Neuroprotective Effect of Dizocilpine (MK-801) via Anti ...€¦ · Anti-apoptosis on Hypoxic-ischemic ... embryonic cortical neuronal cell culture of ... et al. • Neuroprotective

Copyright © 2010 by the Korean Society of Neonatology • Published by the Korean Society of Neonatolog. All rights reserved. 181

Neuroprotective Effect of Dizocilpine (MK-801) via Anti-apoptosis on Hypoxic-ischemic Brain Injury in Neonatal Rats

Min Ae Seo, M.D., Hyun Ju Lee, M.D., Eun Jin Choi, M.D., Jin Kyung Kim, M.D., Hai Lee Chung, M.D., and Woo Taek Kim, M.D.

Department of Pediatrics, School of Medicine, Catholic University of Daegu, Daegu, Korea

Original article

J Korean Soc Neonatol • 2010;17:181-92

doi: 10.5385/jksn.2010.17.2.181pISSN 1226-1513•eISSN 2093-7849

Purpose: Current studies have demonstrated the neuroprotective effects of dizocilpine (MK-801) in many animal models of brain injury, including hypoxic-ischemic (HI) encephlopathy, trauma and excitotoxicity, but limited data are available for those during the neonatal periods. Here we investigated whether dizocilpine can protect the developing rat brain from HI injury via anti-apoptosis.Methods: In an in vitro model, embryonic cortical neuronal cell culture of Sprague-Dawley (SD) rats at 18-day gestation was done. The cultured cells were divided into three groups: normoxia (N), hypoxia (H), and hypoxia treated with dizocilpine (HD). The N group was prepared in 5% CO2 incubators and the other groups were placed in 1% O2 incubators (94% N2, 5% CO2) for 16 hours. In an in vivo model, left carotid artery ligation was done in 7-day-old SD rat pups. The animals were divided into six groups; hypoxia (N), hypoxia (H), hypoxia with sham-operation (HS), hypoxia with operation (HO), HO treated with vehicle (HV), and HO treated with dizocilpine (HD). Hypoxia was made by exposure to a 2 hour period of hypoxic incubator (92% N2, 8% O2).Results: In the in vitvo and in vivo models, the expressions of Bcl-2 in the hypoxia groups were reduced compared to the normoxia group. whereas those in the dizocilpine-treated group were increased compared to the hypoxia group. However. the expressions of Bax and caspase-3 and the ratio of Bax/Bcl-2 were revealed reversely.Conclusion: Dizocilpine has neuroprotective property over perinatal HI brain injury via anti-apoptosis.

Key Words: Anti-apoptosis, Dizocilpine, Hypoxic-ischemic brain injury, Neuroprotection

Introduction

Neurons are highly vulnerable to exposure of hypoxia and

ischemia and related insults that other cell types are able to

withstand. The mechanisms for this are poorly understood

but studies on hypoxic-ischemic (HI) brain injury have

identified at least one important participant such as

overstimulation of excitatory amino acid receptors, including

glutamate and aspartate1).

Glutamate has been implicated in the neuronal death after

HI brain injury because the antagonists of glutamate

receptors have been found to be neuroprotective2). Gluta-

mate receptor activation is associated with the raised

intracellular Ca2+ and the enzymatic production of NO from

the amino acid L-arginine3). Glutamate has long been known

to kill neurons by an N-methyl-d-aspartate (NMDA)

receptor-mediated mechanism. Paradoxically, subtoxic

concentrations of NMDA protect neurons against glutamate-

mediated excitotoxicity. Because NMDA protects neurons in

physiologic concentrations of glucose and oxygen4).

Received: 15 September 2010, Revised: 14 October 2010, Accepted: 20 October 2010Correspondence to Woo Taek Kim, M.D.Department of Pediatrics, School of Medicine, Catholic University of Daegu, 3056-6 Daemyeung4-dong, Nam-gu, Daegu 705-718, KoreaTel: +82-53-650-4250, Fax: +82-53-622-4240, E-mail: [email protected]

182 MA Seo, et al. • Neuroprotective Effect of Dizocilpine on Hypoxic-ischemic Brain Injury

However, dizocilpine (MK-801), a non-competitive NMDA

receptor antagonist, prevents signal transmission by means

of the blockade of NMDA receptor ion channels. Dizocilpine

acts by binding to a site located within the NMDA associated

ion channel and thus prevents Ca2+ flux5).

NMDA receptors are key in the progression of excito-

toxicity. Thus NMDA receptor antagonists including

dizocilpine have been evaluated for use in treatment of

diseases associated with excitotoxicity, such as stroke, HI

brain injury, and neurodegenerative diseases such as

Huntington's, Alzheimer's, and amyotrophic lateral sclerosis.

Dizocilpine has shown effectiveness in protecting neurons

in cell culture and animal models of excitotoxic neuro-

degeneration6, 7). In addition, dizocilpine was assessed by

evaluating hippocampal behavioral and histologic outcomes

in an experimental rat model of neonatal hypoxia ischemia8).

Dizocilpine reduces neuronal damage and preserves

learning and memory in a rat model of traumatic brain injury.

The neuronal caspase-3 expression, neuronal nitric oxide

synthase (nNOS)-positive neurons and OX-42-positive

microglia were all increased in transient brain injury animals.

After dizocilpine treatment neuronal caspase-3 expression

and nNOS-positive neurons were all significantly decreased.

Dizocilpine could significantly inhibit the degeneration and

apoptosis of neurons in damaged brain areas9).

The mechanisms of protective effect of NMDA receptor

stimulation on apoptosis of neurons at their early stage of

development are poorly understood. Anti-apoptotic effects

of NMDA is connected with inhibition of fragmentation of

DNA via caspase-3-independent mechanism10).

In addition, the efficacy of dizocilpine was evaluated in a

rat model of retinal ischemia11). NMDA receptors may have

an important role in ischemia-reperfusion insult as well as in

mediating ischemia-induced apoptosis of retinal neurons.

After intravitreal NMDA injection, ultrastructural features

consistent with classic apoptotic changes were noted in

degenerating cells in the retinal ganglion cell layer and the

inner nuclear layer. NMDA plus dizocilpine did not show

these changes12).

Dizocilpine can prevent excitatory neuronal death, but at

higher concentrations, it can also induce neuronal death in

the limbic system. This dizocilpine-induced selective

neurotoxicity has been proposed as an animal model for

dementia and psychosis. The results suggest that the

dizocilpine-induced neuronal death was apoptotic13).

whereas at high doses or after continuous administration it

induces neuronal degeneration or necrotic-like irreversible

neuronal death

In this study, we determined the protective abilities of

dizocilpine via mechanisms of anti-apoptosis on a HI brain

injury by using an rat model of a HI brain injury (in vivo) and

an embryonic cortical neuronal cell culture of rats (in vitro).

Dizocilpine effects were evaluated by using western blots

and real-time PCRs.

Materials and Methods

1. Materials

(+)-MK-801 hydrogen maleate (dizocilpine) was

purchased from Sigma (St. Louis, Saint Louis, MO, USA).

Primary antibodies included the following: Bcl-2 (1:1,000;

Santa Cruz Biotechnology, Santa Cruz, CA, USA), Bax

(1:1,000; Cell Signaling technology, Beverly, MA, USA),

caspase-3 (1:1,000; Cell Signaling technology), and β-Actin

(1:1,000, Santa Cruz Biotechnology). Secondary antibodies

used were goat anti-mouse or rabbit IgG-HRP (1:2,000,

Santa Cruz Biotech nology).

2. Embryonic cortical neuronal cell culture

The cortical neuronal cell culture of rat embryos were

prepared as previously described14). Sprague-Dawley (SD)

rats pregnant for 19 days were anesthetized with ether for 5

minutes at room temperature and the uterus was removed.

The fetal pups were washed in 100% ethanol and Hanks'

balanced salt solution (HBSS) (GibcoBRL, Grand Island, NY,

USA). The brains of the fetal pups were dissected at 37℃

HBSS containing 1 mM sodium pyruvate and 10 mM HEPES

(pH 7.4). The dissected brain cortical tissues were then

placed in 2 mL trypsin. Trypsinisation of cells was performed

J Korean Soc Neonatol 2010;17:181-92 • doi: 10.5385/jksn.2010.17.2.181 183

under gentle agitation for 1 minute at 37℃ water bath and

reaction was stopped by washing the tissues five times with

10 mL HBSS. The cells were moved in 1 mL HBSS, passed

6-7 times via pasteur pipette with tiny holes and dispersed.

The cell suspension was centrifuged at 1,000 rpm at 25℃ for

5 minutes and pellets were washed with HBSS (without

phenol red). Following final centrifugation cells were

resuspended in plating neurobasal medium (GibcoBRL) (100

mL neurobasal, 2 mL B27 supplement, 0.25 mL glutamax I

0.1 mL 25 mM glutamate, 0.1 mL 25 mM 2-mercaptoethanol)

and counted using a Neubauer hemicytometer.

After cell counting, the cells resuspended in plating

neurobasal medium (GibcoBRL) and plated at approximately

2×106 cells/mm2 in each dish. Cell were cultured in a CO2

chamber with 1/5 of the culture solution changed every three

days with feeding neurobasal medium (GibcoBRL) (100 mL

neurobasal, 2 mL B27 supplement, 0.25 mL glutamax I).

The cultured cells were divided into three groups: a

normoxia group (N), a hypoxia group (H), and a hypoxia

treated with dizocilpine (HD). The N group was prepared in

5% CO2 incubators and the other groups (before a hypoxia

injury) were placed in 1% O2 incubators (94% N2, 5% CO2) for

16 hours. The experiments were repeated four times (n=4) in

the western blots and six times (n=6) in the real time PCRs.

3. Animal model and drug administration

This study was performed in accordance with the ap-

proved animal use guidelines of the Catholic University of

Daegu. A modification of Levine preparation was used as a

model for perinatal hypoxic-ischemic brain injury as

previously described15). We chose 7-day-old SD rat pups

weighing between 12 and 16 g because HI brain injury in 7-

day-old rats can be considered similar to perinatal ashpyxia

in the full-term infants. The sexes were not differentiated

since there are no differences in terms of neonatal HI brain

injury between male and female rats16). The rat pups

underwent permanent unilateral carotid ligation. The

midline of the neck was incised at the longitudinal plane

under ether anesthesia. The left common carotid artery was

permanently ligated with 5-0 surgical silk. Total time of

surgery never exceeded 5 minutes. Animals were excluded

from the study if there was bleeding during ligation or

respiratory arrest resulting from anesthesia. Following a 1

hour period of recovery, the animals were exposed to a 2

hour period of hypoxia (92% N2, 8% O2) by placing them in

airtight containers partially submerged in a 37℃ water bath

to maintain a constant thermal environment. After this

hypoxic exposure, the pups were returned to their dams for

the indicated time. Pups were killed at 7 days after the

hypoxic insult. Left cerebral hemispheres from rat brains

were immediately removed, frozen in liquid nitrogen and

stored at -70℃ until use.

The pups were divided into six groups. No surgical

procedure was not exposed to hypoxia (N) or was exposed

to hypoxia (H). Hypoxia with sham-operated pups

underwent the same surgical procedure without ligation

(HS). The pups were subjected to hypoxia with operation

(HO). Another pups received an intraperitoneal injection

with phosphate-buffered saline (PBS) at the same volume

with dizocilpine (HV) or with dizocilpine at a dose of 10 mg/

kg (HD). Dizocilpine was prepared in PBS and injected

intraperitoneally at a dose of 10 mg/kg 30 minutes before the

hypoxic exposure. The experiments were repeated four

times (n=4) in the western blots and six times (n=6) in the

real time PCRs.

4. Protein isolation and western blotting

Samples of brain tissue and cell were homogenized and

total protein was extracted using a protein lysis buffer

containing complete protease inhibitor cocktail tablets

(Roche Applied Science, Mannheim, Germany), 1 M Tris-HCl

(pH 8.0), 5 M NaCl, 10% Nonidet P-40 and 1 M 1,4-dithio-

DL-threitol (DTT). After incubation for 20 minutes on ice, the

samples were centrifuged at 12,000 rpm at 4℃ for 30

minutes and the supernatant was transferred to a new tube.

Proteins were quantified using Bio-Rad Bradford kit (Bio-

rad Laboratories, Hercules, CA, USA) and taking spectro-

photometric readings at 590 nm. Concentrations were

estimated against a standard curve generated using BSA.

Total protein (50 μg) was subjected to electrophoreses in


12% SDS-polyacryl amide gel electrophoresis (SDS-PAGE)

after denaturing in 5×sodium dodecyl sulfate gel-loading

buffer (60 mM Tris-HCl [pH 6.8], 25% glycerol, 2% SDS, 14.4

mM 2-mercapto ethanol and 0.1% bromophenol blue) in

boiling water for 10 minutes. Proteins were then transferred

onto polyvinylidene difluoride (PVDF) membrane

(Millipore, Bedford, MA, USA) using a semi-dry transfer

apparatus at a constant voltage of 10 V for 30 minutes.

Membranes were blocked in TBS, 0.1% Tween-20

containing 5% nonfat powdered milk. Proteins were reacted

with primary antibodies for overnight at 4℃, and then

incubated with secondary antibodies for 1 hr at room

temperature. Signals were detected using an enhanc ed

chemiluminoescence (ECL) Plus Western Blotting Detection

System (Amersham Biosciences, Piscataway, NJ, USA) or

SUPEX (Neuronex, Pohang, Korea), and expose to film and

develop image. Then analyzed using Kodak X-Omat film or

an image analyzer LAS1000 (Fuji Photo Film, Tokyo, Japan).

Each sample was conducted four times.

5. Semiquantitation of the western blots

The intensity of the corresponding western blot band was

measured by using a densitometer (Multi Gauge Software;

Fuji Photofilm) and was calculated as the ratio of the signal

intensity in the ischemic hemisphere compared to the

contralateral hemisphere.

6. RNA extraction and real-time PCR

Total RNA was isolated using TRIzol reagent (Invitrogen

Corporation, Carlsbad, CA, USA). Incubate the homogenized

samples for 5 minutes at room temperature to permit the

complete dissociation of nucleoprotein complexes. Add 0.2

mL of chloroform per 1 mL of TRIzol reagent. After

centrifugation, the aqueous phase was transferred to a fresh

tube and the RNA from the aqueous phase was precipitated

by mixing with isopropyl alcohol. The precipitate was

washed twice in 100% ethanol. At the end of the procedure,

briefly the RNA pellet was dried and RNA was dissolved in

diethylpyrocarbonate (DEPC)-treated distilled water. From

each sample was taken for GeneQuant 1,300 spectro-

photometer (Gene QuantTM proRNA/DNA calculator, GE

Healthcare, Amersham, Buckinghamshire, UK) mea-

surement of RNA concentration. The RNA was then stored at

-70℃ before further processing. Total RNA was used in a

reverse transcriptase reaction. For real-time PCR (For

reverse transcription), total RNA (1 μg) was reverse

transcribed for 1 hour at 37℃ in a reaction mix ture

containing 20 U RNase inhibitor (Promega, Madison, WI,

USA), 1 mM dNTP (Promega, Madison, WI), 0.5 ng Oligo

(dT) 15 primer (Promega), 1x RT buffer and 200 U M-MLV

reverse transcriptase (Promega). The reaction mixture was

then incubated at 95℃ for 5 minutes to stop the reaction. The

cDNA was then stored at -20℃ before further processing.

Real-time PCR was performed in 48 well PCR plates (Mini

OpticonTM Real-Time PCR System, Bio-rad Laboratories).

Each reaction mixture contained 10 μL iQTM SYBR Green

Supermix (Bio-rad Laboratories), 1 μL template, and 2 pmol

each primer were added and adjusted with sterile water to al

final volume of 20 μL. The initial denaturation was per-

formed at 94℃ for 5 minutes, followed by 40 cycles at 94℃

for 30 seconds (denaturation), 53-59℃ (Table 1) for 30

seconds (annealing), and 72℃ for 30 seconds (extension),

and a final incubation at 72℃ for 7 minutes to ensure

complete strand extension. Real-time PCR data were

analysed with LightCycler software (Bio-rad Laboratories).

Relative expression levels of genes of interest were

calculated as the difference between the specific ratios

(NMDA receptor/Beta-actin) and were further adjusted on

the basis of their differences in CT values (number of cycles

to reach threshold). Each sample was conducted six times.

Table 1. Primer Pairs and Annealing Temperature for Real-time PCR

Name Primer sequence (5'-3') Annealing

Bcl-2

Bax

Caspase-3

β-Actin

F:TTGACGCTCTCCACACACATGR:GGTGGAGGAACTCTTCAGGGAF:TGCTGATGGCAACTTCAACTR:ATGATGGTTCTGATCAGCTCGF:AATTCAAGGGACGGGTCATGR:GCTTGTGCGCGTACAGTTTCF:TTGCTGATCCACATCTGCTGR:GACAGGATGCAGAAGGAGAT

57℃

55℃

56℃

53℃


7. Statistics analysis

Data were analyzed using the SPSS version 12 statistical

analysis package. Examined data were assessed using the

t-test, GLM (general lineal model), and ANOVA. In each test,

the data were expressed as the mean±SD, and P<0.05 was

accepted as statistically significant.

Results

1. Morphologic changes in the embryonic cortical neu ro-nal cell culture of rat (in vitro)

The cortical neuronal cells were observed using light

microscopy under high magnification (×200). The cells in

the N group were well preserved (Fig. 1A), whereas the cells

in the H group showed cellular damages (Fig. 1B). The

cellular patterns of the HD (Fig. 1C) appeared similar to

those in the N group.

2. The expressions of Bcl-2, Bax and caspase-3 antibodies by western blots (Fig. 2A) in the embryonic cortical neuronal cell culture (in vitro)

The expression of Bcl-2 was reduced in the H group

compared to the N group, whereas it showed a greater

increase in the HD group compared to the H group (P<0.05)

(Fig. 2B). Conversely, the expressions of Bax and caspase-3

and the ratio of Bax/Bcl-2 were greater in the H group than

in the N group, whereas they were reduced in the HD group

compared to the H group (P<0.05) (Fig. 2C-E).

3. The expressions of Bcl-2, Bax and caspase-3 mRNAs by real-time PCRs in the embryonic cortical neuronal cell culture (in vitro)

The expression of Bcl-2 was reduced in the H group

compared to the N group, whereas it showed a greater

increase in the HD group compared to the H groups (P<0.05)

(Fig. 3A). Conversely, the expressions of Bax and caspase-3

and the ratio of Bax/Bcl-2 were greater in the H group than

in the N group, whereas they were reduced in the HD group

compared to the H group (P<0.05) (Fig. 3B-D).

4. Gross morphologic changes in the neonatal hypoxic-ischemic brain injury (in vivo)

Gross morphologic changes in the neonatal hypoxic-

ischemic brain injury (in vivo) showed that the percentage of

left hemisphere area compared to right hemisphere area are

107.3% in the normoxia (A; N), 101% in the hypoxia without

operation (B; H), 105% in the hypoxia with Sham operation

(C; HS), 86% in the hypoxia with operation (D; HO), 82.5% in

the D treated with vehicle (E; HV) and 98% in the D treated

with dizocilpine (F; HD) (Fig. 4).

5. The expressions of Bcl-2, Bax and caspase-3 antibodies by western blots in the neonatal hypoxic-ischemic brain injury (in vivo)

The expression of Bcl-2 was reduced in the HO and HV

groups compared to the N, H and HS groups, whereas it

showed a greater increase in the HD group compared to the

HO and HV groups (P<0.05) (Fig. 5A). Conversely, the

expressions of Bax and caspase-3 and the ratio of Bax/Bcl-

2 were greater in the HO and HV groups than in the N, H and

HS groups, whereas they were reduced in the HD group

Fig. 1. Morphologic changes in the embryonic cortical neuronal cell culture of rat (in vitro) were revealed. (A) normoxia; (B) hypoxia; (C) hypoxia treated with dizocilpine.


Fig. 2. Western blots (A) of Bcl-2 (B: N, 100±2.0; H, 92.4±1.8; HD, 101.8±2.0), Bax (C: N, 100±2.5; H, 116.3±2.9; HD, 107.3±2.7) and caspase-3 (D: N, 100±3.1; H, 116.4±3.5; HD, 92.0±2.8) in the embryonic cortical neuronal cell culture (in vitro) and the ratio of Bax/Bcl-2 expression (E) were revealed (n=4). The dizocilpine was administered at a dose of 10 μg/mL. N, normoxia; H, hypoxia; HD, hypoxia treated with dizocilpine; *P<0.05, statistically significant vs. H.

Fig. 3. Real time PCRs of Bcl-2 (A: N, 100±6.1; H, 43.5±2.6; HD, 75.3±4.5), Bax (B: N, 100±6.4; H, 148.5±8.9; HD, 35.4±2.1) and caspase-3 (C: N, 100±5.2; H, 131.9 ±6.6; HD, 91.4±4.5) mRNAs in the embryonic cortical neuronal cell culture (in vitro) and the ratio of Bax/Bcl-2 expression (D) were revealed (n=6). The dizocilpine was administered at a dose of 10 μg/mL. N, normoxia; H, hypoxia; HD, hypoxia treated with dizocilpine; *P<0.05, statistically significant vs. H.


Fig. 4. Gross morphologic changes in the neonatal hypoxic-ischemic brain injury (in vivo) were revealed. (A) normoxia; (B) hypoxia without operation; (C) hypoxia with Sham operation; (D) hypoxia with operation; (E) D treated with vehicle; (F) D treated with dizocilpine. Percentage of left hemisphere area compared to right hemisphere area are 107% (A), 101% (B), 105% (C), 86.0% (D), 82.5% (E) and 98.0% (F).

Fig. 5. Western blots of Bcl-2 (A: N, 100±5.6; H, 105.4±7.5; HS, 119.5±5.9; HO, 54.3±2.7; HV, 70.0±3.5; HD, 118.2±5.9,), Bax (B: N, 100±5.0; H, 97.4±4.8; HS, 1,190±6.0; HO, 314.9±15.7; HV, 300.8±15.0; HD, 106.2±5.3) and caspase-3 (C: N, 100±5.2; H, 91.9±4.6; HS, 102.8±5.1; HO, 172.5±8.6; HV, 221.1±11.1; HD, 99.8±5.0) in the neonatal hypoxic-ischemic brain injury (in vivo) and the ratio of Bax/Bcl-2 expression (D) were revealed (n=4). The dizocilpine was administered at a dose of 10 mg/kg. N, normoxia; H, hypoxia without operation; HS, hypoxia with Sham operation; HO, hypoxia with operation; HV, HO treated with vehicle; HD, HO treated with dizocilpine; *P<0.05, statistically significant vs. HO.


compared to the HO and HV groups (P<0.05) (Fig. 5B-D).

6. The expressions of Bcl-2, Bax and caspase-3 mRNAs by real-time PCRs in the neonatal hypoxic-ischemic brain injury (in vivo)

The expression of Bcl-2 was reduced in the HO and HV

groups compared to the N, H and HS groups, whereas it

showed a greater increase in the HD group compared to the

HO and HV groups (P<0.05) (Fig. 6A). Conversely, the

expressions of Bax and caspase-3 and the ratio of Bax/Bcl-

2 were greater in the HO and HV groups than in the N, H and

HS groups, whereas they were reduced in the HD group

compared to the HO and HV groups (P<0.05) (Fig. 6B-D).

Discussion

Hypoxic–ischemic encephalopathy (HIE) during the

perinatal period, a single most important cause of acute

mortality and chronic disability in newborns, usually occurs

as a result of intrauterine hypoxia or asphyxia during birth17).

It gives rise to neurological disability and even neonatal

death. The incidence of asphyxia at birth is around 0.2-0.4%

in full-term newborn infants and approaches 60% in

preterm infants18). Between 20 and 50% of asphyxiated

babies who exhibit HIE, die during the newborn period19).

Of the survivors, up to 25% have permanent neuropsy-

chological handicaps in the form of cerebral palsy, with or

without associated mental retardation, learning disabilities or

epilepsy20). These can include attention deficit disorders and

minimal brain disorder syndromes, and may form the basis

for psychiatric and neurodegenerative diseases later in life21).

Neuronal injury may be caused by overstimulation of

excitatory amino acid receptors, including glutamate and

aspartate. This excitotoxicity is predominantly mediated by

calcium influx through ionic channels of activated glutamate

receptors. Hypoxia and ischemia result in overaccumulation

of the excitatory amino acid, glutamate. Glutamate, the

principal neurotransmitter of the brain, is responsible for

many physiologic functions, including cognition, memory,

movement, and sensation. Pathophysiologically, excessive

glutamate activates NMDA, α-amino-3-hydroxy-5-methyl-

Fig. 6. Real time PCRs of Bcl-2 (A: N, 100±4.5; H, 85.3±3.4; HS, 99.3±3.9; HO, 72.2±2.8; HV, 79.6±3.1; HD, 108.7±4.3), Bax (B: N, 100±4.1; H, 109.8±4.3; HS, 102.1±4.0; HO, 184.7±7.3; HV, 127.9±5.1; HD, 95.9±3.8) and caspase-3 (C: N, 100±2.4; H, 116.1±2.3; HS, 118.1±2.5; HO, 224.2±4.4; HV, 169.9±3.4; HD, 121.8±2.4) mRNAs in the neonatal hypoxic-ischemic brain injury (in vivo) and the ratio of Bax/Bcl-2 expression (D) were revealed (n=6). The dizocilpine was administered at a dose of 10 mg/kg. N, normoxia; H, hypoxia without operation; HS, hypoxia with Sham operation; HO, hypoxia with operation; HV, HO treated with vehicle; HD, HO treated with dizocilpine; *P<0.05, statistically significant vs. HO.


4-isoxazolepropionate, and kainate glutamate receptors.

Glutamate along with coagonist glycine stimulates NMDA

receptors to increase intracellular calcium, which triggers a

cascade of intracellular reactions, activating phospholipases,

proteases, protein kinases, phosphatases, and nitric oxide

synthase (NOS). The NOS causes increased NO production,

which may damage DNA by base deamination to result in

DNA strand breaks. Damaged DNA activates poly (adeno-

sine 5'-diphosphoribose) polymerase to add deoxyadeno-

sinetriphosphate to the ends of nicked DNA, resulting in

depletion of energy sources from the cell. These pro cesses

ultimately lead to cell death, which can be necrotic or

apoptotic in nature22).

The precise events which initiate the cascade leading to

cell death after HI are still incompletely understood, but are

undoubtedly multifactorial. It is likely partly related to

excessive entry of calcium into cells both during and after

HI23), loss of trophic support from growth factors24), induction

of free radicals during hypoxia and early reperfusion25) and/

or a secondary inflammatory, reaction26), which may act

through activation of cell surface death receptors27), or syn-

thesis of down-stream mediators of cell death such as nitric

oxide synthase and reactive oxygen species28, 29).

The neonatal rat HI model and the cortical cell culture

model of rat embryos have been well characterized and

used extensively to search for neuroprotective agents30). The

most accepted and widely used animal model of perinatal

asphyxia is a modification of the Levine preparation31), which

includes combination of ischemia, obtained by unilateral

occlusion of carotid artery, followed by exposure to hypoxia

in 7-day-old rats. Neurodevelopmental stage of 7-day-old

rats corresponds to that of newborn infants32). This animal

model represents a useful tool for studying potential

neuroprotective strategies capable of preventing or limiting

the perinatal hypoxic.ischemic injury in humans. Our studies

showed that as brain was exposed to hypoxia, the volume of

affected brain was reduced compared to ones of con-

tralateral unaffected brain. However, the affected brain

treated with dizocilpine was restored to the similar volume

of normal brain. In addition, the cortical neuronal cell culture

of rat embryos were prepared from SD rats pregnant for 19

days. The hypoxia were prepared in 1% O2 incubators for 16

hours. Our studies showed that the cortical neuronal cells

cultured in the normal oxygen environment appeared

normal, whereas those exposed in the hypoxic oxygen

environment showed cellular damages. The cellular patterns

of the dizocilpine-treated groups were preserved and

appeared similar to those in the normoxia group.

Cell death may be conveniently classified into two broad

categories : necrosis and apoptosis33). In necrosis, the cells

show early plasma membrane changes, clumping of

chromatin, swelling of intracellular organelles, membrane

breakdown, and leakage of enzymes and proteins causing

extensive inflammatory reactions34). In addition, necrotic

cells appear in patches. In contrast, apoptotic cells are

characteristically scattered throughout the tissue and initially

show condensation of chromatin at the nuclear periphery

and reduction of nuclear size and cell volume35).

The Bcl-2 protein blocks a distal step in an evolutionarily

conserved pathway for programmed cell death and

apoptosis. Bcl-2 is the founding member of the Bcl-2 family

of apoptosis regulator proteins. These proteins govern

mitochondrial outer membrane permeabilization (MOMP)

and can be either pro-apoptotic (Bax, BAD, Bak, and Bok

among others)36) or anti-apoptotic (including Bcl-2 proper,

Bcl-xL, and Bcl-w, among an assortment of others). Some

Bcl-2 family proteins can induce (pro-apoptotic members)

or inhibit (anti-apoptotic members) the release of cyto-

chrome c into the cytosol which, once there, activates

caspase-9 and caspase-3, leading to apoptosis. The majority

of Bax is found in the cytosol, but upon initiation of apoptotic

signaling, Bax undergoes a conformation shift, and inserts

into organelle membranes, primarily the outer mitochondria

membrane37).

The family of caspases are two types of apoptotic

caspases: initiator (apical) caspases and effector (execu-

tioner) caspases. Initiator caspases (e.g. caspase-8, -9)

cleave inactive pro-forms of effector caspases, thereby

activating them. Effector caspases (e.g.caspase-3, -6, -7) in

turn cleave other protein substrates within the cell, to trigger


the apoptotic process. The initiation of this cascade reaction

is regulated by caspase inhibitors38). Caspases are crucial

mediators of programmed cell death (apoptosis). Among

them, caspase-3 is a frequently activated death protease,

catalyzing the specific cleavage of many key cellular

proteins. However, the specific requirements of this (or any

other) caspase in apoptosis have remained largely unknown

until now. Pathways to caspase-3 activation have been

identified that are either dependent on or independent of

mitochondrial cytochrome c release and caspase-9 func-

tion. Caspase-3 is essential for normal brain development

and is important or essential in other apoptotic scenarios in a

remarkable tissue-, cell type- or death stimulus-specific

manner39).

Stimulation of NMDA receptors induces apoptosis in rat

brain. NMDA-induced cell death was completely inhibited

by the NMDA receptor antagonist dizocilpine40). This result

suggest that apoptotic mechanisms are involved in

excitotoxin-induced cell death.

We used the expressions of Bcl-2 antibodies and mRNAs,

as anit-apoptosis, and the expressions of Bax and caspase-

3, as pro-apoptosis, using western blots and real-time PCR

to detect apoptotic properties in perinatal HI brain injury. In

the present study, the expression of Bcl-2 was reduced in the

hypoxia group when compared to the normoxia group,

whereas it was increased in the dizocilpine-treated group

compared to the hypoxia group. In contrast, the expressions

of Bax and caspase-3 and the ratio of Bax/Bcl-2 were

showed reversely.

In conclusion, our experiments demonstrate that

dizocilpine is able to prevent the degeneration of neonatal

cerebral neuronal cells caused by a hypoxic insult. In

addition, dizocilpine neuroprotective effects on HI brain

injury in neonatal rats may be via anti-apoptosis. The present

study may be useful for the further development of clinical

therapies for perinatal HI encephalopathy　induced by

cerebral hypoxia.

한글요약

목적: 비경쟁적 NMDA 길항제인 dizocilpine (MK-801)는 저

산소성 허혈성 뇌병증, 외상성 뇌손상, 흥분독성과 같은 신경 질

환의 동물 모델에서 보호 효과가 있다고 발표되고 있지만 주산

기 가사로 인한 저산소성 허혈성 뇌병증의 치료제로서 그 기전

이 명확하게 밝혀지지 않았다. 저자들은 dizocilpine을 이용하

여 주산기 저산소성 허혈성 뇌병증의 치료제로서 항 세포사멸

사을 통한 기전을 알아보고자 하였다.

방법: 생체외 실험으로 재태기간 19일된 태아 흰쥐의 대뇌피

질 세포를 배양하여 3군(정상산소군, 저산소군, 뇌손상 전

dizocilpine 투여군)으로 나누었다. 정상산소군은 5% CO2 배양

기(95% air, 5% CO2)에 두었고, 저산소군과 뇌손상 전 dizo-

cilpine 투여군(10 μg/mL)은 1% O2 배양기(94% N2, 5% CO2)

에서 16시간 동안 뇌세포손상을 유도하였다. 생체내 실험으로

저산소성 허혈성 뇌병증의 동물 모델에서는 생후 7일된 신생백

서의 좌측 총 경동맥을 결찰한 후 6개 군(정상산소군, 수술 없이

저산소군, sham 수술 후 저산소군, 수술 후 저산소군, vehicle 투

여후 저산소군, dizocilpine 투여 후 저산소군)으로 나누었고,

저산소 손상은 특별히 제작한 통속에서 2시간 동안 8% O2에 노

출시켰다. Dizocilpine은 뇌손상 전후 30분에 체중 kg당 10 mg

를 투여하였고, 저산소 손상 후 7일째 조직을 실험하였다. 생체

외·내 실험 모두 세포사멸사와 관련된 Bcl-2, Bax, caspase-3

항체와 primer를 이용하여 western blots과 실시간 중합효소연

쇄반응을 실시하였다.

결과: 세포사멸사와 관련된 생체외·내 실험에서 Bcl-2의 발

현은 저산소군에서 정상산소군보다 감소하였으나 dizocilpine

투여군에서 저산소군보다 증가하였다. 그러나 Bax와 caspase-

3 발현 및 Bax/Bcl-2의 비는 반대로 표현되었다.

결론: 본 연구에서 dizocilpine은 항 세포사멸사를 통하여 주

산기 저산소성 허혈성 뇌손상에서 신경보호 역할을 하는 것을

알 수 있었다.

References

1) Amir G, Ramamoorthy C, Riemer RK, Reddy VM, Hanley FL. Neonatal brain protection and deep hypothermic circulatory arrest: pathophysiology of ischemic neuronal injury and protective strategies. Ann Thorac Surg 2005;80:1955-64.

2) Choi DW. Cerebral hypoxia: some new approaches and unanswered


questions. J Neurosci 1990;10:2493-501.

3) Garthwaite J, Boulton CL. Nitric oxide signaling in the central nervous system. Annu Rev Physiol 1995;57:683-706.

4) Marini AM, Rabin SJ, Lipsky RH, Mocchetti I. Activity-dependent release of brain-derived neurotrophic factor underlies the neuro-protective effect of N-methyl-D-aspartate. J Biol Chem 1998;273: 29394-9.

5) Mukhin AG, Ivanova SA, Knoblach SM, Faden AI. New in vitro model of traumatic neuronal injury: evaluation of secondary injury and glutamate receptor-mediated neurotoxicity. J Neurotrauma 1997;14:651-63.

6) Ayala GX, Tapia R. Late N-methyl-D-aspartate receptor blockade rescues hippocampal neurons from excitotoxic stress and death after 4-aminopyridine-induced epilepsy. Eur J Neurosci 2005;22:3067-76.

7) Kocaeli H, Korfali E, Oztürk H, Kahveci N, Yilmazlar S. MK-801 improves neurological and histological outcomes after spinal cord ischemia induced by transient aortic cross-clipping in rats. Surg Neurol 2005;64 Suppl 2:S22-6; discussion S27.

8) Ford LM, Sanberg PR, Norman AB, Fogelson MH. MK-801 prevents hippocampal neurodegeneration in neonatal hypoxic-ischemic rats. Arch Neurol 1989;46:1090-6.

9) Han RZ, Hu JJ, Weng YC, Li DF, Huang Y. NMDA receptor antagonist MK-801 reduces neuronal damage and preserves learning and memory in a rat model of traumatic brain injury. Neurosci Bull 2009;25:367-75.

10) Jantas D, Lason W. Different mechanisms of NMDA-mediated protection against neuronal apoptosis: a stimuli-dependent effect. Neurochem Res 2009;34:2040-54.

11) Lam TT, Siew E, Chu R, Tso MO. Ameliorative effect of MK-801 on retinal ischemia. J Ocul Pharmacol Ther 1997;13:129-37.

12) Lam TT, Abler AS, Kwong JM, Tso MO. N-methyl-D-aspartate (NMDA)--induced apoptosis in rat retina. Invest Ophthalmol Vis Sci 1999;40:2391-7.

13) Zhang X, Boulton AA, Zuo DM, Yu PH. MK-801 induces apoptotic neuronal death in the rat retrosplenial cortex: prevention by cycloheximide and R(-)-2-hexyl-N-methylpropargylamine. J Neurosci Res 1996;46:82-9.

14) Brewer GJ. Isolation and culture of adult rat hippocampal neurons. J Neurosci Methods 1997;71:143-55.

15) Vannucci RC, Vannucci SJ. A model of perinatal hypoxic-ischemic brain damage. Ann N Y Acad Sci 1997;835:234-49.

16) Feng Y, Fratkins JD, LeBlanc MH. Treatment with tamoxifen reduces hypoxic-ischemic brain injury in neonatal rats. Eur J Pharmacol 2004;484:65-74.

17) Greenwood K, Cox P, Mehmet H, Penrice J, Amess PN, Cady EB, et al. Magnesium sulfate treatment after transient hypoxia-ischemia in the newborn piglet does not protect against cerebral damage. Pediatr Res 2000;48:346-50.

18) Vannucci RC, Connor JR, Mauger DT, Palmer C, Smith MB, Towfighi J, et al. Rat model of perinatal hypoxic-ischemic brain damage. J Neurosci Res 1999;55:158-63.

19) MacDonald HM, Mulligan JC, Allen AC, Taylor PM. Neonatal asphyxia. I. Relationship of obstetric and neonatal complications to neonatal mortality in 38,405 consecutive deliveries. J Pediatr 1980;96:898-902.

20) Delivoria-Papadopoulos M, Mishra OP. Mechanisms of cerebral injury in perinatal asphyxia and strategies for prevention. J Pediatr 1998;132:S30-4.

21) Weitzdoerfer R, Pollak A, Lubec B. Perinatal asphyxia in the rat has lifelong effects on morphology, cognitive functions, and behavior. Semin Perinatol 2004;28:249-56.

22) Chan PH. Mitochondrial dysfunction and oxidative stress as determinants of cell death/survival in stroke. Ann N Y Acad Sci 2005;1042:203-9.

23) Zipfel GJ, Babcock DJ, Lee JM, Choi DW. Neuronal apoptosis after CNS injury: the roles of glutamate and calcium. J Neurotrauma 2000;17:857-69.

24) Clawson TF, Vannucci SJ, Wang GM, Seaman LB, Yang XL, Lee WH. Hypoxia-ischemia-induced apoptotic cell death correlates with IGF-I mRNA decrease in neonatal rat brain. Biol Signals Recept 1999;8:281-93.

25) Bågenholm R, Nilsson UA, Götborg CW, Kjellmer I. Free radicals are formed in the brain of fetal sheep during reperfusion after cerebral ischemia. Pediatr Res 1998;43:271-5.

26) Giulian D, Vaca K. Inflammatory glia mediate delayed neuronal damage after ischemia in the central nervous system. Stroke 1993;24(12 Suppl):I84-90.

27) Graham EM, Sheldon RA, Flock DL, Ferriero DM, Martin LJ, O'Riordan DP, et al. Neonatal mice lacking functional Fas death receptors are resistant to hypoxic-ischemic brain injury. Neurobiol Dis 2004;17:89-98.

28) Allan SM, Rothwell NJ. Inflammation in central nervous system injury. Philos Trans R Soc Lond B Biol Sci 2003;358:1669-77.

29) Huang SS, Tsai MC, Chih CL, Hung LM, Tsai SK. Resveratrol reduction of infarct size in Long-Evans rats subjected to focal cerebral ischemia. Life Sci 2001;69:1057-65.

30) Ashwal S, Pearce WJ. Animal models of neonatal stroke. Curr Opin Pediatr 2001;13:506-16.

31) Vannucci RC. Hypoxic-ischemic encephalopathy. Am J Perinatol 2000;17:113-20.

32) Towfighi J, Mauger D, Vannucci RC, Vannucci SJ. Influence of age on the cerebral lesions in an immature rat model of cerebral hypoxia-ischemia: a light microscopic study. Brain Res Dev Brain Res 1997; 100:149-60.

33) Wyllie AH. Apoptosis and the regulation of cell numbers in normal and neoplastic tissues: an overview. Cancer Metastasis Rev 1992; 11:95-103.

34) Gerschenson LE, Rotello RJ. Apoptosis: a different type of cell death. FASEB J 1992;6:2450-5.

35) Johnson EM Jr, Deckwerth TL. Molecular mechanisms of develop-mental neuronal death. Annu Rev Neurosci 1993;16:31-46.

36) Dong JW, Zhu HF, Zhu WZ, Ding HL, Ma TM, Zhou ZN. Intermittent hypoxia attenuates ischemia/reperfusion induced


apoptosis in cardiac myocytes via regulating Bcl-2/Bax expression. Cell Res 2003;13:385-91.

37) Wolter KG, Hsu YT, Smith CL, Nechushtan A, Xi XG, Youle RJ. Movement of Bax from the cytosol to mitochondria during apoptosis. J Cell Biol 1997;139:1281-92.

38) Thornberry NA, Lazebnik Y. Caspases: enemies within. Science 1998;281:1312-6.

39) Porter AG, Janicke RU. Emerging roles of caspase-3 in apoptosis. Cell Death Differ 1999;6:99-104.

40) Qin ZH, Wang Y, Chase TN. Stimulation of N-methyl-D-aspartate receptors induces apoptosis in rat brain. Brain Res 1996;725:166-76.

Documents

Neuroprotective Effect of Dizocilpine (MK-801) via Anti ...€¦ · Anti-apoptosis on Hypoxic-ischemic ... embryonic cortical neuronal cell culture of ... et al. • Neuroprotective