MyoD Activity Upregulates E2F1 and Enhances Transcription from the Cyclin E Promoter in Differentiating Myoblasts Lacking a Functional Retinoblastoma Protein

Experimental Cell Research 269, 301–311 (2001)doi:10.1006/excr.2001.5318, available online at http://www.idealibrary.com on

MyoD Activity Upregulates E2F1 and Enhances Transcription from theCyclin E Promoter in Differentiating Myoblasts Lacking

a Functional Retinoblastoma ProteinDonato Tedesco1 and Cesare Vesco2

Istituto di Biologia Cellulare del CNR, v.le Marx 43, 00137 Roma, Italy

We investigated the mechanism leading to cyclin Eaccumulation when cultured mouse myoblasts, lack-ing functional Rb because of sequestration or deletion,are exposed to differentiating conditions (mitogensubtraction and cell-cell contact), which activateMyoD and normally downregulate factors involved incell division. After excluding that stabilization mightaccount for the observed cyclin-E mRNA accumula-tion, we found an induction of the cyclin-E promoterthat correlated with E2F activity upregulation anddepended on both MyoD activation and Rb inactiva-tion. Analyses of the E2F1-promoter activity, in nor-mal and Rb-deficient fibroblasts converted by MyoD,identified a MyoD function stimulating E2F1 expres-sion. The E2F1 induction was very manifest in theRb2/2 cells, but also detectable, at the early stage ofdifferentiation, in normal cells. Its effects, althoughnot indispensable for myogenesis, presumably con-tribute to raise the concentration of Rb-E2F1 tran-scription-repressing complexes, since MyoD stronglyinduces also Rb in differentiating myocytes. The activ-ity of an E2F1 promoter lacking the E2F sites indi-cated that E2F1 itself underwent self-repression bysuch mechanism at late stages of differentiation. Inthe absence of Rb, however, the induced E2F1 is leftwith only its activating role, reversing the normal ef-fect of this MyoD function. © 2001 Academic Press

Key Words: MyoD; E2F1; Rb protein; cyclin E; myo-blasts; differentiation.

INTRODUCTION

Myoblasts induced to differentiate in culture promptlyexit from the cell cycle and exhibit, during the growth-to-differentiation transition, marked changes in the levels,associations, phosphorylation, and localization of the reg-

1 Present address: Department of Molecular Biology, The ScrippsResearch Institute, 10550 North Torrey Pines Road, MB7, La Jolla,CA 92037. E-mail: [email protected].

2 To whom correspondence and reprint requests should be ad-
dressed. Fax: (13906) 827 3287. E-mail: [email protected].
301

ulators of normal proliferation (see for review [1–4]).Some changes are common to cells of almost any typeentering G0, while some are typical of differentiatingmyoblasts, and the most prominent of these have longbeen known to depend on MyoD activity [5]. MyoD, whichis present but kept inactive during growth by associationwith Id and/or phosphorylation [6–9], soon after its acti-vation promotes a large increase in the cell levels of Rband the cdk inhibitor p21 [10, 11], in addition to theexpression of tissue-specific markers. Rb and MyoD atthe onset of differentiation act as central controllers, re-pressing some regulators, inducing others, even directlyassociating with, and getting regulated by, some of them[2, 12–16]. The complex balance of these multiple effectsprovides an ordered passage between the programs ofgrowth and differentiation, a balance that is severelydisrupted when Rb activity is missing because of geneticdamage, or sequestration by viral products with se-quences binding the “pockets” of Rb-family proteins [17–23].

We previously reported that in C2 myoblasts ex-pressing the LT antigen of SV40 (SVLT) the most re-markable alteration was that the cell levels of cyclins Eand A increased when these cells were shifted to dif-ferentiation conditions [24]. Cyclin accumulation bycells in response to mitogen subtraction and cell–cellcontact (which constitute the differentiating condi-tions) was an unusual phenomenon, implying a regu-latory mechanism well deserving further investiga-tions. Downregulation of cyclins E and A [24] and ofE2F1 transcription [25, 26] occurs in normally differ-entiated C2 myotubes. Cyclin E, however, is foundoverexpressed in Rb-deficient mouse fibroblasts [27,28] and neural cells [29]; moreover, Rb2/2 differenti-ated myocytes, unlike wild-type (wt) myocytes, expressnotable levels of cyclins E and A in both high- andlow-serum media [18]. The genes of both cyclin E [30–32] and cyclin A [33–35] appear to be regulated by E2Factivity; in particular, cyclin E has been shown to be adirect target of E2F1 [36]. E2F factors are also knownto be able to function as either activators or repressors,
depending on their associations [12, 23, 37–40].
0014-4827/01 $35.00Copyright © 2001 by Academic Press

All rights of reproduction in any form reserved.

s

C

C

302 TEDESCO AND VESCO

The present work explored different cell systems inwhich Rb and MyoD were either active or inactive, inorder to determine the effect of such conditions oncyclin-E expression and E2F activity. It was found thatthe coexistence of Rb inactivity and MyoD activity con-stantly resulted in an induction of cyclin-E expressionand an increased activity of a synthetic E2F-responsivepromoter. Furthermore, when fibroblasts were con-verted to myocytes by MyoD, those with an intact Rbexhibited only a modest, temporary increase in theactivity of a transfected E2F1-promoter, whereasRb2/2 fibroblasts exhibited such an increase through-out the exposure to the differentiation conditions, ac-companied by augmented level of E2F1 mRNA.

The induction by MyoD of high levels of Rb and p21at the onset of differentiation has presumably the roleof keeping DNA-replication genes tightly repressed.Since Rb has to be tethered to the E2F-binding promot-ers (such as that of E2F1 itself) in order to repressthem [12, 31, 41–43], an E2F1-upregulating ability byMyoD is not functionally incongruous: by accompany-ing the increased Rb level, it may hasten the accumu-lation of Rb-E2F1 complexes. This is not essential,since myogenic differentiation is not blocked by E2F1deficiency [44]. The regulatory unbalance due to a lossof the normal Rb functionality, however, presumablyleaves E2F1 with a merely activating role, reflected inthe observed cyclin-E upregulation.

MATERIALS AND METHODS

Cells and cell cultures. All cells were cultured in DMEM with20% fetal calf serum (growth medium: GM). Cell stocks were care-fully passaged to avoid reaching cell–cell contact density. To inducedifferentiation, confluent cell cultures were shifted to DMEM con-taining 2% newborn calf serum (differentiation medium: DM) andcultured in this medium for the indicated times.

Clone 7 of the C2 line of mouse myoblasts [45] was originallyobtained from M. Buckingham (Pasteur Institut, Paris, France).C2-LT myoblasts were C2 transformants expressing the wt Large-Tof SV40 [24].

Clones of C2 and C2-LT cells, stably expressing the firefly lucif-erase gene driven by either the mouse cyclin-E promoter [30] or asynthetic E2F-responsive promoter [46], were obtained by cotrans-fecting such constructs with the Hygromycin-B phosphotransferaseexpression vector pSVhyg [47], followed by selection for drug resis-tance. A screening for luciferase activity was then carried out, andrepresentative clones were chosen to study this activity under grow-ing and differentiating conditions.

C3H-LT and C3H-M1 were transformants of mouse fibroblastsC3H10t1/2 (henceforth abbreviated as C3H) expressing either the wtLarge-T of SV40, or its Rb-binding defective mutant M1 [48], respec-tively.

Rb2/2 cells, derived from primary fibroblasts of Rb-knockoutmouse embryos [27], were kindly donated by R. A. Weinberg. EL-Rb1/1 and EL-Rb2/2 cells were derived from primary fibroblasts ofnormal or Rb-knockout mouse embryos, respectively, after extendingtheir life in culture with T1M12005, a double mutant of the SV40Large-T defective for Rb-binding and nuclear transport [48].

Retroviral infections. Retrovirus stocks were prepared from tran-
iently transfected Bosc23 packaging cells [49] and stored frozen at
280°C in DMEM with 10% fetal calf serum. Infections were per-formed by incubating cell cultures for 6 h with stocks diluted 1:1 withGM and supplemented with 6 mg/ml of polybrene. After infection,cells were shifted to regular GM and, 24 h later, to DM for 48 h.Vectors pBABEpuro [50], and its derivative pBABEpuro-MyoD [51],carrying MyoD cDNA, were gifts of R. Maione.

Transient transfections. Transient transfections were performedin 33-mm plates, using the Lipofectamine-Plus reagent (Life Tech-nologies, Gaithersburg, MD) according to the manufacturer’s indica-tions, in serum-free medium for 4 h. Cells were then shifted to DMand incubated there for the indicated times.

Vector pCE-543/1263, carrying the luciferase gene driven by themouse cyclin-E promoter [30], was a gift of G. Piaggio; pLuc3xE2Fwt,carrying the same gene under a synthetic E2F-responsive promoter[46], was a gift of R. A. Weinberg. pE2F1-176/136luc and pE2F-176/136DDE2Fluc, carrying the luciferase gene under the mouse E2F1promoter, either wt or mutated in the E2F binding sites, respectively[52], were gifts of P. Farnham.

pcmvMyoD and pcmvRb, expression vectors for MyoD and pRb,respectively, were our constructs, obtained by inserting the corre-sponding cDNAs [5, 53] in pCMV, a pCEP4 (Invitrogen, Carlsbad,CA) plasmid from which we had deleted the Cla1–EcoR1 fragmentcontaining EBV sequences. pCMVb and pSVb (Clontech, Palo Alto,

A) were expression vectors for the E. coli b-galactosidase genedriven by CMV or SV40 enhancer/promoters, respectively.

Reporter gene assays. Luciferase activity of transiently trans-fected cells was assayed as follows: cell cultures were washed twicewith 3 ml of 100 mM Na-phosphate, pH 7.8, 1 mM MgSO4, and lysedwith 0.25 ml of 50 mM K-phosphate, pH 7.8, 1 mM EDTA, 1 mMDTT, 0.1% Triton-X-100; lysates were then harvested in Eppendorftubes and briefly centrifuged to discard insoluble matter. Clearedlysate (0.2 ml) was mixed with 0.05 ml of 1 mM D-luciferin, 2 mM

oA, 5 mM ATP, 33 mM DTT, 50 mM MgSO4, 10 mM K-phosphate,pH 7.8, and the emitted light was measured in a Berthold lumino-meter (Bad Wildbad, FRG). b-Galactosidase activity was measuredaccording to Ref. [54]. Values of luciferase activity were then nor-malized for those of b-galactosidase activity. All transient-transfec-tion experiments were repeated, with two different DNA prepara-tions, at least three times using pCMVb as normalizer, and onceusing pSVb. No substantial differences were observed using the twob-gal expression vectors.

The assay for the luciferase stably expressed in C2 and C2-LTclones was similar to that described above except that all volumeswere scaled up twofold, to enable processing of the low-density cul-tures of growing cells (not over 106 in a 9-cm dish). Activities wereluminometer values per milligram of protein (measured by the Brad-ford method).

Western blots, Northern blots, and RT-PCR. Western and North-ern blot analyses were performed as previously described [24]. Theantibody against cyclin E was sc481 (Santa Cruz Biotechnology,Santa Cruz, CA), that against Rb was G3-245 (Pharmingen, SanDiego, CA), and that against MyoD1 was 5.8A (DAKO, Glostrup,Denmark). Murine cyclin-E cDNA was a gift of M. Eilers, GAPDHcDNA was the 1.2-kb Pst1 fragment from plasmid pGAD-28 [55],myogenin cDNA was the EcoR1 fragment from a pUC19-myogeninplasmid [56]. For mRNA decay experiments Actinomycin D was usedat 5 mg/ml, Cordycepin (39-dA) at 1 mM concentration.

RT-PCR experiments were performed using the SuperScriptRnaseH-free Reverse Transcriptase (Life Technologies, Gaithers-burg, MD) for first-strand cDNA synthesis, following the manufac-turer’s instructions. Five micrograms of total RNA for each samplewas retrotranscribed with 200 U of enzyme and 100 pmol of randomexamers as primers, then 1/10 of the reaction was used as substratefor standard PCR amplification by Taq DNA polymerase (Promega,Madison, WI).

For mouse E2F1 cDNA [57] amplification, a first round of 20 PCR
cycles (1 min 95°C, 1 min 50°C, 1 min 72°C) was performed with the

et

303E2F1 UPREGULATION BY MyoD

following oligos as primers: 59CTTCAAGCCGCTTACCAATC39,59TCGCAGATCGTCATCATCTC39. One-twentieth of the amplifiedproduct was then used as substrate for a second round of 20 PCRcycles (1 min 95°C, 1 min 60°C, 1 min 72°C), with the following inneroligos as primers: 59CACCGCGCCCGATGTCGG39, 59CCCACCAT-GGTGTGGCTGC39. For the amplification of mouse ribosomal pro-tein L7 cDNA, a single round of 25 PCR cycles was performed (1 min95°C, 1 min 54°C, 1 min 72°C), with the following oligos as primers,according to Hollenberg et al. [58]: 59GAAGCTCATCTAT-GAGAAGGC39, 59AAGACGAAGGAGCTGCAGAAC39. After bothamplifications, 1

5 of the products was analyzed by 1.5% agarose gelelectrophoresis, followed by ethidium bromide staining.

RESULTS

Differentiating conditions stimulate the cyclin-E pro-moter and E2F activity in SVLT-expressing myoblasts.To elucidate the mechanism by which the differentiat-ing conditions result in cyclin-E upregulation in C2myoblasts expressing SVLT (C2-LT cells) (Fig. 1A), wefirst examined the possibility that the observed mRNAincrease might be just posttranscriptional, due tomRNA stabilization. Experiments were thus carriedout to analyze the rate of cyclin-E mRNA decay inC2-LT myoblasts treated with inhibitors of RNA syn-thesis. Figure 1B shows that, in C2-LT myoblasts un-der differentiating conditions (DM), the decay of cy-clin-E mRNA in the presence of Actinomycin D was notslower than that in the same cells under growing con-ditions (GM), or in normal growing myoblasts. A sim-ilar experiment in which RNA synthesis was blockedwith the reversible inhibitor Cordycepin demonstratedthat, after removing this block, active transcriptionpromptly raised again the cyclin-E mRNA level (Fig.1C). Since an increased mRNA stability could not ac-count for the raised mRNA level, it was thus concludedfrom these results that in C2-LT myoblasts the differ-entiating conditions indeed promoted a significant in-duction of cyclin-E transcription.

E2F is known to regulate cyclin-E transcription dur-ing the cell cycle [30–32, 36]. To ascertain whethervariations in E2F activity accompanied the cyclin-Eupregulation occurring under differentiating condi-tions in C2-LT myoblasts, we isolated clones of normalmyoblasts and C2-LT myoblasts in which the lucif-erase reporter gene was stably expressed under controlof either the cyclin-E promoter [30] or a synthetic E2F-responsive promoter [46]. Luciferase activity was thenmeasured under growing and differentiating condi-tions. Figures 2A and 2B display the results obtainedwith cells from two clones of each type. They clearlyshow that, with either promoter, luciferase activitywas downregulated in normal C2 myoblasts under dif-ferentiating conditions, whereas it was upregulated inC2-LT myoblasts. The concomitant increase of E2Factivity and activation of the cyclin-E promoter sug-gested that E2F was likely implicated in the cyclin-E
upregulation in mitogen-deprived C2-LT myoblasts.
In the absence of functional Rb, MyoD induces thecyclin-E promoter and E2F activity. SVLT is known

FIG. 1. Cyclin-E upregulation in C2-LT cells under differentiat-ing conditions. (A) C2-LT and normal C2 cells were harvested eitherduring growth (GM) or after 48 h of incubation in differentiationmedium (DM). Top: Western blot analysis of cyclin-E protein levels,derived from 0.3 mg of protein extracts. Middle, bottom: Northernblot analyses of cyclin-E and GAPDH mRNA levels, respectively,from 20 mg of total RNA extracts. (B) Right: C2-LT and C2 cells,ither growing or incubated in DM for 24 or 48 h, as indicated, werereated with 5 mg/ml of Actinomycin D for 0, 3, or 6 h. Cyclin-E and

GAPDH mRNAs were analyzed by Northern blotting as above, de-tected, and quantitated by means of a phosphorimager and softwareof Molecular Dynamics. Left: the cyclin-E mRNA levels (shown to theright), normalized according to GAPDH mRNAs, were plotted in asemi-log diagram. Solid squares and triangles: C2 cells in GM, orafter 24 h in DM, respectively. Open squares, triangles, circles:C2-LT cells in GM, or after 24 h, or 48 h in DM, respectively. (mRNAfrom C2 cells in DM for 48 h was not measurable.) (C) Lower panel:Northern blots of mRNAs from C2-LT cells incubated 48 h in DM,either untreated (lane a) or treated for the last 6 h with 1 mMCordycepin (lane b), then, after treatment, released from inhibitionfor 3 h (lane c) or 6 h (lane d). The release was performed by washingthe cultures and continuing the incubation in drug-free DM. Upperpanel: diagram of the lower-panel values normalized as above. Theupper point at time 0 refers to the lane-a mRNA. Cy-E, cyclin-E.

to bind and inactivate Rb-family proteins, thus freeing


E2F [17, 59]. This effect by itself, however, could notexplain the peculiar stimulation of E2F activity elicitedin C2-LT cells by the differentiating conditions. On theother hand, shifting myoblasts to differentiating con-ditions primarily implies MyoD activation, which wehad previously found to be unaffected by SVLT [21].

To assess the relevance of one or both of these con-ditions (Rb-family inactivation and MyoD activation)for the mentioned increase of cyclin-E levels and E2Factivity, we exploited the myogenic conversion of fibro-blasts. This allowed comparison of the effects of thepresence or absence of MyoD in cultures under thesame DM conditions (rather than in GM vs DM). Betterthan most other fibroblasts, C3H cells can be converted

FIG. 2. Luciferase activity from C2 and C2-LT clones stablyexpressing the luciferase gene, driven by either the mouse cyclin Epromoter (A) or a synthetic E2F-responsive promoter (B). Eightindependent clones (two for each cell type, as indicated) were exam-ined, with cells analyzed either during growth (G) or after a 48-hincubation under differentiating conditions (D). Assays were per-formed as detailed under Materials and Methods. Values are themean of duplicate samples, with the indicated standard deviations.Numbers above braces indicate the D/G ratios for each cell type.

to myoblast-like phenotype by ectopical expression of

MyoD [5] and, upon shift to differentiating conditions,they quit cycling and start expressing muscle-specificgenes. We transduced MyoD cDNA by retroviral infec-tion into three C3H cell types: normal cells, or cellsthat stably expressed either the wt SVLT or a mutantSVLT (M1) unable to bind Rb-family proteins [48].Under differentiating conditions, the cyclin-E mRNAlevel of these cells was compared to that of control cellsthat had received the empty vector. Figure 3A showsthat MyoD caused a regular myogenin induction in allthree cell types, but increased the cyclin-E mRNA levelonly in cells expressing wt SVLT, and not in thoseexpressing the mutant M1 or in normal cells. Thisresult indicated that MyoD caused an enhancement ofcyclin-E expression when it was activated in the ab-sence of a functional Rb-family.

We then investigated whether such an enhancementmight be E2F-mediated by examining, in transientlytransfected C3H cells, the effect of MyoD on the lucif-erase expression controlled by either the E2F-respon-sive promoter or the cyclin-E promoter. As illustratedin Fig. 3B, it was found that both promoters werestimulated by MyoD in cells that expressed the wtSVLT, whereas neither one was stimulated in cellsexpressing the Rb-binding-defective mutant M1. Thiscorroborated the conclusion from the above Northernexperiment that the Rb-family had to be inhibited forthe MyoD-promoted upregulation of cyclin E to occur,and agreed with the results obtained in C2 myoblastsindicating that E2F activity was involved in this pro-cess.

To establish whether Rb in particular, among theRb-family proteins, had to be inactive to bring aboutthe MyoD effect, we subjected to myogenic conversionRb-null fibroblasts. MyoD was transiently transfectedin Rb2/2 fibroblasts, besides normal C3H cells, andthe regulation of the cyclin-E and E2F-responsive pro-moters was examined in transient-transfection exper-iments basically similar to those described above.Rb2/2 cells could thus be compared with either nor-mal cells expressing endogenous Rb, or Rb2/2 cellsthat received, together with MyoD cDNA, also RbcDNA. The results illustrated in Fig. 4 show that, forboth promoters, the absence of Rb sufficed to bringabout the MyoD-dependent transactivation.

The upregulation of E2F activity by MyoD in Rb2/2cells correlates with E2F1 mRNA accumulation.While the Rb2/2 cell system could be transfected with-out particular problems, as in the experiments justdescribed, the infection of such cells (with the MyoD-carrying retrovirus) resulted not to be efficient enoughto carry out Northern analyses of the cyclin-E andmyogenin mRNAs. We thus employed Rb2/2 andRb1/1 fibroblasts whose life had been extended with a
SVLT double-mutant (for Rb binding and transport), a

iMRtfw


mutant still capable of prolonging primary-cell life inculture but no longer able to inhibit differentiation.These cells (indicated with their parental name pre-ceded by EL) could be satisfactorily infected, and couldthen be analyzed for the endogenous-gene expressions

FIG. 3. (A) MyoD dependence of the cyclin-E mRNA level, andeffect of Rb-family sequestration. C3H fibroblasts, either normal(C3H), or expressing wt SVLT (C3H-LT), or the Rb-binding defectivemutant M1 (C3H-M1), were infected with either the retrovirus car-rying MyoD-cDNA or the empty vector; 24 h after infection, thecultures were incubated for 48 h in DM. The indicated mRNAs wereanalyzed by Northern blotting (20 mg of total RNA per sample); lanes2, 4, and 6 refer to the cells that received MyoD; lanes 1, 3, and 5 tothose that received the empty vector. (B) MyoD dependence, in C3Hfibroblasts, of the activities of the cyclin-E promoter and the syn-thetic E2F-responsive promoter, with or without Rb-family seques-tration. C3H cells (either normal, or transformed as in (A)) weretransiently cotransfected with the luciferase gene, driven by theindicated promoters, and either MyoD cDNA (1) or the empty vector(2). After transfection, cells were incubated for 72 h in DM, and thenassayed for luciferase activity. Numbers above braces indicate the1MyoD/2MyoD ratios of paired values. Values are the mean oftriplicate samples, with the indicated standard deviations. Bottom: AWestern blot shows MyoD extracted from cells transfected andtreated like the corresponding samples above.

of interest (cyclin E, myogenin, Rb, and E2F1). Tran-

sient reporter-gene expressions were examined as pre-viously by transfection. The results of these analysesare shown in Fig. 5, where it can be seen that (i) thepattern of stimulation of the cyclin-E and E2F-respon-sive promoters (Fig. 5D) was similar to that of C3H andRb2/2 cells described in Fig. 4; (ii) myogenin expres-sion was induced in all cells that received MyoDwhereas, among these, cyclin-E expression was in-duced only in the Rb2/2 cells (Fig. 5A); (iii) Rb too wastypically upregulated in the Rb1/1 cells that receivedMyoD (Fig. 5B), as had been previously observed in C2and C3H-MyoD myocytes [11, 21]; (iv) the same Rb2/2cells showing the cyclin-E induction were also the onlycells in which the transcript level of E2F1 was aug-mented (Fig. 5C). This finding was important, as itstrongly suggested that E2F1 was directly involved inthe MyoD-dependent increase of E2F activity, presum-ably by transactivation of its promoter. To uphold thisconclusion such transactivation had to be directly ver-ified, to rule out, in particular, that the E2F1 promotermight just respond, via its E2F sites [52], to somegeneral E2F-family upregulation.

FIG. 4. MyoD- and Rb-dependence of the activities of the cy-clin-E promoter and the synthetic E2F-responsive promoter, ana-lyzed in Rb2/2 fibroblasts in DM. The luciferase gene (driven by thendicated promoters) was transiently cotransfected with cDNAs of

yoD, or Rb, or both, as indicated. For comparison with endogenousb in the same experiment, C3H fibroblasts were also included. After

ransfection, cells were incubated for 72 h in DM, and then assayedor luciferase activity. Values are the mean of triplicate samples,ith the indicated standard deviations. 1, 2: Transfections with

either cDNAs or empty vectors, respectively; numbers above bracesindicate ratios of paired values. The Western blots show MyoD andRb extracted from cells transfected and treated like the correspond-
ing samples above (Rb from Rb1/1 cells was not probed for).

c

s

Ratb


MyoD activity regulates the E2F1 promoter. Wethen tried to verify (i) whether a MyoD-dependent ac-tivation of E2F1 transcription actually occurred in

FIG. 5. MyoD- and Rb-dependence of cyclin-E and E2F1 expres-ions in EL cells in DM. (A) EL cells (efficiently infectable Rb2/2 and

Rb1/1 fibroblasts, whose life was extended by a SVLT double-mu-tant, nuclear-transport-, and Rb-binding-defective) were infectedwith either the retrovirus carrying MyoD-cDNA or the empty vector;24 h postinfection, the cultures were incubated for 48 h in DM. Theindicated mRNAs were analyzed by Northern blotting (20 mg of total

NA per sample); lanes 2 and 4, cells that received MyoD; lanes 1nd 3, those that received the empty vector. (B) These cells, underhe same conditions, were also examined for Rb levels by Westernlotting (100 mg of extract proteins per sample). (C) The same cells

and conditions of the preceding panel were used to analyze the E2F1mRNA levels, except that the mRNA was detected by means of PCRamplification (see Materials and Methods for details). (D) MyoD- andRb-dependence of the activities of the cyclin-E promoter and thesynthetic E2F-responsive promoter, analyzed in EL-Rb2/2 fibro-blasts. The experiment was similar to that depicted in Fig. 4 (withEL-Rb1/1 fibroblasts replacing the C3H cells). Values are the meanof triplicate samples, with the indicated standard deviations. Num-bers above braces indicate ratios of paired values. Western blotsbelow represent the same as those described in the legend to Fig. 4.

Rb2/2 cells, as suggested by the previous experiment, t

and (ii) whether such putative activation depended onthe E2F sites in the E2F1 promoter, whose self-regu-latory properties are known [52, 60]. To this end, theE2F1-promoter activity was examined by transienttransfections of the luciferase gene driven by either anintact E2F1 promoter, or one mutated in the E2F bind-ing sites.

The results, illustrated in Fig. 6A, show that: (i) withintact E2F-sites, the E2F1 promoter was indeed up-regulated by MyoD, in the absence of Rb activity, asexpected; (ii) with deleted E2F sites, the E2F1 pro-moter was still upregulated by MyoD, even in the pres-ence of Rb activity. These results indicated that MyoDhad the ability to activate the transcription of the E2F1gene, and that the E2F sites not only did not mediatethis activation, but actually played a repressive role,with Rb present. The E2F sites very likely allowed theRb-E2F1 binding to the promoter, and their deletiondisclosed the E2F1-promoter upregulation by MyoDeven in the presence of Rb.

The behavior of the Rb1/1 cells suggested that theE2F1-promoter induction by MyoD observed in Rb2/2cells might not be intrinsically aberrant. In normalcells, in which Rb is strongly induced by MyoD at theonset of differentiation [11, 21, 24], an induction ofE2F1 would hasten the formation of E2F1–Rb com-plexes, which are needed to repress E2F-site-depen-dent transcription (including that of E2F1 itself; seeIntroduction). On the other hand, the latter experi-ments showed that Rb1/1 cells were able to induce theE2F1 promoter lacking E2F sites, but repressed thenormal promoter. In such experiments, however,MyoD activity was examined at the stage of full differ-entiation, when most MyoD effects had taken place,including Rb accumulation. It seemed thus importantto explore, at earlier stages of differentiation, theMyoD effect on the normal E2F1 promoter in Rb1/1and Rb2/2 cells.

The results illustrated in Fig. 6B show that, in theRb2/2 cells transfected with MyoD, a stimulation ofthe E2F1 promoter occurred and kept increasing for 2 1

2

days, initially less strongly than at later times. In C3Hcells that received MyoD, an upregulation of the E2F1promoter activity also occurred, was detectable asearly as 8 h posttransfection, and lasted for about 24 h,but then declined to very low levels. Significantly, theactivity at late times in C3H cells 1 MyoD appearedmore repressed than in C3H control cells.

It is unclear why, in Rb2/2 cells, the E2F1-promoterstimulation by MyoD was initially sluggish: the cellsbehaved as if a posttransfection lag was needed toreestablish some basic equilibria, since also the activ-ity in Rb2/2 control cells was modestly (but reproduc-ibly) lower at early than at late times. Possibly, Rb2/2ells may be oversensitive to the abrupt mitogen sub-
raction starting at the time of transfection. Nonethe-

Rb2/2 fibroblasts under differentiating conditions, in the presence


less, the overall activity variations displayed by theseresults were compatible with the expectations from aphysiological mechanism, as suggested above.

DISCUSSION

The results of this work provide evidence that MyoDactivity includes a function able to induce E2F1 expres-sion. This effect becomes very manifest in cells inwhich the Rb activity is either blocked or absent, withthe consequence that this E2F1 upregulation is nolonger self-repressible, and the expression of an E2F-regulated gene, such as that of cyclin E, gets abnor-mally upregulated.

Conclusions of works from several laboratories showthat E2F1 is a transcriptional regulator with an eitherpositive or negative role: in particular, responsive pro-moters may get either activated by E2F1 binding aloneor repressed by E2F1 binding in complex with Rb [23,38, 44, 52, 60–62]. These and other notions concur toindicate that Rb plays its basic role of controlling theexpression of many genes involved in DNA replicationby being targeted by E2F to promoters that contain itsbinding sites [12, 28, 31, 42, 43, 63], helped by histonedeacetylase [41, 64, 65].

Keeping DNA replication repressed is a long-recog-nized task of MyoD [66, 67], and the strong inductionsof both Rb [11] and the cdk inhibitor p21 [10] by MyoDclearly serve such purpose. Since Rb needs E2F torepress many DNA-replication genes, however, alsothe expression of proper levels of E2F1 can be legiti-mately viewed as part of a mechanism antagonizingcell proliferation. The E2F sites in the E2F1 promoteritself, which function to repress the promoter in serum-starved cells [52], could automatically ensure, in nor-mal differentiating cells, that only the required levelsand duration of expression take place.

This newly identified MyoD function emerged uponexamining the effects of MyoD and Rb activities inthree cell types, differing for the degree of geneticmanipulation. In C2 myoblasts, both MyoD and Rbwere expressed from endogenous genes, and activatedby differentiating conditions. In these cells, as well asin C3H fibroblasts (in which MyoD activation was ob-tained after myogenic conversion), the activity of theendogenous Rb was counteracted by SVLT. In Rb-nullfibroblasts, the effects of the presence or absence ofeither Rb or MyoD were studied with both genes rep-resented by ectopic constructs. In all such situations, it

or absence of MyoD. Cells were cotransfected with the luciferasegene driven by the E2F1 promoter, and either pcmvMyoD or emptyvector. Immediately posttransfection the cells were placed in DMand incubated for the indicated times. Each kinetics was carried out

FIG. 6. (A) MyoD- and Rb-dependence of the activity of normalE2F1 promoter and of its mutant lacking E2F sites [52]. Cells weretransiently cotransfected with the luciferase gene, driven by eithernormal or mutant promoter, and the cDNAs of MyoD, Rb, or both, asindicated. After transfection, cells were incubated for 72 h in DM.Values are the mean of triplicate samples, with the standard devia-tion. 1, 2: transfections with either cDNAs or empty vectors, respec-tively. Numbers above braces indicate ratios of paired values; West-ern blots below represent the same as those described in the legendto Fig. 4. (B) Time course of E2F1–promoter activity in C3H and

three times; mean values are plotted with their standard deviations.

wcsAmptpb

Mdatmc8paai

pfhrMEa

baasvpfsc(paEn

etepTt[

sMseepttsccc[s

ioRaaMtp


was found that the activities of the cyclin-E and theE2F-responsive promoters had a markedly consistentbehavior, always showing an increase whenever MyoDwas active and Rb inactive. Most important was that aclosely similar behavior was also found when the ac-tivity of the E2F1 promoter itself was examined. Thisexperiment provided another very significant indica-tion: when the E2F sites in the E2F1 promoter wereeliminated, the stimulation by MyoD of the E2F1 pro-moter occurred even in the presence of Rb activity. Thisdemonstrated that the E2F1-promoter activation byMyoD is not E2F-dependent and that, in differentiatedmyocytes, Rb uses these E2F sites to repress E2F1expression. In this manner, a self-regulatory loop takesplace, since MyoD activates the E2F1 productionneeded to target Rb to any promoter carrying E2Fsites, including the promoter of E2F1 itself.

E-box motifs, which are direct DNA-binding sites forMyoD and other bHLH transcription factors, are ab-sent in the murine E2F1 promoter [52]. Nonetheless,the activation by MyoD of the Rb gene at the onset ofdifferentiation has been shown to occur without E-boxinvolvement: whereas one such motif is present in thehuman Rb promoter, its mutagenization has no effecton the Rb gene activation by MyoD [11], and the ho-mologous Rb-promoter region of the mouse has no E-boxes at all [68]. Similarly, E-box independence hasbeen reported for the MyoD promoter activation bychicken MyoD [69]. MyoD is known to physically inter-act with a variety of other transcription factors. Weindeed examined the MyoD effect on several mutantsof the E2F1 promoter (besides that shown in Fig. 6), toget some clues on potential mediators of the E2F1upregulation by MyoD. Briefly, we found that the stim-ulation by MyoD in Rb2/2 cells could still be observed,

ith both transient expression assays and stablelones, after either mutating the E2F1 promoter’s CREite or making deletions upstream of nucleotide 284.dding then a mutation of the Sp1 site at position 277arkedly reduced the stimulation by MyoD (our un-

ublished observations). In view also of the MyoD in-eraction with Sp1 [70], these findings suggest that theositive regulation of the E2F1 promoter by MyoD maye mediated by Sp1.The differentiation process of cultured myoblasts, oryoD-converted fibroblasts, gets completed in about 3

ays, although early-induced markers like myogeninre well detected after 1 day of differentiating condi-ions. The Rb cell-level increase, first described in C2yoblasts, is an early event, which begins as soon as

ells reach culture confluence and continues for over0 h [11]. We examined the variations of the E2F1-romoter activity during normal cell differentiation,nd an upregulation was found early in the process,pproximately when also the Rb cell-level begins to
ncrease. In contrast, the E2F1-promoter activity ap- c
eared notably decreased from midway on in the dif-erentiation process, when the myocytes’ Rb levels areigh [11, 21, 24]. This behavior is consistent with theole we suggest for the E2F1-inducing function ofyoD, that of helping the augmented Rb to repress2F-site-dependent transcription. Needed E2F1 levelsre protected from degradation by Rb itself [71].In a plausible molecular model, at the start of myo-

last differentiation, MyoD activity would thus provideconcentration increase of repressors strong enough torrest the cell cycle and keep it tightly arrested. Ofuch repressor genes, p21 [10] would be directly acti-ated by MyoD via E-boxes, while Rb [11] and itsartner E2F1 by MyoD associated with some otheractor. The increased level of Rb–E2F1 complexeshould facilitate blocking the expression of E2F-site-arrying genes, like those of cyclin E and E2F1 itselfalbeit this strengthening role does not appear indis-ensable, since myogenesis is not stopped by E2F1bsence). Very likely, the absence in cells of Rb leaves2F1 not self-repressing and free to upregulate itsormal targets.Irreversible myogenic differentiation is presumably

nsured by means of concurring growth-repressingools. The Rb-related p130, which gets elevated in cellsntering G0, and exploits the available E2F4 [12, 63],lays an important role also in differentiation [72–74].his role, however, in the absence of Rb is insufficiento ensure the irreversibility of myogenic differentiation19].

The present results agree with the findings of atudy which analyzed the ability of differentiated,yoD-transduced, Rb2/2 fibroblasts to restart DNA

ynthesis upon serum stimulation [18]. Among the rel-vant features of these myocytes was that, prior to thexposure to high-serum medium, the cells that ex-ressed myosin heavy-chain (thus indicating MyoD ac-ivity) exhibited higher levels of cyclins A and E thanhose not expressing myosin, and that, under higherum stimulation (presumably inactivating MyoD),yclin-A expression increased in the myosin-negativeells while it slowly declined in the myosin-positiveells. The cyclin-A promoter is also regulated by E2F134, 35], and Rb appears to be essential for its repres-ion in quiescent cells [75].The potential effects of E2F1 upregulation by MyoD

n the absence of Rb agree with the finding that MyoDverexpression triggers apoptosis in myoblasts whoseb is sequestered [51], since E2F1 is known to causepoptosis when expressed at higher levels, or in thebsence of Rb [76–78]. The E2F1 upregulation byyoD might then help to counterselect any myocyte

hat failed to accumulate adequate levels of hypophos-horylated Rb during normal differentiation.The MyoD ability to induce E2F1, observed also in

onverted C3H cells at the onset of differentiation and

1

1

1

1

1

1

1

1

1

1

2

2

2

2


repressed later on, has not per se the behavior of anaberrant function. Its pathological relevance is whollydependent on Rb, whose deficiency disrupts many con-trols of cell growth and differentiation [12, 18, 63, 79].The alterations found here in the absence of functionalRb (increased cyclin-E level and E2F activity) disclosea mechanism whereby the activity of a factor normallydirected to arrest growth, such as MyoD, results in theopposite effect because of the divalent functionality ofE2F1. Consideration of this type of mechanism is rel-evant to the understanding of tumorigenesis and thedesign of gene therapies.

Thanks are due to Drs. L. Fischer-Fantuzzi, P. Lavia, M. Caruso,and A. Felsani for gifts of probes and helpful discussion. The experttechnical help of L. Baron and gifts of oligonucleotides and radioiso-topes from P. Di Franco and Dr. I. Baldi are gratefully acknowledged.D.T. has been supported by a fellowship of the A. Buzzati-TraversoFoundation.

REFERENCES

1. Walsh, K., and Perlman, H. (1997). Cell cycle exit upon myo-genic differentiation. Curr. Opin. Genet. Develop. 7, 597–602.

2. Maione, R., and Amati, P. (1996). Interdependence betweenmuscle differentiation and cell-cycle control. BBA Rev. Cancer1332, 19–30.

3. Olson, E. N., and Klein, W. H. (1994). bHLH factors in muscledevelopment. Dead lines and commitments, what to leave inand what to leave out. Genes Dev. 8, 1–8.

4. Puri, P. L., and Sartorelli, V. (2000). Regulation of muscleregulatory factors by DNA-binding, interacting proteins, andpost-transcriptional modifications. J. Cell. Physiol. 185, 155–173.

5. Davis, R. L., Weintraub, H., and Lassar, A. B. (1987). Expres-sion of a single transfected cDNA converts fibroblasts to myo-blasts. Cell 51, 987–1000.

6. Jen, Y., Weintraub, H., and Benezra, R. (1992). Overexpressionof Id protein inhibits the muscle differentiation program—Invivo association of Id with E2A proteins. Genes Dev. 6, 1466–1479.

7. Li, L., James, G., Heller-Harrison, R., Czech, M. P., and Olson,E. N. (1992). FGF inactivates myogenic helix–loop–helix pro-teins through phosphorylation of a conserved protein kinase-Csite in their DNA-binding domains. Cell 71, 1181–1194.

8. Liu, L. N., Dias, P., and Houghton, P. J. (1998). Mutation ofThr(115) in MyoD positively regulates function in murine fibro-blasts and human rhabdomyosarcoma cells. Cell Growth Differ.9, 699–711.

9. Skapek, S. X., Rhee, J., Spicer, D. B., and Lassar, A. B. (1995).Inhibition of myogenic differentiation in proliferating myo-blasts by cyclin D1-dependent kinase. Science 267, 1022–1024.

0. Halevy, O., Novitch, B. G., Spicer, D. B., Skapek, S. X., Rhee, J.,Hannon, G. J., Beach, D., and Lassar, A. B. (1995). Correlationof terminal cell cycle arrest of skeletal muscle with induction ofp21 by MyoD. Science 267, 1018–1021.

1. Martelli, F., Cenciarelli, C., Santarelli, G., Polikar, B., Felsani,A., and Caruso, M. (1994). MyoD induces retinoblastoma geneexpression during myogenic differentiation. Oncogene 9, 3579–3590.

2. Dyson, N. (1998). The regulation of E2F by pRB-family pro-
teins. Genes Dev. 12, 2245–2262.
3. Eckner, R., Yao, T. P., Oldread, E., and Livingston, D. M.(1996). Interaction and functional collaboration of p300/CBPand bHLH proteins in muscle and B-cell differentiation. GenesDev. 10, 2478–2490.

4. Flemington, E. K., Speck, S. H., and Kaelin, W. G. (1993).E2F-1-mediated transactivation is inhibited by complex forma-tion with the retinoblastoma susceptibility gene product. Proc.Natl. Acad. Sci. USA 90, 6914–6918.

5. Guo, K., and Walsh, K. (1997). Inhibition of myogenesis bymultiple cyclin–Cdk complexes. Coordinate regulation of myo-genesis and cell cycle activity at the level of E2F. J. Biol. Chem.272, 791–797.

6. Polesskaya, A., Duquet, A., Naguibneva, I., Weise, C., Vervisch,A., Bengal, E., Hucho, F., Robin, P., and Harel-Bellan, A.(2000). CREB-binding protein/p300 activates MyoD by acetyla-tion. J. Biol. Chem. 275, 34359–34364.

7. Chellappan, S., Kraus, V. B., Kroger, B., Munger, K., Howley,P. M., Phelps, W. C., and Nevins, J. R. (1992). Adenovirus-E1A,simian virus-40 tumor antigen, and human papillomavirus-E7protein share the capacity to disrupt the interaction betweentranscription factor-E2F and the retinoblastoma gene product.Proc. Natl. Acad. Sci. USA 89, 4549–4553.

8. Novitch, B. G., Mulligan, G. J., Jacks, T., and Lassar, A. B.(1996). Skeletal muscle cells lacking the retinoblastoma proteindisplay defects in muscle gene expression and accumulate in Sand G(2) phases of the cell cycle. J. Cell Biol. 135, 441–456.

9. Schneider, J. W., Gu, W., Zhu, L., Mahdavi, V., and Nadal-Ginard, B. (1994). Reversal of terminal differentiation medi-ated by p107 in Rb(2/2) muscle cells. Science 264, 1467–1471.

0. Spitkovsky, D., Steiner, P., Lukas, J., Lees, E., Pagano, M.,Schulze, A., Joswig, S., Picard, D., Tommasino, M., Eilers, M.,and Jansen-Durr, P. (1994). Modulation of cyclin gene expres-sion by adenovirus E1A in a cell line with E1A-dependentconditional proliferation. J. Virol. 68, 2206–2214.

1. Tedesco, D., Caruso, M., Fischer-Fantuzzi, L., and Vesco, C.(1995). The inhibition of cultured myoblast differentiation bythe simian virus 40 large T antigen occurs after myogeninexpression and Rb up-regulation and is not exerted by trans-formation-competent cytoplasmic mutants. J. Virol. 69, 6947–6957.

2. Chen, T. T., and Wang, J. Y. J. (2000). Establishment of irre-versible growth arrest in myogenic differentiation requires theRB LXCXE-binding function. Mol. Cell. Biol. 20, 5571–5580.

3. Harbour, J. W., and Dean, D. C. (2000). The Rb/E2F pathway:Expanding roles and emerging paradigms. Genes Dev. 14,2393–2409.

24. Tedesco, D., Baron, L., Fischer-Fantuzzi, L., and Vesco, C.(1997). Induction of cyclins E and A in response to mitogenremoval: A basic alteration associated with the arrest of differ-entiation of C2 myoblasts transformed by Simian virus 40 largeT antigen. J. Virol. 71, 2217–2224.

25. Wang, J., Helin, K., Jin, P., and Nadal-Ginard, B. (1995). Inhi-bition of in vitro myogenic differentiation by cellular transcrip-tion factor E2F1. Cell Growth Differ. 6, 1299–1306.

26. Martelli, F., and Livingston, D. M. (1999). Regulation of endog-enous E2F1 stability by the retinoblastoma family proteins.Proc. Natl. Acad. Sci. USA 96, 2858–2863.

27. Herrera, R. E., Sah, V. P., Williams, B. O., Makela, T. P.,Weinberg, R. A., and Jacks, T. (1996). Altered cell cycle kinetics,gene expression, and G(1), restriction point regulation in Rb-deficient fibroblasts. Mol. Cell. Biol. 16, 2402–2407.

28. Hurford, R. K., Cobrinik, D., Lee, M. H., and Dyson, N. (1997).
pRB and p107/p130 are required for the regulated expression of

2

3

3

3

3


different sets of E2F responsive genes. Genes Dev. 11, 1447–1463.

9. Macleod, K. F., Hu, Y. W., and Jacks, T. (1996). Loss of Rbactivates both p53-dependent and independent cell death path-ways in the developing mouse nervous system. EMBO J. 15,6178–6188.

0. Botz, J., Zerfass-Thome, K., Spitkovsky, D., Delius, H., Vogt, B.,Eilers, M., Hatzigeorgiou, A., and Jansen-Durr, P. (1996). Cellcycle regulation of the murine cyclin E gene depends on an E2Fbinding site in the promoter. Mol. Cell. Biol. 16, 3401–3409.

1. Geng, Y., Eaton, E. N., Picon, M., Roberts, J. M., Lundberg,A. S., Gifford, A., Sardet, C., and Weinberg, R. A. (1996). Reg-ulation of cyclin E transcription by E2Fs and retinoblastomaprotein. Oncogene 12, 1173–1180.

32. Ohtani, K., Degregori, J., and Nevins, J. R. (1995). Regulationof the cyclin E gene by transcription factor E2F1. Proc. Natl.Acad. Sci. USA 92, 12146–12150.

33. Degregori, J., Kowalik, T., and Nevins, J. R. (1995). Cellulartargets for activation by the E2F1 transcription factor includeDNA synthesis- and G(1)/S-regulatory genes. Mol. Cell. Biol.15, 4215–4224.

4. Liu, N. S., Lucibello, F. C., Engeland, K., and Muller, R. (1998).A new model of cell cycle-regulated transcription: Repression ofthe cyclin A promoter by CDF-1 and anti-repression by E2F.Oncogene 16, 2957–2963.

5. Soucek, T., Pusch, O., Hengstschlager-Ottnad, E., Adams, P. D.,and Hengstschlager, M. (1997). Deregulated expression ofE2F-1 induces cyclin A- and E-associated kinase activities in-dependently from cell cycle position. Oncogene 14, 2251–2257.

36. Vigo, E., Muller, H., Prosperini, E., Hateboer, G., Cartwright,P., Moroni, M. C., and Helin, K. (1999). CDC25A phosphatase isa target of E2F and is required for efficient E2F-induced Sphase. Mol. Cell. Biol. 19, 6379–6395.

37. Lipinski, M. M., and Jacks, T. (1999). The retinoblastoma genefamily in differentiation and development. Oncogene 18, 7873–7882.

38. Field, S. J., Tsai, F. Y., Kuo, F., Zubiaga, A. M., Kaelin, W. G.,Livingston, D. M., Orkin, S. H., and Greenberg, M. E. (1996).E2F-1 functions in mice to promote apoptosis and suppressproliferation. Cell 85, 549–561.

39. Yamasaki, L., Bronson, R., Williams, B. O., Dyson, N. J., Har-low, E., and Jacks, T. (1998). Loss of E2F-1 reduces tumorigen-esis and extends the lifespan of Rb1(1/2) mice. Nat. Genet. 18,360–364.

40. Zhang, H. S., Postigo, A. A., and Dean, D. C. (1999). Activetranscriptional repression by the Rb-E2F complex mediates G1arrest triggered by p16(INK4a), TGF beta, and contact inhibi-tion. Cell 97, 53–61.

41. Brehm, A., Miska, E. A., McCance, D. J., Reid, J. L., Bannister,A. J., and Kouzarides, T. (1998). Retinoblastoma protein re-cruits histone deacetylase to repress transcription. Nature 391,597–601.

42. Sellers, W. R., and Kaelin, W. G. (1996). RB as a modulator oftranscription. Biochim. Biophys. Acta 1288, M1–5.

43. Weintraub, S. J., Chow, K. N. B., Luo, R. X., Zhang, S. H., He,S., and Dean, D. C. (1995). Mechanism of active transcriptionalrepression by the retinoblastoma protein. Nature 375, 812–815.

44. Yamasaki, L., Jacks, T., Bronson, R., Goillot, E., Harlow, E.,and Dyson, N. J. (1996). Tumor induction and tissue atrophy inmice lacking E2F-1. Cell 85, 537–548.

45. Yaffe, D., and Saxel, O. (1977). Serial passaging and differen-tiation of myogenic cells isolated from dystrophic mouse mus-
cle. Nature 270, 725–727.
46. Krek, W., Livingston, D. M., and Shirodkar, S. (1993). Bindingto DNA and the retinoblastoma gene product promoted by com-plex formation of different E2F family members. Science 262,1557–1560.

47. Blochlinger, K., and Diggelman, H. (1984). Hygromycin B phos-photransferase as a selectable marker for DNA transfer exper-iments with higher eukaryotic cells. Mol. Cell. Biol. 4, 2929–2931.

48. Tedesco, D., Fischer-Fantuzzi, L., and Vesco, C. (1993). Limitsof transforming competence of SV40 nuclear and cytoplasmiclarge T-mutants with altered Rb-binding sequences. Oncogene8, 549–557.

49. Pear, W. S., Nolan, G. P., Scott, M. L., and Baltimore, D. (1993).Production of high-titer helper-free retroviruses by transienttransfection. Proc. Natl. Acad. Sci. USA 90, 8392–8396.

50. Morgenstern, J. P., and Land, H. (1990). Advanced mammaliangene transfer: High titre retroviral vectors with multiple drugselection markers and a complementary helper-free packagingcell line. Nucleic Acids Res. 18, 3587–3596.

51. Fimia, G. M., Gottifredi, V., Bellei, B., Ricciardi, M. R., Tafuri,A., Amati, P., and Maione, R. (1998). The activity of differenti-ation factors induces apoptosis in polyomavirus large T-ex-pressing myoblasts. Mol. Biol. Cell 9, 1449–1463.

52. Hsiao, K. M., Mcmahon, S. L., and Farnham, P. J. (1994).Multiple DNA elements are required for the growth regulationof the mouse E2F1 promoter. Genes Dev. 8, 1526–1537.

53. Friend, S. H., Bernards, R., Rogelj, S., Weinberg, R. A., Rapa-port, J. M., Albert, D. M., and Dryja, T. P. (1986). A humanDNA segment with properties of the gene that predisposes toretinoblastoma and osteosarcoma. Nature 323, 643–646.

54. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). “Molecu-lar Cloning. A Laboratory Manual,” 2nd ed. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

55. Dugaiczyk, A., Haron, J. A., Stone, E. M., Dennison, O. E.,Rothblum, K. N., and Schwartz, R. J. (1983). Cloning and se-quencing of a deoxyribonucleic acid copy of glyceraldehyde-3-phosphate dehydrogenase messenger ribonucleic acid isolatedfrom chicken muscle. Biochemistry 22, 1605–1613.

56. Wright, W. E., Binder, M., and Funk, W. E. (1991). Cyclicamplification and selection of targets (CASTing) for the myoge-nin consensus binding site. Mol. Cell. Biol. 11, 4104–4110.

57. Li, Y., Slansky, J. E., Myers, D. J., Drinkwater, N. R., Kaelin,W. G., and Farnham, P. J. (1994). Cloning, chromosomal loca-tion, and characterization of mouse E2F1. Mol. Cell. Biol. 14,1861–1869.

58. Hollenberg, S. M., Cheng, P. F., and Weintraub, H. (1993). Useof a conditional MyoD transcription factor in studies of Myodtrans-activation and muscle determination. Proc. Natl. Acad.Sci. USA 90, 8028–8032.

59. Zalvide, J., Stubdal, H., and DeCaprio, J. A. (1998). The Jdomain of Simian virus 40 large T antigen is required to func-tionally inactivate RB family proteins. Mol. Cell. Biol. 18,1408–1415.

60. Neuman, E., Flemington, E. K., Sellers, W. R., and Kaelin,W. G. (1994). Transcription of the E2F-1 gene is rendered cellcycle dependent by E2F DNA-binding sites within its promoter.Mol. Cell. Biol. 14, 6607–6615.

61. Hiyama, H., Iavarone, A., and Reeves, S. A. (1998). Regulationof the cdk inhibitor p21 gene during cell cycle progression isunder the control of the transcription factor E2F. Oncogene 16,1513–1523.

62. Weinberg, R. A. (1996). E2F and cell proliferation: A world
turned upside down. Cell 85, 457–459.

6

6

6

6

6

7

7

7

7

7

7

7

7

RRP


63. Nevins, J. R. (1998). Toward an understanding of the functionalcomplexity of the E2F and retinoblastoma families. Cell GrowthDiffer. 9, 585–593.

4. Luo, R. X., Postigo, A. A., and Dean, D. C. (1998). Rb interactswith histone deacetylase to repress transcription. Cell 92, 463–473.

5. Magnaghi-Jaulin, L., Groisman, R., Naguibneva, I., Robin, P.,Lorain, S., Levillain, J. P., Troalen, F., Trouche, D., and Harel-Bellan, A. (1998). Retinoblastoma protein represses transcrip-tion by recruiting a histone deacetylase. Nature 391, 601–605.

6. Chu, C., Cogswell, J., and Kohtz, D. S. (1997). MyoD functionsas a transcriptional repressor in proliferating myoblasts.J. Biol. Chem. 272, 3145–3148.

7. Crescenzi, M., Fleming, T. P., Lassar, A. B., Weintraub, H., andAaronson, S. A. (1990). MyoD induces growth arrest indepen-dent of differentiation in normal and transformed cells. Proc.Natl. Acad. Sci. USA 87, 8442–8446.

8. Zacksenhaus, E., Gill, R. M., Phillips, R. A., and Gallie, B. L.(1993). Molecular cloning and characterization of mouse RB1promoter. Oncogene 8, 2343–2351.

69. Dechesne, C. A., Wei, Q., Eldridge, J., Gannounzaki, L., Mill-asseau, P., Bougueleret, L., Caterina, D., and Paterson, B. M.(1994). E-box- and MEF-2-independent muscle-specific expres-sion, positive autoregulation, and cross-activation of thechicken MyoD (CMD1) promoter reveal an indirect regulatorypathway. Mol. Cell. Biol. 14, 5474–5486.

70. Biesiada, E., Hamamori, Y., Kedes, L., and Sartorelli, V. (1999).Myogenic basic helix–loop–helix proteins and Sp1 interact ascomponents of a multiprotein transcriptional complex requiredfor activity of the human cardiac alpha-actin promoter. Mol.Cell. Biol. 19, 2577–2584.

71. Hofmann, F., Martelli, F., Livingston, D. M., and Wang, Z. Y.
(1996). The retinoblastoma gene product protects E2F-1 from
degradation by the ubiquitin–proteasome pathway. Genes Dev.10, 2949–2959.

2. Ikeda, M., Jakoi, L., and Nevins, J. R. (1996). A unique role forthe Rb protein in controlling E2F accumulation during cellgrowth and differentiation. Proc. Natl. Acad. Sci. USA 93,3215–3220.

3. Kiess, M., Gill, R. M., and Hamel, P. A. (1995). Expression andactivity of the retinoblastoma protein (pRB)-family proteins,p107 and p130, during L(6) myoblast differentiation. CellGrowth Differ. 6, 1287–1298.

4. Puri, P. L., Balsano, C., Burgio, V. L., Chirillo, P., Natoli, G.,Ricci, L., Mattei, E., Graessmann, A., and Levrero, M. (1997).MyoD prevents cyclin A cdk2 containing E2F complexes forma-tion in terminally differentiated myocytes. Oncogene 14, 1171–1184.

5. Philips, A., Huet, X., Plet, A., Lecam, L., Vie, A., and Blanchard,J. M. (1998). The retinoblastoma protein is essential for cyclinA repression in quiescent cells. Oncogene 16, 1373–1381.

6. Kowalik, T. F., Degregori, J., Leone, G., Jakoi, L., and Nevins,J. R. (1998). E2F1-specific induction of apoptosis and p53 accu-mulation, which is blocked by Mdm2. Cell Growth Differ. 9,113–118.

7. Hsieh, J. K., Fredersdorf, S., Kouzarides, T., Martin, K., andLu, X. (1997). E2F1-induced apoptosis requires DNA bindingbut not transactivation and is inhibited by the retinoblastomaprotein through direct interaction. Genes Dev. 11, 1840–1852.

8. Phillips, A. C., Bates, S., Ryan, K. M., Helin, K., and Vousden,K. H. (1997). Induction of DNA synthesis and apoptosis areseparable functions of E2F-1. Genes Dev. 11, 1853–1863.

9. Mulligan, G., and Jacks, T. (1998). The retinoblastoma genefamily: Cousins with overlapping interests. Trends Genet. 14,
223–229.
eceived April 2, 2001evised version received June 26, 2001ublished online August 27, 2001

Documents

MyoD Activity Upregulates E2F1 and Enhances Transcription from the Cyclin E Promoter in Differentiating Myoblasts Lacking a Functional Retinoblastoma Protein