2011

NIAB

Nuclear Institute for Agriculture and Biology

FAISALABAD – PAKISTAN

Annual Activity Report

i

NIABAnnual Activity Report

2011

Editors

Dr. Javed Akhtar DCS/Director

Mr. Ghulam Sarwar DCS/Head PBGD

Dr. Khalid Mahmood DCS/Head SSD

Dr. Muhammad Hamed DCS/Head PPD

Dr. Shahnaz A. Khanum DCS/Head ASD

Dr. Yusuf Zafar CS/DG A&B, PAEC HQ

Compilation Committee

Mr. Jafar Hussain SS/Incharge DA&IT

Mr. Asif Kamran JS

ii

Acronyms and Abbreviations

AARI Ayub Agricultural Research Institute *M1,2,… Mutant1, Mutant2, …ALP Agriculture Linkages Program MINFA Ministry of Food and AgricultureASD Animal Sciences Division NARC National Agricultural Research

CenterATCOP Al-Technique Corporation of

PakistanNCVT National Coordinated Varietal Trial

AZRI Arid Zone Research Institute NIAB Nuclear Institute for Agricultureand Biology

*BC1,2,… Back Cross1, Back Cross2, … NIBGE National Institute forBiotechnology & GeneticsEngineering

BLB Bacterial Leaf Blight NM NIAB MungBSRS Bio-saline Research Station NUYT National Uniform Yield TrialBt Bacillus Thuringiensis PAEC Pakistan Atomic Energy

CommissionCAYT Chickpea Advance Yield Trial PAMCO Punjab Agriculture and Meat

CorporationCCYT Chickpea Cooperative Yield Trial PARB Punjab Agricultural Research BoardCID (∆) Carbon Isotope Discrimination PARC Pakistan Agricultural Research

CouncilCIMMYT International Maize and Wheat

Improvement CenterPBGD Plant Breeding & Genetics Division

CLCuV Cotton Leaf Curl Virus PCCT Provincial Coordinated CottonTrials

CMS Cytoplasmic Male Sterility PCR Polymerase Chain ReactionDA&IT Data Analysis and Information

TechnologyPIEAS Pakistan Institute of Engineering &

Applied SciencesDAP Di-ammonium Phosphate PMYT Preliminary Micro Yield TrialEAS Electronic Attendance System PPD Plant Protection DivisionEC Electrical Conductivity PPR Peste des petit Ruminants*F1,2,… Filial1, Filial2, … PRI Pulses Research Institute (AARI)FMD Foot-and-Mouth Disease PSC Punjab Seed CouncilGY Grain Yield PSF Pakistan Science FoundationHPR Host Plant Resistance PYT Preliminary Yield TrialsHPS Hydropericardium Syndrome RWC Relative Water ConductivityHS Hemorrhagic Septicemia SOPIB Sulphate of Potash Information

Board (Belgium)IAEA International Atomic Energy Agency SPP Single Plant ProgeniesIBD Infectious Bursal Disease SSD Soil Science DivisionICARDA International Center for Agricultural

Research in Dry AreasSYT Station Yield Trials

ICRISAT International Crops ResearchInstitute for Semi Arid Tropics

UAF University of Agriculture,Faisalabad

IKI Iodine-Potassium IodideIPM Integrated Pest Management * Subscript indicates generation numberLAN Local Area NetworkLSK Low Seeded Kinnow

iii

C O N T E N T SPage

Highlights of the Year 1

I. PLANT BREEDING & GENETICS 4

Cotton 4

Oil Seeds 4

Rice 4

Chickpea 5

Mungbean 5

Lentil 6

Vegetable (Tomato) 7

Marker Assisted Breeding 8

Radiation Safety Services 8

II. SOIL SCIENCE 9

Bio-saline Agriculture 9

Soil fertility and plant nutrition 10

Plant-water Relationships 12

Development of drought tolerant rice 13

III. ANIMAL SCIENCES 15

IV. PLANT PROTECTION 17

Integrated Pest Management (IPM) 17

Biological control based IPM in vegetables 17

Fungal and bacterial diseases in rice 19

Food Toxicology 19

Insect Toxicology & Resistance Studies 19

V. IMPACT 20

VI. PUBLICATIONS 22

VII. APPENDICES 27

i. Funded Research Projects 27

ii. Farmers’ Days 29

iii. Training Courses and Workshops 30

iv. Scientists/Administration 31

v. Promotions 32

vi. Transfers/Postings 32

vii. Appointments 32

viii. Retirements 32

1

Highlights of the Year

NIAB is applying scientific expertise to solve problems faced by the agriculture of the country since 1972

and is the biggest of agriculture center of PAEC. This report describes some of the successes of 2011 the

institute achieved in its research and training activities. All research and development activities planned,

implemented and impacts monitored during the year in four thematic programs are reported below.

Plant breeders continued to develop improved, high yielding lines resistant to stresses (diseases, insect

pests, cold, heat and drought), targeted at specific environments. Efforts were focused on important

crops like cotton, mungbean, chickpea, lentil, rice, wheat, tomato and low seeded Kinnow. The release of

two new crop varieties (Mungbean NM-2011 and Cotton NIAB-852) has been major hallmark of year

2011. Pre-basic seed of earlier approved varieties including Cotton: NIAB-111, NIAB-846, NIAB-777

(1800kg); Rice: Niab-Irri-9 (200kg); Mungbean: NM-2006, NM-2011 (1592kg); Lentil: Masoor-2002,

Masoor-2006 (2500kg) and breeders nuclear seed of chickpea CM-2008, CM-98 (1500kg) was provided

to growers and PSC. The progress made in various crops is summarized below.

A high yielding non-Bt cotton candidate line NIAB-852 was approved by PSC for general

cultivation. Five promising mutants are in process of evaluation and approval. Mutants introgressed with

Bt gene (Cry-1Ac) are at BC and BC stages and new Bt germplasm is being developed.

Two dwarf, early maturing basmati mutants outyielded super with 10% higher yield in NUYT. Over

300 recombinants selected from cross combinations are in F /F . More than 100 accessions of aromatic

and non-aromatic rice were maintained for future programs. For hybrid rice, 90 promising inbred lines

were selected and CMS lines were identified from F populations. Low phytic acid mutants were crossed

with super parent for high yield and shattering resistance.

Elite desi and kabuli lines were evaluated at multi locations and 3 were found resistant to

blight and highly resistant to wilt in screening nurseries. For rainfed conditions, 75 lines were

selected and 16 kabuli and 13 desi drought tolerant lines were identified using physiological and

biochemical techniques. Incidence of (25-30%) root rot disease was first time observed in Bhakkar, Jhang

and Mianwali.

Mungbean and lentil are two most important food legumes and many poor people around

the world including Pakistan rely on them for protein in their diets. Year 2011 was very productive for

pulses group and a new variety NM-2011 was approved by PSC for general cultivation. Shiny bold grains

of high yielding and yellow mosaic virus resistant variety are blessed with 25% protein content.

Introduction of NM-2011 variety will enhance overall production in the country and farmers income.

Three advance lines showed high GY in trials. Thirty four true breeding lines were evaluated in

screening nursery and 400 were selected from F , M and M . PARB awarded a research project (Rs.16 M)

for developing high yielding and disease resistance lentil.

Three lines were found heat tolerant under field conditions. Twenty two lines were free of late

blight, deshape and blossom end rot diseases. Over 180 recombinants were selected with yield 2-

5kg/plant. Fifteen male sterile plants in F and 7 in F populations were selected to develop male sterile

lines. Four hybrids showed significant specific combining ability effects in yield and number of fruits per

plant and 3 showed yield heterosis from 104 to138%.

A Low Seeded Kinnow (LSK) variety evolved is at advance stage of approval.

During 2011 randomly selected fruits were sent to stakeholders of various R&D organizations in the

country for evaluation of seeds/fruit and quality characteristics (size, shape, color and taste). In general,

all of them highly appreciated NIAB LSK and recommended its production on commercial scale. An MoU

was signed between NIAB and PAMCO to develop LSK nurseries in Layyah, Bhakkar and Jhang districts.

NIAB supplied 1000 LSK plants to PAMCO during year 2011.

Molecular markers were identified to fingerprint cotton varieties and

advance lines, characterize races of chickpea pathogens (wilt and blight) and confirm hybrids of tomato.

Advances in Plant Breeding

Cotton:

Rice:

Chickpea:

Mungbean:

Lentil:

Tomato:

Low Seeded Kinnow Variety:

Marker Assisted Breeding:

5 6

3 2

2

4 5 4

3 2

Ascochyta

2

Biochemical markers and antioxidants were used to identify wheat lines for drought tolerance. Seed

storage protein profiling of mungbean and tomato lines exhibited low genetic variation.

Soil Scientists focused their efforts to develop technologies for sustainable use, reduce input costs,

increase crop productivity and conservation of natural resources: soil, water and plant species. Studies

included fertilizer, nutrient management, germplasm selection for stress tolerance, water use efficiency

and phyto-remediation of salt-affected/polluted lands. The progress during year 2011 is presented

hereunder.

After land clearing at BSRS Pakka Anna, trees were planted on 45 acres, forage

grasses on 10 and wheat/barley on 15 acres. Dead seedlings were replaced in 80 acres of .

Cotton NN-3 was found salt tolerant out of 8 varieties tested. A Farmers Day was organized at BSRS in

which 150 farmers, extension workers and scholars participated. Various delegates from industry,

universities and Faisalabad district administration including DCO visited BSRS.

Use of cheaper phosphoric acid increased yield of rice, maize

and wheat crops compared with commercial fertilizer with no adverse effects on soil properties. NIAB

urea phosphate fertilizer containing 17% N and 44% P O increased wheat and rice yield than DAP in

normal/saline soils. Foliar spray of chelated micronutrients (NIAB) showed 36% more yield than control.

Reduction in fruit drop (25%) in kinnow with juice quality improvement was observed with foliar spray of

2-4 D and Salicylic acid. Foliar spray of 0.5% ZnSO increased Basmati yield and Abscisic acid improved

drought tolerance in sunflower hybrids. Urea granules placed at 8cm depth @120kgN/ha at sowing

resulted 11% more wheat yield than broadcast method.

Generation advancement of wheat lines for mega environments

(low, medium and well water) evolved by crossing parents using ∆ technique is at F and F stages. 29

stable high yielding lines from F and 17 from F were selected for preliminary micro yield trials.Two exotic

lines screened have been included in local trials. Work to develop wheat lines resistant to heat and rust

was initiated. Expert Sub-Committee of PSC examined RSP-2 (Rice) for spot and recommended to present

in next meeting for approval as a variety. The line is high yielding and tolerant to drought, salt and lodging.

The huge crop losses inflicted by Insect pests and diseases from seedling to harvest can be minimized by

selecting resistant/tolerant varieties and taking biological control measures. Out of 40 non-Bt cotton

lines, 3 were resistant to whitefly and jassid and 2 to bollworms in NCVT-B/NCVT-C trials. Monsanto Bt

lines were resistant to army and bollworms and susceptible to whitefly and jassid. Severe attacks of pink

bollworm, dusky and red cotton bug were recorded in all cotton varieties. Three Bt lines were found

tolerant to CLCuV out of 49. In chickpea, 29 blight and 5 wilt resistant lines were identified. Leafhopper

was identified a vector in transmitting chickpea chlorotic dwarf virus. In rice, 21 BLB resistant and in

wheat 3 yellow rust resistant lines were found.

Parasitoid ( ) and predator ( suppressed

lepidoptera and sucking insect pests below ETLs. Sprays were reduced significantly in tomato, okra and

cauliflower. Pheromone baited traps were found very effective to indicate peak population of pink

bollworm, army worm and American bollworm. Mango was found the most preferred host of fruitfly

( followed by peach and apple. Bitter gourd was the most preferred host of

followed by brinjal, muskmelon and pumpkin. Mosquito species survey conducted at NIAB

showed presence of Anopheles, Culex and Aedes during Nov. and Dec. High concentration of Aflatoxins

(31-69µg/kg)was found in chili from Jehlum, Jhang and Faisalabad and decontamination with citric acid is

being studied.

Estrus induction and synchronization with methylacetoxy progesterone sponges proved effective both in

cyclic (75%) and acyclic (50%) buffaloes. Management of estrus with double injection of Prostenol also

proved effective in synchronizing estrus in dwarf goats and K in estrus was found significantly higher in

Advances in Soil Science

Bio-saline Agriculture:

Soil fertility and nutrient management:

Germplasm for stress environments:

Advances in Plant Protection

Bio-control based IPM in vegetables:

Advances in Animal Sciences

Eucalyptus

Trichogramma Chrysoperla)

Bactrocera zonata) B.

cucurbitae

2 5

4

5 6

6 5

3

treated animals. Deltamethrin detected in 20% milk samples ranged from 260–650 ppb which is higher

than EU permissible limit (20 ppb). PCR diagnostic assays were established for animal diseases including

FMD, HS, HPS and IBD.

Production of HS vaccine in collaboration with ATCOP runs successfully. The generated receipts during

2011 by sale of HS vaccine touched Rs.9.6M and 136733 vials were produced.

Farm Branch facilitated NIAB/NIBGE scientists to conduct field studies. A mother orchard

for LSK was planted on 5 acres. Branch increased crop yields with better cropping schemes and actively

participated in income generation program. Farm and buildings outlook was improved by growing more

ornamental plants and maintenance of green belts, building passages and channels. NIAB won first

position in two flower exhibitions "Taqreeb-e-Gul 2011" and “Chrysanthemum Flowers Competition

2011” at Faisalabad.

For germplasm improvement 5 semi controlled tunnels were constructed. Two units

for improvement of power factor and Chiller of HVAC plant of lab block-II were overhauled. EAS was

installed and made functional. LAN server machine was upgraded with enhanced bandwidth. E-circular

communication was started. Services for statistical analysis, economic analysis of institute products,

photography, computer system installations, application softwares, peripheral devices, display of

technical charts, etc. and audio-visuals were extended at all the events.

During 2011, NIAB scientists published over 90 research papers

, one book chapter and 16 pamphlets. The cumulative

impact factor of the center was 84.

Number of ongoing projects increased upto 18 and touched cumulative value of

Rs.181M during 2011. Projects were sponsored by: IAEA; SOPIB (Belgium); Sabanci Uni. (Turkey); ALP;

PARB; PSF and MINFA. Moreover, institute scientists prepared and submitted over 15 research proposals

of Rs.185M for funding to national/international agencies.

Seven training courses/workshops and three farmers days were organized as

reflected in “Scientific Events Calendar 2011”. In these technology transfer and knowledge sharing

activities, over 400 farmers from different parts of the country and 237 researchers/students from

various public/private institutes, organizations and universities participated. During 2011, 4 PhD, 10

MPhil and 17 MSc scholars completed research and 40 students from various universities conducted

internships at NIAB.

ISO 9001-2008 certification process was completed and issuance of certificate is

awaited. The process of affiliation with PIEAS for MPhil leading to PhD degree program is in final stage.

The Institute generated receipt increased upto Rs.12M during 2011.

The research efforts to improve crop plants is a continuous process to cope

lingering and ever changing biological, physical and erratically changing climatic conditions coupled with

current needs and perspectives of consumers. Therefore, NIAB envisages initiating research programs:

hybrid seed of selected crops, sudden death syndrome in fruit trees, LSK nursery with micro-propagation

and frost/heat tolerant legume crops.

The teamwork of fellow scientists and staff members has been commendable throughout the report

period and certainly deserves appreciation and acknowledgment. On behalf of the employees at NIAB

and on my own behalf, I sincerely thank the authorities at the PAEC Head Quarters particularly, worthy

Chairman Dr. Ansar Parvez, Member Science Dr. Badar Suleman and Director General (Agri. & Bio.)

Dr. Yusuf Zafar for visiting NIAB during 2011, reviewing research programs and their continued support to

identify issues and modify objectives to improve agriculture productivity.

Farm Branch:

Technical Services:

Publications:

Funded projects:

Scientific events organized:

Other activities:

Emerging Research Goals:

Acknowledgments

Dr. Javed Akhtar

Directo

in national and

international journals and conference proceedings

r

4

Fresh crosses were raised to develop new Btgermplasm and 125 crossed bolls were obtained indifferent combinations.

An early maturingand high yielding(2745kg/ha) NIABC a s t o r - 2 0 1 2m u t a n t w a sexamined for Spotby Expert Sub-Committee of PSC.

Four mutants ofsesame (NS-260,NS-44-SP1, NS-22,and NS-103-1) were evaluated for yield and otherplant characters. These mutants produced 30-40%higher yield, and showed 4-5 weeks early maturitythan standard TS-3. These mutants were included inNCVT for evaluation.

Field trials of non-aromatic line RSP-2 wereconducted at NIAB, Pindi Bhattian and PSC farmsSahiwal. This line produced paddy yield up to4100kg/ha at saline area of Pindi Bhattian (EC9dS/m) while at NIAB it produced up to 8500kg/ha.In addition to high yield and salt tolerance, RSP-2showed lower water requirement from 600-990mmc o m p a r e d w i t h 9 0 0 - 2 5 0 0 m m g e n e ra l l yrecommended for a normal rice crop.

Two early maturingand dwarf Basmatimutants namelyEF1-30-39-04 andE F 1 - 2 0 - 5 2 - 0 4scored 1 and 3positions in NUYTproducing paddyyields of 4391 and4 0 8 4 k g / h a ,respectively (11.2 and 3.4% higher than Super).

Four Basmati mutants were evaluated for yield andother plant characters in station yield trial. Mutant

Oil seeds (sesame/castor)

Rice

Evaluation of elite recombinant lines instation/national yield trials

st rd

I. PLANT BREEDING & GENETICS DIVISIONVarietal maintenance and pure seed production

Cotton

Release of Non-Bt Cotton variety NIAB-852

Bt cotton mutants

Supply of pure and quality seed is a key factor for thesuccess and long life of a variety in the field. Pre-basicseed of earlier approved varieties including Cotton:NIAB-111, NIAB-846, NIAB-777 (1800kg); Rice: Niab-Irri-9 (200kg); Mungbean: NM-2006, NM-2011(1592kg); Lentil: Masoor-2002, Masoor-2006(2500kg) and breeders nuclear seed of chickpea: CM-2008, CM-98 (1500kg) was raised during year 2011.The seed was provided to stakeholders includingfarmers, progressive growers, private companies,researchers and PSC.

A high yieldingca n d i d ate l i n e ,N I A B - 8 5 2 w a srecommended byE x p e r t S u b -Committee of PSCfor approval.

Five candidate elitem u t a n t s w e r eevaluated in NCVT,

PCCT and PSC yield trials. NIAB-9811 scored 1position and NIAB-2009 showed position in alltrials compared with checks. Due to high yield andCLCuV tolerance, Mutant-112 was included in NCVTand PCCT trials.

Spot examination of candidate lines NIAB-2008,NIAB-9811, NIAB-2009, NIAB-2010 and IR-NIAB-824was conducted at PSC. Samples of NIAB-852 fromPSC farm were collected by Expert Sub-Committeefor fibre quality evaluation.

Advance cotton generations derived with seed andpollen irradiation including M (81), M (132), M (62),M (10), M (80) and M /M (262) were evaluated infield. Many segregating generations were grown forpyramiding resistance genes from all sources. 345progenies in F , 135 in F , 96 in F , and 149 in F wereevaluated.

For generation advancement mutants with Cry-1AcBt gene in BC and BC and hybrid generations weregrown in field and glass house, respectively. Selected22 and 11 Bt lines were grown in two replicated PYTwith checks IR-3701 and Tarzan-1. NIAB4-61produced highest cotton yield of 5280kg/hafollowed by NIAB4-46 (4850) and NIAB4-40 (4516)compared with Tarzan-1 (4253), IR-3701 (3370) andnon-Bt CRSM-38 (2115). NIAB4-67 produced highestcotton yield of 3640kg/ha followed by NIAB1-5(3375) compared with Tarzan-1 (3086).

st

8 7 6

5 4 2 3

7 5 4 3

5 6

3rd

Plant Breeding & Genetics Annual Report 2011

Scientists of Plant Breeding and Genetics Division

Castor Spot Examination

A field view of EF-52

A field view of NIAB-852

NIAB-852

FF 52

SuperBasmati

5

recombinants CC121/00 and CM1528/03 produced5.8% and 3.4% higher GY than checks.

Desi recombinant CH85/04 produced highest GY(2067kg/ha) at five irrigated locations. I atthree barani locations, line CH38/04 exhibitedhigher GY (1453kg/ha). Kabuli recombinantsCH47/04 and CH73/02 exhibited highest GY 1767and 1759kg/ha, respectively.

In advanced trials at six locations, desi CM541/05and CM907/05 produced higher GY 1969 and1965kg/ha, respectively. In CAYT-K, kabuli lineCM579/06 gave 12% (1868kg/ha) higher GY followedby 11.5% (CM770/06) and 8% (CM759/06) thancheck at seven locations.

Three lines CH79/06, CH3/06 and CH115/06 werefound resistant to blight and highlyresistant to wilt. Four lines CC121/00, CH20/06,CH1333/05 and CM1399/05 were found resistant toblight and wilt at out-stations. Three exotic accessionswere found resistant to blight out of 45 obtained fromICARDA.

Two sets of studies were conducted under PARBproject for drought screening. On the basis of higherGY, 55 out of 204 and 18 lines out of 54 were selectedunder rainfed conditions at NIAB, PRI (AARI), AZRI andKalurkot. Using physiological and biochemicaltechniques, 16 kabuli and 13 desi drought tolerantlines were selected.

Root rot caused by pathogenis

becoming a serious threat tochickpea production in Punjab. TheNIAB scientists found 25-30%incidence of the disease duringsurvey of major chickpea growingdistricts like Bhakkar, Jhang andMianwali. This is reported first timein Pakistan.

NIAB evolved high yielding, early maturing, anddisease resistant mungbean germplasm withdeterminate planthabit. This programplayed a significantrole in developingeleven approvedvarieties and somei n p i p e l i n e . Aversati le NM-92v a r i e t y r u l e dmungbean area in

n CCYT,

Screening against blight and wilt

Detection of root rot in Thal areas of Punjab

Mungbean

Release of new variety NIAB Mung 2011

Ascochyta

Neocosmospora vasinfecta

201001 (EF1-15-4-1-1) produced 23% higher paddyyield (5046kg/ha) than Super (4104) and wasincluded in NUYT. The long grain mutant had earlyflowering (113days) than Super (127days). Therecombinants, 201005 and 201008 produced higherpaddy yields (4259 and 4228kg/ha, respectively)than Super (4112). Both the recombinants hadlonger paddy lengths and flowering times at par withstandard.

Thirteen mutants of Basmati 370 with Super wereevaluated in two sets of station trials. Mutants201021, 201015 and 201019 produced 31.9, 14.9and 10.3% higher paddy yields, respectively, thancheck. These mutants showed lesser flowering days(115-121) and plant height (128-136cm) thanstandard (129 days and 147cm, respectively).

Recombinant line 201034 produced higher yield of4226kg/ha than Super (3860) out of 39 studied. Fourpromising lines showed flowering in 123-129 days(129check) and plant height 138-158cm (150check).Two exotic salt tolerant lines St-5 and St-8 producedhigher yields of 6250 and 5952kg/ha, respectively.

Based on GY, 300 recombinants were selected fromcross combinations in F /F . 47 mutants of EF1-20-119-99 in M were evaluated. 55 mutants wereisolated from M of Basmati 370. M generations ofBasmati 370, Super Basmati, RD 25, KSK-515, andmutants RSP-2 and EF-39 were raised at 150, 200,250 and 300 Gy. 100 accessions and approvedvarieties of both aromatic and non-aromatic ricewere maintained for use in cross breeding program.

Low phytic acid mutants were crossed with theirparent (Super Basmati) to select the recombinantswith good yield, shattering resistance and bettergermination.

To develop maintainer and restorer lines for hybridrice, three F populations of coarse rice hybrids RH-195, RH-198 and RH-216 were raised. CMS lines wereidentified using IKI test and crossed with commercialcultivars in coarse and basmati background. These Fpopulations were also used to select the promisinginbred lines and 41, 25 and 29 plants were selectedfrom RH-195, RH-198 and RH-216, respectively.

E l i t e l i n e s w e r eevaluated at severallocations. In NYT atnine locations, Desirecombinant (CH23/00) scored 2position producing2 1 3 2 k g / h a . I nCNUYT-K trial at sixl o c a t i o n s ,

3 2

3

2 1

2

2

Chickpea

nd

Annual Report 2011

Field view of Kabuli CM-2008

Plant Breeding & Genetics

NIAB MUNG 2011

6

Selection of true breeding lines in segregatinggenerations

Lentil

Agronomic studies

Eleven true breeding lines were selected from F -F ofdifferent cross combinations. Recombinants withdesirable traits were selected from F (32), F (5), F(74), F (28), F (27), and F (112) generations. F of 13crosses was also evaluated and hybrids wereconfirmed. 212 mutants were selected from M , Mand M generations. To create genetic variability, fiveapproved varieties were irradiated at 100 and 200 Gydoses of gamma and were sown in the field as Mgeneration.

NIAB NL-66172 producedhighest GY (1581kg/ha)followed by NL-9877 (1549)and NL-96475B (1471)compared with check (1)Punjab Masoor 2009 (1400)and check (2) Markaz 2009(1014) in adaptation trial atfour locations. In advance yield trial, the line NLM-0637461 produced the highest yield (2293kg/ha)followed by NLM-07181 (2262) compared with check1 (1588) and 2 (1541). In PYT, the genotype NLH-09005 produced maximum GY (2441kg/ha) followedby NLH-09006 (2367) compared with check 1 (1819)and 2 (1885).

Thirty four true breeding lines were evaluated in theyield screening nursery and genotype NLM-035225produced higher GY (1285kg/ha) than check 1 and 2.

For generation advancement, 209 true breedinglines were selected from F , M and M based on theirhigh bearing and disease resistance againstwilt. 497 mutants from M and M generations and387 recombinants from F and F were selected.Sixteen F cross combinations were raised and 12new crosses were attempted to create geneticvariability.

Three cotton lines were subjected to differenttreatments of zinc and boron. Generally, 15%increase in cotton yield over control was observedwith 0.1% foliar application of Zn and B after 60, 90and 120 days. Best yield of 3718kg/ha was noted inNIAB-852 with Zn+B and 3411 in CIM-496 with soilapplication of B (1.5kg/ha) + 0.1% foliar Zn and B.

Under moisture and nitrogen stresses, NIAB-852 andNIAB-777 produced highest cotton yield 3009 and3948kg/ha, respectively. In moisture stress atvegetative fruiting best interaction was observed atN dose 150kg/ha in NIAB-852 and 100kg/ha N inNIAB-777. NN-3 gave highest yield (2105) with half Pat sowing and half at flowering. NIAB-852 gave best

6 8

7 6 5

4 3 2 1

5 3

2

1

4 5 4

2 3

2 3

1

Fusarium

Pakistan for a long time and adapted well inneighboring countries like India, Srilanka, Burma andNepal. In Bangladesh it was approved for generalcultivation as BN-5.

During 2011, a new variety NIAB Mung 2011 wasapproved by PSC. It was developed by crossing ane x o t i c b o l dseeded accession(VC 1482E ofThailand origin)w i t h s m a l ls e e d e d N I A Bvariety NM 20-21. NIAB Mung2011 produced30% (2525kg/ha) higher GY than check in PYT. Inadvance yield trials, it produced 15% higher GY thanNM-92. In adaptation yield trials it produced 19%higher GY than NM-92 at 7 locations in Mianwali,Bhakkar and Layyah. NIAB Mung 2011 is highlyresistant to mungbean yellow mosaic virus. Itshowed lower disease intensity (2-5%) than checks15% (NM-92) and 10% (NM-2006) at AZRI. NM-2011is an early maturing (65-75days), short staturevariety with determinate plant growth habit. Othersalient characters includes 9.8cm pod length, 25-30seeds/pod and 100grain weight of 5.8g.

Distinct features includepurple hypocotyl base,green stem/leaf color,erect growth habit ,s y n c h r o n o u s p o dmaturity, long pods withblack color. Grains arebold, shiny coat with highprotein contents (25%).The cultivation of newmungbean variety NIABMung 2011 will enhanceoverall production in thecountry and farmersincome.

Candidate lines NM-10 scored 1 (929kg/ha) andNM-9 2 (884) positions, compared with AZRI Mung-2006. Among the twelve genotypes evaluated atNIAB, NARC and AZRI, NM 05-6-7 and NM 3960-88-5produced higher GY of 638 and 618kg/ha,respectively, than NM-2006 (564) and AZRI Mung2006 (478). In advance line yield trials MH3153 andMH5254 produced highest GY of 845 and 527kg/ha,respectively, than NM-2006 (400) and AZRI Mung2006 (349). In PYT highest GY of 511 and 347kg/hawere obtained from MMH12133 and MMH3615,respectively.

Advance lines under Station Yield Trialsst

nd

Annual Report 2011

Pods and seeds of NM-2011

Spot Test of NM-2011

Masoor-2002

Plant Breeding & Genetics

monopolized the citrusindustry in Pakistan. Thesoil and climatic conditionsin Pakistan have givenKinnow a unique flavorwhich distinguishes it fromo t h e r c o m p a r a b l emandarins grown in theworld. It has not onlyexcelled in area, productionand quality relative to other mandarin cultivars, buthas also surpassed the sweet orange cultivars in thecountry. According to an estimate 95% of the totalKinnow produced all over the world is grown inPakistan. Besides local consumption, it has highexport value due to unique taste, excellent flavor andhigh nutritional value. From the juice and fruitquality standpoint, it is an unmatchable mandarin inthe national and international markets.

Pakistan exported 96540 Tons of citrus fruits, worthRs.186 M during 2007-08 and accounted for 80% ofthe total exports. Despite all the good qualityattributes in Kinnow, very high number of seeds perfruit (25±5) is limiting its export as fresh fruit. Most ofthe target export markets of the Pakistani Kinnow arethose of developing countries. Only 2.6% of Kinnowexports target the markets of developed countries,which is due to the emerging demand for seedlessKinnow by the developedcountries. About 61% oftotal world exports ofmandarins are of seedlessvarieties.

Addressing the problem ofhigher number of seeds inKinnow, a project wasinitiated by NIAB to developa seedless Kinnow varietythrough gamma irradiation. Dormant bud irradiationcum grafting technique was employed and a lowseeded mutant (5±3 seeds/fruit) was evolved with anexposure dose of 20 Gy. The mutant resembles itsparent Kinnow in all the quality attributes recordedupto stage, except the number of seeds/fruit. Acitrus fruit with an average of five seeds is consideredcommercially seedless in the international market.

The registration process was initiated. Prior to startof its production on commercial scale, randomlyselected fruits were sent to stakeholders of variousR&D organizations in the country and evaluated fortheir quality characteristics (size, shape, colour andtaste) following 1 (Dislike) to 10 (Like very much)marking scale during 2011. More than 50%stakeholders awarded 65% marks to fruit size, 85%marks to fruit shape, colour, and taste and reported1-3 seeds/fruit, while 40% awarded 85% marks to

mV5

yield (2558) with P O at sowing, flowering, andfruiting. At 15cm spacing NIAB-852 produced bestyield (3150) with 150kg/ha N whereas NN-3 gavebest yield (4256) at100kg/ha. Increase in wheat GY(5.4Ton/ha) and bio-fortification or improvement ingrain-Zn was found with foliar spray of zincatedfertilizers at zinc deficient sites.

Thirty three lines weretested along with standardvarieties Nagina, Riograndeand V for heat tolerance.AL-1, AL-3 and AL-7 weref o u n d h e a t t o l e r a n tcompared with checks.Twenty two lines werefound free of late blight, catface and blossom end rotdiseases. In F /M generations, none of 21 linesproduced good yield due to prolonged watershortage at fruit setting. Thirty four lines wereselected with a yield ranged 2.0 to 3.7 kg/plantagainst 1.4 kg/plantof variety Money Maker in F /M .High yielding 185 recombinants were selected with2-5 kg/plant yield compared with 1.5kg/plant ofstandard variety. Fifteen male sterile plants in F and7 in F population were selected to develop malesterile lines.

Combining ability and heterosis estimates weredetermined from 24 crosses generated by crossing of3 lines and 8 testers to isolate good combiners.Hybrids namely 88572 × B21, 88572 × B26, 88572 ×B27 and Pakit × B24 showed significant specificcombining ability effects for yield/plant and numberof fruits/plant. Hybrid 88572 × B27 had the higheststandard heterosis (138%) with yield of 4.3kg/plantfollowed by 88572 × B25 (112% with 4.1kg/plant),88572 × B26 (104% with 3.9kg/plant), 88572 × B21(97% with 3.8kg/plant), 88572 × B22 (84% with 3.6kg/plant), 88572 × B24 (80% with 3.5kg/plant), Pakit× B25 (69% with 3.3kg/plant ) and Pakit × B24 (63%with 3.2kg/plant). Among 11 parent lines, 88572,B24 and B25 displayed significant general combiningability effects for yield per plant, number of fruits perplant and fruit length. In addition, 88572 and B22recorded desirable general combining ability effectsfor early maturity.

Citrus is a prized fruit of Pakistan and holds numberone position among all fruits both in area andproduction in the country. Among citrus fruits,Kinnow has gained special significance and has

2 5

1

4 4

3 3

3

2

Vegetable (Tomato)

Performance of advance lines in trials and selectionin segregating populations

Performance of F hybrids

Development of Low Seeded Kinnow Variety

1

Annual Report 2011

7

Plant Breeding & Genetics

8

genotypes showed resistance against pathotype III.

Paidar 91 was resistant and CM-88 showed partial

tolerance against pathotype II. Eleven genotypes

confirmed drought tolerance with delayed leaf

senescence.

81 genotypes were screened for drought

tolerance at seedling stage using biochemical,

physiological and seedling growth indices. RWC-TI

(%) significantly correlated with CMS, injury and

RWC, glucose, amylase, MDA and seedling fresh

weight. Barani-83 and HD-2169 were found drought

tolerant applying cumulative drought tolerance

index.

Five hybrids, 7 accessions and 12 varieties

were analyzed by SDS-PAGE for seed storage

proteins. Variety VCT-l was most divergent and

hybrid Avinash distinguished due to 58kDa and

64kDa peptides.

Profiling of seed of 10 advance

lines, 2 checks and 11 parents was conducted with

SDS-PAGE. Resolved protein peptides belonged to 8S

and 7S vicilin, 2S and 11S globulin and 2S albumin as

confirmed with databases.

Waste water samples of textile industry were treated

with different doses of radiation. At 39 KGy gamma

dose pH, EC and total suspended solids reduced and

dissolved oxygen increased. Poly vinyl alcohol aided

methyl red and methyl blue dye films were tested at

different doses for color change and found to be the

best indicator of 200KGy. The shelf life of garlic

extended up to 60 days with radiation at ambient

temperature. To create color variation in ornamental

plants 1800 samples of 20 varieties were irradiated

at different doses. Low radioactivity isotopes ( C, P

and I) from NIAB/NIBGE were treated for disposal

according to IAEA protocols. The exposure files of

NIAB/NIBGE radiation workers were maintained and

radiation absorbed dose ranged 0.5-0.86msv/year.

Twenty five radiation certificates were issued to

National Companies for export purposes.

Wheat:

Tomato:

Mungbean:

Radiation Safety Services

protein

14 32

125

fruit size, 65% marks to fruit shape, colour and tasteas well as recorded 3-5 seeds per fruit and theremaining 10% declared samples extraordinary in allaspects. All the stakeholders highly appreciated theexcellent achievement of NIAB and recommended itsproduction on commercial scale.

DNA samples isolated from 20 cotton lineswere amplified with universal primers. DNAfragments 2-10 per primer were amplified some ofwhich will be used for identification of varieties asshown by the primer H22 (Fig. 1).

Races of pathogen causing wilt,f.sp. were characterized in 49

wilted samples from Thal, Thar and Faisalabad. Race2 was detected in Thal and Thar and in Faisalabadsamples ecotype of race 6 was observed.Amplification of DNA fragment by race 6 specificSCAR primer is shown Fig. 2.

Six local genotypes were screened for pathotypes II

and III, blight causing pathogens. None of the

Marker Assisted Breeding

Cotton:

Chickpea: Fusariumoxysporum ciceris

Annual Report 2011Plant Breeding & Genetics

9

with normal soil irrigated with brackish water. Undernormal irrigation, reasonable crop yield may bepossible on marginally saline soil with adequateleaching to reduce salt accumulation.

Three genotypes (Sehar-2006, Faisalabad-2008 and Sitta) were tested under saline fieldconditions (ECe 12-18dS/m). The genotype Sehar-2006 outperformed the other two genotypes. Themaximum plant height (94.4cm), number of

productive tillers (3.89), spike length (10.4cm)number of grains per spike (56), GY per plant (8.67g),biomass (7300kg/ha) and GY (2577kg/ha), wasrecorded in genotype Sehar-2006 followed by Sitta,while minimum growth and yield was recorded inFaisalabad-2008. Wheat variety Sehar-2006 could begrown on moderately saline soil to obtain better GY.

Forage production was assessed inbased agro-forestry system on

saline land (ECe 12.3-21.7dS/m, SAR 18.4-31.2)irrigated with saline groundwater (EC 4.7dS/m, pH8.6, SAR 39.7 and RSC 21.3meq/L) and soilamendments. Fresh forage yield of

Wheat:

Agro-forestry on saline lands

Acacia nilotica -Brachiaria mutica

B. mutica

II. SOIL SCIENCE DIVISIONThe scientists continued to develop technologies forsustainable use and conservation of natural soil andwater resources, for increased crop productivity,better quality farm produce and improvedenvironment. The research focused on germplasmselection for stress tolerance, water use efficiency,plant nutrient management and phyto-remediationof salt-affected and polluted lands. The progress ofresearch activities is presented hereunder.

The R&D work at Pakka Anna was continued. Newplantation of wasestablished on 45 acres, and restocking was done toreplace dead seedlings in 80 acres ofplantation established in 2010. In addition, salttolerant forage grasses were planted on 10 acres andwheat/barley on 15 acres. A Farmers' Field Day wasorganized in March 2011; over 150 farmers,extension workers and post-graduate studentsparticipated in this technology transfer activity.Several delegations including Member (Science) andDirector General (A&B) from PAEC HQ, DCOFaisalabad, from pulp industry, and a large number ofresearchers and post-graduate students of variousuniversities visited BSRS, Pakka Anna.

Eight cotton lines (IR-901, NN-3, NIBGE-314,IR-3701, IR-NIBGE-1524, NIAB-852 and IR-NIAB-59)were screened for salt tolerance. Soil and watersalinity caused more than 50% reduction in biomassat maturity in all lines. No cotton line survived inPakka Anna soil (ECe 7.6dS/m) irrigated with brackishwater (EC 6.8dS/m); salt accumulation led to saltbuild up (13.5dS/m) beyond tolerance levels.Minimum reduction (13%) in seed cotton yield wasobserved in genotype NN-3 when grown in normalsoil (ECe 1.9dS/m) irrigated with brackish water (EC6.8dS/m), compared to other varieties showing17–34% reduction. In saline soil of Pakka Annairrigated with normal water, 12 to 32 % reduction wasobserved in biomass of tested varieties compared

Bio-saline Agriculture

Screening germplasm for salt tolerance

Cotton:

Eucalyptus camaldulensis

Eucalyptus

Soil Science Annual Report 2011

Scientists of Soil Science Division

Growth of salt tolerant cotton lines at BSRS

NIAB/NIBGE team monitoringcotton emergence at BSRS site

Wheat germinationin high salinity

Promising salt tolerantlines at maturity

NIAB-852

I.R. NIAB

10

(1.10%) in Grass carp. Among mineral contents,maximum value (64.8mg/g) of phosphorus andsodium (11.6mg/g) was observed in Thaila andmaximum potassium (8.1mg/g) was observed inGulfam. Results indicated that the nutritionalcomposition of these fish species obtained frombrackish water is comparable to literature values insame species obtained from freshwater medium.

Phosphorus sources (DAP, TSP and PA) wereapplied by surface mixing, fertigation, placing belowseed on maize grown for 35 days. PA produced higherdry biomass (6.4g/pot) followed by DAP (5.4) and TSP(5.3). P uptake was maximum (20mg/pot) at thehighest rate (88 kg P O /ha) of PA and improved N

uptake in shoot. Post harvest soil analysis showed noadverse effect of PA on soil properties (pH, EC, CaCO ,

organic matter and nitrate reductase activity) even atthe highest rate of its application.

PA applied at transplanting and 1 irrigationenhanced rice yield compared with DAP and TSP andPA. However, lower rates (22 & 44 mg P O /kg) were

more effective in increasing grain and straw yield.Minimum P uptake (75mg/pot) was found in controlwhile it was maximum (122mg/pot) at the highest Prate (88 mg P O /kg soil) applied as PA.

Rock phosphate+HCl (RPM) application increased Puptake in rice compared with control, SSP, H PO ,

RPM+ H SO and SSP+ H SO . No adverse effects on

soil properties (pH, EC, N, HCO , Ca+Mg and organic

matter) was observed.

Paddy yield increased with the increase in number offoliar sprays. Higher GY (18%) was observed withthree sprays of full recommended dose than control.

PA was also tested on wheat in differentdistricts of Punjab placing 5cm below seed.Subsurface application of PA produced maximum GY(4197kg/ha) followed by TSP and DAP, fertigation atfirst irrigation and broadcasted at sowing.

P uptake was influenced significantly by dose rates.Maximum P uptake (15kgP/ha) was observed at PA(88 kgP O /ha) applied through banding. PA at lower

rates (22 & 44 kg P O /ha) was found more effective

in increasing P use efficiency compared with higherrates (66 & 88 kg P O /ha). P treatments also

improved grain N uptake.

Soil fertility and plant nutrition

Phosphoric acid (PA) as P source for crops

Maize:

Rice:

Rock phosphate and HCl as P source

Foliar application of soluble NPK

Wheat:

2 5

3

2 5

2 5

3 4

2 4 2 4

3

2 5

2 5

2 5

st

41.6Ton/ha was obtained with application of gypsumGR 100% + FYM @10Ton/ha followed by 37.8Ton/hawith application of GR 100% + FYM @ 5ton/ha ascompared to control (23.7Ton/ha). Soil propertiesshowed reduction in EC from 12.3-21.7 to 8.4-14.6dS/m and SAR 18.4-31.2 to 15.4-28.7 in surfaceprofile. Agro-forestry is a suitable option forimproving productivity on wastelands and soilamendments further enhance soil amelioration.

Wood samples ofand

grown on saline land, were analyzed forquality parameters. These tree species differ greatlywith respect to different quality parameters likedensity, static bending strength, elasticity. All thetested species have strength properties comparablewith Shisham wood and thus have good utilizationpotential for wood products. Energy value of thesewoods was also determined. Maximum calorificvalue was observed in(4900kcal/kg) and minimum in(4540kcal/kg). The tested tree species have goodpotential for timber and fuel production in salineforestry system.

Growth performance of four fishbreeds: (Thaila),

(Silver carp),(Grass carp) and (Gulfam) wasassessed in saline water (EC 4.7dS/m, pH 8.6, SAR39.7 and RSC 21.3meq/L). All four species were welladapted to formulated feed and roughages in salineenvironment. Silver carp fed with formulated feed @3% body weight alternated with roughages hadmaximum production (3200kg/ha), followed byThaila (2910kg) Gulfam (2880kg) and Grass carp(2760kg); gross production of fish fed on roughagesonly was decreased by 30-45%. The use of salttolerant roughages alternated with formulated feed(20% CP) is suitable for polyculture system in brackishwater to obtain economic production.

Six fish species, viz.Rohu ( ), Mori ( ), Thaila,Silver carp, Grass carp and Gulfam, collected frombrackish water pond were analyzed for quality.Maximum protein content (21%) was observed inSilver carp and minimum (17.3%) in Grass carp.Minimum amount of water content (70.8%) andmaximum ash content (6.49%) and carbohydrates(1.86%) were observed in Gulfam. Total fats wereobserved maximum (2.11%) in Mori and minimum

Wood quality of salt tolerant trees

Aquaculture

Fish Polyculture:

Composition of fish species:

Eucalyptus camaldulensis, Acacianilotica, A. ampliceps, Prosopis juliflora Tamarixaphylla,

E. camaldulensisA. ampliceps

Catla catla Hypophthalmichthysmolitrix Ctenopharyngodon idella

Cyprinus carpio

,

Labeo rohita Cirrhinus mrigala

Annual Report 2011Soil Science

11

foliar spray of Zn @ 0.5%ZnSO and K @ 0.5%K SO .An advance rice line RSP-2 produced higher yieldthan Shaheen and Super Basmati at three sites.Maximum paddy yield was recorded at Farooqabadfollowed by Gujranwala and Pindi Bhattian.

Excessive dropping of kinnow fruit is a severeproblem which reduces yield. Studies in citrus-growing area of Punjab revealed that foliarapplication of 2-4 D and Salicylic acid @ 10 mg/L eachreduced the fruit drop by 25% and also improvedjuice quality by enhancing TSS/acid ratio.

The 1% HA aqueous solution showed pH from 7.3-10.2 and EC 314–2670 µS/cm. Solubility of 2% HA in0.1 N NaOH varied from 30–98%. HA concentrationvaried from 15–89% in original sample. Total organiccarbon in HA original samples varied from 10–36%, inextracted HA samples 4–23% and in extracted FAsamples 0.5–2%. Optical densities decreased withincrease in wavelength and were correlatedsignificantly with carbon contents. Maximum growthof fungi ( spp and

and spp andwas observed at 0.025% HA.

Effect of urease inhibitor N-(n-butyl) thiophosphoric-triamide (NBPT) on wheat yield was evaluated underfield conditions using two urea-N rates (90 and120kgN/ha) and two wheat cultivars (November-

4 2 4

Control of fruit drop in Kinnow

Physicochemical properties of humic acid andgrowth of fungi

Urease inhibitor NBPT increases wheat yield underfield conditions

Trichoderma . (harzianumhaementum) Alternaria . (alternatacitrae))

Foliar application of soluble fertilizer

Evaluation of NIAB urea phosphate (UP)

Evaluation of NIAB chelated micronutrients

Urea sulphate enhances rice yield

Cotton:

Improvement in rice yield with Zn and K on salt-affected soils

Wheat GY increased with the increase in number offoliar sprays. Higher GY (20%) was observed withthree sprays (full recommended dose) and 9.5% withhalf dose of soil applied N and P than control. Thebiomass of the crop also increased (10%) withincrease in number of sprays of the soluble fertilizer.

UP containing 17%N and 44%P O , an acidic fertilizer(pH 2) was prepared and its efficacy was comparedwith di-ammonium phosphate (DAP), a basicfertilizer (pH 8). UP showed its superiority to DAP forall the agronomic parameters of wheat grown innormal and saline soils at different levels of soilapplied P (20-80 ppm P O ). Increase in GY (overcontrol) ranged 2.75–17.7% and 1.3-9.2% with UPand DAP, respectively, in normal soils that was54–75% and 30–62% with UP and DAP, respectively,in saline soil conditions.

Plant micronutrients are deficient in our soils andfoliar application of chelated micronutrients hasbeen well documented. EDTA chelates of differentmicronutrients prepared in powder form weretested on super basmati rice through foliarapplication. Maximum increase in paddy yield (36%over control) was obtained with the foliar spray ofchelated Zn compared with soil applied non-chelatedmicronutrients.

Urea sulphate, a highly acidic N fertilizer (pH <1,N15%) was applied on super basmati rice with P @90kg/ha (SSP) applied to all treatments. Ureasulphate produced 14% more paddy compared withurea confirming that acidic N fertilizers are moreeffective to increase rice yield.

UP (17% N & 44% P O ), urea sulphate (SUN,15% N) and urea chloride (HUN, 15% N) were testedwith checks (urea and DAP) in cotton. HUN+DAPshowed maximum (41g/pot) seed cotton yield, 20%higher than Urea+DAP. The treatments followed theorder HUN+DAP > SUN+DAP > Urea+UP > Urea+DAPfor cotton production. The leaf analysis revealed thatnitrogen was maximum (2.8%) in SUN+DAP treatedplants followed by HUN+DAP (2.6%), Urea+UP (2.5%)and Urea+DAP (2.2%).

Foliar application of Zn+K @ 0.25%ZnSO +0.25%K SO produced 23% higher yield than controlwhich is at par to K SO @ 100 kgK O/ha, Zn+K @ 15kgZn/ha + 50 kgK O/ha incorporated in soil and

2 5

2 5

2 5

4

2 4

2 4 2

2

Annual Report 2011Soil Science

Without spray 2-4D spray

SA + 2-4Dspray SA spray

12

Plant-water relationships

Screening crop for drought tolerance (DT)

Rice:

Cotton:

Chickpea:

Screening rice for heat tolerance

Maize productivity with irrigation management

Non-aromatic rice lines rice lines RSP-1, RSP-2,KSK-133 and NIAB-Irri-9 were screened in lysimetersunder different waterregimes. RSP-2 showedhighest but similar GYin well-water (WW)and medium-water(MW) irrigation. Non-significant yield loss bydirect seeding, 25%water-saving underMW and higher (6.75)number of days to complete excise water lossconfirm that RSP-2 is drought tolerant and isrecommended for low and soil-stored moistureconditions.

Out of 10 advance lines screened for DTusing physiological indices, line N-852 performed thebest followed by CIM-496, CIM-534 while NIAB-777and N-2010 were medium tolerant.

Fifty four lines were found DT out of 204.Dry biomass, stress tolerance and cell membranestability were suitable physiological indices for DT incotton and chickpea.

Thirteen rice genotypes, viz. EF-1-25-32-1, DM-1-30-3-39, RP-2; DM-1-20-7-99, EF-76-1, DM-1-30-15-04,DM-1-20-29-4-1, DM-15-13-1, M-107-4, DM-1-20-3, DM-1-15-1, Kashmir Basmati and EF-1-25-3-02were identified for high temperature (45 C)tolerance using physiological indices.

Maize grown under drip irrigation producedsignificantly higher BY (16%), GY (17%) andconsumed 15% less water than furrow irrigation.B o t h b i o m a s s ( 5 2 k g / h a / m m ) a n d g ra i n(22kg/ha/mm) water use efficiency showed similartrend. In various field trials on maize, canopy growthand biomass predicted with AquaCrop model wereclose to measured values. However, over estimationwas more under furrow irrigation.

o

sown cv. Sehar and December-sown cv. Bhakkar). Inboth cultivars, significant increase in the GY (12 to24%) was recorded when urea applied at 90 kgN/hawas amended with NBPT @ 1% of urea-N (Figure 1).Taking into account the yield increase, fertilizersaving and cost of urease inhibitor, the net benefitdue to NBPT ranged from Rs.15600/ha (Sehar) to Rs.24600/ha (Bhakkar). An extensive adaptive researchis needed before the inhibitor may be recommendedfor incorporation in urea granules by ureamanufacturers.

Studies were conducted to evaluate effect of ureaapplication methods on yield of late wheat varietyBhakkar. Urea was applied at two rates (80 and120kgN/ha) by four methods: (i) as granules byconventional broadcast method in two splits, (ii) asgranules broadcast followed by incorporation all atsowing, (iii) as granules applied along seed rows (8cm depth) all at sowing, and (iv) as liquid appliedalong seed rows (8 cm depth) all at sowing. Ureagranules (all applied at sowing) @ 120kgN/ha alongseed rows at about 8 cm depth produced an extra503kg/ha of grain (11% increase over conventionalbroadcast method; Figure 2) without affecting thegrain N concentration. This increased GY isequivalent to an additional income of Rs. 11900/ha.Application of urea along seed rows can be carriedout simultaneously at sowing using seed-fertilizerdrill.

Subsurface application of urea along seed rowsincreases wheat yield

Annual Report 2011Soil Science

Figure 1: Effect of urease inhibitor ‘NBPT’ on dry matter yield of

two wheat cultivars fertilized at two urea-N rates.

7578

8523

4370

5747

8403

10350

5438

6433

7580

10623

4933

5683

7445

9300

5148

5493

4000

6000

8000

10000

12000

Straw (cv Bhakkar) Straw (cv Seher) Grain (cv Bhakkar) Grain (cv Seher)

Urea 90 kg N/ha

Urea 90 kg N/ha + NBPT 0.9 kg/ha

Urea 120 kg N/ha

Urea 120 kg N/ha + NBPT 1.2 kg/ha

Yie

ld (

kg/h

a)

Figure 2: Dry matter yield of wheat cv. Bhakkar as affected

affected by urea applied at 120 kg N/ha by different methods

4600

6552

4458

6490

5103

7405

4335

6695

3000

6000

9000

Grain Straw

Granules broadcast in 2 splits (conventional)

Granules incorporated (all at sowing)

Granules sub-surface (in rows, all at sowing)

Liquid sub-surface (in rows, all at sowing)

Dry

matter

yie

ld (

kg/h

a)

Control

Heat Stressed Normal Heat Stressed

Control

13

variety Niab-Irri-9). Candidate line RSP-2 wasincluded in NURYT during 2007 and 2008. In NURYTsof 2007 at seven locations, RSP-2 secured firstposition producing 17.6% higher yield than KS-282.In NURYTs of 2008, RSP-2 produced 15.5% higherpaddy yield than KSK-133. Disease incidence ofBacterial Leaf Blight (BLB), Brown Spot and graindiscoloration was recorded in 2006 and 2007. RSP-2was highly resistant to Brown Spot, Niab-Irri-9 andKS-282 were resistant and moderately resistant,respectively. RSP-2, Niab-Irri-9 and KS-282 weremoderately resistant to BLB but moderatelysusceptible to grain discoloration.

The case of RSP-2 for Spot Test was presented beforeexpert sub-committee of PSC. The committeerecommended RSP-2 for presentation in next expertsub-committee meeting for approval as a varietyafter visit during Sept. 2011. The line is high yielding,drought/salt tolerant, and also lodging and diseaseresistant.

Ld value (lethal dose to kill 50% population) of 6varieties has been calculated depending upon thedata of germination percentage and root/shootlength. The M material is now in the field and themain focus will be given to the tips blackening whichis the main problem of the variety Sehar.

Fifty three fresh crosses were made among theselected drought tolerant and high yielding linesduring the year 2010-11. The successfully harvestedcrosses have been sown for next round of evaluation.

Wheat germplasm for stress environments

Mutants evaluation

Fresh crosses evaluation

50

0

Development of drought tolerant rice (RSP-2) usingC isotope discrimination technique

13

Rice, with 2.5 billion Rupees foreign exchange andsecond staple diet in Pakistan, has great economicvalue. Institute evolved two varieties of rice- KashmirBasmati and Niab-Irri-9 for lowland and irrigatedareas. Development of drought resistant and salttolerant cultivars is a major challenge due to decreasein fresh water resources and increase in saline areas.The studies conducted at NIAB confirmed that Carbonisotope discrimination (∆) is an excellent indirectscreening tool to identify crop plants for megaenvironments (Low, medium and well water). NIAB

applied ∆ technique to screen rice germplasm fordrought tolerance. Five rice genotypes (RSP-1, RSP-2,RSP-3, RSP-4 and RSP-5) with low ∆ were selected andtested under different water regimes in lysimeters(controlled soil moisture) for their waterrequirement. Out of five tested lines, RSP-2 gaveoptimum yield (7367 to 5499kg/ha) with 762-990 mmirrigation water compared with 900-2500 mmnormally recommended.

In station yield trials, conducted for four years, RSP-2showed very high yield potential (8500kg/ha). Innational yield trials, RSP-2 produced 17% higher yieldover check variety KS-282. In adaptation trials RSP-2produced up to 4100kg/ha, 15% higher yield thanNiab-Irri-9 under saline soil conditions (EC:10dS/m)at Soil Salinity Research Institute, Pindi Bhattian.Preliminary seedling tests of RSP-2 at BiosalineResearch Station at Pakka Anna (Soil EC:12-16 dS/mand Irrigation water EC:4-6 dS/m) indicate that RSP-2is more salt tolerant compared with all commercialcultivars in the country.

In PYT, RSP-2 produced 6851kg/ha paddy yield(17.15% higher than Niab-Irri-9 and 19.6% higherthan KS-282). In advance yield trials RSP-2 produced7575kg/ha paddy yield 9.3 and 20% higher thanNiab-Irri-9 and KS-282, respectively.

In stability and adaptability studies conducted atthree locations Pindi Bhattian, Sheikhupura andGujranwala for two years, RSP-2 produced6331Kg/ha seed yield (13.18% higher than check

Annual Report 2011Soil Science

RSP-2 exhibits very high yield potential Spot Test of upcoming rice variety RSP-2

Chairman PAEC visits rice field

RSP-2

14

higher than checks have been included in local trials.

Screening against rust diseases is underway undernatural conditions and due to the obligate nature ofthe pathogens some crosses will be attempted innext year.

Material crossed in the years 2004-05 and 2005-06 isnow in F and F generation, respectively. In year2010-11, 35016 F plants were grown from 16 crossesand 19600 F plants from 20 crosses. Performanceindicators are presented in Table-1.

Table 1: Summary of selected wheat progenies.

SPP= Single Plant Progenies

Advancement of generations

*

5 6

5

4

National and international collaboration

Wheat lines for heat and rust tolerance/resistance

Mutual material sharing with national andinternational institutions is also in pipeline which willnot only increase the variation in the localgermplasm but also will be a great source of localadvance lines improvement.

To mitigate the effect of increases in heat emergingdue to abrupt climatic changes and wheat rust atflowering stage studies have been started. Materialdeveloped locally and obtained from WheatResearch Institute (AARI, Faisalabad) has been grownwith different sowing dates. These lines will bescreened using morphological and physiological dataand crosses will be attempted in desirable parentsbased upon the membrane thermo-stability.

Six wheat lines (C P -4, C P -9, C P -20, C P -13,C P -25 and C P -3) developed using carbonisotopic discrimination technique showed droughttolerance.

Two exotic lines (CYT-20 and CYT-37) screened fromCIMMYT and some newly developed lines yielding

1 47 7 1 10 4 7 28

10 45 1 27

Annual Report 2011Soil Science

Stage SPP ProgeniesSelected

Segregating

F5113 ideotype

selected

F4

244

140

7029 in PMYT5917 in PMYT

5 (in field)

15

Estrus induction and synchronization withmethylacetoxy progesterone sponges in cyclic andacyclic female buffaloes

A study was performed to determine the effect oflocally prepared intra-vaginal methylacetoxyprogesterone (MAP) sponges on estrus inductionand synchronization in cyclic and acyclic femalebuffaloes ( ) kept at livestock farm,UAF. Twenty healthy multi-parous female buffaloes,5-10 years of age and 350–610 kg weight weregrouped on the basis of their ovarian status (rectalpalpation) into cyclic (n=8) and acyclic (n=12) lots.The day of treatment was specified as day-0. Thecyclic and acyclic buffaloes were sub-divided intotreated (MAP sponges) and untreated subgroups.MAP sponges were prepared in the laboratory andinserted intravaginally in buffaloes by using asterilized glass applicator and rod for 16 days.Sponges were removed on day-17 and buffaloeswere observed for estrus upto 120 hours afterremoval of sponges. A teaser bull and observation ofmucus were used as markers for heat detection.Three out of 4 cyclic treated buffaloes showed heatand exhibited estrus, whereas 4 cyclic untreatedbuffaloes did not synchronize during observatoryperiod. However, these animals had corpus luteumconfirmed on day-11 after the removal of spongesshowing them to be cyclic but not synchronized.Estrus was induced in 3 out of 6 acyclic treatedbuffaloes, while all the acyclic controls did not exhibit

Bubalus bubalis

III. ANIMAL SCIENCES DIVISION

Nutritive value of planted at NIABfarm

Moringa oleifera

Moringa oleifera

Moringa oleifera

commonly known as “Sohanjna” isa fast growing drought and frost resistant multi-purpose tree with a tremendous variety of potentialuses. The common uses of this tree include alleycropping, animal forage, domestic cleaning agent, indyes, for fencing, as fertilizer, foliar nutrient, forgreen manuring, gum, medicinal purposes,ornamental and for water purification, etc. In orderto evaluate the adaptation and the nutritive value of

plant for feeding of livestock, apasture was developed at NIAB Farm in February2010. The pasture comprised of a horizontal plot

measuring 560 m with a row x row distance of 190cm and plant x plant distance of 100-120cm. Theplants were studied for agronomic as well as nutritiveparameters after nine and eighteen months ofplanting. The plant heights were 206cm and 393cmwith a crown width of 125cm and 286cm while thestem width of 4.4cm and 22.5cm on the twosampling stages (9 and 18 month after sowing)showing a vigorous growth of the plant. Similarly thefresh and dry matter yields of the plant were 892g/plant and 4830g/plant on the two sampling stages.

There was a lush green stand of the trees in evencoldest periods of the year showing the potential ofthis tree for year round supply of the forage. Theleaves sampled from the plants were processed intoMoringa leaf meal (MLM) and analyzed for proximateparameters. The dry matter content of MLM was19.2 and 24%, crude protein 22.9 and 17.2%, crudefibre 19.9 and 19.5, ether extract 4.9 and 4.8% whileash contents 9.5 and 7% at 9 and 18 months afterplanting. The higher crude protein and ether extractvalues represent potential of the MLM as animalfeed. Biological trials related to animal performanceby utilizing the Moringa leaf meal as animal feedsupplement are in progress at NIAB.

2

th th

th th

Animal Sciences Annual Report 2011

Goat kids grazing Moringa pasture

NIAB HS Vaccine being tested in rabbits

Scientists of Animal Sciences Division

16

was in acetonitrile and comparison of the samplewith standard was not possible. Third method ofHammock was improved one. It gave deltamethrinpeak at 10.2 minute. This method was adopted withslight modifications (to obtain peak earlier than this).In the revised conditions, column behaved well atwavelength of 266nm with the mobile phase ofacetonitrile: water (6:4 v/v) with 0.1% formic acid. Itshowed deltamethrin at 1.8 minute in methanol and1.92 minute in spiked milk samples.

Milk samples were collected from different dairyfarms and local market areas in the peripheries ofFaisalabad. These samples were analyzed by revisedmethod for deltamethrin monitoring. From theresults, it was observed that deltamethrin waspresent in 20% of the milk samples withconcentration range of 260- 650 ppb in the areas ofDhuddiwala, Ghluam Muhammad Abad andNarhwala Bangla. These residues levels are quiteabove the EU permissible limits (20 ppb) in milk.

PCR based diagnostic assays were established for keyanimal diseases including Foot-and-Mouth Disease(FMD), Hemorrhagic Septicemia (HS), Peste des petitRuminants (PPR), Hydropericardium Syndrome(HPS) and Infectious Bursal Disease (IBD) (Table-1).FMD diagnostic specimens that included epithelialtissues and saliva from suspected cases werecollected from six districts of Punjab includingFaisalabad, Lahore, Gujranwala, Bhakkar, Sahiwaland Okara. Out of 42 samples, 35 were found positiveusing universal primers (F1/R1). Infectious samplesfor the diseases: IBD (35), HS (3), PPR (15) and HPS (7)were collected from Faisalabad district; all thesesamples were detected positive on their respectiveRT-PCR or direct PCR assays except for HS where onlyone positive sample was detected.

Table 1: PCR Primer sequences and product sizes forthe diagnosis of animal disease.

Establishment of PCR based diagnostic assays forthe key animal diseases

estrus. Corpus luteum was confirmed through rectalpalpation on day-11 after estrus in all thesynchronized animals. Blood sampling was alsoperformed in all synchronized buffaloes after estrusdetection on alternate days till 24 days fordetermination of progesterone profiles. Serum wasseparated from the samples and stored at -20 C tillanalysis. In conclusion, the treatment with MAPproved effective in synchronizing estrus in 75% cyclicand 50% acyclic buffaloes.

A study was conducted to examine the efficacy ofprostenol for synchronizing estrus in dwarf goats

and the role of macro minerals inestrus synchronization with (Prostenol) with aninterval of twelve days. A flock was maintained atNIAB. Goats (n=8) were selected on the basis of theirpost-partum period > 2 months. Five goats weregiven (Prostenol) injection 12 days apart at a doserate of 0.5ml/goat, while 3 goats were kept ascontrol. A teaser buck was introduced in the herd forestrus detection and visual symptoms were alsonoticed. Blood collection was carried out for sodium,potassium and phosphorus determination. Inexperimental goats estrus was observed after 48 to96 hours of 2 Prostenol injection with a mean timeof onset of estrus at 72±33 hours. Estrus wasobserved in all treated goats (100% response) whileno estrus was exhibited by any animal of the controlgroup. Potassium in estrus was found to besignificantly higher in treated animals. Sodium andpotassium levels were found to be non-significant intreated as well as control groups. It is concluded thatdouble injection treatment of Prostenol was efficientin synchronizing estrus in goats and potassium mighthave some important role in estrus induction ingoats.

In continuation with the previous work, attemptswere made to determine ectoparasiticides in animalderived food. For this purpose, deltamethrin wasstandardized and applied to different milk samples.Column efficiency was evaluated with three differentanalytical methods for deltamethrin detections.

With US-EPA column method showed delayedretention time of deltamethrin standard (19.5 min.).This method was rejected due to heavy wastage ofsolvents in mobile phase. In Bissacot method,standard performed well in methanol and not inacetonitrile (the extracting solvent of the milk). Themethod was rejected as the final extract of the milk

o

nd

Synchronization of estrus with double injection ofProstenol in dwarf goats and role of macro minerals

Veterinary drugs residue analysis in animal derivedfood

(Capra hircus)

Annual Report 2011Animal Sciences

Disease Primer Primer sequenceProductLength

1F GCCTGGTCTTTCCAGGTCTFMD

1R CCAGTCCCCTTCTCAGATC328bp

KTT72 AGGCTCGTTTGGATTATGAAG

HS KTSP61

ATCCGCTAACACACTCTC618bp

NP3 TCTCGGAAATCGCCTCACAGACTGPPR

NP4 CCTCCTCCTGGTCCTCCAGAATCT351bp

FAVHL GACATGGGGTCGACCTATTTCGACATHPS

FAVHR AGTGATGACGGGACATCAT730bp

VP-2F CAGGGTCAGGGCTAATTGTCTTTTIBD

VP-2R ACTCTGGGCCTGTCACTGCTGTC460bp

17

Tomato

Okra

Survival of in tomato

Population of mealybug and its parasitoid

Four weekly releases of predatorand three applications of insecticides controlledaphid up to 2.5/leaf in three tomato varieties ascompared to 18/leaf in untreated control. Eightweekly releases of and three insecticidesprays controlled the population of fruit borer up to1.00 larvae/plant as compared to 2.25/plant inuntreated control. Comparatively high yield wasachieved in integrated control plots.

Integration of two releases of , ten releasesof and four applications of insecticides inApril-sown okra reduced the infestation of Americanand spotted bollworms below ETL (5%). Populationof jassid and whitefly was increased from moderate(7/leaf) to high (12/leaf) during May to June.However, two sprays of insecticides and bio-controlagents kept this pest below ETL (2/leaf).

Studies on survival and parasitism of wereconducted in tomato during March 2011. Parasitismwas highest (81.3%) after 2 days releases ofparasitoids followed by 1, 3, 4, 5, 6 and 7 days with78.4, 56.3, 30.9, 21.8, 4.6, 0.5% parasitism,respectively.

Field survey of mealybug on different host plantsshowed that ornamental plant ( ), weeds( ) and crop plants(cotton, okra, tomato) had 64% infestation andparasitism 63% by its parasitoid spp.

Chrysoperla carnea

T. chilonis

C. carneaT. chilonis

T. chilonis

HibiscusAmranthus, Circium, Euphorbia

Aenasius

Trichogramma

IV. PLANT PROTECTION DIVISIONIntegrated Pest Management

Host plant resistance (insect/pests) in cotton

Performance of cotton genotypes (Bt/non-Bt)against major insect pests

Studies on cotton bollworms population

Biological control based IPM in vegetables

Rearing host insect and parasitoid

Cauliflower

Field studies on 15 coded cotton genotypes showedthat 3 genotypes were tolerant to whitefly, 3 tojassid, and 2 (for squares) and 2 (for bolls) tobollworms. Three genotypes showed high yieldpotential. Other trials on 25 cotton genotypesindicated that 3 genotypes were resistant to whitefly,3 to jassids, and 3 (for squares) and 3 (for bolls) tobollworms as compared to remaining geneticmaterial. Three genotypes gave the maximum yield.

Local Bt cotton (Bt- 22) had considerable effect onthe populations of whitefly and jassid, whereas,more effect in reducing the populations of pink andspotted bollworms than conventional non-Bt cottonline (NIAB-2010).

Field trials on Monsanto Bt cotton lines showed highmortality to early instars of armyworm, and pinkbollworm as compared to non-Bt lines. However,both Bt and non-Bt lines exhibited the severe attackof sucking insects (whitefly, thrips, jassids, mites,mealybug, dusky and red cotton bug) than last year.

Peak populations of pink bollworm, army worm andAmerican bollworm were observed duringSeptember, August-September, and August & firstweek of September, respectively, by installation ofpheromone traps.

Eight varieties of wheat were tested to rear grainmoth that is a factitious host of useful parsitoid,

. Biological parametersindicated that variety Inqilab-91 gave high nutritionto the insect for completing its quick developmentand getting high vigor.

Population of army worm was suppressed in rangefrom 0.5-0.8 larvae/ plant/week (below ETL) duringthe month of February, 2011 after four releases of

No insecticide was applied.

no

Trichogramma chilonis

T.chilonis.

Plant Protection Annual Report 2011

Scientists of Plant Protection Division

18

symptoms. ELISA tests of the 168 symptomatic plantscategorized that alfalfa mosaic virus was the mostprevalent virus in 43 genotypes, followed by beetwestern yellows virus in 40 genotypes, cucumbermosaic virus in 36 genotypes, pea seed born mosaicvirus in 36 genotypes and chickpea chlorotic dwarfvirus in 7 genotype.

Among two aphid and three leafhopper speciescaptured from field, only the leafhopper

successfully transmitted the CpCDV fromdiseased to healthy chickpea plants under controlledconditions.

Out of 29 tomato genotypes, 7 showed symptoms oflate blight while the remaining were free fromsymptoms. Noor F2, RT2 8 9 0 a n d R T 2 8 9 1showed mild catfacedisorder but Chef F2showed severe catfaceand blossom end rots y m p t o m s . O t h e rgenotypes were diseasefree.

Based on disease symptoms, morphologicalcharacteristics and pathogenicity test, it has beenconfirmed for the first time that the causingearly blight disease in(tomatoes) could infect (fieldbindweed, lehli).

Insect vector transmission of chickpea chloroticdwarf virus (CpCDV)

Field screening of tomato germplasm against lateblight disease and abiotic disorders

Identification of a new host of

Orosiusalbicinctus

A. solaniSolanum lycopersicum

Convolvulus arvensis

Alternaria solani

IPM of fruit flies, mosquitoes and other insect pests

Rearing of Tephritid fruit flies

Fruit flies host preference

Fruit flies surveys in orchards

Mosquitoes

Bio-control with Wolbachia

Plant Virology & Host Plant Resistance

Evaluation of Bt cotton lines against CLCuD

Evaluation of chickpea germplasm against virusesand phyllody

Lab rearing of fruit flies, andhas been initiated successfully for

laboratory experiments and culturing of theirparasitoids.

Mango was the most preferred host offollowed by peach and apple on the basis ofmaximum insect pupal recovery, pupal weight andadult emergence. Host preference of

highest in bitter gourd, moderate in brinjal andlowest in muskmelon and pumpkin.

Fruit fly populations were monitored in guava,mango and citrus orchards installing Steiner trapsbaited with Methyl euginol attractant (lure). Peakpopulation of in guava and mango wasfound during May and in citrus during Oct. and Nov.

Mosquitoes collected during November andDecember from NIAB campus were characterized.Two genera, Anopheles and Culex were identifiedand Aedes was not observed.

Wolbachia bacterium is a useful bio-control agentcausing parthenogenesis, male killing andfeminization due to cytoplasmic incompatibility.Screening of Wolbachia species in fruit flies,mosquitoes and other insect pests has beeninitiated.

Response of 49 Bt cotton genotypes was recordedagainst CLCV in the field under natural whitefliestransmission conditions. All genotypes weresusceptible to CLCV. However, the minimum diseasewas noted in C-15 (2.9%), C-23 (3.4%) and C-17(4.6%).

Out of 324 kabuli and desi type genotypes, 168showed viral symptoms and 6 showed phyllody

Bactrocera zonata B.cucurbitae

B. zonata

B. cucurbitaewas

B. zonata

Annual Report 2011Plant Protection

Peach fruit fly, B. zonata Melon fly, B. cucurbitae

Tomato late blight

Blossom end rot (disorder) Catface (disorder)

Early blight on lehli Early blight on tomato Spore A. solani

O. albicinctus

adult nymph

19

Pathodiversity of pv. ( ) andbehavior of resistant gene

Screening rice germplasm against BLB

Food toxicology

Aflatoxins in chili and its detoxification

Insect toxicology & resistance studies

Laboratory screening of insecticides

Field screening of insecticides

X. oryzae oryzae Xoo

Pathodiversity of 179 indigenous isolates wastested on six rice differentials in the field. Isolateswere grouped in 28 pathotypes. Race identificationof population through DNA markers is beingdone with NIBGE. Behavior of 26 NILs/pyramids(having different genes) was tested against 20local isolates. Xa-21 and its pyramids showed thebest resistance against tested isolates.

Pre-selected 341 advance rice lines were screenedagainst under natural and artificial conditions.Twenty one lines were found resistant and 45moderately resistant. isolated from three weedsamples viz. Deela ( ), Dhiddan( ) and Daria Booti (

) were confirmed to be pathogenic on ricedifferentials.

Chili ( L.) samples collected fromthree districts of Punjab were analyzed with HPLC foraflatoxins. High concentration 69µg/kg of Aflatoxin(AFB ) was found in Jehlum samples followed by 65 inJhang and 31 in Faisalabad. Stability of citric acid wasevaluated at 18 and 30 C and found very stable. Theretention time of citric acid was 2.30 minutes.Decontamination using organic acid is in progress.

Eleven insecticides were tested against armyworm( ) larvae. Flubendiamide,chlorfenapyr, rynaxypyr, spinetoram, lufenuran,methoxyfenazide, flufenoxuran and emamectinbenzoate were very effective against larvaecompared to spinosad, indoxacarb, deltamethrin,cypermethrin and cyhalothrin.

Different insecticides were tested against insectpests of okra and cotton crop. Chlorfenapyr,nitenpyram, spirotetramate and spiromesifen werevery effective against thrips, jassids, whitefly andmites, respectively, as compared to acetamiprid andimidacloprid. Buprofezin and pyriproxyfen wererelatively better in controling whitefly. Chlorfenapyrand flubendiamide were found highly effectiveagainst armyworms with the maximum mortalityafter 3 day of application. All insecticides

were toxic to parasitoid( spp.) and predator ( ) .

Xoo

Xoo

XaXoo

Xoo

Xoo

XooScirpus maritimus

Echinochloa crus-galli Ecliptaprostate

Capsicum annuum

Spodoptera litura

Aenasius Chrysoperla

1

o

rdexcept

spinosad and spinetoram

Biological pathotyping of isolates

Evaluation of chickpea genotypes for resistanceagainst blight

Evaluation of chickpea genotypes for resistanceagainst wilts

Phytotoxic effect of extract from mango leaves oncanary grass (weed) and wheat

Screening of wheat genotypes against yellow rust

Fungal and bacterial diseases in rice

Survey of rice areas for collection of diseasesamples in the Punjab

Ascochyta rabiei

Ascochyta

Fusarium

Pathogenecity of 12 isolates was tested onhost differential set comprising six chickpea cultivars(resistant, tolerant & susceptible). Ten isolatesbelonging to Attock, Mianwali, Chakwal, Kark andPeshawar areas were found to be highly virulent andwere selected for the screening of chickpeagermplasm to get durable resistance.

One hundred and sixty five chickpea genotypes fromNIAB, ICARDA & ICRISAT were tested against highlyvirulent isolate Three genotypes fromICARDA were resistant and 26 from ICARDA and NIABwere moderately resistant. However, all genotypesfrom ICRISAT were highly susceptible to this isolate.

The same chickpea germplasm from differentorganizations was also tested for resistance against

wilt in wilt sick field. Only five genotypesfrom NIAB were highly resistant and 5 were resistant.All genotypes from ICARDA were highly susceptible;whereas genotypes from ICRISAT were tolerant tohighly susceptible.

Phytotoxicity of different concentrations of aqueousextract (2.5, 5.0, 7.5 and 10%) of new and old mangoleaves was tested against canary grass and wheat. Allextracts inhibited significantly the germination andearly seedling growth of canary grass both &

. However, the extract from old leaves and itshigh concentration showed high inhibiting effects.Biochemical analysis showed high total phenoliccontents in new mango leaves.

Out of 841 wheat genotypes evaluated in fieldagainst yellow rust only 3 were highly resistant and145 were resistant and were found to be suitable forfurther breeding program.

Various fungal and bacterial diseases were foundcommonly in the rice fields of Punjab but BacterialLeaf Blight (BLB) was found the most destructive.Three hundred isolates of BLB pathogen

pv. ( ) were purifiedfrom diseased leaves

.

A. rabiei

A. rabiei .

Fusarium

in vitroin vivo

Xanthomonas oryzae oryzae Xoo

Annual Report 2011Plant Protection

20

V. IMPACT

Livestock and Meat Production

NIAB HS Vaccine,

Socio Economic effect of NIAB Crop Varieties

Mungbean and Lentil:

Rice:

Cotton:

Chickpea:

Bio-saline Agriculture Technology

Sheep and goats are a critical part to increase farmers' income, meat production and value addition to

forage biomass raised on salt-affected soils. The program involves adaptability of suitable animal breeds

under saline environment. Nearly 215 animals were raised at Pakka Anna during 2011; the number shows

a 43% increase compared to the previous year.

very effective against Hemorrhagic Septicemia disease in cattle, is being marketed

through ATCOP. During 2011 production touched 1.5 million doses, covering about 2.5% animals of

Pakistan. A soft target of 2 million doses has been envisioned for year 2012. NIAB also provided 4000

animal nutritional units of NIAB Feed Blocks to farmers to enhance milk production in year 2011.

NIAB scientists interact with different government organizations, PSC, other quality seed producing

companies and farmers with the aim to provide pre-basic seed to PSC, seed companies and basic seed to

farmers. In addition to seed provision, NIAB also provides production technology to farmers through

dissemination of varieties, brochures and through telephonic discussion. Crop wise annual production

and income is described as under.

A total of 1992 kg pre-basic seed of NM-2006 and NM-2011 was sold during 2011

to PSC and growers. PSC produced certified seed of NIAB mungbean varieties including 26000 kg NM-

2006 and 3575 kg NM-2011. The share of NIAB varieties is more than 90% that fetched approximate

income of Rs. 7.28 million to farmers. For lentil, 1385 kg pre-basic seed of NIAB Masoor-2002 and 1210 kg

of NIAB Masoor-2006 was produced.

NIAB variety Kashmir Basmati, released for Azad Jammu and Kashmir, covered over 20% area of rice

crop. Other rice variety, NIAB-Irri-9 covered 111 thousand hectares in Punjab. It fetches higher price (Rs.

50-100 per 40 kg) over other coarse varieties due to its fine and translucent grain character. The PSC

procured 77 tons of NIAB-Irri-9 paddy for distribution among the farmers. During 2011, PSC multiplied

NIAB-Irri-9 to produce 200 Tons of certified seed; it accounted for 12.5% share in coarse group.

NIAB provided 1884 kg pre-basic seed of approved varieties (NIAB-111, 507 kg; NIAB-846, 530 kg;

NIAB-777, 874 kg) to progressive growers/seed companies for further multiplication on about 500 acres.

Adaptability trials of candidate varieties were conducted with 60 farmers for evaluation in ten districts of

Punjab and also in Sindh. Cultivation of NIAB cotton varieties helped to improve the farmers' income as

these varieties are high yielding and tolerant to CLCuV disease with desirable fibre quality. Rs. 1.476

million was generated through sale of cotton produce from experimental plots at NIAB.

NIAB provided 519 kg Breeder Nucleus Seed (BNS) of Kabuli variety CM-2008 and 111 kg of

Desi variety CM-98 to progressive growers/seed companies during 2011. In the current season, NIAB CM-

2008 has been grown on 65 acres at PSC Farm (Piplan) for quality seed production. During 2010-11, PSC

sold 26500 kg seed of NIAB chickpea varieties to farmers. The share of NIAB varieties under cultivation in

Punjab is about 10% of total area.

Increasing saline area is threatening agricultural lands worldwide. NIAB continued its efforts to improve

bio-saline agriculture technology and additional 100 acres of barren land were brought under cultivation

at BSRS Pakka Anna. The newly developed land was planted with selected trees, forages and crop plants.

The salt tolerant crop plants including wheat, barely and cotton will enhance productivity with improved

soil properties. Seed of salt tolerant plants were provided to several public/private organizations and

Impact Annual Report 2011

21

farmers. A Farmers' Day was organized at BSRS for demonstration of Bio-saline Agriculture Technology.

Over 150 participants including farmers, post-graduate students from various universities and staff

members of Bio-saline-II project (UNDP and Government of Punjab) attended the activity. Institute also

organized two training courses on the applications of modern techniques in abiotic stresses and soil,

plant, water analyses.

Introduction of pre-selected fish breeds (Thaila, Silver Carp, Grass Carp and Common Carp) increased

overall fish production by 25% under saline aquaculture system. The cost-benefit ratio further improved

by using formulated feed (20% crude protein) as a supplement with salt tolerant roughages.

Increasing fertilizer prices and water scarcity are major constraints for crop productivity and demand

alternatives. Studies on Phosphoric acid (fluid P source) showed that band placement of phosphoric acid

resulted in 7 to 34 % increase in wheat yield compared to conventional broadcast method with same

quantity of P fertilizer (88 kg P O /ha) at four sites in Punjab. Similarly, aerobic rice culture or alternate

wetting and drying in transplanted rice could save up to 30% water. Irrigation management techniques

and use of water efficient genotypes are being recommended to decrease inputs cost.

Biological control is the best environment-friendly and foreign exchange saving method compared to

insecticidal control of insect pests. Experiments on IPM-based bio-control of insect pests in vegetables

showed that we can save 4-6 insecticides in cauliflower, tomato and okra by 4-8 releases of

parasitoids and 4-6 releases of predators. This practice

reduces (up to 50%) the use of chemical insecticides (6-12 sprays in different vegetables) normally

applied by farmers in addition to the improved quality of produce having lesser residues.

Research on pesticide residues and aflatoxins is beneficial to human as well as animals by exploring the

facts on toxic residues occurring in food and water. Pesticide residue levels in food items (rice, wheat,

corn) and aflatoxins in rice, chilli and other food items consumed locally and exported were determined.

Analytical services were provided to food industry and exporters. More than 45 industries benefited for

analyses of pesticide residues, aflatoxins and heavy metals in their products. This is an income generation

activity for NIAB that fetched Rs. 2.68 M during 2011.

2 5

Biological Control of Insect Pests

Food Toxicology

Trichogramma chilonis Chrysoperla carnea

Impact Annual Report 2011

22

VI. Publications

1. Ahmad, I., M.S.A. Ahmad, M. Hussain, M. Ashraf and M.Y. Ashraf. (2011). Spatio-temporal variations in soilcharacteristics and nutrient availability of an open scrub type rangeland in the sub-mountainous Himalayantract of Pakistan. Pak. J. Bot. 43: 565-571.

2. Ahmad, I., M.S.A. Ahmad, M. Ashraf, M. Hussain and M.Y. Ashraf. (2011). Seasonal variation in somemedicinal and biochemical ingredients in (L.) Huds. Pak. J. Bot., 43(SI): 69-77.

3. Ahmad, N., M. Sarwar, M.S. Wagan, R. Muhammad and M. Tofique. (2011). Conservation of bio-controlagents in cotton, L. Field by food supplements for insect pests management. TheNucleus, 48(3): 255-260.

4. Akhtar, K. P., M.Y. Saleem, M. Asghar, M. Ahmad and N. Sarwar. (2010). Resistance of species toCucumber mosaic virus subgroup IA and its vector Myzus persicae. Eur J. Plant Pathol. 128: 435–450.

5. Akhtar, M., F. Hussain, T.M. Qureshi, M.Y. Ashraf, J. Akhter and A. Haq. (2011). Rapid and inexpensive steamdistillation method for routine analysis of nitrogen in alkaline calcareous soils. Communication in Soil Sci. andPlant Analysis 42: 920-931.

6. Akhtar, M., A. Naeem, J. Akhter, S.A. Bokhari and W. Ishaque. (2011). Improvement in nutrient uptake andyield of wheat by combined use of urea and compost. Soil and Environ. 30: 45-49.

7. Akhtar, K. P., G. G. Sarwar, G. Abbas, M. J. Asghar, N. Sarwar and T. M. Shah. (2011). Screening of mungbeangermplasm against mungbean yellow mosaic India virus and its vector . Crop Protection,30(9): 1202-1209.

8. Akhtar, K. P., M. Ahmad, T. M. Shah and B. M. Atta. (2011). Transmission of Chickpea chlorotic dwarf virus inChickpea by the Leafhopper (Distant) in Pakistan – Short Communication Plant ProtectionSci. 47(1): 1–4.

9. Akhtar, K. P., N. Sarwar, M. Y. Saleem and M. Asghar. (2011). , a new host forcausing early blight of in Pakistan. Australasian Plant Disease Notes, 6: 84-86.

10. Akhtar, K.P., G. Sarwar and H. M. I. Arshad. (2011). Temperature response, pathogenicity, seed infection andmutant evaluation against causing charcoal rot disease of sesame. Archives ofPhytopathology and Plant Protection, 44(4): 320-30.

11. Akhtar, N., and M. Tufail. (2011). Cancer risk in Pakistan due to natural environment pollutants. Int. J. Environ.Research. 3(10): 159-166.

12. Akhtar, N., M. Tufail, M.Y. Hussain and M. Akram. (2011). Primordial radionuclides contamination level infertilized farms soils of Faisalabad, Pakistan J. of Soil and Environment. 30(1): 88-94.

13. Akhtar, M. S. Tahir, M.Y. Ashraf, J. Akhtar and S.M. Alam. (2011). Influence of different rates of phosphorus ongrowth, yield and phosphorus use efficiency in two wheat cultivars. J. Plant Nutr., 34: 1223-1235.

14. Akram, M., S. Farooq, M. Ashraf, M. Afzaal, R. Arshad and F. Azam. (2011). Detecting differences in some elitewheat lines for salt tolerance through multi parameters evaluation. I. Morphological and yield parameters.Pak. J. Bot., 43(1): 435-443.

15. Ali, H., M. A. Haq, T. M. Shah, M. Rahman and W. Chen. (2011). Validation of molecular markers for resistanceamong Pakistani chickpea germplasm to races of Eur. J. Plant Pathol. DOI10.1007/s10658-011-9868-1.

16. Ali, A., M. Sarwar, S. Khanzada and G. H. Abro. (2011). Evaluating resistance of wheat germplasms to attackby red flour beetle, (Herbst) (Coleoptera). Pak. J. Zool., 43(4):793-797.

17. Alim. M., R. Nawaz, M. R. Asi, M. Shahid, Shahzad Z. Iqbql, and M. Abbas. (2011). Study of urinary excretionand renal clearance of pioglitazone in male volunteers. Asian J. Chem. 23(1): 9509.

18. Amjad, M., J. Iqbal, D. Rees, Q. Iqbal, A. Nawaz and T. Ahmad. (2010). Effect of packaging material anddifferent storage regimes on shelf life of green hot pepper fruits. Acta Hort., 876: 227-234.

19. Arslan, M., A. Ashraf, M. Sajid, A. Ahmad, A.D. Ahmad,M. Ashraf,B. Fahad AB Al-Qurainy and M.Y. Ashraf.(2011). Alleviation of waterlogging stress in upland cotton ( L.) by exogenous applicationof potassium in soil and as a foliar spray. Crop & Pasture Sci., 62:25–38.

Mentha longifolia

Gossypium hirsutum

Solanum

Bemisia tabaci

Orosius albicinctus

Convolvulus arvensis Alternariasolani Solanum lycopersicum

Macrophomina phaseolina

Fusarium oxysporum f. sp. ciceris.

Tribolium castaneum

Gossypium hirsutum

,

Research Publications Annual Report 2011

23

20. Ashraf, M. Y., N. Azhar, M. Ashraf, M. Hussain and M. Arshad. (2011). Influence of lead on growth and nutrient

accumulation in canola ( L.) cultivars. J. Environ. Bio., 32:659-666.

21. Ashraf, M. Y., R. Sadiq, M. Hussain, M. Ashraf, M.S.A. Ahmad. (2011). Toxic effect of nickel (Ni) on growth and

metabolism in germinating seeds of sunflower ( L.). Biol. Trace Elem. Res.,

143:1695–1703.

22. Asi, M.R., S.Z. Iqbal, A. Arino and A. Hussain. (2011). Effect of seasonal variations and lactation times on

aflatoxin M contamination in milk of different species from Punjab. Pak. Food Control, 25: 34-38.

23. Azhar, N., B. Hussain, M.Y. Ashraf and K.Y. Abbasi. (2011). Water stress mediated changes in growth,

physiology and secondary metabolites of Desi Ajwain ( L.). Pak. J. Bot., 43(SI): 15-19.

24. Balal, R.M., M.Y. Ashraf, M.M. Khan, M.J. Jaskani and M. Ashfaq. (2011). Influence of salt stress on growth and

biochemical parameters of citrus rootstocks. Pak. J. Bot., 43: 2135-2141.

25. Chughtai, M.I. and A.R. Awan (2011). Growth performance of monosex and mixed-sex tilapia (

) in brackish water by using salt-tolerant roughages as supplementary food. Pak. J. Zool., 43: 596-

599.

26. Chughtai, M.I., K. Mahmood and A.R. Awan (2011). Assessment of planktonic diversity in river Chenab as

affected by sewage of Multan city. Pak. J. Bot., 43: 2551-2555.

27. Chughtai M.I., K. Mahmood, M. Farooq, A.R. Awan, M. Rizwan and G.M. Kamal. (2011). Water quality and

biodiversity of Manka Canal (D.G. Khan), Pakistan Middle-East J. Sci. Res., 7: 452-457.

28. Erskine, W., A. Sarker and M. Ashraf. (2011). Reconstructing an ancient bottleneck of the movement of the

lentil ( ssp. ) into South Asia. Genet. Res. Crop Evol. 58(3): 373-391.

29. Farooq, S., S. Gilani, R. Arshad, M. Afzaal, M. Akram, N. Iqbal and F. Azam. (2010). Differences in tolerance to

water deficiency at vegetative stage among wild upland rice, lowland rice landrace, their inter-specific

hybrids and lowland rice varieties. Cer. Res. Commun., 38: 56-66.

30. Fu, X. Z., E. U. Khan, S. S. Hu, Q. J. Fan and J. H. Liu. (2011). Over-expression of a betaine aldehyde

dehydrogenase gene from enhances salt tolerance in transgenic trifoliate orange (

L. Raf.). Environmental and Experimental Botany, 74: 106-113.

31. Ghafoor, A., A. Mahmood, N. Iqbal, M.S. Khan, F. Azam and H.A. Farooq. (2011). Identification of prey

remnants in the gut of spiders by Polyacrylamide Gel Electrophoresis (PAGE) of esterase Isozymes. World

Applied sciences Journal. 14: 586-590.

32. Haidar, S., M. Aslam, M. A. Haq, M. K. R. Khan, M. Ul-Hussan, H. M.Hassan, and A. Ditta. (2011). Genetic

diversity among upland cotton genotypes for different economic traits and response to cotton leaf curl virus

(CLCV) disease. Pakistan Journal of Botany, 43(7): IP

33. Hameed, A., Bibi, N., Akhter, J. and Iqbal, N. (2011). Differential changes in antioxidants, proteases, and lipid

peroxidation in flag leaves of wheat genotypes under different levels of water deficit conditions. Plant

Physiology and Biochemistry, 49: 178-185.

34. Hameed, A., M. Goher and N. Iqbal. (2011). Heat stress induced cell death changes in antioxidants, lipid per

oxidation and protease activity in wheat leaves. Journal of Plant Growth Regulation. (DOI 10.1007/s00344-

011-9238-4) pblished online 29 Oct. 2011

35. Haq, M. H., N. Islam and S. S. Alam. (2011). Comparative evaluation of local Bt and non-Bt cotton against

exotic Bt varieties for cotton leaf curl virus disease. Int. J. Biol. and Biotech., 8(1): 131-134.

36. Haq, M. Hussain, N. Islam, S. S. Alam and M. Aslam. (2011). Evaluation of diverse cotton genotypes for

reaction to cotton leaf curl virus disease and yield performance under different ecological zones. Int.J.Biol.

and Biotech. 8(1): 135-138.

37. Hassan, M., A. Rashid, I. Cakmak, F. Hussain and M. Rizwan. (2011). Agronomic bio-fortification of wheat

grain in zinc deficient calcareous soils of Pakistan. : Proc. 3 International Zinc Symposium 10-14 October

2011, Hyderabad, India. pp. 7.

Brassica napus

Helianthus annuus

Trachyspermum ammi

Oreochromis

niloticus

Lens culinaris culinaris

Artiplex hortensis Poncirus

trifoliata

In

1

rd th

Research Publications Annual Report 2011

24

38. Hassan, M., M. Aslam, M. Maqsood, M. Saleem, S. Haider, H. M. Hassan and S. S. Alam. (2011). Varietal

specific intra-row planting density management for sustainable cotton production. : Proc. “Prospects and

Challenges to Sustainable Agriculture”. July 14-16, AJK Univ. Rawlakot, Pakistan. pp. 360.

39. Iqbal, Z., M. Akhtar, T.M. Qureshi, J. Akhter and R. Ahmad. (2011). Variation in composition and yield of

foliage oil of . J. Chem. Soc. Pak.33: 183-187.

40. Iqbal, N., M.Y. Ashraf and M. Ashraf. (2011). Modulation of endogenous levels of some key organic

metabolites by exogenous application of glycine betaine in drought stressed plants of sunflower (

L.). Plant Growth Regulation, 63:7-12.

41. Iqbal, Q., M. Amjad, M.R. Asi and A. Arino. (2011). Assessment of hot peppers for aflatoxin and mold

proliferation during storage. J. Food Protection, 74(5): 830-835.

42. Iqbal, Q., M. Amjad, M.R. Asi and E.T. Carey. (2010). Pattern of capsaicin and dihydrocapsaicin distribution in

hot peppers harvested at different stages. 20 International Pepper Conference, 12-14 September, Las

Cruces, New Mexico State, USA. pp 20-21.

43. Iqbal, S. Z., I.A. Bhatti, M. R. Asi, H.N. Bhatti and M. A. Sheikh. (2011). Aflatoxin contamination in chilies from

Punjab, Pakistan with reference to climate change. Int. J. Agric. Biol., 13: 261-265.

44. Iqbal, S. Z., R. Russell, M. Paterson, I.A. Bhatti, and M.R. Asi. (2011). Aflatoxin concentrations in chilies vary

depending on variety. Mycoscience, 52: 296–299.

45. Iqbal, S. Z., R.M. Patterson, I.A. Bhatti and M.R. Asi. (2011). Comparing aflatoxin contamination in chilies from

Punjab, Pakistan produced in summer and winter. Mycotoxin Research, 27: 75-80.

46. Iqbal, S.Z., M.R. Asi and A. Arino. (2011). Aflatoxin M contamination in cow and buffalo milk samples from

the North West Frontier Province (NWFP) and Punjab Provinces of Pakistan. Food Additives and

Contamination: Part B, 4(4): 282-288.

47. Iqbal, Z., T. M. Qureshi, A. Lodhi, S. Tahir, M. Akhtar and J. Akhtar, 2011. Development of mixed soluble

fertilizers and chelated micronutrients for better crop production. In:Abstracts. Third PASTIC Symposium. 12

February, 2011, Faisalabad.

48. Kamal G. M., F. Anwar, A.I. Hussain, N. Sarri and M.Y. Ashraf. (2011). Yield and chemical composition of

essential oils as affected by drying pretreatment of peels. Int. Food Res. J., 18: 1275-1282.

49. Kamran, M.A. and G. P. Shivakoti. (2011). No one size fits all! How colonial policies failed to consider social,

economic and ecological wisdom embedded in customary rights in Tribal areas irrigation systems of

Pakistan? ISSRM 2011, University of Malaysia Sabah, June 10-15, 2011. p. 67.

50. Kamran, M.A. and G. P. Shivakoti. (2011). Colonial law, customary rights and contemporary issues in

community irrigation systems in Punjab Pakistan. 10 East West Center International Graduate Students

Conference on the Asia-Pacific Region, Hawaii, 17-19 February. p. 38

51. Kamran, M.A. and R.C. Bastakoti. (2011). External disturbances and institutional response in management of

indigenous irrigation systems in Pakistan and Nepal. International Association for the Study of Commons. 13

IASC Held in Hyderabad India on January 10-14, 2011. http://iasc2011.fes.org.in/papers/

docs/673/submission/original/673.pdf

52. Kamran, M.A., R.C. Bastakoti. and G.P. Shivakoti. (2011). Institutional response to biophysical and human

induced disturbances in small scale irrigation systems in South Asia. IGS-SENSE Conference on 'Resilient

societies- Governing risk and vulnerability for water, energy and climate change', University of Twente, the

Netherlands, October 19-21, 2011. p.31

53. Khan, A.W., R.A. Mann, M. Saleem and A. Majeed. (2011). Integrated potash nutrient management

enhanced rice productivity under paddy soil. Int. J. Biol. Biotech., 8: 395-399.

54. Khan, E. U., X.Z. Fu, and J.H. Liu. (2011). Transformation and characterization of TfGA2-ox2 gene in cell

suspension cultures of Bingtangcheng sweet orange ( L. Osbeck). Acta Hort., 892:109-118.

In

Eucalyptus polybractea

Helianthus

annuus

Citrus

Citrus sinensis

th th

th

th

1

Research Publications Annual Report 2011

25

55. Khanum S.A., M. Hussain, H.N. Hussain, A.R. Awan and K. Mahmood. (2011). Economic utilization of saline

marginal land for animal production using salt tolerant plant species. FAO synthesis document on

successes and failures with animal nutrition practices and technologies in developing countries". pp. 107-

110.

56. Khanum S.A., M. Hussain, H.N. Hussain and M. Ishaq, (2011). Impact of urea molasses multinutrient blocks

(UMMB) supplementation on livestock production in Pakistan. Proceedings of FAO E-Conference: pp. 25-28.

57. Lodhi A. and Azam F. (2011). Fate of Cyfluthrin in soil-plant system, Book published by VDM publishing

company, Germany.

58. Lodhi, A, S. Tahir, A. Mahmood, M.H. Sajjad, Z. Iqbal and T.M. Qureshi, 2011. Practical considerations in the

use of exo-polysaccharides produced by bacterial and fungal cultures, In:Abstracts.Third PASTIC

Symposium.12 Febaruary, 2011. Faisalabad.

59. Lodhi, A., S. Tahir, Z. Iqbal and T.M. Qureshi. (2011). Foliar application of soluble fertilizers as a supplement to

enhance NPK uptake in maize. In:Abstracts International conference on “Prospects and Challenged to

sustainable Agriculture” Abstract Book, p-403. 14-16 July 2011. The University of AJ & K, Rawalakot, A.K.

60. Mahjabeen, K. P. Akhtar, N. Sarwar, M.Y. Saleem, M. Asghar, Q. Iqbal and F. F. Jamil 2011). Effect of cucumber

mosaic virus infection on morphology, yield and phenolic contents of tomato. Archives of Phytopathology

and Plant Protection (Online published) (DOI: 10.1080/03235408.2011.595965).

61. Mahmood, K. (2011). Salinity tolerance in barley ( L.): Effects of varying NaCl, K /Na and

NaHCO on cultivars differing in tolerance. Pak. J. Bot., 43: 1651-1654.

62. Mahmood, K., A.R. Awan, and M.I. Chughtai. (2011). : A plant for saline and dry lands. NIAB

Nr. 5. 4 pp.

63. Mahmood, K., A.R. Awan and M.I. Chughtai. (2011). : A tree for waterlogged and

saline wastelands. NIAB Nr. 4. 4 pp.

64. Mahmood, T, R. Ali, Z. Latif and W. Ishaque. (2011). Dicyandiamide increases the fertilizer-N loss from an

alkaline calcareous soil treated with N-labelled urea under warm climate and under different crops. Biology

& Fertility of Soils, 47: 619-631.

65. Nadeem, M. K., S. Nadeem, S. Ahmed, M. Hasnain and M. Ashfaq. (2011). Comparative efficacy of some

insecticides against cotton whitefly, (Gennadius) (Homoptera: Aleyrodidae) under field

conditions. The Nucleus, 48(1): 159-162.

66. Nadeem S., and M. Hamed. (2011). Biological control of sugarcane borers with inundative releases of

(Ishii) (Hymenoptera: Trichogrammatidae) in farmer fields. Pak. J. Agric. Sci., 48(1):

71-74.

67. Nadeem, S., M. Hamed, and M. Shafique. (2011). Feeding preference and developmental period of some

storage insect species in rice products. Pak. J. Zool., 43(1): 79-83.

68. Nadeem, S., M. Hamed, M. Shafique, B.M. Atta and T.M. Shah. (2011). Evaluation for resistance in Kabuli

chickpea genotypes against chickpea pod borer, (Hübner) (Lepidoptera: Noctuidae)

under field conditions. Songkalanakarian J. Sci. Tech., 33(3): 291-294.

69. Numan, M., Z.A. Qureshi, M. Shauket, H.A. Hashmi, M. Iqbal, Z.J. Gill, M. Habib and M. Siddique. (2011).

Rabies out-break in mules at Mansehra, Pakistan. Res Vet Sci. (90):160-162.

70. Rizwana, S., M. Hamed A. Naheed and S. Afghan. (2011). Resisitance in stored rice varieties against

Angoumois grain moth, (Olivier) (Lepidoptera: Gelechidae). Pak. J. Zool., 43(2): 343-348.

71. Saleem M., S.H. Abbas, R.A. Mann, A.W. Khan, A. Majeed and M. Qamar. (2011). Evaluating a new wheat

genotype (NARC 2009) against two rainfed cultivars at different nitrogen to phosphorous penta oxide ratios.

Int. J. Biol. Biotech., 8: 395-399.

72. Saleem M., M. Hassan, S.S. Alam and A. Javaid. (2011). Fraction of intercepted radiation of cotton responds to

irrigation and integrated plant nutrition. Pak. J. Bot., 43: 2875-2879.

In:

Hordeum vulgare

Acacia ampliceps

Eucalyptus camaldulensis

Bemisia tabaci

Trichogramma chilonis

Helicoverpa armigera

Sitotroga cerealella

. (

,

,

+ +

15

3

Research Publications Annual Report 2011

26

73. Saleem, M. Y., J.I. Mirza and M.A. Haq. (2010). Combining ability analysis of some morpho-physiological traits

in Basmati rice. Pak. J. Bot., 42(5): 3113-3123.

74. Sarwar, M. (2011). Effects of wheat and barley intercropping ecosystem on the prevalence of aphid

(Hemiptera: Aphididae) population in canola ( L.) crop. Biological Diversity and Conservation,

4 (1): 11-16.

75. Sarwar, M. (2011). Effects of Zinc fertilizer application on the incidence of rice stem borers (

species) (Lepidoptera: Pyralidae) in rice ( L ) crop. J. Cereals and Oilseeds, 2(5): 61-65.

76. Sarwar, M., N. Ahmad and M. Tofique. (2011). Identification of susceptible and tolerant gram (

L.) genotypes against gram pod borer ( ) (Hubner). Pak. J. Bot., 43(2): 1265-1270.

77. Sarwar, M., N. Ahmad, M. Bux, Nasrullah and M. Tofique. (2011). Comparative field evaluation of some

newer versus conventional insecticides for the control of aphids (Homoptera: Aphididae) on oilseed rape

( L.). The Nucleus, 48(2):163-167.

78. Sarwar, M., N. Ahmad, M. Tofique and A. Salam. (2011). Efficacy of some natural hosts on the development of

(Stephens) (Neuroptera: Chrysopidae) - A laboratory investigation. The Nucleus, 48(2):

169-173.

79. Sarwar, M., N. Ahmad and M. Tofique. (2011). Impact of soil potassium on population buildup of aphid

(Homoptera: Aphididae) and crop yield in canola ( L.) field. Pak. J. Zool., 43(1): 15-19.

80. Sarwar, M., W. Kongming, X. Xu. and E.Wang. (2011). Evaluations of four mite predators (Acari: Phytosiidae)

released for suppression of spider mite infesting protected crop of sweet pepper ( L.).

African J. Agric. Res., 6 (15): 3509-3514.

81. Sarwar, M., X. Xu., E. Wang, and W. Kongming. (2011). The potential of four mite species (Acari: Phytoseiidae)

as predators of sucking pests on protected cucumber ( L.) crop. African J. Agric. Res., 6 (1): 73-

78.

82. Sarwar. N., M.H. Zahid, S. Ashfaq and F.F. Jamil. (2011). Induced systemic resistance in chickpea against

by safe chemicals. Pak. J. Bot. 43(2): 1381-1387.

83. Shah, M.S., A. Ashraf, M.I. Khan, M. Rahman, M. Habib, S. Babapoor, A. Ghaffar, I.R. Malik, S.A. Khanum and J.

A. Qureshi. (2011). Molecular characterization of fowl adenoviruses associated with hydropericardium

syndrome in broilers. Afr. J. Microbiol. Res. 5(30): 5407-5414.

84. Shah, T.M., B.M. Atta, M.A. Haq and J.I. Mirza. (2011). Induced genetic variability in chickpea (

L.). IV. Spectrum of morphological mutations. Pak. J. Bot. 43(4): 2039-2043.

85. Shahzadi, A., I. Javed, B. Aslam, M. Faqir, M.R. Asi, M.Y. Ashrafand and Z. Rahman. (2011). Therapeutic effects

of ciprofloxacin on the pharmacokinetics of carbamazepine in healthy adult male volunteers. Pak. J. Pharm.

Sci., 24: 63-68.

86. Tabasum, A., A.A. Cheema, A. Hameed, M. Rashid and M. Ashraf. (2011). Radiosensitivity of rice genotypes to

gamma radiations based on seedling traits and physiological indices. Pak. J. Bot., 43(2): 1211-1222.

87. Tahir S., S.M. Alam and Z. Ahmad. (2011). Wheat yield and phosphorus fertilizer efficiency as influenced by

pre-incubated use of single super phosphate and poultry litter and its time of application. J. Plant Nutr., 34:

1034–1040.

88. Tahir, S., Z. Ahmad, A. Lodhi, T.M. Qureshi and Z. Iqbal. (2011). Effect of 2, 4-D as a growth regulator on growth

and yield of different wheat genotypes. In:Abstracts. International conference on “Prospects and Challenges

to sustainable Agriculture” Abstract Book, p-416. 14-16 July 2011. The University of AJ & K, Rawalakot, A.K.

89. Waraich, E.A., R. Ahmad, Saifullah, M.Y. Ashraf and Ehsanullah. (2011). Role of mineral nutrition in alleviation

of drought stress in plants. Australian J. Crop Sci., 5: 764-777.

90. Waraich E.A., R. Ahmad, M.Y. Ashraf, Saifullah and A. Mahmood. (2011). Improving agricultural water use

efficiency by nutrient management in crop plants. Acta Agriculturae Scandinavica Section B-Soil and Plant

Sci.: 1-14.

Brassica napus

Scirpophaga

Oryza sativa .

Cicer arietinum

Helicoverpa armigera

Brassica napus

Chrysoperla carnea

Brassica napus

Capsicum annuum

Cucumis sativus

Ascochyta blight

Cicer arietinum

Research Publications Annual Report 2011

27

Appendices Annual Report 2011

VII. APPENDICES

i. Funded Research Projects

Title of the Project SourceFunds(Rs. M)

PrincipalInvestigator

Molecular epidemiology and control of foot and mouthdisease in Pakistan IAEA 1.025

Dr. MudasserHabib

Enhancing crop water productivity with improvedirrigation/management practices involving isotopictechniques

-do- 2.016Dr. KhalidMahmood

Strengthening capabilities to monitor and controlveterinary drug residues in food stuffs -do- 42.550

Dr. UzmaMaqbool

Breeding for high yielding long grain rice with adaptationto high temperatures

-do- 1.025Dr. MuhammadAshraf

Improvement in nutrient and water use efficiency undermulch based cropping system -do- 2.013

Mr. WajidIshaque

Improvement in yield and salt tolerance potential throughpotash fertilizer (SOP) in wheat and rice on salt-affectedsoils

BELGIUM 2.700Dr. M. YasinAshraf

Evaluation of nitrification inhibitors for reducing nitrogenloss under irrigated cotton-wheat system using

15N-

balance techniquePARC/ALP 5.557

Dr. TariqMahmood

Studying the role of anti-oxidant enzymes in controllingprogrammed cell death (PCD) triggered in plants inresponse of exogenous stress

PSF 1.000Dr. AmjadHameed

Control of bacterial leaf blight (BLB) in rice throughmanagement and resistant varieties PARB 10.483

Hafiz M. ImranArshad

Improvement of chickpea productivity through theidentification of drought tolerant and disease resistantchickpea genotypes for marginal lands

-do- 19.840

Dr. TariqMahmud Shah

Evaluation of Phosphoric acid as an alternative tocommercial phosphoric fertilizer and enhancing itsefficiency for higher crop productivity

-do- 13.931

Dr. MuhammadAkhtar

Improvement of lentil germplasm for high seed yield anddisease resistance -do- 15.982

Mr. GhulamSarwar

Development of high yielding, disease resistant anddrought tolerant mungbean genotypes for marginal lands -do- 19.018

Mr. GhulamSarwar

Integrated Pest Management (IPM) of insect pests onokra and brinjal with emphasis on biological control -do- 22.715

Dr. MuhammadHamed

Biological control of major cotton pests includingmealybug in Pakistan MINFA 21.398

Dr. MuhammadHamed

HarvestPlus Zinc Fertilizer SabanciUni.

Turkey4.500

Mr. Mahmood-ul-Hassan

28

Appendices Annual Report 2011

Submitted Research Projects

Title of the Project SourceFunds(Rs. M)

PrincipalInvestigator

Improving the germination and yield of low phytic acidmutants of Super Basmati and identification of molecularmarkers linked to lpa trait

IAEA 2.220 Dr. Zia-ul-Qamar

Improvement in water use efficiency and productivity ofwheat through potassium nutrition management in salteffected soil

BELGIUM 5.052Dr. M. YasinAshraf

Bioefficacy of plant extracts to control important fungaldiseases of tomato plant and fruits

ALP 6.000Dr. NighatSarwar

Bio-fortification of Rice Cultivar “Basmati-515” by Back CrossBreeding

-do- 8.000 Dr. Zia-ul-Qamar

Quantification of Tennins in trees leaves, shrubs andcommon feed stuffs and measures to reduce their tox iceffect in livestock feeding

PSF3.200 Dr. Shahnaz

Adeeb Khanum

Characterization of cotton leaf curl virus disease resistancein cotton (Gossipium hirsutum L.) by use of physical mappingand molecular marker techniques

-do- 3.482 Dr. Sajjad Haider

Induction of resistance in tomato against important early &late blight and CMV diseases, using environment friendlychemicals and plant extracts

-do- 2.000Dr. NighatSarwar

Improvement of low phytate Basmati rice -do- 3.680 Dr. Zia-ul-Qamar

Biochemistry of disease resistance to leaf curl virus in cotton-do- 2.854

Dr. S. SarwarAlam Anjum

Isolation characterization and bioremediation potential ofthe producing biofilm bacteria from brackish and pollutedirrigation waters

-do- 2.000 Dr. M. Ashraf

Development of high yielding wheat genotypes for waterlimited conditions PARB 13.699 Dr. Javed Akhtar

Molecular epidemiology and control of infectious bursaldisease in Pakistan -do- 7.571

Dr. MudasserHabib

Development of cotton germplasm resistant to CLCuV andwhitefly

-do- 42.500 Dr. Nayyer Iqbal

Development of soluble mixed fertilizer and its applicationthrough drip irrigation. -do- 9.687 Mr. Zafar Iqbal

Control of excessive fruit drop in citrus and improvement inyield and quality through management of plant nutrientsand growth regulators

-do-25.000 Dr. M. Yasin

Ashraf

Pak-US Cotton productivity enhancement program MINFA 24.750 Dr. Sajjad HaiderPak-US cotton productivity enhancement program(collaborative Project) USDA 25.000 Dr. Sajjad Haidar

Identifying traits to improve nitrogen and phosphorus useefficiency of wheat in Pakistan IDB

3.900 Ms. SharmeenTahir

29

Appendices Annual Report 2011

ii. Farmers’ days organized during 2011

Farmers’ day (22 March) on Bio-saline Agriculture Technology at BSRS Pakka Annand

Organizer: Dr. Khalid Mahmood, DCS Participant: >150

Dr. Shahzada Munawar Mehdi (Director, Soil Salinity Research Institute, Pindi Bhattian) chief

guest along with participants visiting Bio-saline Agriculture Technology, demonstrations (i.e.

nursery raising, transplantation, irrigation), uses of forage, timber, fuel-wood, food/feed and

for agro-based industrial processing

Farmers’ day (30 March) on Rabi Crops (Chickpea, Lentil, Wheat, Tomato)th

Organizer: Dr. T. M. Shah, PS Participant: >150

Dr. Faiz A. Faiz (Director Pulses AARI) chief guest, Dr. M. S. Cheema (Director RRI), Mian

Aslam (GM JSC), Dr. G. Mohy-ud-Din, PP, Ray Amjad Ali, Botanist, delegates and participants

from Bhakkar, Layyah, Chakwal, Sialkot, Narowal, Jehlum, Attock, Jhang and Faisalabad

visiting lentil and promising wheat advance lines

Farmers’ day (6 Nov.) on Feeding Strategies to Improve Meat, Milkand Live Stock Production

th

Organizer: Mr. Mujahid Hussain, PS Participant: >100

Dr. Abdul Jabbar Abbasi (Chief Executive Abbasi Associates) chief guest, Dr. GhulamMuhammad (Chairman Dept. of Clinical Medicine, UAF), Dr. Rana Dil Nawaz Ahmed

(Manager Ghazi Brothers) with participants

30

Appendices Annual Report 2011

iii. Training Courses and Workshops conducted during 2011

Hybrid breeding in tomato(Participants: 23)

Safety measures in use of radiation in Agri. and Bio. Res.(Participants : 27)

Biochemical & molecular Tech. in plant breeding(Participants: 38)

Modern Tech. in Res. on abiotic stress tolerance in plants(Participants: 66)

Soil, water and plant analysis(Participants: 23)

The use of nuclear & other advanced Tech. in Agri. andBiological research (Participants: 26)

Org.: Dr. M. Y. Saleem CG: Dr. Akhlaq Hussain, PD Org.: Dr. Nasim Akhtar CG: Dr. R. H. Dab, Pr. PMC

Org.: Dr. Nayyer Iqbal CG: Prof. Dr. M. Ashraf, UAF Org.: Dr. M. Y. Ashraf CG: Prof. Dr. Kausar A. Malik

Org.: Mr. Zafar Iqbal CG: Dr. M. Arshad, Dir. SES, UAF Org.: Dr. S. A. Khanum CG: Dr. Abdus Sattar, Dir. ARI, AARI

Sustainable IPM with emphasis on insect pest and disease (Participants: 34)

Org.: Dr. M. Hamed CG: Dr. Yusuf Zafar, DG (A&B) PAEC

31

Appendices Annual Report 2011

iii. Scientists/Administration

Dr. Javed Akhtar, DCS/Director

Plant Breeding & GeneticsDivision

Dr. Bilal Rasool, JS Technical Services Division

Mr. Ghulam Sarwar, DCS/HoD Mr. Noor Abid Saeed, JS Mr. Masood-ul-Hassan, PE/HoD

Dr. S. M. Sarwar Alam Anjum, PS Mr. Kamran Saleem, JS Mr. Arfan Waheed, PS

Dr. (Ms.) Nasim Akhtar, PS Soil Science Division Mr. Naeem Ahmed, SS*

Dr. Tariq Mahmud Shah, PS Dr. Khalid Mahmood, DCS/HoD Mr. Jafar Hussain, SS

Dr. Nayyer Iqbal , PS Dr. Tariq Mahmood, DCS Mr. Ghulam Mustafa, SE

Dr. Manzoor Hussain , PS Mr. Zafar Iqbal, DCS Mr. Muhammad Asif Kamran, JS

Dr. M. Yussouf Saleem , PS Dr. M. Yasin Ashraf (T.I.), DCS Mr. Muhammad Akram, ARO

Dr. Rubina Arshad, PS Dr. Asma Hassan, PS Administration

Dr. Muhammad Asghar, PS Dr. Muhammad Ashraf, PS** Mr. Sajjad Mahmud, PAO

Ms. Hina Ali, PS Dr. Muhammad Akhtar, PSLt. Col. Abrar Hussain(Retd), OC FSSU

Mr. Babar Manzoor Atta, SS* Mr. Abdul Rasul Awan, SS Mr. Bakhshish Jilani, SAO/HLAO

Dr. Ehsan Ullah Khan, SS Ms. Asia Gulnaz, SS Mr. Muhammad Asif, SL

Mr. M. Kashif Riaz Khan, SS* Dr. Zafar Iqbal, SS Dr. Aaysha Tariq, SMO

Mr. Muhammad Rashid, SS* Mr. Muhammad Yaqub, SS Mr. Sajid Azmat, SAO

Dr. Sajjad Haider, SS Dr. Muhammad Saleem, SSMr. Tahir Mahmood, Supdt.(Proc.)

Mr. Mahmood-ul-Hassan, SS Dr. Rehmat Ali, SSMr. Muhammad Hanif, Supdt.(Admin.)

Dr. Zia-ul-Qamar, SS Dr. Tariq M. Qureshi, SS/FM Mr. M. Riaz Kausar, AAO

Dr. Amjad Hameed, SS Ms. Um-e-Robab, SS*

Dr. Muhammad Ashraf, SS Mr. Muhammad Rizwan, SS Abbreviations

Mr. Ghulam Abbas, SS Mr. Wajid Ishaque, SS DCS: Deputy Chief Scientist

Dr. M. Jawad Asghar, SS Ms. Shermeen Tahir, SS PS: Principal Scientist

Ms. Noreen Bibi, JS* Mr. M. Ismail Chughtai, JS PE: Principal Engineer

Mr. Abdul Rehman Khan, JS* Mr. Asif Naeem, JS SS: Senior Scientist

Dr. Qumer Iqbal, JS Mr. Muhammad Atif Riaz, JS SE: Senior Engineer

Ms. Aqsa Tabasum, JS* Mr. Sajid Shokat, JS JS: Junior Scientist

Hafiz Mumtaz Hassan, JS Mr. Sabir Ali Sabir, ARO ARO: Assistant Research Officer

Plant Protection Division Animal Sciences Division SMO: Senior Medical Officer

Dr. Muhammad Hamed,DCS/HoD

Dr. Shahnaz A. Khanum,DCS/HoD

FM: Farm Manager

Dr. Nighat Sarwar, DCS Mr. Mujahid Hussain, PS PAO: Principal Administrator

Dr. Sajid Nadeem, PS Dr. Uzma Maqbool, PS SAO: Senior Accounts Officer

Dr. Muhammad Sarwar, SS Ms. Rehana Kausar, SS* AAO: Assistant Accounts Officer

Mr. Rashid Ahmad Khan, SS* Dr. Mudasser Habib, SS HoD: Head of Division

Ms. Asia Riaz, SS* Mr. M. Salah-ud-Din Shah, JS*HLAO: Head, Local AccountOffice

Dr. Muhammad Rafique Asi, SS Ms. Shumaila Yousaf, JS * on study leave

Ms. Sumaira Yousaf, SS* Ms. Sadia Mahboob, JS ** on post doctoral studies

Mr. Khalid Pervaiz Akhtar, SS Hafiz Noubahar Hussain, JS

Hafiz M. Imran Arshad, SS Mr. Tarique Hussain, JS

32

Appendices Annual Report 2011

v. Promotions

vi. Transfers/Postings

vii. Appointments

viii. Retirements

From To On

1. Ms. Hina Ali Sr. Scientist Pr. Scientist 01-12-2011

2. Dr. Sajid Nadeem Sr. Scientist Pr. Scientist 01-12-2011

3. Mr. Sajid Azmat Accounts Officer Sr. AccountsOfficer

01-12-2011

From To On

1. Mr. Sajjad Mahmud,Pr. Administrator

PINSTECH,Islamabad

NIAB, Faisalabad 10-01-2011

2. Mr. Junaid Ahmad Khan,Pr. Scientist

NIAB, Faisalabad PIEAS, Islamabad 29-04-2011

3. Dr. Muhammad Sarwar,Sr. Scientist

NIA, Tandojam NIAB, Faisalabad 09-05-2011

4. Dr. Aaysha Tariq,Sr. Medical Officer

NIBGE,Faisalabad

NIAB, Faisalabad 28-07-2011

5. Mr. Muhammad Ashraf,PSO-I

NIAB, Faisalabad PAEC HQ,Islamabad

02-08-2011

6. Dr. Manzoor Hussain,Pr. Scientist

NIA, Tandojam NIAB, Faisalabad 20-10-2011

7. Lt. Con. Mohsin AzizKhan (Retd), Sr. SecurityOfficer

NIAB, Faisalabad MDP -208,Islamabad

18-11-2011

8. Mr. Zahid Islam,Sr. Admin. Officer

NIAB, Faisalabad NTFP, Islamabad 21-11-2011

Date

1. Mr. Sajid Shokat, Jr. Scientist 20 -09 -2011

2 Lt. Col. Abrar Hussain Shah (Retd), OC FSSU 19 -10 -2011

1. Mr. Mumtaz Ahmed, Administrator

2 Dr. M. Afzal Murtaza, Pr. Scientist

Date

10-01-2011

24-04-2011

33

Appendices Annual Report 2011

Dr. Ansar Parvez Chairman PAEC visiting NIAB field Dr. Badar Sulaman Member Science briefed aboutR&D activities of NIAB

Member Science planting tree at BSRS Pakka Anna Member Science briefed about BSRS, Pakka Anna

Dr. S.H. Mujtaba Naqvi visiting research area Mr. Nasim Sadiq DCO, Faisalabad visiting Pakka Anna

Dr. Mujeeb Qazi visits NIAB fields DG Security SPD briefed about NIAB

34

Appendices Annual Report 2011

Commissioner Faisalabad presenting trophy on

1 position in Flower Exhibitionst

NIPA trainees visiting NIAB research fieldsStudents visiting BSRS Pakka Anna

Dr. Yusuf Zafar, DG (A&B) addressing on award wining

ceremony of Flower Exhibition

Farewell get to gather in the honor of Dr. Abdul Rashid

Ex Member Bio-SciencesGrowers taking interest in chickpea

35

Appendices Annual Report 2011

Scientists of NIAB with Director

Administration and Accounts Scientists/Engineers of Technical Services Division

36

Appendices Annual Report 2011

CONFERENCE FARMERS' DAY TRAINING WORKSHOP

Opportunities for stake holdersDeveloping human resource and knowledge sharing

NIAB, P.O.Box 128, Jhang Road, Faisalabad

Tel: 0092 41 2654210; 9201751-69; Fax: 9201776

Email: director@niab.org.pk

Web: www.niab.org.pk

Nuclear Institute for Agriculture and Biology

-P

+P