtual-

J. Wehrle et al.


Figure 1. Identification of novel NF-E2 target genes.(A) Experimental Design. Purified peripheral bloodCD34+-cells from healthy donors, were transducedwith either the empty lentiviral vector, pLeGo-iG-hU6(top), or pLEGO-iG-hU6 engineered to express humanNF-E2 cDNA (middle) or a shRNA silencing NF-E2expression (bottom). 84 h following transduction,GFP+-cells were FACS-sorted, RNA extracted, andused for microarray analysis on an AffymetrixHuman Exon Array. Four separate pools of CD34+

cells were transduced in parallel with each of thethree vectors, yielding a total of 12 microarrays foranalysis, four independent arrays for each vector. (B)NF-E2 mRNA expression in lentivirally transducedCD34+ cells. The RNA used for microarray analysis[see (A) above] was quantitated for NF-E2 expressionby qRT-PCR. Results are reported as copies NF-E2expressed per 103 copies of the beta-2-microglobulinhousekeeping gene; n = 4 each; *P<0.05. (C) IL-8mRNA expression in microarray analysis. (Top)Following data analysis, mRNA expression values arenormalized, assigned to a color on a green-red scaleand displayed as a color field. (Bottom) IL-8 expres-sion for each of the four independent microarrays inthe three conditions is depicted. (D) IL-8 mRNAexpression by qRT-PCR. mRNA expression of IL-8 andthe housekeeping gene beta-2-microglobulin (b-2-M)was quantified in CD34+ cells by qRT-PCR. IL-8expression was normalized to b-2-M expression andthe expression in empty virus transduced CD34+ cellsset at 1. Values are reported as fold change overempty virus transduced cells and depict mean andSD of 4 individual experiments. *P≤0.05 by paired t-test.

A

B

C

D

CD34+-cells

EMPTY

lentiviraltransduction

AffymetrixHuman Exon1.0 ST array

FACS sort GFP+

cDNA-NF-E2

EMPTY cDNA-NF-E2 shRNA-NF-E2

5000

4000

3000

2000500400300200100

0



IL-8 fo

ld cha

nge

NF-E2/1.00

0 B2

M

0.0 1.0 4.0fold change

IL-8

5

4

3

2

1

0

shRNA-NF-E2

© Ferrata

Stor

ti Fou

ndati

on.

No com

mercial

use i

s allo

wed

ly abolished NF-E2-mediated IL-8 promoter activation(Figure 4C). Both of the NF-E2 binding sites identified in sil-ico thus contribute functionally to induction of IL-8 promot-er activity by NF-E2.Because the two NF-E2 binding sites are functional in the

IL-8 promoter, we sought to investigate whether they areoccupied by NF-E2 in vivo. To this end, we used chromatinimmunoprecipitation (ChIP) to interrogate NF-E2 bindingto the IL-8 locus in HEL cells (Figure 5A). Both the proximal-120 bp site as well as the distal -5kb site of the IL-8 locusare bound by NF-E2 in intact chromatin in HEL cells (Figure5B), whereas other sites within the IL8 locus as well as sitesin the myogenin control gene are unaffected (Figure 5B).Taken together these data establish a role for NF-E2 in reg-ulating expression of the pro-inflammatory cytokine IL-8,thereby identifying IL-8 as a novel NF-E2 target gene.

Discussion

Plasma and serum levels of the pro-inflammatorycytokine IL-8 are elevated in patients with PV and PMF,displaying a considerable variation in plasma concentra-tions.24,27 In PMF, where only half of the patients carry theJAK2V617F mutation, increased IL-8 expression is independ-ent of the presence or absence of the JAK2 mutation.28Elevated IL-8 levels have been implicated in the alteredmegakaryocyte growth and differentiation observed inPMF, as either inhibition of IL-8 by neutralizing antibodiesor reduction of IL-8 expression by RNAi technologyrestored normal megakaryocyte proliferation and differen-tiation to PMF cells.27 Moreover, addition of neutralizinganti–IL-8 receptor antibodies to PMF cells in liquid cultureincreased proliferation and differentiation of CD41+



Figure 2. IL-8 protein expression following NF-E2 expression in U937 cells. U937 cells were transduced either with the empty lentivirus orwith a virus expressing the NF-E2 cDNA. (A) Total cell extracts were interrogated with an antibody against NF-E2 (top). Equal loading wasassured by reprobing with an antibody against GAPDH (bottom). (B-C) Lentivirally transduced U937 cells were cultured for 4 h in mediumcontaining brefeldin A (10 ng/mL) to block the secretion of IL-8. Subsequently, intracellular IL-8 was stained and analyzed by FACS. (B)Representative histogram of n=5, depicting intracellular IL-8 staining of untreated cells (control) as well as cells infected with empty vector(empty) or with NF-E2 expressing virus (NF-E2), as indicated. (C) Mean and SD of the mean fluorescence intensity (MFI) of IL-8 staining inn=5 independent experiments are displayed, *P≤0.05 by one-way ANOVA with post-hoc Tukey’s Multiple Comparison Test. (D) Lentivirallytransduced U937 cells were cultivated for 24 h and the supernatant subsequently removed for detection of IL-8 protein secretion by ELISA.Bars depict the mean and SD IL-8 concentration of 3 independent experiments from untreated cells (control) or from cells transduced withempty virus (empty) or with virus expressing the NF-E2 cDNA.

Figure 3. IL-8 protein expression following knockdown of NF-E2 in MPN cell lines. (A) UKE1 cells (B) SET2 cells and (C) HEL cells were trans-duced with the empty lentiviral vector as well as a virus expressing a shRNA against NF-E2 (shRNA-NF-E2). 24 h after transduction, thesupernatant was removed and IL-8 concentration determined by ELISA (top). Bars depict the mean and SD IL-8 concentration of 3 inde-pendent experiments measured in duplicate. *P≤ 0.05 by t-test. Total cell extracts were interrogated with an antibody against NF-E2 (top).Equal loading was assured by reprobing with an antibody against GAPDH (bottom).

A B C DU937

UKE1

NF-E2

GAPDH

SET2 HEL

EMPTY cDNA-NF-E2

NF-E2

GAPDH

Cell co

unt

MFI

(mea

n flu

ores

cenc

e intens

ity)

IL-8(pg/mL)

IL-8 PE100 101 102 103 1040

Control

EMPTY

cDNA-NF-E2

100

80

60

40

20

0

400

300

200

100

0

IL-8 (p

g/mL)

EMPTY scrambled shRNA-shRNA NF-E2



250

200

150

100

50

0

100

80

60

40

20

0

250

200

150

100

50

0Control EMPTY cDNA-

NF-E2Control EMPTY cDNA-

NF-E2

© Ferrata

Stor

ti Fou

ndati

on.

No com

mercial

use i

s allo

wed

megakaryocytic cells and restored their polyploidization.27These data implicate pathologically elevated IL-8 levels inthe altered megakaryocyte maturation of PMF.Low doses of IL-8, which is produced by bone marrow

stromal cells,29 have been shown to stimulate CD34+ pro-liferation and increase cell survival.30,31 In mice, exogenousIL-8 administration causes neutrophilia and stem cellmobilization.32 Increased numbers of circulating CD34+hematopoietic stem cells are consistently observed in allMPN subtypes, with the highest efflux seen in PMFpatients.33 By stimulating IL-8 production, increased NF-E2levels may thus contribute to MPN stem cell mobilization. Growth of erythroid colonies in the absence of Epo (so

called endogenous erythroid colonies, EECs) is a pathog-nomonic feature of PV which can be used diagnostically.34Treatment of healthy bone marrow with a combination ofIL-8 and SCF allows for Epo-independent EEC growth.35

Hence, the elevated IL-8 levels observed in PV and PMFmay contribute to several prominent disease features,including Epo-independent erythroid growth and stem cellefflux.Discovery of the JAK2V617F mutation in MPN patients

spurred the development of several specific JAK2inhibitors. These were initially assessed for clinical effica-cy in patients with PMF; patients who demonstrate thehighest medical need. Surprisingly, several trials have nowdemonstrated that the response rate to JAK2 inhibitors issimilar among PMF patients carrying the JAK2V617F muta-tion and those with wild-type JAK2.36,37 One possibleexplanation for this observation is that the recently FDAapproved JAK1/JAK2 inhibitor ruxolitinib (INC424) hasbeen shown to lower the levels of inflammatorycytokines, including IL-8. Increased cytokine levels areindependent of the JAK2 status.28,36,38 The reductions inspleen size observed with ruxolitinib treatment may thusreflect an anti-inflammatory effect, mediated in part bythe observed reduction of IL-8 levels. IL-8 was the only cytokine that appeared statistically

significantly altered by changes in NF-E2 levels (OnlineSupplementary Table S1). However, we analyzed changes inexpression levels as soon as successful transduction couldbe observed by GFP positivity in order to capture early,primary events. It is entirely possible that other cytokinesmay also constitute NF-E2 targets that are up-regulated ata later time point, or that these genes may be regulatedindirectly through secondary effects following NF-E2upregulation.Tefferi and colleagues have recently correlated plasma

inflammatory cytokine levels with clinical outcome.39 In a

J. Wehrle et al.


Figure 4. NF-E2 transactivation of the IL-8 promoter. (A) Schematicrepresentation of the IL-8 promoter/enhancer reporter gene con-struct. The construct includes a 1 kb upstream enhancer region,from -5.5kb to -4.5kb, and the proximal 262 bp of the IL 8 promoter.NF-E2 sites predicted by in silico analysis are indicated by open cir-cles. (B) The IL-8 promoter/enhancer luciferase vector was transfect-ed into 293T cells together with plasmids encoding NF-E2 and/orMafG as indicated. Bar graphs represent the mean and SD of atleast 5 independent experiments, each performed in duplicate. Dataare shown normalized to the IL-8 reporter construct co-transfectedwith MafG alone, which was set at 1. ***P<0.001 by one-wayANOVA with post-hoc Tukey’s Multiple Comparison Test. (C) Thepotential NF-E2 binding sites were altered by site-directed mutagen-esis. Presence of the mutations is indicated by crosses in the circles.Sequences of the wt and the mutated sites are depicted below(mutated bases in bold). The IL-8 reporter constructs shown were co-transfected into 293T cells together with expression plasmids forNF-E2 and MafG. Bar graphs represent the mean and SD of 4 inde-pendent experiments, each performed in duplicate. Data are nor-malized to the wt IL-8 reporter construct transfected with MafGalone, which was set at 1. ***P<0.001, **P<0.01, *P<0.05 by one-way ANOVA with post-hoc Tukey’s Multiple Comparison Test.

Figure 5. Chromatin immunoprecipitation (ChIP) analysis of NF-E2binding sites on the IL-8 promoter and enhancer. (A) Schematic rep-resentation of the primers used to ChIP the two NF-E2 binding sites.(B) HEL cell lysates were chromatin immunoprecipitated (ChIPed)either with an antibody to NF-E2 or with an unrelated IgG control, asindicated. ChIPed DNA was amplified by PCR using either primerscovering the NF-E2 binding sites in the IL-8 promoter and enhanceror with control primers from other regions within the IL8 locus andfrom the myogenin promoter, as indicated. In lane 3 (Input), a 1:50dilution of the input DNA was used, lane 4 (Control) shows controlPCR reactions without DNA.

A

B

C

IL-8 promoter

-5kb -120bp

-5kb -120bp

A

B

Fold activation

NF-E2 wtmutated

Fold activation

0 1 2 3 4 5 6 7 8 9 10 11 12

8

7

6

5

4

3

2

1

0MafG - - + +NF-E2 - + - +

-13kb -5kb -2.7kb -120 bp

Exon1

-5kb

-120 bp

-2.7kb

-13kb

Myogenin

HEL

NF-E2 IgG Input Control

© Ferrata

Stor

ti Fou

ndati

on.

No com

mercial

use i

s allo

wed

multivariate analysis of treatment-naïve patients, elevatedIL-8 levels independently predicted inferior outcome.Moreover, IL-8 levels remained a significant predictor ofinferior survival, even when risk stratification according tothe recently up-dated Dynamic International PrognosticScoring System (DIPSS plus) was included in the analysis.39IL-8 was the only cytokine analyzed which was associat-ed with an elevated level of circulating blasts (> 1%) andpredicted leukemia-free survival. In addition, increased IL-8 levels were associated with both leukocytosis and con-stitutional symptoms.39 JAK2 inhibitors decrease whiteblood cell counts and lower IL8 levels. Since neutrophilsand monocytes are the main sources of IL8, JAK2 inhibitortreatment, may relieve constitutional symptoms ultimate-ly by decreasing IL-8 levels.36 Likewise, in a recent phase Itrial, elevated IL-8 levels were found to predict a poor ane-mia response to palidomide in PMF.28 IL-8 may thus con-tribute to several pathophysiological processes in PMFpatients, changes that are reversible with novel treatmentstrategies. Taken together, our data demonstrate that the pro-

inflammatory cytokine IL-8 is a novel NF-E2 target gene

and that augmentation of NF-E2 levels increases IL-8 pro-duction. The elevated IL-8 levels observed in PV and PMFpatients have been demonstrated to contribute to variousaspects of disease pathophysiology. Therefore, one mech-anism by which NF-E2 overexpression contributes toMPN pathology may constitute increased IL-8 expression.

AcknowledgmentsThe authors gratefully acknowledge support from the MPD

Research Consortium (MPD-RC) Tissue Bank which providedtissue samples. We thank Lara Rheinemann for kindly providingcell cultures.

This work was supported by grants from the National CancerInstitute (PO1 CA108671 to HLP) and the DeutscheForschungsgemeinschaft, DFG (Pa 611/6-1 to HLP). HLP is amember of the MPD Research Consortium (MPD-RC).

UKE 1 cells were a kind gift from Prof. Dr. W. Fiedler.

Authorship and DisclosuresInformation on authorship, contributions, and financial & other

disclosures was provided by the authors and is available with theonline version of this article at www.haematologica.org.



References

1. James C, Ugo V, Le Couedic JP, Staerk J,Delhommeau F, Lacout C, et al. A uniqueclonal JAK2 mutation leading to constitu-tive signalling causes polycythaemia vera.Nature. 2005;434(7037):1144-8.

2. Cario H, Goerttler PS, Steimle C, LevineRL, Pahl HL. The JAK2V617F mutation isacquired secondary to the predisposingalteration in familial polycythaemia vera.Br J Haematol. 2005;130(5):800-1.

3. Bellanné-Chantelot C, Chaumarel I,Labopin M, Bellanger F, Barbu V, De TomaC, et al. Genetic and clinical implications ofthe Val617Phe JAK2 mutation in 72 familieswith myeloproliferative disorders. Blood.2006;108(1):346-52.

4. Kralovics R, Teo SS, Li S, Theocharides A,Buser AS, Tichelli A, et al. Acquisition ofthe V617F mutation of JAK2 is a late genet-ic event in a subset of patients with myelo-proliferative disorders. Blood. 2006;108(4):1377-80.

5. Nussenzveig RH, Swierczek SI, Jelinek J,Gaikwad A, Liu E, Verstovsek S, et al.Polycythemia vera is not initiated byJAK2V617F mutation. Exp Hematol. 2007;35(1):32-8.

6. Campbell P, Baxter E, Beer P, Scott L, BenchA, Huntly B, et al. Mutation of JAK2 in themyeloproliferative disorders: timing, clon-ality studies, cytogenetic associations androle in leukemic transformation. Blood.2006;108(10):3548-55.

7. Theocharides A, Boissinot M, Girodon F,Garand R, Teo SS, Lippert E, et al.Leukemic blasts in transformed JAK2-V617F positive myeloproliferative disor-ders are frequently negative for the JAK2-V617F mutation. Blood. 2007;110:375-9.

8. Goerttler PS, Kreutz C, Donauer J, Faller D,Maiwald T, Marz E, et al. Gene expressionprofiling in polycythaemia vera: overex-pression of transcription factor NF-E2. Br JHaematol. 2005;129(1):138-50.

9. Wang W, Schwemmers S, Hexner EO, Pahl

HL. AML1 is overexpressed in patientswith myeloproliferative neoplasms andmediates JAK2V617F-independent overex-pression of NF-E2. Blood. 2010;116(2):254-66.

10. Andrews N, Erdjument-Bromage H,Davidson MB, Tempst P, Orkin SH.Erythroid transcription factor NF-E2 is ahematopoietic-specific basic-leucine zipperprotein. Nature. 1993;362(6422):722-8.

11. Kaufmann K, Gründer A, Hadlich T,Wehrle J, Gothwal M, Bogeska R, et al. Anovel murine model of myeloproliferativedisorders generated by overexpression ofthe transcription factor NF-E2. J Exp Med.2012;209(1):35-50.

12. Kiekhaefer CM, Grass JA, Johnson KD,Boyer ME, Bresnick EH. Hematopoietic-specific activators establish an overlappingpattern of histone acetylation and methyla-tion within a mammalian chromatindomain. Proc Natl Acad Sci USA. 2002;99(22):14309-14.

13. Onishi Y, Kiyama R. Interaction of NF-E2 inthe human beta-globin locus control regionbefore chromatin remodeling. J Biol Chem.2003;278(10):8163-71.

14. Demers C, Chaturvedi CP, Ranish JA, JubanG, Lai P, Morle F, et al. Activator-mediatedrecruitment of the MLL2 methyltransferasecomplex to the beta-globin locus. Mol Cell.2007;27(4):573-84.

15. Chaturvedi CP, Hosey AM, Palii C, Perez-Iratxeta C, Nakatani Y, Ranish JA, et al.Dual role for the methyltransferase G9a inthe maintenance of {beta}-globin gene tran-scription in adult erythroid cells. Proc NatlAcad Sci USA. 2009;106(43):18303-8.

16. Weber K, Bartsch U, Stocking C, Fehse B. Amulticolor panel of novel lentiviral "geneontology" (LeGO) vectors for functionalgene analysis. Mol Ther. 2008;16(4):698-706.

17. Roelz R, Pilz IH, Mutschler M, Pahl HL. Ofmice and men: human RNA polymerase IIIpromoter U6 is more efficient than itsmurine homologue for shRNA expressionfrom a lentiviral vector in both human and

murine progenitor cells. Exp Hematol.2010;38(9):792-7.

18. Team RDC. R: A language and environ-ment for statistical computing. RFoundation for Statistical Computing,Vienna, Austria: 2008.

19. Gentleman RC, Carey VJ, Bates DM,Bolstad B, Dettling M, Dudoit S, et al.Bioconductor: open software developmentfor computational biology and bioinfor-matics. Genome Biol. 2004;5(10):R80.

20. Smyth GK, Michaud J, Scott HS. Use ofwithin-array replicate spots for assessingdifferential expression in microarray exper-iments. Bioinformatics. 2005;21(9):2067-75.

21. Benjamini Y, Hochberg Y. Controlling thefalse discovery rate: a practical and power-ful approach to multiple testing. J RoyalStat Soc. 1995;57:289-95.

22. Livak KJ, Schmittgen TD. Analysis of rela-tive gene expression data using real-timequantitative PCR and the 2(-Delta DeltaC(T)) Method. Methods. 2001;25(4):402-8.

23. Shang Y, Myers M, Brown M. Formation ofthe androgen receptor transcription com-plex. Molecular Cell. 2002;9(3):601-10.

24. Hermouet S, Godard A, Pineau D, Corre I,Raher S, Lippert E, et al. Abnormal produc-tion of interleukin (IL)-11 and IL-8 in poly-cythaemia vera. Cytokine. 2002;20(4):178-83.

25. Lin SN, Ayada K, Zhao Y, Yokota K,Takenaka R, Okada H, et al. Helicobacterpylori heat-shock protein 60 induces pro-duction of the pro-inflammatory cytokineIL8 in monocytic cells. J Med Microbiol.2005;54(Pt 3):225-33.

26. Consortium EP. A user's guide to the ency-clopedia of DNA elements (ENCODE).PLoS Biol. 2011;9(4):e1001046.

27. Emadi S, Clay D, Desterke C, Guerton B,Maquarre E, Charpentier A, et al. IL-8 andits CXCR1 and CXCR2 receptors partici-pate in the control of megakaryocytic pro-liferation, differentiation, and ploidy inmyeloid metaplasia with myelofibrosis.Blood. 2005;105(2):464-73.

28. Pardanani A, Begna K, Finke C, Lasho T,

© Ferrata

Stor

ti Fou

ndati

on.

No com

mercial

use i

s allo

wed

Tefferi A. Circulating levels of MCP-1, sIL-2R, IL-15, and IL-8 predict anemia responseto pomalidomide therapy in myelofibrosis.Am J Hematol. 2011;86(4):343-5.

29. Rougier F, Cornu E, Praloran V, Denizot Y.IL-6 and IL-8 production by human bonemarrow stromal cells. Cytokine. 1998;10(2):93-7.

30. Hermouet S, Corre I, Lippert E. Interleukin-8 and other agonists of Gi2 proteins:autocrine paracrine growth factors forhuman hematopoietic progenitors acting insynergy with colony stimulating factors.Leuk Lymphoma. 2000;38(1-2):39-48.

31. Corre I, Pineau D, Hermouet S. Interleukin-8: an autocrine/paracrine growth factor forhuman hematopoietic progenitors acting insynergy with colony stimulating factor-1 topromote monocyte-macrophage growthand differentiation. Exp Hematol. 1999;27(1):28-36.

32. Laterveer L, Lindley IJ, Hamilton MS,Willemze R, Fibbe WE. Interleukin-8

induces rapid mobilization of hematopoiet-ic stem cells with radioprotective capacityand long-term myelolymphoid repopulat-ing ability. Blood. 1995;85(8):2269-75.

33. Barosi G, Viarengo G, Pecci A, Rosti V,Piaggio G, Marchetti M, et al. Diagnosticand clinical relevance of the number of cir-culating CD34(+) cells in myelofibrosiswith myeloid metaplasia. Blood.2001;98(12):3249-55.

34. Weinberg RS. In vitro erythropoiesis inpolycythemia vera and other myeloprolif-erative disorders. Semin Hematol. 1997;34(1):64-9.

35. Corre-Buscail I, Pineau D, Boissinot M,Hermouet S. Erythropoietin-independenterythroid colony formation by bone mar-row progenitors exposed to interleukin-11and interleukin-8. Exp Hematol. 2005;33(11):1299-308.

36. Verstovsek S, Kantarjian H, Mesa RA,Pardanani AD, Cortes-Franco J, ThomasDA, et al. Safety and efficacy of

INCB018424, a JAK1 and JAK2 inhibitor, inmyelofibrosis. N Engl J Med. 2010;363(12):1117-27.

37. Stein BL, Crispino JD, Moliterno AR. Januskinase inhibitors: an update on the progressand promise of targeted therapy in themyeloproliferative neoplasms. Curr OpinOncol. 2011;23(6):609-16.

38. Boissinot M, Cleyrat C, Vilaine M, JacquesY, Corre I, Hermouet S. Anti-inflammatorycytokines hepatocyte growth factor andinterleukin-11 are over-expressed inPolycythemia vera and contribute to thegrowth of clonal erythroblasts independ-ently of JAK2V617F. Oncogene.2011;30(8):990-1001.

39. Tefferi A, Vaidya R, Caramazza D, Finke C,Lasho T, Pardanani A. CirculatingInterleukin (IL)-8, IL-2R, IL-12, and IL-15Levels Are Independently Prognostic inPrimary Myelofibrosis: A ComprehensiveCytokine Profiling Study. J Clin Oncol.2011;29(10):1356-63.

J. Wehrle et al.


© Ferrata

Stor

ti Fou

ndati

on.

No com

mercial

use i

s allo

wed

Documents

Myeloproliferative Disorders ARTICLES