의학의학의학의학 박사학위박사학위박사학위박사학위 논문논문논문논문

Knockdown of nfa1 Gene Cloned from

Naegleria fowleri by Antisense RNA

아아아아 주주주주 대대대대 학학학학 교교교교 대대대대 학학학학 원원원원

의의의의 학학학학 과과과과

이이이이 상상상상 철철철철

Knockdown of nfa1 Gene Cloned from

Naegleria fowleri by Antisense RNA

by

Sang-Chul Lee

A Dissertation Submitted to The Graduate School of Ajou University

in Partial Fulfillment of the Requirements for the Degree of

DOCTOR OF PHILOSOPHY

Supervised by

Ho-Joon Shin, Ph.D.

Department of Medical Sciences

The Graduate School, Ajou University

February, 2006

이상철이상철이상철이상철의의의의 의학의학의학의학 박사학위박사학위박사학위박사학위 논문을논문을논문을논문을 인준함인준함인준함인준함.

심사심사심사심사 위원장위원장위원장위원장 이이이이 일일일일 영영영영 인인인인

심심심심 사사사사 위위위위 원원원원 신신신신 호호호호 준준준준 인인인인

심심심심 사사사사 위위위위 원원원원 박박박박 선선선선 인인인인

심심심심 사사사사 위위위위 원원원원 김김김김 경경경경 민민민민 인인인인

심심심심 사사사사 위위위위 원원원원 임임임임 경경경경 일일일일 인인인인

아아아아 주주주주 대대대대 학학학학 교교교교 대대대대 학학학학 원원원원

2005년년년년 12월월월월 22일일일일

i

-ABSTRACT-

Knockdown of nfa1 Gene Cloned from

Naegleria fowleri by Antisense RNA

PAME caused by N. fowleri is an acute, fulminant, and rapidly progressing fatal

illness that usually affects children and young adults. There have been few reports to

address proteins functioning in vitro cytotoxicity of N. fowleri. The nfa1 gene, cloned

from a cDNA library of N. fowleri by immunoscreening, should be concerned with

the formation of food-cups that is a phagocytic structure. In addition, an anti-Nfa1

antobody reduced the in vitro cytotoxicity of N. fowleri against target cells. To

elucidate the function of proteins cloned from N. fowleri, the gene-knockdown

analysis by a transfection system are not yet established. In this present study, to

describe the association of an Nfa1 protein in vitro cytotoxicity of N. fowleri to target

cells, an antisense RNA or siRNA of nfa1 gene were transfected into N. fowleri

trophozoites. By the synthetic dsRNA of nfa1 gene ORF, the expression of nfa1 gene

and the Nfa1 protein were knockdowned about 50% and 30%, respectively. However,

by antisense RNA transcribed in vitro, the expression of nfa1 gene and the Nfa1

protein were less knockdowned than those of dsRNA of nfa1 gene. Four synthetic

siRNAs were not act equally, but a sinfa1-1 was highly effective to knockdown the

nfa1 gene and Nfa1 protein with 70% and 43%, respectively. However, N. fowleri

trophozoites transfected with synthetic dsRNA or sinfa1-1 did not highly induce in

ii

vitro cytotoxicity against murine macrophages as compared with normal N. fowleri

trophozoites. Therefore, a vector-based system, in which transfected genes can be

maintain longer, was used to transfect the nfa1 gene into N. fowleri. A pAct/SAGAH

vector with a sinfa1-1 and a pAct/asnfa1AGAH vector with an asRNA of the nfa1

gene ORF were cloned, and then transfected into N. fowleri. By the pAct/SAGAH

vector, the expression of nfa1 gene and the Nfa1 protein were knockdowned as 60%

and 29%, in comparison with the pAct/asnfa1AGAH vector of 30% in the nfa1 gene

and 18% in Nfa1 protein. In particular, the in vitro cytotoxicity of N. fowleri

transfected with a pAct/SAGAH vector against macrophages was decreased to 26.6%

at 17 h and 26.8% at 24 h post co-incubation, whereas the in vitro cytotoxicity was

decreased to 7.4% at 17 h and 6.6% at 24 h by a pAct/asnfa1AGAH vector. These

results suggest that the function of RNAi should be worked in N. fowleri trophozoites.

Therefore, single stranded RNA, dsRNA, siRNA, and siRNA-vector were not only

efficiently transfected into N. fowleri using each transfection reagent, but also

decreased the function of Nfa1 protein which plays very important role in destroying

macrophages. This result may be helpful for understanding the function of Nfa1

protein as a target cell-cantact mechanism in the N. fowleri infection.

____________________________________________________________________

Key Words: N. fowleri, PAME, nfa1 gene, RNAi, cytotoxicity

iii

TABLE OF CONTENTS

ABSTRACT ------------------------------------------------------------------------------ i

TABLE OF CONTENTS --------------------------------------------------------------- iii

LIST OF FIGURES ---------------------------------------------------------------------- v

LIST OF TABLES ----------------------------------------------------------------------- vii

I. INTRODUCTION ---------------------------------------------------------------------- 1

A. Free-living amoeba Naegleria fowleri ---------------------------------------- 1

B. Life cycles and occurrence of PAME by N. fowleri ------------------------- 2

C. Pathogenic factors related to PAME by N. fowleri -------------------------- 5

D. The nfa1 gene --------------------------------------------------------------------- 6

E. Antisense RNA regulation and RNA interference --------------------------- 7

1. Antisense RNA regulation ---------------------------------------------------- 7

1-1. Antisense RNA regulated system in eukaryotes --------------------- 8

2. RNA interference -------------------------------------------------------------- 9

2-1. Mechanism of RNAi --------------------------------------------------- 11

2-2. Delivery, practical aspects and problems of RNAi -------------------- 13

F. Subjects in this study ----------------------------------------------------------- 15

II. MATERIALS AND METHODS ------------------------------------------------- 16

A. Cultivation of N. fowleri trophozoites and murine macrophages -------- 16

B. Total RNA preparation and RT-PCR ----------------------------------------- 16

C. Synthesis of antisense- and sense-directed RNA of nfa1 gene ORF,

and siRNAs of the nfa1 gene ------------------------------------------------ 17

iv

D. Southern blot hybridization --------------------------------------------------- 19

E. Transfection of asnfa1, dsnfa1 and siRNAs into N. fowleri -------------- 20

F. Northern blot hybridization and quantitation of RNA --------------------- 20

G. Cell lysate preparation and immunoblots ----------------------------------- 21

H. Vector construction of sinfa1-1 and asnfa1 -------------------------------- 22

I. Transfection of pAct/sinfa1-1AGAH and pAct/asnfa1AGAH vector

into N. fowleri trophozoites and hygromycin selection -------------------- 24

J. Indirect immunofluorescence antibody test --------------------------------- 26

K. In vitro cytotoxicity ------------------------------------------------------------ 27

III. RESULTS --------------------------------------------------------------------------- 28

A. In vitro synthesis of ssnfa1, asnfa1 and dsnfa1 ----------------------------- 28

B. Knockdown of the nfa1 mRNA and Nfa1 protein by asnfa1 or dsnfa1 -- 31

C. Knockdown of the nfa1 mRNA and Nfa1 protein by synthetic siRNAs -- 35

D. RNAi function by a vector-based system ------------------------------------ 40

E. Expression of an Nfa1 protein in N. fowleri transfected with

a RNAi vector ------------------------------------------------------------------ 45

F. In vitro cytotoxicity of N. fowleri transfected with a RNAi vector ------- 49

IV. DISCUSSION ---------------------------------------------------------------------- 51

V. CONCLUSION ---------------------------------------------------------------------- 60

REFERENCES --------------------------------------------------------------------------- 62

국문요약 ------------------------------------------------------------------------------------------ 74

v

LIST OF FIGURES

Fig. 1. Life cycles of N. fowleri and PAME ------------------------------------------ 3

Fig. 2. Model for RNAi --------------------------------------------------------------- 11

Fig. 3. Schematic representation of an nfa1 gene in N. fowleri used to produce

sense (ss) and antisense (as) RNA followed by dsRNA formation

in vitro --------------------------------------------------------------------------- 29

Fig. 4. Findings of dsnfa1 synthesis and Southern blotting ---------------------- 30

Fig. 5. Northern blotting and quantitative analysis of the nfa1 gene mRNA

from N. fowleri trophozoites transfected with an asnfa1 or dsnfa1 ----- 33

Fig. 6. Western blotting and quantitative analysis of the Nfa1 protein

from N. fowleri trophozoites transfected with an asnfa1 or dsnfa1 ----- 34

Fig. 7. GFP fluorescence in N. fowleri transfected with GFP-conjugated

with siRNA of Lamin A/C gene -------------------------------------------- 36

Fig. 8. Northern blotting and quantitative analysis of the nfa1 gene mRNA

from N. fowleri trophozoites transfected with the siRNAs

of an nfa1 gene ----------------------------------------------------------------- 38

Fig. 9. Western blotting and quantitative analysis of the Nfa1 protein from

N. fowleri trophozoites transfected with the siRNAs of an nfa1 gene -- 39

Fig. 10. Vector construction for RNAi in N. fowleri --------------------------------- 41

Fig. 11. Feasibility of transfection reagents for transfection into N. fowleri

and gene transcription by reverse transcription-PCR --------------------- 43

vi

Fig. 12. Northern blotting and quantitative analysis of the nfa1 gene mRNA

from N. fowleri trophozoites transfected with the RNAi vector --------- 44

Fig. 13. Western blotting and quantitative analysis of the Nfa1 protein

from N. fowleri trophozoites transfected with the RNAi ----------------- 46

Fig. 14. The fluorescence of the Nfa1 protein by immunocytochemistry -------- 48

vii

LIST OF TABLES

Table 1. In vitro cytotoxicity of N. fowleri against murine macrophages -------- 50

1

I. INTRODUCTION

A. Free-living amoeba Naegleria fowleri

Naegleria fowleri is the causal agent of primary amoebic meningoencephalitis

(PAME) which is fulminant and rapidly fatal disease that affects mainly children and

young adults (Carter, 1970). Naegleria spp. are amoeboflagellates found in soil and

water, but they are not as ubiquitous as Acanthamoeba, by which granulomatous

amoebic encephalitis (GAE) is occurred as a subacute or chronic disease with focal

granulomatous lesions in the brain. In a swimming pool that had been identified as

the source of an outbreak of 16 PAME cases, N. fowleri and other thermophilic

Naegleria spp. were found to proliferate in a cavity behind a damaged wall of the

pool (Kadlec et al., 1980). Although 30 species of Naegleria have been recognized

based upon sequencing data (De Jonckheere, 2004), N. fowleri is the only one that

has been isolated from cases of PAME. Other species (N. australiensis, N. italica, N.

pilippinensis) may be pathogenic in the mouse model of PAME, but have not been

identified from any human cases. Because, it grows at somewhat elevated

temperature, the amoeba has been isolated from warm-water bodies including man-

made lakes and ponds, hot spring, and thermally polluted streams and rivers. But

thermotolerance is not the sole factor determining pathogenicity of Naegleria spp.

but is non-pathogenic in the mouse model for PAME (De Jonckheere et al., 1977,

2

Stevens et al., 1980)

B. Life cycles and occurrence of PAME by N. fowleri

The Naegleria life cycle includes amoeboid and cystic stages, as well as a

flagellate stage which develops from the amoeba (Fig. 1). The trophic amoeba has

distinctive limacine (slug-like) pattern of locomotion, with one or more ectoplasmic

psuedopods. When the amoeba undergoes a morphogenetic transformation (over

30−60 min) and triggered by suspension in water, trophozoites are changed into a

transitory non-feeding and non-dividing flagellate stage. The cyst stage has a double

wall with pores. All Naegleria spp. are morphologically similar, if not identical to

one another, although some differences among species may be found, as in cyst pore

structure (Pussard and Pons, 1979). In nature and in the laboratory, the amoeba feeds

actively on bacteria. Isolations of N. fowleri from environmental soil or water

samples are accomplished by growth on nutrient agar plates coated with Escherichia

coli at 45℃ (Lares-Villa et al., 1993). Other bacteria (preferably non-mucoid strains),

such as Enterobacter aerogenes or Klebsiella pneumoniae, may also be used. PAME

is a fulminating disease, developing within several days following exposure to the

water source, and causing death within 1−2 weeks after hospitalization (Fig. 1).

3

Fig. 1. Life cycles of N. fowleri and PAME. The distinctive feature of N. fowleri

trophozoite is the presence of multiple finger-like projections, pseudopodia.

Trophozoite or flagellate form can infect human and experimental mouse via

olfactory bulb, resulting in PAME.

Olfactory nerveEpithelium

Brain

PAME

Trophozoite

Flagellate

CystTrophozoite

Pseudopodium

4

Because of the rapid onset of the infection and the delay in diagnosis, few

individuals survive. Infection results from introduction of water containing amoebae

into the nasal cavity and subsequent passage of the organisms to the central nervous

system (CNS) via the olfactory apparatus (Carter, 1968, 1970, 1972). Acute

hemorrhagic necrotizing meningoencephalitis follows invasion of the CNS. Only

amoebic trophozoites are found in the lesions of patients with PAME (Fig. 1). PAME

is characterized by the sudden onset of bifrontal or bitemporal headache, fever (from

38.2℃ to >40℃), nausea, vomiting (usually projectile), signs of meningeal irritation,

and encephalitis. There is often a rapid progression from fever and early signs of

leptomeningitis, encephalitis, or meningoencephalitis to coma and seizures. Nausea,

vomiting, photophobia, and other symptoms related to increase intracranial pressure

may also be prominent. The final diagnosis of PAME is based on the isolation and

culture of free-living amoebae from cerebrospinal fluid (CSF) or the demonstration

of amoebic trophozoites in biopsied brain tissue. Clinical diagnosis by experienced

practitioners is based on the characteristic stromal infiltrate. Antibodies may be

detected in serum; however, serologic tests usually are of no value in the diagnosis of

infections with free-living amoebae (John, 1982). Amphotercin B reportedly cured

one case of PAME (Ma et al., 1990). High morbidity and mortality may be reduced

with rapid diagnosis and earlier treatment. A drawback in the use of Amphotericin B

is its potential for impairment of kidney function. This has stimulated testing of other

less toxic forms of the drug for use in treatment. Amphotericin B methyl ester is one

of the less damaging forms of the compound, but it is less effective in treatment in

5

the mouse model of PAME (Ferrante, 1982). Other antimicrobials that have been

tested, mostly in vitro, are clotrimazole, itraconazole, fluconazole, and ketoconazole,

with varying degrees of efficacy. Differences in reported drug sensitivity are due to

the use of different N. fowleri strains in different laboratories, which show variation

to drugs. Amphotericin B, however, remains the drug of choice for PAME treatment.

C. Pathogenic factors related to PAME by N. fowleri

It is still unclear that the molecular mechanisms of invasion and pathogenesis of

PAME by N. fowleri are still unclear. The pathogenicity would be a complex process

which involves both contact-dependent and contact-independent pathways in order to

kill host cells quickly and to reduce the degree to which defense can be induced.

However, in general, adhesion is one of the crucial steps for the pathogenicity of

amoeba as non-pathogenic amoeba exhibit significant decreased binding to host cells

(Yang et al., 1997). The ability of N. fowleri to produce such a rapidly fatal infection

has encouraged to search for virulence properties of the amoeba that might serve as

virulence factors are the release of the enzymes phopholipase (Cursons et al., 1978),

or neuraminidase (Eisen and Franson, 1987), the secretion of cystein proteinase

(Aldape et al., 1994), the creation of pores in target cell membranes that may have a

lytic effect (Young and Lowrey, 1989; Herbst et al., 2002) and aggressive

phagocytotic activity (Brown, 1979). The amoeboid stage forms food cups

(amoebostomes) that are capable of pinching off bits of target cell cytoplasm (Brown,

6

1979; John et al., 1985, Kang et al., 2005). In particular, as related with contact-

dependent cell killing by N. fowleri, a few genes have been cloned and characterized

in our previous studies (Cho et al., 2003; Shin et al., 2001).

D. The nfa1 gene of N. fowleri

An antigen-related gene was cloned from cDNA expression library of N. fowleri

by immunoscreening with sera obtained from mice that were either immunized with

an amoebic lysate or infected with trophozoites. The coding sequence of the cloned

gene consisted of 357 bases that were translated into 119 amino acids. This gene was

designated as nfa1 gene (N. fowleri antigen 1). The amino acid sequence of Nfa1

protein shares 43% identity, especially 100% in conserved regions and iron-binding

residues, with the myohemerythrin protein of a marine annelid, Nereis diversicolor

(Takagi et al., 1991; Shin et al., 2001). In our previous study, the Nfa1 protein was

observed to localize specifically in pseudopodia using an anti-Nfa1 polyclonal

antibody by a transmission electron microscopy (Shin et al., 2001). More recently,

when N. fowleri trophozoites were cultured with CHO target cells, the Nfa1 protein

was observed to localize in food-cups of phagocytic organelles (Kang et al., 2005).

Anti-Nfa1 monoclonal antibodies were also produced using hybridoma (unpublished

yet). When an anti-Nfa1 monoclonal antibody was used to observe the location of the

Nfa1 protein in N. fowleri trophzoites, the Nfa1 protein was localized in pseudopodia.

Because the location of the Nfa1 protein by the anti-Nfa1 polyclonal antibody was

7

identical with that by the anti-Nfa1 monoclonal antibody, and the Nfa1 protein was

not detected in Acanthameobae by the anti-Nfa1 polyclonal antibody (Cho et al.,

2003), it was suggested that the anti-Nfa1 polyclonal antibody be a mono-specific

antibody. N. fowleri trophozoites showed the cytopathic effect on CHO target cells in

a co-culture systemd. Otherwise, CHO cells co-cultured with N. fowleri trophozoites

and an anti-Nfa1 antibody showed less destruction in a dose-dependent manner

(Jeong et al., 2004). When the nfa1 gene from N. fowleri was tranfected into non-

pathogenic N. gruberi, the in vitro cytotoxicity of N. gruberi was slightly increased

(Jeong et al., 2005).

E. Antisense RNA regulation and RNA interference

1. Antisense RNA regulation

The first natural antisense RNAs were discovered in 1981 independently in

Tomizawas and in Nordströms laboratories. These authors found that small plasmid-

encoded RNA regulators control the copy numbers of the E. coli plasmids ColE1 and

R1, respectively (Stougaard et al., 1981; Tomizawas et al., 1981). Antisense RNAs

are small, diffusible, highly structured RNAs that act via sequence complementarity

on target RNAs called sense RNAs. In eukaryotes, some processes like splicing or

editing make use also of complementary small RNAs; however, these RNAs are not

independent regulators, and therefore not regarded as bona fide antisense RNAs. In

8

the classical case, antisense RNAs are encoded in cis, i.e. they are transcribed from a

promoter located on the opposite strand of the same DNA molecule, and therefore

fully complementary to their target RNAs. However, over the past years, a number of

antisense RNAs were detected that are encoded in trans, reveal only partial

complementarity to their target RNA and have more than one target. The sense RNAs

are mostly mRNAs encoding proteins of important/essential functions. In the

majority of cases, antisense-RNA action entails posttranscriptional inhibition of

target RNA function. However, a few activating antisense RNAs have been found,

too. Some antisense RNAs (those involved in plasmid copy number control and

postsegregational killing) are unstable, others (most chromosomally encoded and a

few phage and transposon antisense RNAs) are stable.

1-1. Antisense RNA regulated system in eukaryotes

Eukaryotic antisense RNAs have been found only accidentally, and in most cases,

their regulatory roles and the mechanism of action are still elusive. They seem to act

preferentially via destabilization of the sense RNAs, but inhibition of splicing or

translation has been suggested, too. Destabilization has been attributed to targeting of

the antisense/sense-RNA duplex to dsRNase. Three cases are well studied. Antisense-

RNA-mediated mRNA destabilization occurs mostly in the cytoplasm (Hildebrandt

and Nellen, 1992). In mammalian cells, the stability of the eIF2α-mRNA is regulated

by a differentially expressed antisense transcript originating from a promoter located

9

in the first intron of the eIF2α gene. In plants, no naturally occurring antisense RNAs

have been found so far. However, artificially introduced antisense transcripts are

believed to target mRNA for degradation. Short antisense RNAs can be also

generated by RNA-dependent RNA polymerase (RdRp) from aberrant sense RNAs.

In addition to RNA interference (RNAi), such RNAs can mediate methylation of

homologous DNA sequences in the plant genome, thus silencing gene expression, a

pathway which might be used by natural RNA regulators as well (Bender 2001;

Matzke et al., 2001). Recently, a large number of small RNAs with probable

regulatory functions have been discovered in Caenorhabditis elegans (Lau et al.,

2001; Lee and Ambros, 2001). The expression of some of these microRNAs

(miRNAs) varies during larval development, and the potential orthologs of several of

these miRNA genes were identified in Drosophila and human genomes. These

findings indicate that small regulatory RNAs may be ubiquitous in eukaryotes, too.

2. RNA interference

RNA interference (RNAi) is the induction of sequence-specific gene silencing by

double-stranded RNA (dsRNA) (Fig. 2). It occurs posttranscriptionally and involves

mRNA degradation. The term RNAi was coined after the discovery that the injection

of double-stranded RNA (dsRNA) into C. elegans interferes with the expression of

specific genes highly homologous in sequence to the delivered dsRNA (Fire et al.,

1998).

10

RNAi is related to the "posttranscriptional gene silencing" (PTGS) or

"cosuppression" phenomena observed in plants (Baulcombe, 1999; Vaucheret et al.,

2000; Waterhouse et al., 1999) and "quelling" (silencing of an endogenous gene by

the introduction of a transgenic copy of the gene) observed in Neurospora (Cogoni

and Maciano, 1999, 1999). RNAi is a powerful tool that makes gene inactivation

possible in organisms that were not amenable to genetic analysis before. In nature,

RNAi may both play an important biological role in protecting the genome against

instabilities caused by transposons and repetitive sequences (Ketting et al., 1999;

Tabara et al., 1999) and be an ancient antiviral response/protection mechanism in

both animals and plants (Baulcombe, 1999, Grant, 1999; Ratcliff et al., 1999).

2-1. Mechanism of RNAi

Biochemical analysis of RNAi became possible with the development of an in

vitro Drosophila embryo lysate system for dsRNA-dependent gene silencing (Tuschl

et al., 1999). A key finding was that small (21–23 nucleotides) dsRNAs called short

interfering RNAs (siRNAs) are generated from the input dsRNA during PTGS and

RNAi (Hammond et al., 2001). These small RNAs have been detected in plants,

Drosophila and C. elegans and have been suggested to serve as guide RNAs for

target recognition. In Drosophila extracts, these siRNAs with their 3′-OH and 5′-

phosphate termini resemble breakdown products of an RNase III-like enzyme, e.g.,

11

Fig. 2. Model for RNAi. Antisense RNA strands are drawn in thin black, sense RNA

strands in thick black. Sense target RNA is shown in spotted lines, antisense target

RNA in short thin line. The dsRNA processing proteins containing an RNA binding

domain and a dsRNA-specific endonuclease domain are illustrated as grey-colored

small and big ovals. The protein domain of small oval binds in the 5′–3′ direction, the

protein domain of big oval in the 3′–5′ direction. Only the siRNA associated with the

domain of big oval is able to guide target RNA cleavage. The RNA-induced silencing

complex (RISC) is shown as large oval. A conformational change is proposed to

occur in the RISC before target RNA cleavage because the cleavage site of the target

RNA is displaced by 10–12 nt relative to the dsRNA processing site. The cleaved

target RNA is directed into the processing pathway where it will be sequentially

degraded. This figure was based on Elbashir et al (2001).

PPPP

PPPP

DicerPPPP

PPPPRISC

PPPP

AnAnAnAn

PPPP

AnAnAnAn

PrimerDependent

RdRP?

dsRNA

Activated RISC

RNA synthesis

RNA degradation

siRNA

Exogenous dsRNA

Viral dsRNA

12

Dicer, digestion (Elbashir et al., 2001). Synthetic siRNAs can also induce gene-

specific inhibition of expression in Drosophila extracts (Tuschl et al., 1999), in insect

and mammalian cell lines (Elbashir et al., 2001; Caplen et al., 2001) and in C.

elegans indicating that the dsRNA-processing step and the targeting step can be

uncoupled. In each case, the interference was superior to the inhibition mediated by

single-stranded antisense oligonucleotides (Bass, 2000). A model tries to explain why

the double-stranded trigger RNA is cleaved into small fragments. Cleavage to

segments of 21–23 nt might provide optimal specificity for a homology-based

searching mechanism. Much shorter segments would leave insufficient specificity,

while much longer segments might allow unwanted attacks on cellular genes with

partial but extended identity to the trigger.

The following model for dsRNA-directed mRNA cleavage is proposed (based on

(Bass, 2000; Berstein et al., 2001; Elbashir et al., 2001). The dsRNA is cleaved to

21–23-nt-long fragments by Dicer or a Dicer homologue. Processing starts from the

ends of the blunt-ended dsRNA or dsRNAs with short 3′ overhangs and proceeds in

21–23-nt steps. The resulting fragments (siRNAs) are bound by RNAi-specific

enzymes possibly still including Dicer and could be incorporated into a distinct

nuclease complex (RNA-induced silencing complex; RISC) that targets mRNA for

degradation. In this complex, they pair with the target mRNA and cleave the mRNA

in the center of the region recognized by the siRNA whereby the mRNA cleavage

boundaries are determined by the sequence of the dsRNA. Either the same RNase

that cleaves the dsRNA or another RNase that has to be recruited cleaves the target

13

RNA, probably by temporarily displacing the passive siRNA strand not used for

target recognition. The dsRNA-processing proteins or a subset of them remains

associated with the siRNA duplex after the processing reaction. The orientation of

the siRNA duplex relative to these proteins determines which of the two

complementary strands functions in guiding target RNA degradation. Chemically

synthesized siRNA duplexes guide cleavage of sense as well as antisense target RNA,

as they are able to associate with protein components in either possible orientation.

Adenosine triphosphate (ATP) may be required for complex formation on the dsRNA,

strand dissociation during or after dsRNA cleavage, pairing of the 21–23-nt RNAs

with the target mRNA, mRNA cleavage and recycling of the targeting complex.

Therefore, an RNA-dependent ATPase, or RNA helicase, is probably associated with

the RISC.

2-2. Delivery, practical aspects and problems of RNAi

For dsRNA delivery, several methods can be applied. Electroporation is used in

simpler organisms, whereas microinjection of dsRNA into germ line or early embryo

is the method of choice in multicellular organisms. In C. elegans, injection into the

intestine or pseudocoelom is almost as efficient as injection into the germ line. Even

feeding worms with bacteria that express dsRNA, or soaking worms in dsRNA

solutions has been applied with success (Tabara et al., 1998; Tabara et al., 1999;

Timmons and Fire, 1998). Because RNAi is homology-dependent, single base pair

14

mismatches between siRNA and target RNA dramatically reduce silencing. The

length of the dsRNA can affect the RNAi efficiency (Bosher et al., 1999). Usually,

dsRNA of at least 500 bp is applied but recently it has been found that perfectly

matching duplexes as short as 21 bp suffice (Caplen et al., 2001; Parrish et al., 2000).

When dsRNA is injected into early embryos, it is diluted upon cell division.

Therefore, early genes are more easily inactivated than late genes, which is

especially a problem for higher organisms (in mouse, a construct was effective only

until a 40–50-fold increase in cell mass) (Wianny and Zernicka-Goetz, 2000). In C.

elegans, the application of a plasmid with inducible (by heat-shock) promoter for the

production of dsRNA (sense RNA and antisense RNA expressed in the form of a

hairpin) made inheritable RNAi possible (Tavernarakis et al., 2000). With this

approach inheritable transgenes are easily generated, large numbers of mutant

organisms can be propagated delivering enough material for a broad variety of

analyses and stage-specific RNAi can be performed. Furthermore, neurons, normally

partially resistant to exogenous supply of dsRNA, became RNAi sensitive upon

plasmid-derived in vivo supply of dsRNA (Clemens, 1997). The expression of

dsRNA under the control of tissue-specific promoters instead of inducible ones is

also conceivable.

Although experiments to elucidate the underlying mechanism progress rapidly,

we are still at the beginning of our understanding of the molecular processes

responsible for RNAi and the breadth of its function in biology. In contrast, practical

applications have already allowed rapid surveys of gene functions (Fraser et al.,

15

2000) and will possibly result in new therapeutical interventions.

F. Subjects in this study

A great advance in studying the function of genes and biology of free-living

ameobae has been the use of transfection technology. In Acanthamoeba, the transient

and stable transfection system had been established (Hu and Henney, 1997; Yin and

Henney, 1997; Peng et al., 2005). Transfection of the pEGFP–C2 vector with an nfa1

gene into nonpathogenic N. gruberi has been tried in our previous study, and

transgenic N. gruberi has been maintained for nine months after the treatment of

G418 antibiotics as a selective marker (Jeong et al., 2005).

In this study, to observe the gene-knockdown of the Nfa1 protein in N. fowleri,

antisense RNA and siRNA of the nfa1 gene were constructed, cloned in a

transfection vector and transfected into trophozoites of N. fowleri. In addition, to

describe the association of Nfa1 protein with the in vitro cytotoxicity of N. fowleri to

a target cell, N. fowleri tracfected with vectors including an antisense RNA or siRNA

of the nfa1 gene was co-cultured with murine macrophages.

16

II. MATERIALS AND METHODS

A. Cultivation of N. fowleri trophozoites and murine macrophages

Trophozoites of N. fowleri (Carter NF69 strain, ATCC No. 30215) were cultured

under axenic conditions in Nelson’s medium (Willaert, 1971). Trophozoites of N.

fowleri in log phase of growth were used in all experiments. N. fowleri was tested

before use for its ability to produce PAME in experimental mouse and for its

cytopathic activity on CHO target cells (Jeong et al., 2004). Murine macrophages

(ATCC No. TIB-71) were cultured with Dulbecco’s Minimal Essential Medium

(DMEM, GibcoBRL) containing 10% fetal bovine serum (FBS, GibcoBRL)

(complete DMEM) at 37 in 5% CO℃ 2 incubator (Ralph et al., 1977).

B. Total RNA preparation and RT-PCR

Total RNA was prepared using an isolation kit RNAzol B (TEL-TEST,

Fiendswood, TX, USA) solution. After 500 µl of RNAzol B solution was mixed with

pellet of 1 × 105 N. fowleri trophozoites by pipetting, 10 µl of chloroform was added

to the mixture. It was incubated on ice for 5 min and centrifuged at 10,000 × g for 15

min at 4℃. The supernatant was transferred to a new 1.5 ml tube and reacted with

250 µl of isoamylalcohol. Incubated for 15 min at 4℃, it was centrifuged at 10,000 ×

17

g for 15 min at 4℃. The pellet was washed with 1 ml of 70% ice-cold ethanol once

and dried at room temperature (RT). The total RNA was suspended with 10 µl of

diethylpyrocarbonate (DEPC)-treated distilled water (DW) and stored at -70℃. RNA

yield and quality were evaluated spectrophotometrically and by analytical gel

electrophoresis according to Sagerström and Sive (1996). For reverse transcription-

polymerase chain reaction (RT-PCR), we used a Superscript First Strand Synthesis

System kit (Invitrogen) to generate cDNA from 5 µg of total RNA pretreated with 1

µg of DNase I (Sigma). Reverse transcription was performed according to the

manufacturer’s recommendations for first-strand synthesis using gene-specific

primers. PCR fragments were amplified from cDNA by using Taq polymerase

(Promega) and 32 cycles of 95℃ for 30 s, 55℃ for 1 min, and 72℃ for 1 min.

C. Synthesis of antisense and sense-directed RNA of nfa1 gene ORF, and siRNAs

of the nfa1 gene

To transcript antisense-directed RNA of an nfa1 gene open reading frame (ORF)

(asnfa1), the nfa1 gene was cloned into pGEM−4Z vector (Promega) containing T7

promoter behind multicloning sites (MCS) using the method of a cohesive ligation to

construct a pGEM−4Z/asnfa1 vector. The pGEM−4Z/asnfa1 vector was digested

with the restriction enzyme of Eco RI for 2 h and transcribed in vitro. Briefly,

approximately 500 ng of prepared DNA was added to the transcription mixture

containing 10 µl of 10 mM NTP mix (2.5 mM ATP, 2.5 mM CTP, 2.5 mM UTP, 2.5

18

mM GTP; Invitrogen), 2.5 µl of 10 mM DTT, 2.5 µl of 10× buffer, 40 U of RNase

inhibitor (Invitrogen) and 30 U of T7 RNA polymerase (Promega). The mixture was

incubated at 37℃ for 1 h and the reaction was stopped by phenol/chloroform

extraction. The transcripts were precipitated using 3 M sodium acetate and dissolved

in DEPC-treated water. For sense-directed RNA of an nfa1 gene ORF (ssnfa1), the

nfa1 gene was first cloned into pGEM−3Zf(+) vector (Promega) containing T7

promoter at the front of MCS using the method of a cohesive ligation to construct a

pGEM−3Zf(+)/ssnfa1 vector. The pGEM−3Zf(+)/ssnfa1 vector was digested with the

enzyme of Hind III and the sense-directed nfa1 gene was transcribed using T7

polymerase. The transcript was precipitated with 3 M sodium acetate mentioned

above. To make double stranded RNA of nfa1 gene ORF (dsnfa1), equal amounts of

ssnfa1 and asnfa1 were mixed, heated to 65 and annealed by slow cooling (65 , ℃ ℃

55 ,45 , 35 and 25 for respective 30 min) for 2 h 30 min.℃ ℃ ℃ ℃ Individual RNAs

and double stranded RNA were analyzed on 1% agarose gel. The four short double-

stranded nfa1 gene, four synthetic siRNAs; sinfa1-1, correspondence of nucleotides

340–360 of the nfa1 gene ORF (Genebank Accession No. AF230370), 5’-

r(AAGTACAAGGGAGTGCTTTAA)d(TT); sinfa1-2, correspondence of nucleotides

82–102 of the nfa1 gene ORF, 5’-r(AAGCTCTTTGCTCTCATCAAT)d(TT); sinfa1-

3, correspondence of nucleotides 252–272 of the nfa1 gene ORF, 5’-

r(AAGATGCTTTGGGTTTGAAG)d(TT); sinfa1-4, correspondence of nucleotides

196–216 of the nfa1 gene ORF, 5’-r(AAGGTGAATTTCTCTGATTCT)d(TT),

were synthesized (Qiagen) and resuspended in siRNA suspension buffer as supplied

19

by the manufacturer to final concentration of 20 µM solution. After the solution of

siRNA was heated to 90 for 1 mi℃ n and then incubated at 37 for 1 h, it was stored ℃

frozen at -20 prior to transfection.℃

D. Southern blot hybridization

To identify ssnfa1 or asnfa1 made by in vitro transcription, southern blot

hybridization was performed. Samples loaded on agarose gel were prepared by PCR.

For DNA of an nfa1 gene from pGEM–3Zf(+)/ssnfa1 vector, primers (5’-

ATGGCCACTACTATTCCATCA-3’ and 5’-TTAAAGCACTCCCTTGTACTT-3’)

were used. In our previous study, for DNA sequence unrelated with the nfa1 gene

cloned into pEGFP−C2 vector (Clontech), primers (5’-ACAACATCGAGGACGGC-

AGCGTGCAGCTCG-3’ and 5’-GTTTGGACAAACCACAACTAGAATGCAGTG-

3’) were used (Jeong et al., 2004). After electrophoresis, the gels were subjected to

short wave UV irradiation for 2 min and the DNA was denatured in alkaline solution

(10 N NaOH, 5 M NaCl) for 45 min at RT, followed by neutralization for 45 min.

DNA was transferred to Hybond N+ membrane (Amersham) by dry blotting

overnight. The membrane was cross-linked using XL-1500 UV Crosslinker

(Spectrolinker Co.). For probe preparation, RNA probe labeled with α-32P-UTP was

produced by random priming of in vitro transcribed ssnfa1 or asnfa1. The probe was

hybridized overnight at 65 in hybridization buffer. The membrane was washed and ℃

then exposed to X-ray film (Kodak) for 2 days.

20

E. Transfection of asnfa1, dsnfa1 and siRNAs into N. fowleri trophozoites

To observe the effect of asnfa1, dsnfa1, and siRNAs of the nfa1 gene, each RNA

was transfected into N. fowleri according to the procedure of an RNAi starter kit

(Qiagen). The day before transfection, 4 × 104 trophozoites were cultured in 24 well

cell culture plate (Nunc) in 0.5 ml of Nelson complete medium at 37℃. On the day

of transfection, 1 µg each RNA in Nelson medium was diluted to give a final volume

of 100 µl, and mixed by vortexing. For complex formation, 6 µl of RNAiFect reagent

(Qiagen) was added and mixed. And then the samples were incubated for 15 min at

RT to allow formation of transfection complexes. While complex formation was

taking place, Nelson medium was gently aspirated from the plate. After 300 µl of

fresh Nelson complete medium was added, the complexes were drop-wised onto the

N. fowleri trophozoites. To observe the transfection of siRNAs using RNAiFect

reagent, green fluorescent protein (GFP) fused siRNA directed against the human

lamin A/C gene, which was unrelated with the nfa1 gene, was used in parallel. The

transfection was observed under a fluorescent microscopy using standard FITC

exitation/emission filters (488 nm/507 nm).

F. Northern blot hybridization and quantitation of RNA

For northern blot hybridization, 10 µg of total RNA was heated to 65℃ for 10

21

min, and size fractionated under denaturing conditions on agarose gels containing

formaldehyde. The RNA was transferred to a Hybond N+ membrane (Amersham)

and hybridized under stringent conditions as described previously (Bracha et al.,

1995). The membrane was cross-linked using XL-1500 UV Crosslinker

(Spectrolinker). For an nfa1 gene-specific probe, the nfa1 gene was amplified with

primers of 5’-ATGGCCACTACTATTCCATCA-3’ and 5’-TTAAAGCACTCCCT-

TGTACTT-3’ and eluted. The probe randomly labeled with α-32P-dATP was prepared

from the appropriate PCR fragment. It was hybridized overnight at 65 in ℃

hybridization buffer. The membrane was washed and then exposed to imaging plate

for 2 days. After the bands on imaging plate were read by Image Reader (FLA-3000,

Fujifilm, Japan), they were quantified by a densitometer program of Image Guage

(LAS1000, Fujifilm, Japan).

G. Cell lysate preparation and immunoblots

Cultures (12 ml) of N. fowleri trophozoites were harvested and the cell pellets

were suspended with 200 µl of phosphate-buffered saline (PBS, pH 7.4; 137 mM

NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4). Pellets were solubilized by

freezing-thawing method (Im and Shin, 2003) to obtain a lysate. Protein content in

cell-free extracts was determined according to Bradford (Bradford, 1976) with

protein assay dye reagent and bovine serum albumin for standard curve calibration

(Ultrospec 3000, Pharmacia Biotech). The lysate was boiled in sodium dodecyl

22

sulfide (SDS) treatment buffer (125 mM Tris-HCl, 4% (w/v) SDS, 20% (v/v)

glycerol, 3.1% (w/v) dithiothreitol, 0.001% (w/v) bromophenol blue) for 5 min. The

lysate was resolved for 2 h at 100 V on 15% polyacrylamide gel (15 µg/lane) under

reducing conditions in a Mini-Protean II Cell (Bio-Rad) according to the method of

Laemmli (Laemmli et al., 1970). The lysate was transferred electrophoretically to

polyvinylidene difluoride (PVDF) membrane (Hybond-P; Amersham Biosciences)

with transfer buffer (25 mM Tris, 192 mM glycine, 20% (v/v) methanol; without

adjusting the pH, it should be around 8.0 − 8.2) at 250 mA for 1 h 30 min. After the

blot was incubated with 3% bovine serum albumin (BSA) in PBS, it was reacted with

a suspension of anti-Nfa1 polyclonal antibody (1:100) and then subjected to interact

with an horseradishperoxidase (HRP)-conjugated anti-mouse IgG (1:2,000)(Sigma)

and developed by enhanced chemiluminescence. Detection was done for only HRP

reaction by autoradiography. The amount was determined to quantify the Nfa1

protein expression by a densitometer (LAS1000, Fujifilm, Japan). The densities of

protein bands were divided by the corresponding densities recognized by the anti-

Nfa2 antibody to obtain a normalized protein ratio. The standard curve of proteins

was used to demonstrate that signals were in the linear range for quantitative

purposes.

H. Vector construction of sinfa1-1 and asnfa1

The vector of sinfa1-1 transfected to pathogenic N. fowleri was modified from a

23

RNAT−U6.1/Hygro (6.5 kb, Genscript) vector. The pRNAT−U6.1/Hygro vector was

designed for mammalian transfection. It carries a hygromycin resistance gene as the

selectable marker, GFP marker (coral GFP, cGFP) under cytomegalovirus (CMV)

promoter control used to track the transfection efficiency. It uses U6 promoter, which

is a kind of human polymerase III promoter to effectively transcribe short RNA. An

sinfa1-1 was cloned into the pRNAT−U6.1/Hygro vector to construct a

pRNAT−U6.1/sinfa1-1/Hygro vector by the manufacturer of Genscript company. In

our previous study, U6, CMV and simian virus (SV) 40 promoter transfected into N.

fowleri trophozoites did not transcribe siRNA, cGFP, and hygromycin resistance

gene, respectively. The fluorescence of GFP was not also observed in N. fowleri

transfected with a pRNAT−U6.1/Hygro vector (data not shown). It needs to change

other promoter functioning RNA transcription. Therefore, 5’ untranslated regions

(UTR) (kindly presented by Prof. Lee at Yonsei University) as a promoter of an actin

gene from nonpathogenic N. gruberi was used to transcribe genes mentioned above.

For cloning of 5’ UTR of an actin gene, three promoters of U6, CMV, and SV40

were excised from the vector using restriction enzymes. To clone final pAct/SAGAH

vector (Act and A, 5’ UTR of an actin gene; S, siRNA of an nfa1 gene; G, GFP; H,

hygromycin resistance gene) used to transfect into N. fowleri trophozoites, 5’ UTR of

an actin gene in pEGFP−N2 vector (Clontech) was amplified with primers containing

restriction enzymes sites as follows; for cloning of 5’ UTR of an actin gene in the

location of excised CMV, primer containing Hind III (5’-AGTCCTAAGCTTTTT-

CCTTTTTTAGAAGCC-3’) and primer containing Nhe I (5’-ACTAGGGCTA-

24

GCTTTGTTGAGTGTTTGAG-3’); for cloning of 5’ UTR of an actin gene in the

location of excised U6, primer containing Bgl II (5’-AGTCCTAGATCTTTTCCTT-

TTTTTAGAAGC-3’) and primer containing Bam HI (5’-ACTATTGGATCCT-

TTGTTGAGTGTTTGAG-3’); for cloning of 5’ UTR of an actin gene in the location

of excised SV 40, primer containing Avr II (5’-AGTCCTCCTAGGTTTCCTTTT-

TTAGAAGCC-3’) and primer containing Xma I (5’-ACTAGCCCGGGTT-

TGTTGAGTGTTTGAG-3’). Each amplified fragment was ligated into the

pRNAT−U6.1/Hygro vector excised with respective restriction enzymes to create

pAct/SAGAH vector. To also observe the effect of asnfa1 by a vector-based system,

an antisense DNA of the nfa1 gene was cloned into pAct/AGAH vector, in which an

sinfa1-1 was eliminated, to create pAct/asnfa1AGAH vector. After the PCR

fragment of antisense DNA of the nfa1 gene was amplified with the primers of 5’-

AAGTCCAAGCTTATGGCCACTACTATT-3’ containing Hind III site and 5’-

AAGTCCGGATCCTTAAAGCACTCCCTT-3’ containing Bam HI site, it was

ligated into pAct/AGAH vector to create a pAct/asnfa1AGAH vector. All cloned

vectors were sequenced with ABI Perkin Elmer 373A automated DNA sequencer

(Applied Biosystems, Foster city, CA).

I. Transfection of pAct/sinfa1-1AGAH and pAct/asnfa1AGAH vector into N.

fowleri trophozoites and hygromycin selection

The transfection of DNA vectors into pathogenic N. fowleri was performed using

25

SuperFect transfection reagent (Qiagen GmbH, Germany). As our previously data,

SuperFect reagent was successfully used in the nonpathogenic N. gruberi

transfection study (Jeong et al., 2005). The branches of the reagent radiate from a

central core and terminate at charged amino groups which can then interact with

negatively charged phosphate groups of nucleic acids (Tang et al., 1996). Briefly, the

day before transfection, 4 × 104 trophozoites were cultured in 24 well cell culture

plate (Nunc) in 0.5 ml of Nelson incomplete medium without penicillin and

streptomycin (Gibco BRL, Gaithersburg, MD) at 37 overnight. On the da℃ y of

transfection, 1 µg plasmid DNA in Nelson incomplete medium without antibiotics

was diluted to give a final volume of 60 µl, and mixed by vortexing. For complex

formation, 5 µl of SuperFect reagent was added and mixed. And then the samples

were incubated for 15 min at RT to allow formation of transfection complexes.

While complex formation was taking place, Nelson medium was gently aspirated

from the plate and N. fowleri trophozoites were washed once with 4 ml of 1 × PBS.

After 350 µl of fresh Nelson complete medium was added, the complexes were drop-

wised onto the N. fowleri trophozoites. The transfection was observed under a

fluorescent microscopy using standard FITC exitation/emission filters (488 nm/507

nm). For the selection of transfected N. fowleri trophozoites, hygromycin antibiotics

(100 µg/ml) (Gibco BRL, Gaithersburg, MD) was added to the 24 well plate 5 days

after transfection. The lethal dose of untransfected N. fowleri to hygromycin

antibiotics was determined that it was died after 1 week.

26

J. Indirect immunofluorescence antibody test

Immunocytochemistry was used to observe the knockdown of Nfa1 protein in N.

fowleri transfected with a pAct/SAGAH or pAct/asnfa1AGAH vector. N. fowleri

trophozoites were cultured on 24 well cell culture plate (Nunc A/S, Roskilde,

Denmark) overnight. After the culture medium was discarded, the trophozoites were

washed with 0.85% saline three times and were done with cold 0.85% saline at third

time. 200 µl of 10% formalin in 0.85% saline was added and the plate was incubated

at RT for 30 min. The trophozoites were washed with 0.85% saline three times,

added 200 µl of 1% NH4OH to render them permeable, and then incubated at RT for

5 min. The prefixed and permeablized trophozoites were incubated with an anti-Nfa1

polyclonal antibody (1:100 dilution containing 3% BSA) at RT overnight. After

several washes with PBS containing Tween 20 (PBST), the trophozoites were treated

with a tetramethyl rhodamine isocyanate (TRITC)-conjugated AffiniPure rabbit anti-

mouse immunoglobulin G secondary antibody (Jackson ImmunoResearch

Laboratories) (1:2,000 dilution with 3% BSA) at RT for 2 h and then washed with

PBST. Trophozoites were analyzed by fluorescence microscopy using standard FITC

excitation/emission filters (488 nm/507 nm).

K. In vitro cytotoxicity

Murine macrophages were used to observe the in vitro cytotoxicity of the amoeba.

27

This experiment, in 96 well cell culture plates, was performed using 5 × 104 murine

macrophages either alone or cocultured with (i) 5 × 104 trophozoites of N. fowleri,

(ii) 5 × 104 trophozoites of N. fowleri transfected with a pAct/AGAH vector as a

control vector, (iii) 5 × 104 trophozoites of N. fowleri transfected with a

pAct/SAGAH vector, (iv) 5 × 104 trophozoites of N. fowleri transfected with a

pAct/asnfa1AGAH vector, (v) 5 × 104 trophozoites of N. fowleri transfected with

only SuperFect reagent, (vi) 5 × 104 trophozoites of N. fowleri supplemented with

hygromycin antibiotics (100 µg/ml). The total volume per well was 200 µl of DMEM.

Murine macrophages and trophozoites were observed under an inverted microscope

at 24 h intervals. A lactate dehydrogenase (LDH) release assay was performed to

quantify in vitro cytotoxicity. For the LDH assay, 50 µl of reacted supernatant in

each well was transferred to a 96 well assay plate. After addition of 50 µl of

reconstituted assay buffer from a CytoTox96 Non-radioactive Cytotoxicity Assay kit

(Promega, Madison, WI), the plate was incubated for 30 min at RT, and then 50 µl of

stop solution was added. The reactants were read at 490 nm using an enzyme-linked

immunosorbent assay reader. The formula used to calculate the percent in vitro

cytotoxicity was as follows: (sample value − control value) × 100 /(total LDH release

− control value). Total LDH release was obtained from 50 ul of supernatant released

from 5 × 104 murine macrophages treated with lysis buffer for 1 h.

28

III. RESULTS

A. In vitro synthesis of ssnfa1, asnfa1 and dsnfa1

Prior to synthesize a dsnfa1 to knockdown an nfa1 gene and Nfa1 protein in N.

fowleri, ssnfa1 and asnfa1 were synthesized by PCR. An nfa1 gene ORF was cloned

into a pGEM−3Zf(+) and pGEM−4Z vector to create a pGEM−3Zf(+)/ssnfa1 and

pGEM−4Z/asnfa1 vector, respectively (Fig. 3). The transcription was driven by the

T7 promoter. After restriction enzymes digestion of Hind III for ssnfa1 and Eco RI

for asnfa1, the restricted fragment was transcribed in vitro using T7 RNA polymerase.

For dsnfa1, ssnfa1 and asnfa1 were equally mixed and annealed by slow-cooling

method (Malhotra et al., 2002). Individual RNAs and double stranded RNAs were

analyzed on 1% agarose gel (Fig. 4A). As the fragments were compared with each

other, the size of ssnfa1 and asnfa1 was a little higher than PCR product of the nfa1

gene ORF of 360 bp. According to Malhotra et al. (2002), the size of dsRNA and

dsDNA was almost double to ssRNA. The reason why size variation was occurred in

ssnfa1, asnfa1, and dsnfa1 seemed to be the structural differences of genes. Although

the size of synthetic dsnfa1 was not exactly double to single-stranded RNA, because

the size of PCR fragment of the nfa1 gene was similar with it of dsRNA, dsnfa1 was

successfully synthesized in the present study (Fig. 4A). Moreover, that ssnfa1 and

asnfa1 were well synthesized was confirmed by southern blotting of DNA-RNA

29

Fig. 3. Schematic representation of an nfa1 gene in N. fowleri used to produce

sense (ss) and antisense (as) RNA followed by dsRNA formation in vitro. To

prepare dsRNA, the nfa1 gene cloned into a pGEM–3Zf(+) and pGEM–4Z vector

was in vitro transcribed by T7 polymerase, and then ssRNA and asRNA were mixed,

incubated at 65℃, and cooled slowly to obtain their corresponding dsRNA.

SP6 promoternfa1 (360 bp)T7 promoter

EcoRI HindIII

Transcription start

pGEM-3Zf(+)/ssnfa1

T7 promoternfa1 (360 bp)SP6 promoterTranscription start

pGEM-4Z/asnfa1

30

Fig. 4. Findings of dsnfa1 synthesis and Southern blotting. (A) Agarose gel

electrophoresis of the nfa1 gene. To prepare dsnfa1, in vitro transcribed ssnfa1 and

asnfa1 were mixed with equal amounts, incubated at 65 and coole℃ d slowly. (B).

Schematic representation of the nfa1 gene of N. fowleri used to produce ssnfa1,

asnfa1 and dsnfa1 by in vitro transcription. M, 1kb+ DNA ladder; lane 1, PCR

product of nfa1 gene in pGEM–3Zf(+)/ssnfa1; lane 2, PCR product of nfa1 gene in

pGEM–4Z/asnfa1; lane 3, nfa1 ssnfa1; lane 4, asnfa1; lane 5, dsnfa1.

A

1.0

0.5

0.3

kb

B 1

asnfa1 probe

2 3 1 2 3

ssnfa1 probe

M 1 2 3 4 5

31

hybridization (Fig. 4B). DNA of nfa1 gene amplified from pGEM–3Zf(+)/nfa1

vector was detected with α-32P-UTP labeled ssnfa1 or asnfa1. But, a GFP gene in

pEGFP–C2 vector and a control of DW was not detected.

B. Knockdown of the nfa1 mRNA and Nfa1 protein by asnfa1 or dsnfa1

RNAi means post-transcriptional gene silencing and has been induced in most

organisms by microinjection. In this present study, a lipid formulation was used for

the transfection. Because there have not been reports showing the effect of

transfection reagents for RNAi in free-living amoebae, TransMessenger or RNAiFect

reagent was used for the transfection of single-stranded and dsRNA. As a northern

blot analysis, it was observed that an nfa1 mRNA was successfully knockdowned in

N. fowleri trophozoites transfected with dsnfa1 using RNAiFect reagent (Fig. 5A,

5B). Using TransMessenger reagent, no changes were observed in the level of the

nfa1 gene mRNA. In the principle, TransMessenger reagent is recommended in the

transfection of single-stranded RNA. Hybridizations of northern blotting with a

probe specific for the nfa1 gene revealed that in the transfection of asnfa1 using

TransMessenger reagent, no changes were observed in the level of the nfa1 gene

mRNA and also, in ssnfa1 and only RNAiFect reagent, the level of the nfa1 gene

mRNA was almost identical with it of untransfected N. fowleri. Therefore, it was

suggested that dsnfa1 should be very effective in knockdowning the nfa1 gene

mRNA. An nfa2 gene which used to normalize and show that RNAi was specific for

32

the nfa1 gene was not changed in the mRNA patterns (Fig. 5A). Therefore, it was

suggested that, although long dsRNA but not siRNA had the problem of non-

specificity, dsnfa1 could be specifically acted in N. fowleri. In Fig. 5B, it was shown

that there were not any problems in nfa1 gene-specific probe due to the stringent

experimental conditions. To more understand the level of knockdowned nfa1 gene

mRNA, a quantitative analysis was performed (Fig. 5C). The transfection of dsnfa1

using RNAiFect reagent had the highest effect about 60% on knockdowning the

mRNA gene. There were not the differences of dsnfa1 transfected using

TransMessenger reagent with asnfa1 transfected using RNAiFect reagent. When

asnfa1 was transfected using TransMessenger reagent, no change was also observed

in the nfa1 gene mRNA (data not shown).

As a western blot analysis, the Nfa1 protein was not decreased highly as the nfa1

gene mRNA (Fig. 6). It was observed that the Nfa1 protein was higher knockdowned

in N. fowleri trophozoites transfected with dsnfa1 than asRNA using RNAiFect or

dsnfa1 using TransMessenger reagent (Fig. 6A). Similar amounts of the Nfa1 protein

were detected in the controls and the patterns of the Nfa2 protein of 21 kDa were not

changed (Fig. 6A). Quantitative estimation of the level of the Nfa1 protein showed

higher decreasing effect about 30% in the N. fowleri transfected with dsnfa1 using

RNAiFect reagent (Fig. 6B). On contrast, there were few changes in the dsnfa1 using

TransMessenger or asnfa1 using RNAiFect reagent. These results indicate that

dsnfa1 using RNAiFect reagent is the most efficient for knockdowning the nfa1 and

Nfa1 protein

33

Fig. 5. Northern blotting and quantitative analysis of the nfa1 gene mRNA from

N. fowleri trophozoites transfected with an asnfa1 or dsnfa1. (A) Northern

blotting of the nfa1 or nfa2 gene mRNA with a gene-specific probe. 25 µg of the

mRNA samples were loaded. (B) Northern blotting of the nfa1 gene mRNA used as a

loading control. C. Quantitative analysis of fig. 5A. F, RNAiFect reagent; T,

TransMessenger reagent.

Probe

nfa1

nfa2

asnfa

1 (F)

ssnfa

1 (F)

dsnfa

1 (T)

dsnfa

1 (F)

F NoneA

B5 μμμμ

g10

μμμμg

15 μμμμ

g20

μμμμg25

μμμμg30

μμμμg35

μμμμg40

μμμμg

C

Probe

nfa1

99.895.4 98.7

50.4

100 100

Qua

ntity

of a

n N

fa1

prot

ein

(%)

20

40

60

80

100

ssnf

a1 (F

)as

nfa1

(F)

dsnf

a1 (T

)ds

nfa1

(F) F

Non

e

34

Fig. 6. Western blotting and quantitative analysis of the Nfa1 protein from N.

fowleri trophozoites transfected with an asnfa1 or dsnfa1. (A) Western blotting of

the Nfa1 or Nfa2 protein detected with a respective polyclonal antibody. 10 µg of the

N. fowleri lysate was loaded. (B) Quantitative analysis of fig. 5A. F, RNAiFect

reagent; T, TransMessenger reagent.

Probe

nfa1

nfa2

asnfa

1 (F)

ssnfa

1 (F)

dsnfa

1 (T)

dsnfa

1 (F)

F None

99.1 100 97.6

70.1

100 99.8

Qua

ntity

of a

n N

fa1

prot

ein

(%)

20

40

60

80

100

ssnf

a1 (F

)as

nfa1

(F)

dsnf

a1 (T

)ds

nfa1

(F) F

Non

e

A B

35

C. Knockdown of an nfa1 gene mRNA and Nfa1 protein by synthetic siRNAs

The transfection of siRNA into N. fowleri trophozoites was performed with

RNAiFect reagent. It is not easy to find the most functional siRNA of any genes.

Although a lot of siRNAs are chosen, they don’t act to knockdown equally. In other

words, in the present study, four siRNAs were randomly chosen as considerations of

siRNA choices. Because siRNA has very little nucleotide and it is difficult to observe

whether the transfection is done or not, we identified the transfection with the

fluorescence of GFP-conjugated siRNA of Lamin A/C gene from human, irrespective

of the nfa1 gene (Fig. 7). GFP fluorescence was observed 24 h after the transfection

into N. fowleri trophozoites with the GFP-conjugated siRNA of Lamin A/C as

compared with untransfected N. fowleri. GFP fluorescence was observed in the

cytoplasm of transfected N. fowleri. This result showed that siRNA could be

transfected using RNAiFect reagent. The fact of the decrease of the nfa1 gene and

Nfa1 protein by a dsnfa1 transfection using RNAiFect reagent supported that the

RNAi mechanism associated with siRNA not only exist in N. fowleri trophozoites but

also siRNA act to knockdown the nfa1 gene. Thus, we transfected each siRNA

(sinfa1-1, sinfa1-2, sinfa1-3 and sinfa1-4) using a RNAiFect reagent into N. fowleri

trophozoites. All siRNAs were composed of each 21 nucleotides. The expression of

the nfa1 gene mRNA in the siRNA transfectants was assessed by northern blot

analysis with a specific probe for the nfa1 gene ORF (Fig. 8).

36

Fig. 7. GFP fluorescence in N. fowleri transfected with GFP-conjugated with

siRNA of Lamin A/C gene. (A) and (C) under a light microscopy, and (B) and (D)

under a fluorescence microscopy were observed 24 h after the transfection. (D)

shows N. fowleri transfected with GFP-conjugated with siRNA of Lamin A/C

compared with untransfected N. fowleri of fig. 7D. × 400.

B

D

A

C

37

Although they didn’t show an identical effect, all siRNAs had an effect on

knockdowning nfa1 gene mRNA. In particular, the sinfa1-1 showed the highest

knockdown of the nfa1 gene mRNA by northern blotting (Fig. 8A). According to the

quantitative analysis, even the sinfa1-2 or sinfa1-4 showed the effect from 55 ~ 57%

and the sinfa1-1 did the effect about 70% (Fig. 8B). No change of the nfa2 gene

mRNA, which is not homologous with the nfa1 gene, was occurred by the

transfection of siRNAs of the nfa1 gene (Fig. 8A). Western blots with anti-Nfa1

polyclonal antibody showed the highest decreasing effect of the Nfa1 protein levels

by the sinfa1-1, in agreement with the northern blot data (Fig. 9). The Nfa1 protein

transfected with each siRNA was not knockdowned as the nfa1 gene mRNA (Fig.

9A). According to the quantitative analysis of fig. 9A, the knockdowned Nfa1 protein

was higher about 20% than the nfa1 protein (Fig. 9B). Even though it was done so,

the sinfa1-1 showed the highest decreasing effect with about 43%. In the sinfa1-4,

the nfa1 gene mRNA was knockdowned with about 45% but the Nfa1 protein with

7%, which was very different from the effect of other three siRNAs. The level of the

Nfa2 protein was not affected by the transfection of siRNAs of the nfa1 gene (Fig.

9A). These results supported the functional analysis in vitro. However, when we

observed the in vitro cytotoxicity of N. fowleri trophozoites knockdowned by the

dsnfa1 or sinfa1-1 against murine macrophages, we didn’t observe the significant

inhibition of the cytotoxicity of N. fowleri by the morphological analysis of murine

macrophages and LDH release assay (data not shown).

38

Fig. 8. Northern blotting and quantitative analysis of the nfa1 gene mRNA from

N. fowleri trophozoites transfected with the siRNAs of an nfa1 gene. (A)

Northern blotting of the nfa1 or nfa2 gene mRNA with a gene-specific probe. 25 µg

of the mRNA samples were loaded. (B) Quantitative analysis of fig. 5A. N. fowleri

trophzoites were transfected using RNAiFect reagent.

sinfa

1-1

sinfa

1-2

sinfa

1-3

sinfa

1-4

RNAiFec

t

None

Probe

nfa1

nfa2

30.8

53.244.6

55.4

100 100

Qua

ntity

of a

n N

fa1

prot

ein

(%)

20

40

60

80

100

sinfa

1-1

sinfa

1-2

sinfa

1-3

sinfa

1-4

RN

AiF

ect

Non

e

A B

39

Fig. 9. Western blotting and quantitative analysis of the Nfa1 protein from N.

fowleri trophozoites transfected with the siRNAs of an nfa1 gene. (A) Western

blotting of the Nfa1 or Nfa2 protein detected with a respective polyclonal antibody.

10 µg of the N. fowleri lysate was loaded. (B) Quantitative analysis of fig. 5A. N.

fowleri trophzoites were transfected using RNAiFect reagent.

sinfa

1-1

sinfa

1-2

sinfa

1-3

sinfa

1-4

F None

Probe

nfa1

nfa2 57.5

70.666.5

93.6100 99.3

Qua

ntity

of a

n N

fa1

prot

ein

(%)

20

40

60

80

100

sinf

a1-1

sinf

a1-2

sinfa

1-3

sinfa

1-4

RN

AiF

ect

Non

e

A B

40

This result supported the use of a long-lasting system such as a vector. Therefore, we

used the vector-based system with sinfa1-1 showing the highest decreasing effect of

the nfa1 gene mRNA and Nfa1 protein.

D. RNAi function by a vector-based system

DNA-vector based technology has a lot of advantages comparing to chemically

synthesized siRNA. It is more effective than synthetic siRNA for inhibition of gene

expression and very stable and easy to handle (Yu et al., 2002). It also allows

researcher to obtain a stable cell line, and observe long-term effects of RNAi. The

vector with selectable markers and active promoters is required to transfect. A

pRNAT−U6.1/Hygro vector was transfected into N. fowleri trophozoites using

SuperFect reagent, but the GFP fluorescence (data not shown) as well as GFP

transcript by reverse transcription-PCR were not observed. Also, when the nfa1 gene

mRNA level was examined by northern blotting, it was not knockdowned in N.

fowleri trophzoites transfected with the pRNAT−U6.1/Hygro vector (data not shown).

It meant that U6 promoter in the vector did not act to transcribe a sinfa1-1. Therefore,

all viral promoters and U6 promoter in the pRNAT−U6.1/Hygro vector were

replaced with 5’ UTR of actin gene from nonpathogenic N. gruberi, and a sinfa1-1

showed the highest decreasing effect or asnfa1 was cloned to create a pAct/SAGAH

or pAct/ asnfa1AGAH vector (Fig. 10). The size of the pAct/SAGAH and pAct/

asnfa1AGAH vector was 7040 and 7400 bp, respectively. Act means 5’ UTR of actin

41

Fig. 10. Vector construction for RNAi in N. fowleri. The pAct/SAGAH and

pAct/asnfa1AGAH vector were derived from the pRNAT–U6.1/Hygro vector. All

promoters in the pRNAT–U6.1/Hygro vector were replaced with 5’ UTR of actin

gene. S, sinfa1-1; A, 5’ UTR of actin gene; G, GFP; H, hygromycin resistance gene.

pRNAT–U6.1/Hygro6549 bp

GFP

Hygr gene

pUCOri

Ampr

gene

U6P

CMV P

SV40P

Multicloning sites

Bam

HI

Asp

718

IK

pnI

Hin

dIII

pAct/SAGAH7040 bp

GFP

Hygr gene

pUCOri

Ampr

gene

sinfa1-1Bam

HI

(17

6 bp

)

Hin

dIII

(2

48 b

p)

Nhe I (706 bp)

5’ UTR of actin Avr II(2460 bp)

Xma I (2923 bp)

5’ UTR of actin

Bgl II (6331 bp)

ssDNA loop asDNAIn vivo

ssRNAloop

asRNA

SV40P

pAct/asnfa1AGAH7400 bp

GFP

Hygr gene

pUCOri

Ampr

gene

asnfa1Bam

HI

(176

bp)

Hin

dIII

(5

43 b

p)

Nhe I (1066 bp)

5’ UTR of actin Avr II(3820 bp)

Xma I (3283 bp)

5’ UTR of actin

Bgl II (6691 bp)

SV40P

42

gene. It has not been used in pathogenic N. fowleri yet. When 5’ UTR cloned into the

pAct/SAGAH vector was applied to this RNAi study, it efficiently transcribed the

GFP and hygromycin resistance gene, which were observed by reverse transcription-

PCR (Fig. 11). On the other hand, GFP gene was not transcribed in N. fowleri

transfected with a pAct/SAGAH vector using a lipid formulated-Lipofectamine 2000

(Invitrogen) compared (Fig. 11A). In other pAct/AGAH, pAct/SAGAH, and pAct/

asnfa1AGAH vector, the hygromycin resistance gene was transcribed by reverse

transcription-PCR (Fig. 11B). However, no fragments were amplified in controls of

untransfected and mock-transfected N. fowleri. These result showed the possibility of

5’ UTR of actin gene as a promoter, and that SuperFect reagent could be used to

transfect a mammalian vector into N. fowleri trophozoites.

The knockdown of an nfa1 gene and Nfa1 protein was observed by northern and

western blotting. When the pAct/SAGAH vector with sinfa1-1 was transfected into N.

fowleri, the nfa1 gene mRNA was significantly knockdowned as compared with

pAct/AGAH vector without sinfa1-1 by northern blot analysis (Fig. 12A).

Surprisingly, in the transfectants of the pAct/asnfa1AGAH vector with asnfa1, the

nfa1 gene mRNA was a little knockdowned. In the study of asnfa1 which was not

cloned into a vector, when asnfa1 was transfected into N. fowleri trophozoites, no

changes were occurred in the level of the nfa1 gene mRNA and Nfa1 protein. It was

suggested that the vector-based system cloned with asnfa1 should be more stable to

knockdown the nfa1 gene mRNA than asnfa1 alone. This suggestion was supported

by quantitative analysis (Fig. 12B). About 30% of the nfa1 gene mRNA was

43

Fig. 11. Feasibility of transfection reagents for transfection into N. fowleri and

gene transcription by reverse transcription-PCR. (A) Reverse transcription-PCR

data of GFP gene from N. fowleri transfected with each vector using Lipofectamine

2000 or SuperFect reagent. pDNA was used as a positive control of plasmid DNA

from E. coli. (B) Reverse transcription-PCR data of hygromycin resistance gene from

N. fowleri transfected with a vector with 5’ UTR of actin gene using SuperFect

reagent. pDNA was used as a positive control of plasmid DNA from E. coli.

M1.65

1.00.85

1024 bp

kb None

pAct/AGAH

pAct/SAGAH

pAct/asn

fa1AGAH

SuperFect

pDNA

Hygromycinresistance gene

M None

pRNAT-U6.1

/Hyg

ro

SuperFec

t

pDNApRNAT-U

6.1/si

nfa1-1/H

ygro

pAct/SAGAH

Lipofecta

mine2000

pRNAT-U6.1

/Hyg

ro

pRNAT-U6.1

/sinfa1-1

/Hyg

ro

pAct/SAGAH

Lipofectamine 2000 SuperFect

0.65

0.40.5

kb

500 bp

A

B

44

Fig. 12. Northern blotting and quantitative analysis of the nfa1 gene mRNA

from N. fowleri trophozoites transfected with the RNAi vector. (A) Northern

blotting of the nfa1 or nfa2 gene mRNA with a gene-specific probe. 25 µg of the

mRNA samples were loaded. (B) Quantitative analysis of fig. 5A. N. fowleri

trophzoites were transfected using SuperFect reagent.

None

pAct/AGAH

pAct/SAGAH

pAct/as

nfa1AGAH

SuperFect

Probe

nfa1

nfa2

95.799.9

40.8

70.7

100

Qua

ntity

of a

n N

fa1

prot

ein

(%)

20

40

60

80

100

None

pAct

/AG

AH

Supe

rFec

t

pAct

/SAG

AHpA

ct/a

snfa

1AG

AH

A B

45

knockdowned in N. fowleri transfected with the pAct/asnfa1AGAH vector. In the

transfection of the pAct/SAGAH vector, the nfa1 gene mRNA was higher

knockdowned with about 60% than in the pAct/asnfa1AGAH vector. By western blot

analysis, identical patterns of the Nfa1 protein were shown (Fig. 13). The Nfa1

protein from N. fowleri transfected with a pAct/SAGAH vector was knockdowned

with about 28% compared with N. fowleri transfected with a pAct/asnfa1AGAH

vector with about 17% (Fig. 13B). However, the level of the Nfa1 protein was more

increased about 29% in the pAct/SAGAH vector and 12% in the pAct/asnfa1AGAH

vector than that of the nfa1 gene mRNA. This increased result was similar with the

effect of dsnfa1 and asnfa1 without cloning into a vector. There were no changes in

the level of the Nfa1 protein from the controls of a pAct/AGAH vector and

SuperFect alone and Nfa2 protein used to normalize or prove Nfa1 protein-specific

(Fig. 13A). The results supported that the RNAi vectors should be transfected into N.

fowleri trophzoites using SuperFect reagent and used to knockdown the specific

genes.

E. Expression of an Nfa1 protein in N. fowleri transfected with a RNAi vector

Immunocytochemistry was used to observe the knockdown of a Nfa1 protein in

N. fowleri transfected with a pAct/SAGAH or pAct/asnfa1AGAH vector.

46

Fig. 13. Western blotting and quantitative analysis of the Nfa1 protein from N.

fowleri trophozoites transfected with the RNAi vector. (A) Western blotting of the

Nfa1 or Nfa2 protein detected with a respective polyclonal antibody. 10 µg of the N.

fowleri lysate was loaded. (B) Quantitative analysis of fig. 5A. N. fowleri trophzoites

were transfected using SuperFect reagent.

None

pAct/AGAH

pAct/SAGAH

pAct/asn

fa1AGAH

SuperFect

Probe

nfa1

nfa2

99.9 99.9

71.7

82.5

100

Qua

ntity

of a

n N

fa1

prot

ein

(%)

20

40

60

80

100

None

pAct/

AGAH

Supe

rFec

t

pAct/

SAGAH

pAct/

asnf

a1AGAH

A B

47

Prior to IFA test, the GFP expression of N. fowleri transfected with a RNAi vector

mentioned above was observed under immunofluorescence microscope (data not

shown). It was observed very weakly in N. fowleri transfected with the vector. When

the transfection efficiency was analyzed with fluorescence activated cell sorting

(FACS), 0.10 ~ 0.24% N. fowleri showing weak or strong GFP fluorescence was

observed (data not shown). Although the transfection efficiency was very low,

fluorescent N. fowleri trophozoites were sorted using FACS followed by

immunocytochemistry. After N. fowleri trophozoites were fixed by 10% formalin

and permeabilized, they were treated with the anti-Nfa1 antibody, followed by

rhodamine-conjugated anti-IgG antibody. The fluorescence of red colored-rhodamine

of the Nfa1 protein was observed under a fluorescence microscopy (Fig. 14). N.

fowleri trophozoites transfected with the pAct/SAGAH vector showed the weakest

fluorescence among other samples. The fluorescence of N. fowleri transfected with

the pAct/asnfa1AGAH vector was a little stronger than that transfected with

pAct/SAGAH vector. Other samples as controls showed the strongest fluorescence.

These results were similar patterns with northern or western blotting by RNAi

vectors.

48

Fig. 14. The fluorescence of the Nfa1 protein by immunocytochemistry. N.

fowleri trophozoites were treated with the anti-Nfa1 polyclonal antibody, followed

by rhodamine-conjugated anti-IgG. (A) Untransfected N. fowleri. (B) N. fowleri

transfected with a pAct/AGAH vector. (C) N. fowleri transfected with a

pAct/SAGAH vector. (D) N. fowleri transfected with a pAct/asnfa1AGAH vector.

(E) mock-transfected N. fowleri. × 400.

A B C

D E

None pAct/AGAH pAct/SAGAH

pAct/asnfa1AGAH SuperFect

49

F. In vitro cytotoxicity of N. fowleri transfected with a RNAi vector

To test whether an nfa1 gene-knockdowned N. fowleri trophzoites could destroy

murine macrophages, the in vitro cytotoxicity was performed by LDH release assay,

where a red color represents the extent of in vitro cytotoxicity. LDH is released from

destroyed mammalian cells. All transfected or untransfected N. fowleri trophozoites

were maintained with the Nelson medium containing hygromycin (100 µg /ml). As

experimental time increased, murine macrophages were severely damaged by

untransfected N. fowleri, but murine macrophages cocultured with N. fowleri

transfected with a pAct/SAGAH or pAct/asnfa1AGAH vector were less damaged for

17 h and 24 h than murine macrophages cocultured with N. fowleri transfected with a

control, pAct/AGAH vector (Table 1). The calculated cytotoxicity of untransfected N.

fowleri was highest, with a mean of 67% for 17 h and 89% for 24 h. The cytotoxicity

of N. fowleri transfected with the pAct/SAGAH vector was about 40% for 17 h and

52% for 24 h, lower than that of untransfected N. fowleri (t test; P < 0.01). The

inhibition of the cytotoxicity of N. fowleri transfected with the pAct/AGAH vector

was not occurred. The in vitro cytotoxicity of N. fowleri with added hygromycin

antibiotics showed no differences from that of normal N. gruberi. Therefore, an

increase in the cytotoxicity of N. fowleri transfected with the pAct/SAGAH vector

was not the result of hygromycin antibiotics selection. These results show that N.

fowleri trophozoites knockdowned with the nfa1 gene be inhibited in the cytotoxicity

against murine macrophages.

50

Table 1. In vitro cytotoxicity of N. fowleri against murine macrophages.

66.9 ± 0.5

59.1 ± 2.6

40.9 ± 0.2

66.2 ± 0.1

66.5 ± 2.2

67.3 ± 5.0

17 h 24 hMacrophagea

89.1 ± 4.2Macrophage + N. fowlerib ----------------------------------------------------------

52.9 ± 0.8Macrophage + N. fowleri transfected with a pAct/SAGAH vector ----------

79.1 ± 1.1Macrophage + N. fowleri transfected with a pAct/asnfa1AGAH vector ----

86.4 ± 0.2Macrophage + N. fowleri transfected with only SuperFect reagent ----------

85.1 ± 2.6Macrophage + N. fowleri transfected with a pAct/AGAH vector ------------

85.7 ± 3.1Macrophage + N. fowleri + Hygromycin antibioticsc --------------------------

Cytotoxicity (%)

66.9 ± 0.5

59.1 ± 2.6

40.9 ± 0.2

66.2 ± 0.1

66.5 ± 2.2

67.3 ± 5.0

17 h 24 hMacrophagea

89.1 ± 4.2Macrophage + N. fowlerib ----------------------------------------------------------

52.9 ± 0.8Macrophage + N. fowleri transfected with a pAct/SAGAH vector ----------

79.1 ± 1.1Macrophage + N. fowleri transfected with a pAct/asnfa1AGAH vector ----

86.4 ± 0.2Macrophage + N. fowleri transfected with only SuperFect reagent ----------

85.1 ± 2.6Macrophage + N. fowleri transfected with a pAct/AGAH vector ------------

85.7 ± 3.1Macrophage + N. fowleri + Hygromycin antibioticsc --------------------------

Cytotoxicity (%)

a 5 × 104 cells.b 5 × 104 trophozoites.c 100 μg/ml of hygromycin antibiotics.

Group

51

IV. DISCUSSION

PAME caused by N. fowleri is an acute, fulminant, and rapidly progressing fatal

illness that usually affects children and young adults. The olfactory neuroepithelium

is the route of invasion in PAME due to N. fowleri. Invasions of the olfactory mucosa

and the olfactory bulbs, with hemorrhagic necrosis of both cerebral gray and white

matters and an acute inflammatory infiltrate, are the histopathologic characteristics

(Maritra et al., 1976). Naegleria has an intranuclear mitosis, called promitosis,

following the classical pattern of chromosome separation, but the chromosomes are

too small to be counted by conventional histological techniques (Fulton, 1970).

However, it has been possible to enumerate the chromosomes with the use of pulsed

field gel electrophoresis. The number of chromosomes and their size differ between

species and even between strains of the same species. Two stains of N. gruberi sensu

lato have 23 chromosomes, but the size of some chromosomes differs (Clark et al.,

1990). The ploidy of the Naegleria genome is still not known. The sum of the

chromosome sizes (approximately 19 Mb) does not equal the expected genome size

(approximately 104 Mb), which indicates that Naegleria might be polyploidy (Clark

et al., 1990). Isoenzyme studies of Naegleria spp. usually imply diploidy (Cariou and

Pernin, 1987). These organisms have been long recognized as attractive models for a

variety of studies in basic cellular and molecular biology. They have a relatively

large size, rapid growth in axenic culture, active motility and phagocytosis, and they

52

exhibit unicellular differentiation. Despite the attractiveness of Naegleria, it has been

underutilized as a model system. So far there has been no evidence for sexual

reproduction. Therefore, classical mapping and genetic analysis is limited. The

earliest stage post-inoculation of N. fowleri was 24 h (Jarolim et al., 2000). As the

recent study (Rojas-Hernández et al., 2004), the events occurring during the first 8 h

post-inoculation are as follows: N. fowleri trophozoites make contact with the surface

of the mucous layer of the olfactory epithelium; some of them move across the

mucous layer and reach the apical pole of the epithelial cells, apparently without

disruption and/or depletion of the mucosa. Several trophozoites are eliminated by

being embedded in the mucous layer that sometimes forms a lump containing

inflammatory cells. The binding of N. fowleri trophozoites to the mucous layer can

be mediated by specific cell surface lectins that recognize carbohydrates in mucin

glycoproteins, as has been described during intestinal colonization by Entamoeba

histolytica (Chadee et al., 1987, 1988). The binding of N. fowleri trophozoites to

mucins may facilitate the adhesion and invasion of the parasite. After 96 h, N. fowleri

trophozoites in the olfactory bulb were abundant, suggesting that they have

proliferated. Furthermore, abundant inflammatory cells and severe tissue damage

were found. This damage could be provoked by both N. fowleri and neutrophils.

Trophozoites may invade and enhance tissue damage by releasing cystein proteases

and other enzymes which degrade components of the extracellular space and have a

cytopathic effect on mammalian cells (Aldape et al., 1994). In Acanthameoba of

same free-living amoeba, the mechanism by which Acanthamoeba produces

53

granulomatous amoebic encephalitis and amoebic keratitis (AK) has not been fully

elucidated. However, it is generally accepted that the two major predisposing factors

in the pathogenesis of AK are minor corneal trauma caused by contact lens wear or

other noxious agents and exposure to contaminated solutions including lens care

products and tap water (Kilvington et al., 2004; Larkin et al., 1990). The adhesion of

parasites to the host cells is clearly a critical first step in the pathogenesis of infection

(Moore et al., 1991; Panjwani et al., 1997; van Klink et al., 1992). Subsequent to

adhesion, the parasites produce a potent cytopathic effect leading to target cell death

(Cao et al., 1998; De Jonckeere, 1980; Larkin et al., 1991; van Klink et al., 1992).

That the Acanthamoeba may adhere to host cells via a carbohydrate-binding protein

has been suggested by studies demonstrating that: (i) the adhesion of Acanthamoeba

to corneal epithelial cells in culture as well as to the surface of the corneal buttons

can be inhibited by free methyl-α-mannopyranoside (α-Man) but not by a number of

other sugars (Cao et al., 1998; Morton et al., 1991; Panjwani et al., 1997; Yang et al.,

1997), (ii) Acanthamoebae bind to a neoglycoprotein, mannosylated-bovine serum

albumin but not to galactose-bovine serum albumin (Cao et al., 1998), (iii) mannose-

related saccharides that inhibit amoeba binding to corneal epithelial cells are also

potent inhibitors of the amoeba-induced cytopathic effect (Cao et al., 1998). In

addition, preliminary studies have shown that Acanthamoebae express a putative

mannose-binding protein (MBP) of 136 kDa (Yang et al., 1997). These findings

suggest that the adhesion of Acanthamoeba to the corneal surface is mediated by

interactions between a mannose-specific lectin on the surface of the amoeba and

54

mannose residues of glycoproteins of corneal epithelium, and that the mannose-

mediated cross-talk between amoeba and corneal epithelial cells is a key component

of the Acanthamoeba-induced cytopathic effect. On the mechanism of pathogenicity

of N. fowleri, the adherence of the amoeba to host cells is most important, and the

specific pseudopodial projection, so called as amoebastome, is formed (Derr-Harf

and De Joncheere, 1984). In addition, it was reported that killing of host cells is

mediated by a pore-forming peptide known as amoebapore (Herbst et al., 2002) and

proteolysis of the host’s extracellular matrix is mediated by cysteine proteinases

(Aldape et al., 1994). We previously reported that the Nfa1 protein expressed from

nfa1 gene was located in pseudopodia and around vacuoles (Shin et al., 2001). When

CHO target cells were cocultured with N. fowleri trophozoites, the Nfa1 protein was

specifically localized at amoebastomes of phagocytic evidence (Kang et al., 2005). It

powerfully supported that the Nfa1 protein might be related with the cytotoxicity of

N. fowleri. Moreover, the treatment of anti-Nfa1 antibody decreased the cytotoxicity

of N. fowleri against CHO cells (Jeong et al., 2004). Recently, to elucidate an Nfa1

protein with cytotoxicity of transgenic N. gruberi to CHO cells, transfection study

was performed (Jeong et al., 2005). N. gruberi trophozoites were transfected with a

pEGFP–C2/nfa1UTR vector, and the trophozoites induced in vitro cytotoxicity to

CHO cells. And also, the treatment of anti-Nfa1 antibody to transgenic N. gruberi

decreased the cytotoxicity to CHO cells.

In Naegleria, because of the presence of multiple copies of the genome, it is

difficult to study gene function in N. fowleri by classical genetical methods or to

55

isolate mutants. Mammalian gene function has been determined traditionally by

methods such as disruption of murine genes, the introduction of transgenes, the

molecular characterization of human hereditary diseases, and targeting of genes by

antisense or ribozyme techniques. In addition, microinjection of specific antibodies

into cultured cells or binding of antibodies to cell surface-exposed receptors may

provide information on the function of the targeted protein. A new alternative to

these reverse genetic approaches has now become available with the discovery of

small interfering RNAs, which are able to trigger RNA interference in mammalian

somatic cells (Caplen et al., 2001; Elbashir et al., 2001). RNAi is a sequence-specific

posttranscriptional gene silencing mechanism, which is triggered by dsRNA and

causes degradation of mRNAs homologous in sequence to the dsRNA (Fire et al.,

1988; Montgomery et al., 1998). Our strategy involves the use of antisense RNA or

dsRNAi, which have been used effectively in other protozoa, E. histolytica (Kaur and

Lohia, 2004), Leishmania donovani (Zhang and Matlashewski, 2000), Trypanosoma

brucei (Tschudi et al., 2003), Plasmodium falciparum (Malhotra et al., 2002), and

other organisms.

In the present study, to observe the association of an Nfa1 protein with

cytotoxicity of N. fowleri infection, we have applied antisense RNA or dsRNA

interference strategy to the nfa1 gene, which is post-transcriptional gene silencing

mechanism, to knockdown an nfa1 gene and the Nfa1 protein. When antisense RNA

or dsRNA of the nfa1 gene was transfected into N. fowleri trophozoites, the nfa1

gene and the Nfa1 protein were efficiently knockdowned. However, dsRNA

56

transfection was more effective than antisense RNA transfection. In other words, the

effect of dsRNA using RNAiFect transfection reagent was higher about 45% in an

nfa1 gene and 29% in an Nfa1 protein than antisense RNA. It was presumed that

exogenously transfected antisense RNA should be unstable. The fact that dsRNA

induced to knockdown the nfa1 gene supported that RNAi mechanism should be in N.

fowleri trophozoites. Initially, dsRNA have to be excised by enzyme, e.g.,

RNAaseIII-like endonuclease to form siRNAs to specifically knockdown a gene. It

was supported that endonuclease identically functioning with RNAaseIII-like

endonuclease should be in N. fowleri trophozoites. There was no change in the level

of an nfa2 mRNA and Nfa2 protein used to normalize and show specific function.

The nfa2 gene was cloned by immunoscreening with immune and infected sera

identically used for the nfa1 gene in our previous study (Jeong et al., 2004). It was

homologous to calcineurin B gene related with signal transduction. The reason why

the nfa2 gene was used to normalize and show specific function was that any house-

keeping gene like glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in

mammalian cells has not yet been cloned in pathogenic N. fowleri trophozoites. The

quantity of the nfa2 mRNA and Nfa2 protein has no changes, although dsRNA

treatment has the possibility of nonspecific function, which supported that dsRNA

and antisense RNA of the nfa1 gene was specifically functioned in N. fowleri

trophozoites. Using siRNAs, although dsRNA of nfa1 gene ORF was processed to

siRNAs, all siRNAs did not function identically. However, a randomly chosen

sinfa1-1 of nfa1 gene was more effective with about 13.8 ~ 24.6% than sinfa1-2,

57

sinfa1-3, and sinfa1-4. The sinfa1-1 was corresponded to nucleotides 340–360 closed

by ending codon of the nfa1 gene. There were no changes in the level of the nfa2

gene and Nfa2 protein in this siRNA transfection study. In vitro cytotoxicity

experiment was performed with the nfa1 gene knockdowned-N. fowleri trophozoites

against murine macrophages. When N. fowleri transfected with dsRNA or sinfa1-1 of

the nfa1 gene was applied for the in vitro cytotoxicity, we could not observe the

obscure inhibition of cytotoxicity of the amoeba. Thus, we applied a vector-based

system of plasmid to transfect into N. fowleri trophozoites. The vector-based system

supplies more stable system and marker select transfected N. fowleri. A pRNAT–

U6.1/Hygro vector was used, and it carries GFP and hygromycin selectable marker

transcriptable by viral promoters. In particular, U6.1 is a promoter from human and

can efficiently transcript short RNAs. When a pRNAT–U6.1/Hygro vector was

transfected into N. fowleri, we could observe neither GFP fluorescence (data not

shown) nor any fragment transcripted by a viral promoter using reverse transcription-

PCR. Therefore, viral promoters and U6.1 promoter were replaced with 5’ UTR of an

actin gene in nonpathogenic N. gruberi by cohesive ligation to make a pAct/SAGAH

vector. When the vector was transfected into N. fowleri trophzoites, the nfa1 gene

and Nfa1 protein efficiently were knockdowned. Moreover, the GFP gene and

hygromycin resistance gene transcript were observed by reverse transcription-PCR.

Also, we observed the weak GFP fluorescence in the transfected N. fowleri. Even

though it was done so, it was supported that 5’ UTR of an actin gene could be used as

a promoter to transcript siRNA of sinfa1-1 in a pAct/SAGAH vector. In addition, a

58

pAct/asnfa1AGAH vector transcriptable to antisense RNA of the nfa1 gene was

cloned to compare with a pAct/SAGAH vector. There was no GFP fluorescence in

transfected N. fowleri until five days of transfection with a pAct/SAGAH or

pAct/asnfa1AGAH vector. We did not observe any amplified fragment by reverse

transcription-PCR using even 1 µg of cDNA. The result was different from general

transfection data in mammalian cells or other protozoa. In our transfection system,

GFP fluorescence, and GFP and hygromycin resistance gene transcript were detected

since six days of the transfection. In particular, the nfa1 gene mRNA and Nfa1

protein were efficiently knockdowned in N. fowleri transfected with a pAct/SAGAH

vector. In the case of a pAct/asnfa1AGAH vector, the knockdown effect was less

than a pAct/SAGAH vector. The nfa1 gene mRNA and Nfa1 protein in N. fowleri

transfected with the pAct/SAGAH vector were knockdowned with about 60% and

30%, respectively. On the other hand, by the pAct/asnfa1AGAH vector, the nfa1

gene mRNA and Nfa1 protein were knockdowned with about 30% and 18%,

respectively. There were no changes in the nfa2 gene and Nfa2 protein. Following

the observation of the nfa1 gene and Nfa1 protein knockdown, the transfected N.

fowleri trophozoites were selected with hygromycin antibiotics. After N. fowleri

trophzoites were selected with hygromycin antibiotics two times, they were used to

experiment in vitro cytotoxicity against macrophages, which have similar

characteristics with murine microglial cells of target cells by the infection of N.

fowleri. In our previous study, in vitro cytotoxicity of other free-living amoeba, A.

culbertsoni, was performed with primary cultured rat microglial cells (Shin et al.,

59

2001). Recently, in vitro cytotoxicity of N. fowleri was performed with primary

cultured rat microglial cells (unpublished). Because it was difficult in obtain

sufficient numbers of primary cultured rat microglial cells, and CHO target cells

often used for in vitro cytotoxicity did not have characteristics similar to microglial

cells, immortalized murine macrophages were used in this study. Almost all (89% at

24 h) macrophages cocultured with N. fowleri at a ratio of 1 to 1 were destroyed,

whereas N. fowleri transfected with a pAct/SAGAH and pAct/asnfa1AGAH vector

destroyed 52.9% and 79.1% of macrophages at 24 h, respectively. However, the

cytotoxicity of N. fowleri transfected with a pAct/AGAH vector as a control vector,

was about 66.5% at 17 h and 85.7% at 24 h, which was little difference with the

cytotoxicity of normal N. fowleri. Moreover, the in vitro cytotoxicity of N. fowleri

with added hygromycin antibiotics showed no difference from that of normal N.

fowleri. Therefore, the decrease in the cytotoxicity of N. fowleri transfected with a

pAct/AGAH or pAct/asnfa1AGAH vector was not the result of G418 selection. The

lower cytotoxic effect of transgenic N. fowleri transfected with a pAct/AGAH or

pAct/asnfa1AGAH vector suggests that Nfa1 protein contributes to in vitro

cytotoxicity against macrophages.

60

V. CONCLUSION

In the present study, to observe whether the nfa1 gene could be related with in

vitro cytotoxicity, an nfa1 gene and Nfa1 protein were knockdowned in pathogenic N.

fowleri using RNAi strategy. By synthetic dsRNA of the nfa1 gene ORF, the

expression of nfa1 gene and the Nfa1 protein were knockdowned about 50% and

30%, respectively. However, the exoression of nfa1 gene and the Nfa1 protein by in

vitro transcribed asRNA were not highly knockdowned as dsRNA of nfa1 gene. Four

synthetic siRNAs were not act equally, but sinfa1-1 was the highest effective for

knockdown of the expression of nfa1 gene and Nfa1 protein with 70% and 43%,

respectively. However, N. fowleri trophozoites transfected with synthetic dsRNA or

sinfa1-1 did not highly induce in vitro cytotoxicity against murine macrophages as

compared with normal N. fowleri trophozoites. Therefore, a vector-based system, in

which transfected genes can be maintain longer, was used to transfect the nfa1 gene

into N. fowleri. A pAct/SAGAH vector with sinfa1-1 and a pAct/asnfa1AGAH

vector with asRNA of the nfa1 gene ORF to transcribe efficiently selective marker

genes were cloned and transfected into N. fowleri. The expression of nfa1 gene and

Nfa1 protein were efficiently knockdowned about 60% and 29%, respectively by a

pAct/SAGAH vector, as compared with a pAct/asnfa1AGAH vector of 30% in the

nfa1 gene and 18% in Nfa1 protein. In particular, the in vitro cytotoxicity of N.

fowleri transfected with a pAct/SAGAH vector against macrophages were decreased

61

with 26.6% at 17 h and 26.8% at 24 h in comparision with normal N. fowleri and N.

fowleri transfected with a pAct/AGAH control vector. Also, the in vitro cytotoxicity

by a pAct/asnfa1AGAH vector was decreased with 7.4% at 17 h and 6.6% at 24 h.

These results suggest that the mechanism of RNAi should be worked in N. fowleri

trophozoites. Therefore, single stranded RNA, dsRNA, siRNA and siRNA-vector

were not only efficiently transfected into N. fowleri using each transfection reagent

but also the Nfa1 protein play very important role in destroying macrophages.

62

REFERENCES

1. Aldape K, H Huizinga, J Bouvier, J McKerrow: Naegleria fowleri:

Characterization of a secreted histolytic cysteine protease. Exp Parasitol 78:230–

241, 1994

2. Bass BL: Double-Stranded RNA as a Template for Gene Silencing. Cell 101:235–

238, 2000

3. Baulcombe DC: Viruses and gene silencing in plants. Arch Virol Suppl 15:189–

201, 1999

4. Bender J: RNA Silencing and DNA Methylation in Plants. Cell 106:129–132,

2001

5. Bernstein E, AA Caudy, SM Hammond, GJ Hannon: Role for a bidentate

ribonuclease in the initiation step of RNA interference. Nature 409:363–366,

2001

6. Bosher JM, P Dufourcq, S Sookhareea, M Labouesse: RNA interference can target

pre-mRNA: Consequences for gene expression in a Caenorhabditis elegans

operon. Genetics 159:1245–1256, 1999

7. Bradford MM: A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Anal Biochem

7:248−254, 1976

8. Brown T: Observation by immunofluorescence microscopy on the

63

cytopathogenicity of Naegelria fowleri in mouse embryo-cell cultures. J Med

Microbiol 12:363−371, 1979

9. Cao Z, DM Jefferson, N Panjwani: Role of Carbohydrate-mediated adherence in

cytopathogenic mechanisms of Acanthamoeba. J Biol Chem 273:15838−15845,

1998

10. Caplen NJ, S Parrish, F Imani, A Fire, RA Morgan: Specific inhibition of gene

expression by small double-stranded RNAs in invertebrate and vertebrate

systems. Proc Natl Acad Sci USA 98:9742–9747, 2001

11. Cariou ML, P Pernin: First evidence for diploidy and genetic recombination in

free-living amoebae of the genus Naegleria on the basis of electrophoretic

variation. Genetics 115:265−270, 1987

12. Carter RF: Description of Naegleria sp. Isolated from two cases of primary

amoebic meningoencephalitis, and the experimental pathological changes

induced by it. J Pathol 100:217−244, 1970

13. Carter RF: Primary amoebic meningoencephalitis: clinical, pathological and

epidemiological features of six fatal cases. J Pathol Bacteriol 96:1−25, 1968

14. Carter RF: Primary amoebic meningo-encephalitis. An appraisal of present

knowledge. Trans R Soc Trop Med Hyg 66:193−213, 1972

15. Chadee K, WA Petri, DJ Innes, JI Ravdin: Rat and human colonic mucins bind to

and inhibit adherence lectin of Entamoeba histolytica. J Clin Invest

80:1245−1254, 1987

64

16. Chadee K, ML Johnson, E Orozco, WA Petri, JI Ravdin: Binding and

internalization of rat colonic mucins by the galactose/N-acetyl-D-galactosamine

adherence lectin of Entamoeba histolytica. J Infect Dis 158:398−406, 1988

17. Cho MS, SY Jung, S Park, KH Kim, HI Kim, SH Sohn, HJ Kim, KI Im, HJ Shin:

Immunological characterizations of a cloned 13.1-kilodalton protein from

pathogenic Naegleria fowleri. Clin Diagn Lab Immunol 10:954–959, 2003

18. Clark CG: Genome structure and evolution of Naegleria and its relatives. J

Protozool 37:25–65, 1990

19. Clark CG, EY Lei, C Fulton, GAM Cross: Electrophoretic karyotype and linkage

groups for the amoeboflagellate Naegleria gruberi. J Protozool 37:400–408,

1990

20. Clemens MJ: PKR–A protein kinase regulated by double-stranded RNA. Int J

Biochem Cell Biol 29:945–949, 1997

21. Clemens CJ, Worby CA, Simonson-Leff N, Muda M, Maehama T, Hemmings

BA, Dixon JE: Use of double-stranded RNA interference in Drosophila cell lines

to dissect signal transduction pathways. Proc Natl Acad Sci USA 97:6499–6503,

2000

22. Cogoni C, G Macino: Gene silencing in Neurospora crassa requires a protein

homologous to RNA-dependent RNA polymerase. Nature 399:166–169, 1999

23. Cogoni C, G Macino: Posttranscriptional gene silencing in Neurospora by a

RecQ DNA helicase. Science 286:2342–2344, 1999

24. Cursons RTM, TJ Brown, EA Keyes: Virulence of pathogenic free-living amebae.

65

J Parasitol 64:744–745, 1978

25. De Jonckheere JF: Growth characteristics, cytopathic effect in cell culture, and

virulence in mice of 36 type strains belonging to 19 different Acanthamoeba spp.

Appl Environ Microbiol 39:681–685, 1980

26. De Jonckheere J, H van de Voorde: Comparative study of six strains of Naegleria

with special reference to nonpathogenic variants of Naegleria fowleri. J

Protozool 24:304–309, 1977

27. Derr-Harf C, JF De Joncheere: Isolation of pathogenic Naegleria australiensis

(Amoebida, Vahlkampfiidae) from the Rhine. Protistologica 302:489–494, 1984

28. Eisen D, RC Franson: Acid-active neuraminidases in growth media from cultures

of pathogenic Naegleria fowleri and in sonicates of rabbit alveolar macrophages.

Biochim Biophys Acta 924:369–372, 1987

29. Elbashir SM, J Harborth, W Lendeckel, A Yalcin, K Weber, T Tuschl: Duplexes

of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.

Nature 411:494–498, 2001

30. Elbashir SM, W Lendeckel, T Tuschl: RNA interference is mediated by 21- and

22-nucleotide RNAs. Genes Dev 15:188–200, 2001

31. Ferrante A: Comparative sensitivity of Naegleria fowleri to amphotericin B and

amphotericin B methyl ester. R Soc Trop Medi Hyg 76:476–478, 1982

32. Fire A, S Xu, MK Montgomery, SA Kostas, SE Driver, CC Mello: Potent and

specific genetic interference by double-stranded RNA in Caenorhabditis elegans.

Nature 391:806–811, 1988

66

33. Fjose A, Ellingsen S, Wargelius A, Seo HC: RNA interference. Mechanism and

applications. Annu Rev Biotechnol 7:31–57, 2001

34. Fraser AG, Kamath RS, Zipperlen P, M Martinez-Campos, M Sohrmann, J

Ahringer: Functional genomic analysis of C. elegans chromosome I by

systematic RNA interference. Nature 408:325–330, 2000

35. Fulton C: Amebo-flgellates as research partners: the laboratory biology of

Naegleria and Tetramitus. In: Meth Cell physiol (Ed. D. M. Prescott). Academic

Press 4:341–476, 1970

36. Grant SR: Dissecting the Mechanisms of Posttranscriptional Gene Silencing. Cell

96:303–306, 1999

37. Hammond SM, E Bernstein, D Beach, GJ Hannon: An RNA-directed nuclease

mediates post-transcriptional gene silencing in Drosophila cells. Nature

404:293–296, 2000

38. Herbst R, C Ott, T Jacobs, T Marti, F Marciano-Cabral, M Leippe: Pore-forming

Polypeptides of the Pathogenic Protozoon Naegleria fowleri. J Biol Chem

277:22353–22360, 2002

39. Hildebrandt M, W Nellen: Differential antisense transcription from the

Dictyostelium EB4 gene locus: Implications on antisense-mediated regulation of

mRNA stability. Cell 69:197–204, 1992

40. Hu Q, HR Henny Jr: An Acanthamoeba polyubiquitin gene and application of its

promoter to the establishment of a transient transfection system. Biochim Biophys

Acta 20:126–136, 1997

67

41. Im KI, HJ Shin: Acanthamoeba sohi, n. sp., a pathogenic Korean isolate YM-4

from a freshwater fish. Korean J Parasitol 41:181–188, 2003

42. Jarolim KL, JK McCosh, MJ Howard, DT John: A light microscopy study of the

migration of Naegleria fowleri from the nasal submucosa to the central nervous

system during the early stage of primary amebic meningoencephalitis in mice. J

Parasitol 86:50–55, 2000

43. Jeong SR, SC Lee, KJ Song, S Park, K Kim, MH Kwon, KI Im, HJ Shin:

Expression of the nfa1 gene cloned from pathogenic Naegleria fowleri in

nonpathogenic N. gruberi enhances cytotoxicity against CHO target cells in vitro.

Infect Immun 73:4098-4105, 2005

44. Jeong SR, SY Kang, SC Lee, KJ Song, KI Im, HJ Shin: Decreasing effect of an

anti-Nfa1 polyclonal antibody on the in vitro cytotoxicity of pathogenic

Naegleria fowleri. Korean J Parasitol 42:35–40, 2004

45. John DT: Primary amebic meningoencephalitis and the biology of Naegleria

fowleri. Annu Rev Microbiol 36:101−23, 1982

46. John DT, TB Cole Jr, RA Bruner: Amebostomes of Naegleria fowleri. J

Protozool 32:12–19, 1985

47. Kadlec V, J Skvarova, L Cerva, D Nebazniva: Virulent Naegleria fowleri in

indoor swimming pool. Folia Parasit (Praha) 27:11−17, 1980

48. Kang SY, KJ Song, SR Jeong, JH Kim, S Park, K Kim, MH Kwon, HJ Shin:

Role of the Nfa1 protein in pathogenic Naegleria fowleri cocultured with CHO

target cells. Clin Diagn Lab Immunol 12:873−876, 2005

68

49. Kaur G, A Lohia: Inhibition of gene expression with double strand RNA

interference in Entamoeba histolytica. Biochem Biophys Res Comm

320:1118−1122, 2004.

50. Ketting RF, TH Haverkamp, HG van Luenen, RH Plasterk: mut-7 of C. elegans,

required for transposon silencing and RNA interference, is a homolog of werner

syndrome helicase and RNaseD. Cell 99:133–141, 1999

51. Kilvington S, T Gray, J Dart, N Morlet, JR Beeching, DG Frazer, M Matheson:

Acanthamoeba Keratitis: The Role of Domestic Tap Water Contamination in the

United Kingdom. Invest Ophthalmol Vis Sci 45:165–169, 2004

52. Lares-Villa F, JF De Jonckheere, DE Moura H, A Recchi-Iruretagoyena, E

Ferreira-Guerrero, G Fernadez-Quintanilla, C Ruiz-Matus, GS Visvesvara: Five

cases of primary amebic meningoencephalitis in Mexicali, Mexico: study of the

isolates. J Clin Microbiol 31:685−688, 1993

53. Larkin DF, M Berry, DL Easty: In vitro corneal pathogenicity of Acanthamoeba.

Eye 5:560−568, 1991

54. Larkin DF, S Kilvington, DL Easty: Contamination of contact lens storage cases

by Acanthamoeba and bacteria. British J Ophthalmol 74:133–135, 1990

55. Lau NC, PL Lee, EG Weinstein, DP Bartel: An abundant class of tiny RNAs with

probable regulatory roles in Caenorhabditis elegans. Science 294:858–862, 2001

56. Lee RC, V Ambros: An extensive class of small RNAs in Caenorhabditis

elegans. Scienc 294:862–864, 2001

57. Ma P, GS Visvesvara, AJ Martinez, FH Theodore, PM Daggett, TK Sawyer:

69

Naegleria and Acanthamoeba infections: Review. Rev Infect Dis 12:490–513,

1990.

58. Malhotra P, Dasaradhi PVN, Kumar A, Mohmmed A, Agrawal N, Bhatnagar RK,

Chauhan VS: Double-stranded RNA-mediated gene silencing of cysteine

proteases (falcipain-1 and -2) of Plasmodium falciparum. Mol Microbiol

45:1245–1254, 2002

59. Maritra SC, PBN Krishna, SC Agarwala, SR Das: Ultrastructure studies on

experimental primary amoebic meningo-encephalitis (PAME) of mouse due to

Naegleria aerobia and Hartmanella culbertsoni. Int J Parasitol 6:489–493, 1976

60. Matzke MA, AJ Matzke, GJ Pruss, VB Vance: RNA-based silencing strategies in

plants. Curr Opin Genet Dev 11:221–227, 2001

61. Montgomery MK, S Xu, A Fire: RNA as a target of double-stranded RNA-

mediated genetic interference in Caenorhabditis elegans. Proc Natl Acad Sci

USA 95:15502–15507, 1998

62. Moore MB, JE Ubelaker, JH Martin, R Silvany, JM Dougherty, DR Meyer, JP

McCulley: In vitro penetration of human corneal epithelium by Acanthamoeba

castellanii: a scanning and transmission electron microscopy study. Cornea

10:291–298, 1991

63. Morton LD, GL McLaughlin, HE Whiteley: Effects of temperature, amebic strain,

and carbohydrates on Acanthamoeba adherence to corneal epithelium in vitro.

Infect Immun 59:3819–3822, 1991

64. Ngo H, C Tschudi, K Gull, E Ullu: Double-stranded RNA induces mRNA

70

degradation in Trypanosoma brucei Proc Natl Acad Sci USA 95:14687–14692,

1998

65. Panjwani N, Z Zhao, J Baum, LD Hazlett, Z Yang: Acanthamoebae bind to rabbit

corneal epithelium in vitro. Invest Ophthalmol Vis Sci 38:1858–1864, 1997

66. Parrish S, J Fleenor, S Xu, C Mello, A Fire: Functional anatomy of a dsRNA

trigger differential requirement for the two trigger strands in RNA interference.

Mol Cell 6:1077–1087, 2000

67. Peng Z, R Omaruddin, E Bateman: Stable transfection of Acanthamoeba

castellanii. Biochim Biophys Acta 22:93–100, 2005.

68. Pussard M, R Pons: Étude des genres Leptomyxa et Gephyramoeba (Protozoa,

Sarcodina). II−Leptomyxa flagellate Goodey. Protistologica 12:307−319, 1979

69. Ralph P, I Nakoinz: Antibody-dependent killing of erythrocyte and tumor targets

by macrophage-related cell lines: enhancement by PPD and LPS. J Immunol

119:950−954, 1977

70. Ratcliff FG, SA MacFarlane, DC Baulcombe: Gene Silencing without DNA:

RNA-Mediated Cross-Protection between Viruses. Plant Cell 11:1207–1216,

1999

71. Rojas-Hernández S, A Jarillo-Luna, M Rodríguez-Monroy, L Moreno-Fierros,

R Campos-Rodríguez: Immunohistochemical characterization of the initial stages

of Naegleria fowleri meningoencephalitis in mice. Parasitol Res 94:31−36, 2004

72. Sagerström CG, HL Sive: A laboratory guide to RNA: Isolation, analysis, and

synthesis (Krieg PA, ed), Wiley-Liss, Inc, New York 83−103, 1996.

71

73. Shin HJ, MS Cho, SY Jung, HI Kim, S Park, HJ Kim, KI Im: Molecular cloning

and characterization of a gene encoding a 13.1 kDa antigenic protein of

Naegleria fowleri. J Eukaryot Microbiol 48:713−717, 2001

74. Shin HJ, MS Cho, SY Jung, HI Kim, S Park, JH Seo, JC Yoo, KI Im: Cytopathic

changes in rat microglial cells induced by pathogenic Acanthamoeba culbertsoni:

morphology and cytokine release. Clin Diag Lab Immunol 8:837–840, 2001

75. Stevens AR, JF De Jonckheere, E Willaert: Naegleria lovaniensis new species:

Isolation and identification of six thermophilic strains of a new species found in

association with Naegleria fowleri. Int J Parasitol 10:51−64, 1980

76. Stougaard P, S Molin, K Nordström: RNAs involved in copy-number control and

incompatibility of plasmid R1. Proc Natl Acad Sci USA 78:6008–6012, 1981

77. Tabara H, A Grishok, CC Mello: RNAi in C. elegans: Soaking in the genome

sequence. Science 282:430–431, 1998

78. Tabara H, M Sarkissian, WG Kelly, J Fleenor, A Grishok, L Timmons, A Fire,

CC Mello: The rde-1 Gene, RNA interference, and transposon silencing in

Caenorhabditis elegans. Cell 99:123–132, 1999

79. Takagi T, Cox JA: Primary structure of myohemerythrin from the annelid Nereis

diversicolor. FEBS Lett 285:25−27, 1991

80. Tang MX, CT Redemann, FC Szoka: In vitro gene delivery by degraded

polyamidoamine dendrimers. Bioconjugate Chem 7:703, 1996.

81. Tavernarakis N, SL Wang, M Dorovkov, A Ryazanov, M Driscoll: Heritable and

inducible genetic interference by double-stranded RNA encoded by transgenes.

72

Nat Genet 24:180–183, 2000

82. Timmons L, A Fire: Specific interference by ingested dsRNA. Nature 395:854,

1998

83. Tomizawa J, T Itoh, G Selzer, T Som: Inhibition of ColE1 RNA primer formation

by a plasmid-specified small RNA. Proc Natl Acad Sci USA 78:1421–1425, 1981

84. Tschudi C, A Djikeng, H Shi, E Ullu: In vivo analysis of the RNA interference

mechanism in Trypanosoma brucei. Methods 30:304–312, 2003

85. Tuschl T, PD Zamore, R Lehmann, DP Bartel, PA Sharp: Targeted mRNA

degradation by double-stranded RNA in vitro. Genes Dev 13:3191–3197, 1999

86. van Klink F, H Alizadeh, GL Stewart, MS Pidherney, RE Silvany, Y He, JP

McCulley, JY Niederkorn: Characterization and pathogenic potential of a soil

isolate and an ocular isolate of Acanthamoeba castellanii in relation to

Acanthamoeba keratitis. Curr Eye Res 11:1207–1220, 1992

87. Vaucheret H, C Beclin, T Elmayan, F Feuerbach, C Godon, JB Morel, P

Mourrain, JC Palauqui, S Vernhettes: Transgene-induced gene silencing in plants.

Plant J 16:651–659, 1998

88. Waterhouse PM, NA Smith, MB Wang: Virus resistance and gene silencing:

killing the messenger Trends Plant Sci 4:452–457, 1999

89. Willaert E: Isolement et culture in vitro des amibes de genre Naegleria. Ann Soc

Belg Med Trop 51:701−708, 1971

73

90. Yang Z, Z Cao, N Panjwani: Pathogenesis of Acanthamoeba keratitis:

carbohydrate-mediated host-parasite interactions. Infect Immun 65:439−445,

1997

91. Yin J, HR Henney Jr: Stable transfection of Acanthamoeba. Can J Microbiol

43:239-244, 1997

92. Young JDE, DM Lowrey: Biochemical and functional characterization of a

membrane-associated pore-forming protein from the pathogenic ameboflagellate

Naegleria fowleri. J Biol Chem 264:1077−1083, 1989

93. Yu JY, SL DeRuiter SL, DL Turner DL: RNA interference by expression of

short-interfering RNAs and hairpin RNAs in mammalian cells. Proc Natl Acad

Sci USA 99:6047–6052, 2002

94. Zhang WW, G Matlashewski: Analysis of antisense and double stranded RNA

downregulation of A2 protein expression in Leishmania donovani. Mol Biochem

Parasitol 107:315–319, 2000

74

–국문요약–

Antisense RNA를를를를 이용한이용한이용한이용한 병원성병원성병원성병원성자유아메바로부터자유아메바로부터자유아메바로부터자유아메바로부터 클로닝된클로닝된클로닝된클로닝된

nfa1 유전자의유전자의유전자의유전자의 발현억제발현억제발현억제발현억제 시스템시스템시스템시스템

아주대학교 대학원의학과

이 상 철

(지도교수: 신 호 준)

파울러자유아메바 (Naegleria fowleri)에 의한 원발성 아메바성 수막뇌염 (primary

amoebic meningoencephalitis)은 소아나 실험동물에서 급성으로 발병하며 치명적

이다. 파울러자유아메바의 병인기전 및 독성과 연관된 단백질에 관한 보고는

거의 미약하다. 또한, 단백질의 기능을 파악하기 위한 transfection 시스템도 아직

완전히 확립되지 못하였다. 본 연구에서 사용된 병원성 nfa1 유전자는 병원성

파울러자유아메바로부터 immunoscreening 통해 클로닝되었으며, 357 개의 DNA로

구성되어 있다. Nfa1 단백질은 아메바의 위족 특히, food-cup 형성에 관여하는

것으로 알려져 있다. 또한 anti-Nfa1 항체는 파울러아메바의 세포독성을 감소

시키는 효과를 갖고 있다. 따라서 본 연구자는 nfa1 유전자에 대한 antisense

RNA와 siRNA를 이용하여, transfection system의 확립과 더불어 표적세포에 대한

아메바의 세포독성에 있어서 Nfa1 단백질의 연관성을 확인하고자 하였다. 시험관

내에서 합성된 dsRNA에 의해서 nfa1 유전자의발현과 Nfa1 단백질의 생산은 각각

약 50% 및 30%가 억제되었다. 하지만, 시험관 내에서 합성된 antisense RNA에

의해서는 dsRNA에 의한 효과만큼 크지는 않았다. 합성된 네개의 siRNAs들 중

sinfa1-1이 최대의 효과가 있었으며, nfa1 유전자에는 70% 그리고 Nfa1 단백질에

75

는 43%의 억제를 보여주었다. 하지만, 합성된 dsRNA 혹은 sinfa1-1을 transfection

한 파울러자유아메바는 대식세포에 대한 세포독성을 유발하지 않았다. 따라서,

transfection 된 유전자가 더욱 더 세포내에서 오랫동안 유지 될 수 있는 벡터를

이용하여 파울러자유아메바에 transfection하고 세포독성을 관찰하고자 하였다.

sinfa1-1이 클로닝된 pAct/SAGAH와 antisense nfa1 유전자 mRNA가 클로닝된

pAct/asnfa1AGAH 벡터가 이용되었다. pAct/SAGAH 벡터에 의해서 nfa1 유전자의

발현과 Nfa1 단백질 생산이 각각 60% 및 29%가 억제되었고, pAct/asnfa1AGAH

벡터에 의해서 유전자와 단백질이 30% 및 18%가 각각 억제되었다. 특히,

pAct/SAGAH 벡터가 transfection 된 파울러자유아메바는 표적세포인 대식세포와

17 시간 혼합배양에 있어서 대조군들보다 약 26.6% 그리고 24 시간에 있어서 약

26.8%의 세포독성 억제를 보여주었다. pAct/asnfa1AGAH 벡터가 transfection 된

파울러자유아메바에 의해서는 17 시간 혼합배양 하였을때 약 7.4% 그리고 24

시간에 있어서는 약 26.8% 정도의 세포독성이 감소되었다. 본 연구의 결과,

파울러자유아메바의 nfa1 유전자의 antisense RNA를 만들어 벡타를 이용하여

transfection 시킴으로써 nfa1 유전자의 발현을 억제시키는 system을 확립할 수

있었다. 그 결과, 파울러자유아메바의 Nfa1 단백질은 표적세포를 파괴하는데

중요한 역할을 한다는 것을 알 수 있었으며, 이 연구는 파울러자유아메바에 의한

감염기전을 밝히는데 중요한 자료가 될 것이다.

____________________________________________________________________

핵심어: 원발성아메바성수막뇌12130염, N. fowleri, nfa1 gene, RNAi, 세포독성