Available online at www.sciencedirect.com

journal homepage: www.elsevier.com/locate/yexcr

E X P E R I M E N T A L C E L L R E S E A R C H 3 2 0 ( 2 0 1 4 ) 2 6 9 – 2 8 0

0014-4827/$ - see frohttp://dx.doi.org/10.1

Abbreviations: cGMModified Eagle's Mehorseradish-peroxidI, neuronal NOS; NPcGMP-dependent p

nCorresponding autE-mail address: e

Research Article

Nitric oxide drives embryonic myogenesis in chickenthrough the upregulation of myogenicdifferentiation factors

Denise Cazzatoa, Emma Assia, Claudia Moschenib, Silvia Brunellic, Clara DePalmaa, Davide Cerviaa,d, Cristiana Perrottaa,e, Emilio Clementia,e,n

aUnit of Clinical Pharmacology, National Research Council-Institute of Neuroscience, Department of Biomedical and ClinicalSciences, University Hospital L. Sacco, Università di Milano, 20157 Milano, ItalybMorphology Unit, Department of Biomedical and Clinical Sciences, University Hospital L. Sacco, Università di Milano,20157 Milano, ItalycDepartment of Health Sciences, Università di Milano-Bicocca, 20126 Milano, ItalydDepartment for Innovation in Biological, Agro-food and Forest systems (DIBAF), Università della Tuscia, 01100 Viterbo, ItalyeScientific Institute IRCCS Eugenio Medea, 23842 Bosisio Parini, Lecco, Italy

a r t i c l e i n f o r m a t i o n

Article Chronology:

Received 13 June 2013Received in revised form8 November 2013Accepted 9 November 2013Available online 15 November 2013

Keywords:

NOS-IChick embryoMuscle development

cGMP/PKGMurine myoblastsMef2c

nt matter & 2013 Elsevier016/j.yexcr.2013.11.006

P, cyclic GMP; DETA, 1-dium; FBS, foetal bovinease; Mef2, Myocyte enhaLA, Nω-propyl-L-argininerotein kinase; SDS, sodiuhor. Fax: þ39 250319646.milio.clementi@unimi.it (E

a b s t r a c t

The muscle-specific variant of neuronal nitric oxide (NO) synthase (NOS-I), is developmentally regulated

in mouse suggesting a role of NO during myogenesis. In chick embryo, a good model of development,we found that the expression of NOS-I is up-regulated, but only in the early phase of development.Through a pharmacological intervention in ovo we found that NO signalling plays a relevant role duringembryonic development. The inhibition of NOS-I decreased the growth of embryo, in particular ofmuscle tissue, while the restoring of physiological NO levels, via administration of a NO donor, reversedthis effect. We found a selective action of NO, produced by NOS-I, on regulatory factors involved inmyogenic differentiation in the early phase of chick embryo development: inhibition of NO generationleads to a decreased expression of the Myocyte enhancer factor 2a (Mef2a), Mef2c, Myogenin andMyosin, which was reversed by the administration of a NO donor. NO had no effects on Myf5 andMyoD, the myogenic regulatory factors necessary for myogenic determination. The action of NO on themyogenic regulatory factors was mediated via generation of cyclic GMP (cGMP) and activation of the

cGMP-dependent protein kinase G (PKG). Finally we found in myoblasts in vitro that the activation ofMef2c was the key event mediating the NO-induced modulation of myogenesis.

Our results identify NO produced by NOS-I as a key messenger in the early phase of embryonicdevelopment of chicken, acting as a critical determinant of myogenesis through its physiological cGMP/PKG pathway.

& 2013 Elsevier Inc. All rights reserved.

Inc. All rights reserved.

[N-(2-aminoethyl)–N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate, DMEM, Dulbecco'sserum; GAPDH, glucose 6 phosphate dehydrogenase; HH, Hamburger and Hamilton; HRP,ncer factor 2; MRFs, myogenic regulatory factors; NO, nitric oxide; NOS, NO synthases; NOS-; ODQ, 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one; PBS, phosphate buffered saline; PKG,m dodecyl sulphate; sGC, soluble guanylate cyclase

. Clementi).

E X P E R I M E N T A L C E L L R E S E A R C H 3 2 0 ( 2 0 1 4 ) 2 6 9 – 2 8 0270

Introduction

Nitric oxide (NO) is a gas and a messenger, synthesised by thefamily of NO synthases (NOS) from L-arginine to regulate keyphysiological events of adult organisms [1,2]. NO has also beenshown to play a role in development; studies in Drosophilamelanogaster have shown that it controls cell proliferation duringdevelopment [3]; the complete lack of endogenous production ofNO, in triple NOS knockout animals, results in a significantreduction of the survival rate and the number of offspring [2].Moreover, the inhibition of NOS during oocyte pre-maturationand/or maturation affects embryo development [4]. The observeddifferences in the amount of NO required and the differentsensitivity to NO of embryos at different developmental stagesindicates that the NO/NOS system is tightly regulated in adevelopmental stage-specific manner [5,6]. Thus, the importanceof endogenous NO as a regulator of embryonic development,specifically during the progression from two-cell stage to blas-tocyst and later [7] and limb development [8] has been estab-lished. NO-mediated actions later during organogenesis havebeen suggested to take place in different tissues and organs,as for instance in the placenta [9], the endothelium [10], the bone[11], the heart [12,13], the lung [14], and the nervous system[15–23]. A key downstream messenger of NO is cyclic GMP(cGMP). This messenger is generated by physiological concentra-tions of NO following activation of the enzyme soluble guanylatecyclase (sGC) [1,24–26]. A role for cGMP signalling in mediatingthe effect of NO in embryonic development and cell differentia-tion has recently emerged [27,28].During embryogenesis, skeletal muscle originates from pro-

genitor cells originating in the somites. While Myosin heavy chainis one of the most important terminal-differentiation genes,several myogenic regulatory factors (MRFs) are involved in theearlier myogenic steps that commit precursor cells to the skeletalmuscle fate. These factors include the myogenic determinationfactors Myf5 and MyoD as well as factors required for differentia-tion such as Myogenin and the Myocyte enhancer factor 2 (Mef2)family of factors [29–33].Studies have shown that the muscle-specific variant of neuronal

NOS (NOS-I) [34–36], is developmentally regulated in the mousewith peaks of expression and activity coinciding with embryonicmyoblasts fusion [37], suggesting a role of NO also in muscledevelopment. As yet, however, the involvement of NO/cGMPsystem in embryonic myogenesis has not been investigatedexcept for a report in the Xenopus laevis, where NO acts in veryearly phases of development to increase cell movement duringmesodermal induction [38].To investigate this issue we used the chick embryo as a model

of development since it is easily accessible from pre-gastrulationstages throughout organogenesis, the stages of its embryonicdevelopment are well characterised and it is easy to manipulatewith drugs in ovo. In addition, the developmental history of theavian somite, the source of most muscle and bone in theorganism, has been extensively characterised such that it allowsa clear definition of the developmental role of signalling mole-cules [29,31].Taking advantage of this model we now report that NO has a

role in vertebrate skeletal muscle development. We found thatthe expression in chick embryo of NOS-I and endothelial NOS

(NOS-III), an enzyme also expressed in skeletal muscle, has atemporal-spatial distribution during embryonic and foetal devel-opment. Through a pharmacological intervention in ovo allowingus to dissect the molecular players of NO pathway, we found thatNO signalling plays a relevant role during embryonic develop-ment, via the regulation of specific MRFs. Finally, using a wellestablished in vitro model of myoblasts, we found that theactivation of Mef2c is a key event mediating the NO-inducedmodulation of myogenesis.

Materials and methods

Experimental models

Fertilised chick (Gallus Gallus) eggs (SPF Premium Plus Eggs) weresupplied from Charles River Laboratories Italia (Calco, Lecco, Italy).Eggs were stored at room temperature for less than 1 week andthen incubated at 37.5170.5 1C and 60–70% relative humidity.Embryos were staged according to the criteria of the Hamburgerand Hamilton (HH) series [39]. At the end of the experiments,embryos were harvested from the egg, trimmed of their vitellinemembrane and extra-embryonic tissue, and washed with phos-phate buffered saline (PBS). The murine skeletal muscle cell lineC2C12 and the endothelial cell line H5V were cultured in Dulbec-co's Modified Eagle's Medium (DMEM) supplemented with 10%foetal bovine serum (FBS), 2 mM glutamine, 100 U/ml penicillinand 100 mg/ml streptomycin (37 1C, 5% CO2 in an humidifiedatmosphere). Differentiation of C2C12 cells into myoblasts wasinduced substituting the 10% FBS-containing culture mediumwitha culture medium containing 2% horse serum when cells reached70% confluence [40].

Western blotting of chick embryos

Embryos were dissected and homogenised in RIPA buffer contain-ing 50 mM Tris–HCl (pH 7.4), 150 mM NaCl, 1% NP-40, 1% sodiumdeoxycholate, 1 mM EDTA, 0.1% sodium dodecyl sulphate (SDS)and supplemented with protease inhibitors. After SDS—polyacry-lamide gels electrophoresis with the Bio-Rad Mini-PROTEAN3 system, polypeptides were transferred onto nitrocellulose filters(GE Healthcare, Milan, Italy). The incubation of total extracts wasperformed with the following primary antibodies: anti-NOS-I(1:1000), anti-NOS-III (1:1000), anti-MyoD (1:200), anti-Myf5(1:500), anti-Mef2a (1:500), anti-Mef2c (1:1000), anti-Myogenin(1:10), anti-Myosin (1:200), and with the appropriate horseradish-peroxidase (HRP)-conjugated secondary antibody [41]. Bands werethen visualised using the SuperSignal West Pico ChemiluminescentSubstrate (Thermo Fisher Scientific) according to the manufac-turer's instructions and exposure to autoradiography Cl-Xposurefilms (Thermo Fisher Scientific). To monitor potential artefacts inloading and transfer among samples in different lanes, the blotswere routinely treated with the Restore Western Blot StrippingBuffer (Thermo Fisher Scientific) and re-probed with and antiglucose 6 phosphate dehydrogenase (GAPDH) primary antibody(1:10000) and the appropriate HRP-conjugated secondary anti-body. By means of the NIH ImageJ software, the semi-quantitativeanalysis of blots was performed by measuring the optical density ofthe protein bands with respect to the optical density of the bandcorresponding to GAPDH.

Table 1 – Primer pairs used for standard PCR analysis.

Name Symbol Primer sequence

Myogenicdifferentiation 1

myoD1 F: 5′-CGTGAGCAGGAGGATGCATA-3′R: 5′-GGGACATGTGGAGTTGTCTG-3′

Myogenic factor5

myf5 F: 5′-TGCCCTGAGGAAGAGGAACAC-3′R: 5′-ACGATGCTGGAGAGGCAGTC-3′

Myocyte-specificenhancer factor2c

mef2c F: 5′-AGCAGCTCAGCCACTTTCTC-3′R: 5′-AATATTCACCACCCGGTTCA-3′

Myogenin myog F: 5′-AGCCTCAACCAGCAGGAG-3′R: 5′-TGCGCCAGCTCAGTTTTGGA-3′

Myosin mhy1 F: 5′-AGACAAAAACACCTGGTGCC-3′

E X P E R I M E N T A L C E L L R E S E A R C H 3 2 0 ( 2 0 1 4 ) 2 6 9 – 2 8 0 271

As shown in Suppl. Fig. S1, the sequence similarity between themurine and the chicken proteins, i.e. NOS-I, NOS-III, MyoD, Myf5,Mef2a, Mef2c, Myogenin, and Myosin was assessed by usingprotein BLAST free-software. Since the antibodies used in ourexperiments have been raised against the human or the rodentprotein form, they were validated for the cross reactivity and thespecificity with the chicken form in our experimental model(Suppl. Fig. S2).

Pharmacological treatments in ovo

The groups were as follows: HEPES (control); 500 ng/g egg of theinhibitor of NOS I Nω-propyl-L-arginine (NPLA); 2 mg/g egg of theNO donor 1-[N-(2-Aminoethyl)–N-(2-ammonioethyl)amino]dia-zen-1-ium-1,2-diolate (DETA-NO), 500 ng/g egg of the sGC inhi-bitor 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ), and600 ng/g egg of the cGMP-dependent protein kinase (PKG)inhibitor KT5823. Of notice, increasing doses of these compoundswere found to induce the death of embryos within 48 h (data notshown). Fertile chicken eggs were prepared for injection bycleansing the blunt end of eggs with 95% ethanol. Eggs wereplaced horizontally with respect to the long axis, and a small holewas made in the blunt end of each egg, and based on the averagemass of the eggs, the same volume of compounds (ca. 2 μl/g egg)was injected to attain the desired concentrations described above.Compounds were administered via two injections: at HH6 (24 h)and HH12 (48 h) for the experiments performed at HH18 (embryo-nic development); at HH23 (4 days) and HH26 (5 days) for theexperiments performed at HH30 (foetal development) [42]. Aftertreatment the window was sealed with a transparent coverslip andwax, thus allowing observation of the heart beat in situ. Embryoswere harvested at appropriate HH stage for analysis.

Morphological analysis

Chick embryos images were digitalised under a stereomicroscope(SMZ1500; Nikon) equipped with a high-resolution plan apoc-hromatic 1� objective. Embryos were only photographed if theywere rotated at 901 to the sagittal plane. The image analysissystem was calibrated using digital photographs of a stagemicrometre set to the height of the midplane of embryos. Theanalysis of the area was done using the NIH ImageJ software. Theembryo's weight was evaluated on a balance accurate to 710 μg.

Immunofluorescence

Chick embryos were fixed in ice cold 4% paraformaldehyde beforebeing rinsed in PBS and cryo-protected overnight in 30% sucrose.Embryos were then embedded in O.C.T. Compound (Sakura) andtissues were cut in a CM1850 UV cryostat (Leica). Sections(10 mm) were placed on pre-treated slides, air dried, then rinsedin PBS, blocked in 0.5% bovine serum albumin (BSA), andincubated overnight with the anti-sarcomeric Myosin MF20 anti-body (1:2). Sections were then incubated with the appropriatesecondary antibody conjugated with the Alexa Fluor 546 fluor-escent dye (Molecular Probes), rinsed and coverslips added in themounting medium containing 4′,6-diamidino-2-phenylindole.Slides were examined using a Leica DMI4000 B automatedinverted microscope equipped with a DCF310 digital camera

(Leica Microscopy Systems, Heerbrugg, Switzerland). Image acqui-sition was controlled by the Leica LAS AF software.

In situ hybridisation

The following primers for Myogenin were used: AGCCTCAACCAG-CAGGAG (forward), TGCGCCAGCTCAGTTTTGGA (reverse) [43]. ThePCR fragment was cloned into pBlueScript and transformed intocompetent bacteria (Promega). After sequencing, the clone wasvalidated and the orientation of the insert determined. Digox-igenin (DIG)-labelled sense and antisense RNA probes weresynthesised using T3 and T7 polymerases. In situ hybridisationwas performed on chick embryos using the whole-mount proto-col described previously [43]. Briefly, chick embryos were fixed inice cold 4% paraformaldehyde and stored in methanol at �20 1C.They were rehydrated to PBST (phosphate buffered saline, 0.1%Tween-20 pH 7.3). After rehydration, embryos were permeabi-lised in 2% hydrogen peroxide in PBST (1 h) and by a 15 minproteinase K treatment (10 μg/ml) and post fixed for 1 h with 4%paraformaldehyde. The embryos were then hybridised overnightin hybridisation buffer at 67 1C. DIG-labelled probes weredetected using Nitro Blue Tetrazolium and Bromo Chloro-Indole-Phosphate as alkaline-phosphatase substrates to yield a deeppurple colour. The chromogens were diluted in 100 mM Tris-buffered saline (pH 9.5) containing 50 mM Mg2þ and 1% Tween-20. No signal was ever detected with the sense probe. Phase-contrast images of staining were viewed and digitalised under astereomicroscope (SMZ1500; Nikon) equipped with a high-resolution plan apochromatic 1� objective.

PCR experiments

Total RNA from chick embryos was extracted with the standardTRIZOL method. After solubilisation in RNase-free water, totalRNA was quantified by the Nanodrop 2000 spectrophotometer(Thermo Fisher Scientific, Waltham, MA, USA). First-strand cDNAwas generated from 1 μg of total RNA using ImProm-II ReverseTranscription System (Promega, Madison, WI, USA). The PCR reac-tions were carried out using 1 μl of cDNA and the GoTaq GreenMaster Mix (Promega), containing 500 nM of appropriate primers.For standard PCR experiments a set of primer pairs amplifying

E X P E R I M E N T A L C E L L R E S E A R C H 3 2 0 ( 2 0 1 4 ) 2 6 9 – 2 8 0272

fragments ranging from 157 to 579 bp was designed to hybridise tounique regions of the appropriate chicken gene sequence (Table 1).The amplification reactions were carried out in the MJ Minipersonal thermal cycler (Bio-Rad, Hercules, CA, USA). A 5 μl sampleof the PCR reaction was electrophoresed on an ethidium bromide-containing 2% agarose gel by the use of the Bio-Rad Sub-cell GTSystem. After migration, bands corresponding to the amplifiedproducts were visualised with the Bio-Rad Gel Doc XR System.Quantitative real-time PCR (QPCR) was performed using Light-

Cycler 480 SYBR Green I Master (Roche) on the Roche LightCycler480 Instrument, according to manufacturer's recommended pro-cedure. All reactions were run as triplicates using a set of primerpairs amplifying fragments ranging from 128 to 239 bp designedto hybridise to unique regions of the appropriate chicken genesequence (Table 2). The melt-curve analysis was performed at theend of each experiment to verify that a single product per primerpair was amplified. Gel electrophoresis was also performed as acontrol experiments to verify the specificity and size of theamplified QPCR products. Samples were analysed using the RocheLightCycler 480 Software (release 1.5.0) and the second derivativemaximum method. The fold changes were determined relative toa calibrator after normalising to β-actin (internal reference)through the use of the formula 2�ΔΔCT [44,45].

Analysis of Mef2c translocation and Myosin expression inmouse myoblasts

Murine C2C12 cells were cultured in differentiation medium for 6or 24 h. During this incubation the cells were exposed to 10 μM ofDETA-NO, in the absence or presence of 1 mM of KT5823[46–48]. The total fraction was obtained by cell homogenisationin RIPA buffer as specified above. The nuclear and cytosolicfractions of cells were separated using a NE-PER nuclear andextraction reagent kit (Pierce), in accordance with the manufac-turer's protocol. The cell pellet was homogenised in ice-coldbuffer with a protease inhibitor cocktail. After 10 min, the homo-genate was centrifuged and the supernatant transferred to a cleanpre-chilled tube (cytosolic extract). The insoluble (pellet) fraction,which contains nuclei, was suspended in hot Laemmly samplebuffer. The total, cytoplasmic, and nuclear extracts were used forWestern blot analysis as described above, using anti-Mef2c(1:1000), anti-Myosin (1:200), anti-GAPDH (1:10000; cytosolic

Table 2 – Primer pairs used for QPCR analysis.

Name Symbol Primer sequence

Myocyte-specificenhancer factor2c

mef2c F: 5′-AGCAGCTCAGCCACTTTCTC-3′R: 5′-AATATTCACCACCCGGTTCA-3′

Myogenin myog F: 5′-GGCTTTGGAGGAGAAGGACT-3′R: 5′-CAGAGTGCTGCGTTTCAGAG-3′

Myosin mhy1 F: 5′-CTTCAACCACCACATGTTCG-3′R: 5′-GCTTGGGCTTCTGAAAGTTG-3′

β-actin actb F: 5′-CCGCTCTATGAAGGCTACGC-3′R: 5′-CTCTCGGCTGTGGTGGTGAA-3′

F: forward, R: reverse.

loading), anti-TATA binding protein (TBP; 1:2000; nuclear load-ing), and anti-β-actin (1:5000; total loading) primary antibodies.By means of the NIH ImageJ software, the semi-quantitativeanalysis of nuclear expression of Mef2c was performed bymeasuring the optical density of the protein band in the nuclearextract with respect to the optical density of the band corre-sponding to TBP.

Statistical analyses

Upon verification of normal distribution, statistical significance ofraw data between the groups in each experiment was evaluatedusing ANOVA followed by the Newman–Keuls Multiple Compar-ison post-test. The GraphPad Prism software package (GraphPadSoftware, San Diego, CA, USA) was used. After statistics (raw data),data belonging to different experiments were represented andaveraged in the same graph. The results were expressed asmeans7SEM of the indicated n values.

ChemicalsDMEM, FBS, glutamine, penicillin, and streptomycin were pur-chased from Euroclone (Milano, Italy). Primary antibodieswere obtained as follows: anti-NOS-I (610309) and anti-NOS-III(610297) from BD Biosciences (Franklin Lakes, NJ, USA); anti-Myogenin (F5D) and anti-sarcomeric Myosin (MF20) from Devel-opmental Studies Hybridoma Bank (Iowa City, IA, USA); anti-MyoD (E1) (sc-377186), anti-Myf5 (N-20) (sc-31946) and anti-Mef2a (C-21) (sc-313) from Santa Cruz Biotechnology (Dallas, TX,USA); anti-TBP (1TBP18) (ab818) and anti-Mef2c (ab64644) fromAbcam (Cambridge, UK). HRP-conjugated secondary antibodieswere purchased from Cell Signaling (Danvers, MA, USA). NPLAwas obtained from Cayman Chemical (Boston, MA, USA); DETA-NO and ODQ were obtained from Alexis Italia, and KT5823 fromMerck Millipore (Darmstadt, Germany). T3 and T7 polymerases,Nitro Blue, Tetrazolium and Bromo Chloro-Indole-Phosphate wereobtained from Promega (Milan, Italy). Primer pairs were obtainedfrom Primm (Milan, Italy). Where not specified, chemicals andreagents including anti-GAPDH (G8795) and anti-β-actin (A2228)were purchased from Sigma-Aldrich (Milan, Italy).

Results

Nitric oxide is required for embryonic but not foetal growth

To study the role of NO during chick embryogenesis the expressionof NOS-I and NOS-III was evaluated by Western blotting at differentdevelopmental HH stages. As shown in Fig. 1A high NOS-I expressionwas found in the early phase of development (HH12 and HH18;embryonic development), while at later stages (HH28, HH30 andHH34; foetal development) [42,49] it significantly diminished toreach very low levels. On the contrary, expression of NOS-IIIremained unchanged throughout the stages investigated (Fig. 1B).

To assess a possible role of NOS-I in the growth of embryo, eggswere injected with the specific inhibitor of NOS-I NPLA (500 ng/gegg) [50], at different times of development, and embryos thenevaluated in terms of weight and area. At HH18, a stage of high NOS-I expression, the inhibition of the enzyme significantly decreasedembryo growth with respect to the controls (Fig. 1C and D). This

E X P E R I M E N T A L C E L L R E S E A R C H 3 2 0 ( 2 0 1 4 ) 2 6 9 – 2 8 0 273

effect was reversed by the co-administration at early stages ofdevelopment of NPLA and 2 mg/g egg of DETA-NO, a NO donor thatreleases NO persistently and at physiological rates [46,47]. Bycontrast, no differences were observed in embryos from treatedand control eggs at HH30, a stage corresponding to low level ofNOS-I expression (Fig. 1E and F).

Fig. 1 – ((A) and (B)) Western blotting analysis of NOS-I (A) and NOdifferent HH stages. GAPDH was used as internal standard. Each hisexperiments (n¼5 eggs per group). The semi-quantitative analysisNOS protein bands with respect to the optical density of the band cRepresentative images are depicted in the upper panels. ((C)–(F)) Mand HH30 ((E) and (F)) stages, assessed in terms of weight and areegg) and NPLAþDETA-NO (2 mg/g egg). DETA-NO was applied alsorepresent the mean7SEM of data from 3 independent experimentssetting the control samples as 1. npo0.01 vs. CTR. Representative ibar¼40 lm.

Nitric oxide modulates embryonic myogenicdifferentiation

To assess whether NOS-I inhibition in chicken eggs led to adysregulated myogenesis during embryonic development, weanalysed at HH18 the expression of Myosin, a hallmark of muscle

S-III (B) protein levels during chick embryo development attogram represents the mean7SEM of data from 5 independentof blots was performed by measuring the optical density of theorresponding to GAPDH. npo0.05 and nnpo0.01 vs. HH18 stage.orphological analysis of chick embryos at HH18 ((C) and (D))

a. Eggs were treated with Hepes (CTR: control), NPLA (500 ng/galone (HH30 stage experiment). Weight and area values(n¼5 eggs per group). Data in the histograms are expressed bymages are depicted in the upper panels of (C) and (E). Scale

Fig. 2 – (A) Digital imaging of chick embryo sections loaded with the fluorescent DNA-binding dye DAPI and Myosin antibody. Eggswere treated with Hepes (CTR: control) or with NPLA (500 ng/g egg) and analysed at HH18 stage. The images are representative of 3independent experiments (n¼5 eggs per group). Scale bar¼500 lm. (B) Digital imaging of whole-mount in situ hybridisation ofchick embryos using a Myogenin probe. Eggs were treated with Hepes (CTR: control), NPLA (500 ng/g egg), or NPLAþDETA-NO(2 mg/g egg) and analysed at HH18 stage. The images are representative of 3 independent experiments (n¼5 eggs per group). Scalebar¼1 mm. The boxed areas in the upper row are shown at higher magnification in the lower row.

Fig. 3 – Western blotting analysis of MyoD, Myf5, Mef2c, Myogenin, and Myosin in chick embryo. Eggs were treated with Hepes(CTR: control), NPLA (500 ng/g egg), or NPLAþDETA-NO (2 mg/g egg) and analysed at HH18 stage. GAPDH was used as internalstandard. Each histogram represents the mean7SEM of data from 5 independent experiments (n¼5 eggs per group). The semi-quantitative analysis of blots was performed by measuring the optical density of the protein bands with respect to the opticaldensity of the band corresponding to GAPDH. Data are expressed by setting the control samples as 1. npo0.01 and nnpo0.001 vs.CTR. Representative images are depicted in the upper panels.

E X P E R I M E N T A L C E L L R E S E A R C H 3 2 0 ( 2 0 1 4 ) 2 6 9 – 2 8 0274

E X P E R I M E N T A L C E L L R E S E A R C H 3 2 0 ( 2 0 1 4 ) 2 6 9 – 2 8 0 275

terminal-differentiation [32,33]. Immunofluorescence analysis ofFig. 2A showed a noticeable decrease of Myosin expression afteregg injections with 500 ng/g egg NPLA.

In situ hybridisation experiments depicting the expression ofMyogenin mRNA levels in chick embryo at stage HH18 (Fig. 2B)revealed that the egg injections of 500 ng/g egg NPLA reducedMyogenin levels with respect to the untreated control, while therestoration of NO levels by 2 mg/g egg DETA-NO-injectionsreversed NPLA effects.These data prompted us to investigate the role of NO on factors

involved in embryonic muscle formation. We investigated keyfactors expressed in chick embryo at or before stage HH18 [51,52].Treatment of eggs with 500 ng/g egg of NPLA significantlyreduced protein expression of Mef2c and Myogenin in HH18chick embryos (Fig. 3). Consistently, we found a decreasedexpression also of Myosin. The administration of 2 mg/g egg ofDETA-NO confirmed the positive effect of NO on embryonicmyogenesis as it induced an increase of these factors, whichreached levels of expression even higher than those observed inthe controls. The same pattern of expression was observed whenMef2a protein was analysed (Suppl. Fig. S3A). In contrast, NPLA orNPLA and DETA-NO injection in HH18 chick embryos did notchange the expression of the myogenic determination proteinsMyoD and Myf5 (Fig. 3). Similar results concerning MyoD, Myf5,Mef2c, Myogenin, and Myosin were obtained at mRNA levels(Fig. 4A). In particular, QPCR experiments in HH18 chick embryosshowed that NPLA significantly reduced mRNA expression ofMef2c, Myogenin and Myosin, and these effects were reversedby DETA-NO (Fig. 4B).

Nitric oxide effect in muscle embryonic development ismediated by the generation of cGMP and the activation ofPKG

NOS/NO pathway induces many of its action in muscle cells viageneration of cGMP and activation of PKG [24,48]. To evaluate thecGMP/PKG-dependence of the events we observed in chickembryos, we injected the eggs with 500 ng/g egg ODQ and600 ng/g egg KT5823 which are more selective inhibitors of sGCand PKG, respectively [53,54], and measured the development ofembryos at stage HH18. As observed in eggs treated with NPLA,embryos of ODQ- and KT5823-injected eggs showed a significantreduction in weight (Fig. 5A) and dimension (Fig. 5B) with respectto the untreated control.In situ hybridisation experiments in chick embryos at stage

HH18 showed that injection of ODQ (500 ng/g egg) and KT5823(600 ng/g egg) in the eggs reduced the mRNA levels of Myogeninwith respect to the untreated control (Fig. 5C).Consistently, this reduction was paralleled by the decrease at

protein expression level of the myogenic markers Mef2c, Myo-genin, Myosin (Fig. 5D), and Mef2a (Suppl. Fig. S3B).

Fig. 4 – (A) Standard PCR products of MyoD, Myf5, Mef2c,Myogenin, and Myosin in chick embryo. Eggs were treatedwith Hepes (CTR: control), NPLA (500 ng/g egg), orNPLAþDETA-NO (2 mg/g egg) and analysed at HH18 stage.GAPDH was used as internal reference. Images arerepresentative of 3 independent experiments (n¼5 eggs pergroup). (B) QPCR analysis of Mef2c, Myogenin, and Myosin inchick embryo treated as specified above. β-actin was used asinternal reference. Values are expressed as mean7SEM (n¼5)of the fold change over CTR (set as 1). *po0.05 vs. CTR.

E X P E R I M E N T A L C E L L R E S E A R C H 3 2 0 ( 2 0 1 4 ) 2 6 9 – 2 8 0276

Nitric oxide induces nuclear translocation of Mef2cthrough the activation of PKG

To gain insight into the molecular mechanisms underlying theobserved PKG-dependent, positive regulation of muscle embryonicdevelopment by NO, we searched for targets of its effect. A largebody of evidence implicates Mef2 proteins, including Mef2c, as keydownstream effectors of signalling pathways that control skeletal

Fig. 5 – Eggs were treated with Hepes (CTR: control), ODQ (500 ng/gat HH18 stage. ((A) and (B)) Morphological analysis assessed in termean7SEM of data from 3 independent experiments (n¼5 eggs pcontrol samples as 1. npo0.01 and nnpo0.001 vs. CTR. Representatbar¼40 lm. (C) Digital imaging of whole-mount in situ hybridisatiindependent experiments (n¼5 eggs per group). Scale bar¼1 mmmagnification in the lower row. (D) Western blotting analysis of Minternal standard. Each histogram represents the mean7SEM of dasemi-quantitative analysis of blots was performed by measuring toptical density of the band corresponding to GAPDH. Data are expand nnnpo0.001 vs. CTR. Representative images are depicted in the

muscle differentiation [55–57]. Mef2c is activated by differentmechanisms followed by its nuclear translocation and its transcrip-tional activity [57,58]. Since myogenic differentiation can berecapitulated in vitro, wherein myoblasts can be converted tomyotubes, we investigated whether the myogenic role of the NO/PKG pathway was linked to Mef2c activation (i.e. increased nuclearlocalisation) using the C2C12 mouse cell line, a well-establishedmodel for myogenic differentiation. Differentiating cells were

egg) and KT5823 (600 ng/g egg) and the chick embryo analysedms of weight and area. Weight and area values represent theer group). Data in the histograms are expressed by setting theive images are depicted in the upper panel of (A). Scaleon using a Myogenin probe. The images are representative of 3. The boxed areas in the upper row are shown at higheref2c, Myogenin, and Myosin protein levels. GAPDH was used asta from 5 independent experiments (n¼5 eggs per group). Thehe optical density of the protein bands with respect to theressed by setting the control samples as 1. npo0.05, nnpo0.01,upper panels.

E X P E R I M E N T A L C E L L R E S E A R C H 3 2 0 ( 2 0 1 4 ) 2 6 9 – 2 8 0 277

treated for 6 h with 10 μM DETA-NO in the absence or in thepresence of 1 μM KT5823 [47,48] and cytoplasmic/nuclear localisa-tion of Mef2c was evaluated by Western blotting after subcellularfractionation. The application of DETA-NO significantly increasedMef2c nuclear content with respect to the untreated control andthis effect was reversed by KT5823 (Fig. 6A and B). The fact that 6 hcell treatments did not change the total content of Mef2c (Suppl.Fig. S4) suggests that during the early stages of differentiation theNO/PKG pathway was positively coupled to Mef2c activation whilenot yet affecting Mef2c expression.

The mechanistic link between the NO/PKG pathway and thecommitment to differentiation of C2C12 myoblasts was alsodemonstrated at later stages by Western blotting of Myosinexpression. As shown in Fig. 6C, the levels of Myosin increasedin cells treated for 24 h with DETA-NO with respect to theuntreated control and this effect was reversed by KT5823.

Discussion

In this study, we provide the first evidence on the function ofNO/cGMP system during the embryonic development of verte-brate muscular tissues. Much of our understanding of earlyvertebrate embryogenesis derives from experimental work donewith the avian embryo [29,31]. NO is normally present in thedeveloping chick embryo and perturbations of endogenous NOSactivity was already known to alter the normal pattern of NOproduction and induce tissue-specific dysmorphogenesis [21]. Ithad not been known whether and at which stages NO acts tocontrol embryonic myogenesis. We show here that while NOS-IIIlevels remain unchanged during chick embryo development theexpression of NOS-I is developmentally regulated with a peak ofexpression occurring in the early phase of development. We also

Fig. 6 – (A) Western blotting analysis of Mef2c protein levels in cycultured in differentiation medium for 6 h in the absence (CTR: coNOþKT5823 (1 μM). GAPDH and TBP were used for detection of cyrepresentative of 5 independent experiments. (B) Semi-quantitativmeasuring the optical density of the protein band in the nuclear ecorresponding to TBP. Each histogram represents the mean7SEM(C) Western blotting analysis of Myosin protein levels in total extracβ-actin was used as internal standard. The image is representative

show that the inhibition of NOS-I within this temporal windowdecreases the growth of embryo, an effect reversed by NOadministration. These findings demonstrate that NO is requiredfor the growth of egg during embryonic development of chickenwhile being dispensable for the foetal one. The fact that Myosinexpression at HH18 decreases after NOS-I inhibition indicates forthe first time that NO is a fundamental player on the primaryembryonic myogenesis. Further, it indicates that NOS-I-generatedNO has an important role, as inhibition of this enzyme is per sesufficient to disrupt physiological morphogenesis. These resultsprovide a functional explanation of previous findings on devel-opmental changes in NOS-I expression in mouse in which peaksof expression and activity coincide with embryonic myoblastsfusion [37].We found that NO acts on key events and molecular players in

myogenic development. In this process relevant are MRFs thatappear in the precursor compartment of the myotome even beforethese histological and biochemical differentiation takes place. MRFsregulate myogenesis tightly: expression of MyoD and Myf5 by cellsthat migrate from the somite occurs when they reach the limb[30,32]. There is a general agreement that MyoD and Myf5 act todetermine the myoblast lineage whereas Myogenin, MRF4 andMef2 family are important for the subsequent differentiation andmaintenance of the terminally differentiated state [29,30,32,33].We demonstrate a selective action of NO, produced by NOS-I, onMRFs in the early phase of chick embryo development: inhibitionof NO generation lead to a decreased expression of Mef2a, Mef2c,Myogenin and thus Myosin while the restoring of physiological NOlevels by the administration of a NO donor reverses these effects.In adult muscle NO has been found to modulate the expression ofMyoD, Myf5, Myogenin, and Mef2c in myogenic stem cells [59–61].At variance with the adult muscle NO had no effect on MyoD andMyf5 in embryo. These results indicate a role of NO as key

tosolic (C) and nuclear (N) extracts of C2C12 cells. Cells werentrol) and in the presence of DETA-NO (10 μM) or DETA-tosolic and nuclear loading, respectively. The image ise analysis of nuclear expression of Mef2c protein performed byxtract with respect to the optical density of the bandof data from 5 independent experiments. npo0.001 vs. CTR.ts of C2C12 cells. Cells were cultured as described above for 24 h.of 5 independent experiments.

E X P E R I M E N T A L C E L L R E S E A R C H 3 2 0 ( 2 0 1 4 ) 2 6 9 – 2 8 0278

signalling molecules in myogenic differentiation and not in myo-genic determination.We found that activation of the cGMP/PKG pathway is a key

event in the modulation of the MRFs exerted by NO activity.Mef2c facilitates Myogenin-mediated differentiation of muscleand it is also capable of directly interacting with other MRFs toactivate synergistically several muscle-specific genes, turning thenascent myotube from a committed myoblast into a mature fibre[55–58,62]. The fact that the activation of this transcription factoris under the control of the NO/PKG pathway positions NO at thecentre of regulation of embryonic myogenesis.

Remarks

The role of NO in regulating adult skeletal muscle function hasbeen characterised thoroughly. It regulates the coupling ofexcitation and contraction such that it prevents muscle damageduring contractile activity [63]. In addition NO reduces muscletetanic and twitch contractions without affecting maximal pro-duction of force [63]. It also regulates the development ofneuromuscular synapses acting on the control of both activity-dependent and resting potential [64]. Furthermore NO has aprofound importance on muscle bioenergetics. It vasodilatingeffect contributes to the supply of oxygen and to increase theuptake glucose during muscle exercise [63]. This short term actionis accompanied by more lasting changes due to NO ability toenhance mitochondrial biogenesis [65] and regulates severalenzymes relevant to cell energy metabolism [63]. Alongside theseeffects NO has been shown also contribute directly to musclerepair via several mechanisms ultimately resulting in anenhanced maintenance of the pool of myogenic precursor cellsand in the stimulation of activation, proliferation, differentiationand fusion of these cells [48,66–70].Our results identify NO produced by NOS-I as a key messenger

inducing the early phase of embryonic development of chicken,acting as a critical determinant of myogenesis, thus providing aphysiological muscle correlate to previous morphological observa-tions [15,18–21]. In particular, we found that the NO acting throughits physiological cGMP/PKG pathway is positively coupled to myo-genic differentiation. In contrast to somitogenesis, which is aninherent process of the paraxial mesoderm, somite differentiationinto muscular tissues depends on local signalling between neigh-bouring structures. In particular, after extirpation of the neural tube,myotome differentiation is suppressed [29,31]. In chicken develop-ment NO has been shown to be fundamental during the growth ofthe nervous system, including the development of neuroepitheliumand the closure of neural tube [15,18–21]. Although it is generallyaccepted that the initiation of myogenesis is independent of thepresence of the neural tube and even occurs in the neighbourhoodof a grafted notochord [29], it is tempting to speculate the existenceof a functional cross-talk between NO-induced neurogenesis andNO-induced myogenesis.

Acknowledgments

We thank Dr. Sestina Falcone (UMR S787 Inserm, Université Pierreet Marie Curie Paris 6, Paris, France) for her help during thisproject. This work was supported by grants from the EuropeanCommunity's framework programme FP7/2007-2013 under the

agreement no. 241440 (ENDOSTEM), from the “AssociazioneItaliana Ricerca sul Cancro” (AIRC, IG11365), from the “Ministerodella Salute” (RC2013), from “Regione Lombardia” (NEPENTEProject) to E.C., and from the “Ministero dell'Istruzione, Universitàe Ricerca” (MIUR, PRIN2010-2011) to E.C. and D.C.

Appendix A. Supplementary material

Supplementary data associated with this article can be found inthe online version at http://dx.doi.org/10.1016/j.yexcr.2013.11.006.

r e f e r e n c e s

[1] D.G. Hirst, T. Robson, Nitric oxide physiology and pathology,Methods Mol. Biol. 704 (2011) 1–13.

[2] M. Tsutsui, H. Shimokawa, T. Morishita, Y. Nakashima, N. Yana-gihara, Development of genetically engineered mice lacking allthree nitric oxide synthases, J. Pharmacol. Sci. 102 (2006)147–154.

[3] B. Kuzin, I. Roberts, N. Peunova, G. Enikolopov, Nitric oxideregulates cell proliferation during Drosophila development,Cell 87 (1996) 639–649.

[4] K.R. Schwarz, P.R. Pires, T.H. de Bem, P.R. Adona, C.L. Leal,Consequences of nitric oxide synthase inhibition during bovineoocyte maturation on meiosis and embryo development, Reprod.Domest. Anim. 45 (2010) 75–80.

[5] K. Sengoku, N. Takuma, M. Horikawa, K. Tsuchiya, H. Komori,D. Sharifa, K. Tamate, M. Ishikawa, Requirement of nitric oxide formurine oocyte maturation, embryo development, and tropho-blast outgrowth in vitro, Mol. Reprod. Dev. 58 (2001) 262–268.

[6] A. Vignini, A. Turi, S.R. Giannubilo, D. Pescosolido, P. Scognami-glio, S. Zanconi, C. Silvi, L. Mazzanti, A.L. Tranquilli, Follicular fluidnitric oxide (NO) concentrations in stimulated cycles: the rela-tionship to embryo grading, Arch. Gynecol. Obstet. 277 (2008)229–232.

[7] R.C. Gouge, P. Marshburn, B.E. Gordon, W. Nunley, Y.M. Huet-Hudson, Nitric oxide as a regulator of embryonic development,Biol. Reprod. 58 (1998) 875–879.

[8] G.M. Tiboni, E. Clementini, Teratological consequences of nitricoxide synthesis inhibition, Curr. Pharm. Des. 10 (2004) 2759–2767.

[9] H. Khan, K.T. Kusakabe, S. Wakitani, M. Hiyama, A. Takeshita,Y. Kiso, Expression and localization of NO synthase isoenzymes(iNOS and eNOS) in development of the rabbit placenta, J.Reprod. Dev. 58 (2012) 231–236.

[10] A.M. Teichert, J.A. Scott, G.B. Robb, Y.Q. Zhou, S.N. Zhu, M. Lem,A. Keightley, B.M. Steer, A.C. Schuh, S.L. Adamson, M.I. Cybulsky,P.A. Marsden, Endothelial nitric oxide synthase gene expressionduring murine embryogenesis: commencement of expression inthe embryo occurs with the establishment of a unidirectionalcirculatory system, Circ. Res. 103 (2008) 24–33.

[11] M. Saura, C. Tarin, C. Zaragoza, Recent insights into the implica-tion of nitric oxide in osteoblast differentiation and proliferationduring bone development, Sci. World J. 10 (2010) 624–632.

[12] Y. Liu, Q. Feng, NOing the heart: role of nitric oxide synthase-3 inheart development, Differentiation 84 (2012) 54–61.

[13] W. Bloch, K. Addicks, J. Hescheler, B.K. Fleischmann, Nitric oxidesynthase expression and function in embryonic and adultcardiomyocytes, Microsc. Res. Tech. 55 (2001) 259–269.

[14] T.S. Sherman, Z. Chen, I.S. Yuhanna, K.S. Lau, L.R. Margraf,P.W. Shaul, Nitric oxide synthase isoform expression in the devel-oping lung epithelium, Am. J. Physiol. 276 (1999) L383–L390.

E X P E R I M E N T A L C E L L R E S E A R C H 3 2 0 ( 2 0 1 4 ) 2 6 9 – 2 8 0 279

[15] A. Nachmany, V. Gold, A. Tsur, D. Arad, M. Weil, Neural tubeclosure depends on nitric oxide synthase activity, J. Neurochem.96 (2006) 247–253.

[16] A. Contestabile, Role of nitric oxide in cerebellar developmentand function: focus on granule neurons, Cerebellum 11 (2012)50–61.

[17] E. Ciani, S. Severi, A. Contestabile, R. Bartesaghi, Nitric oxidenegatively regulates proliferation and promotes neuronal differ-entiation through N-Myc downregulation, J. Cell Sci. 117 (2004)4727–4737.

[18] A. Traister, S. Abashidze, V. Gold, N. Plachta, E. Karchovsky,K. Patel, M. Weil, Evidence that nitric oxide regulates cell-cycleprogression in the developing chick neuroepithelium, Dev. Dyn.225 (2002) 271–276.

[19] A. Traister, S. Abashidze, V. Gold, R. Yairi, E. Michael, N. Plachta,I. McKinnell, K. Patel, A. Fainsod, M. Weil, BMP controls nitricoxide-mediated regulation of cell numbers in the developingneural tube, Cell Death Differ. 11 (2004) 832–841.

[20] N. Plachta, A. Traister, M. Weil, Nitric oxide is involved in establishingthe balance between cell cycle progression and cell death in thedeveloping neural tube, Exp. Cell Res. 288 (2003) 354–362.

[21] P.G. Alexander, L. Chau, R.S. Tuan, Role of nitric oxide in chickembryonic organogenesis and dysmorphogenesis, Birth DefectsRes. A Clin. Mol. Teratol. 79 (2007) 581–594.

[22] B. Puttmann, E.M. Gerlach, M. Kruger, D. Blottner, Neuromuscularcontacts induce nitric oxide signals in skeletal myotubes in vitro,Neurosignals 14 (2005) 85–95.

[23] S. Arnhold, M. When, D. Labbe, C. Andressen, K. Addicks,Transient expression of NOS-II during development of themurine enteric nervous system, J. Mol. Histol. 35 (2004) 741–748.

[24] A.Y. Kots, K. Bian, F. Murad, Nitric oxide and cyclic GMP signalingpathway as a focus for drug development, Curr. Med. Chem. 18(2011) 3299–3305.

[25] T.C. Bellamy, J. Wood, J. Garthwaite, On the activation of solubleguanylyl cyclase by nitric oxide, Proc. Nat. Acad. Sci. U.S.A. 99(2002) 507–510.

[26] R.G. Knowles, M. Palacios, R.M. Palmer, S. Moncada, Formationof nitric oxide from L-arginine in the central nervous system:a transduction mechanism for stimulation of the soluble gua-nylate cyclase, Proc. Nat. Acad. Sci. U.S.A. 86 (1989) 5159–5162.

[27] V.G. Sharin, K. Mujoo, A.Y. Kots, E. Martin, F. Murad, I.G. Sharina,Nitric oxide receptor soluble guanylyl cyclase undergoes splicingregulation in differentiating human embryonic cells, Stem CellsDev. 20 (2011) 1287–1293.

[28] A. Friebe, E. Mergia, O. Dangel, A. Lange, D. Koesling, Fatalgastrointestinal obstruction and hypertension in mice lackingnitric oxide-sensitive guanylyl cyclase, Proc. Nat. Acad. Sci. U.S.A.104 (2007) 7699–7704.

[29] B. Brand-Saberi, J. Wilting, C. Ebensperger, B. Christ, The forma-tion of somite compartments in the avian embryo, Int. J. Dev.Biol. 40 (1996) 411–420.

[30] R.L. Perry, M.A. Rudnick, Molecular mechanisms regulatingmyogenic determination and differentiation, Front. Biosci. 5(2000) D750–D767.

[31] F.E. Stockdale, W. Nikovits Jr., B. Christ, Molecular and cellularbiology of avian somite development, Dev. Dyn. 219 (2000)304–321.

[32] M. Buckingham, L. Bajard, T. Chang, P. Daubas, J. Hadchouel,S. Meilhac, D. Montarras, D. Rocancourt, F. Relaix, The formation ofskeletal muscle: from somite to limb, J. Anat. 202 (2003) 59–68.

[33] M.H. Parker, P. Seale, M.A. Rudnicki, Looking back to the embryo:defining transcriptional networks in adult myogenesis, Nat. Rev.Genet. 4 (2003) 497–507.

[34] R.D. Cohn, K.P. Campbell, Molecular basis of muscular dystro-phies, Muscle Nerve 23 (2000) 1456–1471.

[35] L. Kobzik, M.B. Reid, D.S. Bredt, J.S. Stamler, Nitric oxide inskeletal muscle, Nature 372 (1994) 546–548.

[36] J.E. Anderson, C. Vargas, Correlated NOS-Imu and myf5 expres-sion by satellite cells in mdx mouse muscle regeneration duringNOS manipulation and deflazacort treatment, Neuromuscul.Disord. 13 (2003) 388–396.

[37] D. Blottner, G. Luck, Nitric oxide synthase (NOS) in mouseskeletal muscle development and differentiated myoblasts, CellTissue Res. 292 (1998) 293–302.

[38] N. Peunova, V. Scheinker, K. Ravi, G. Enikolopov, Nitric oxidecoordinates cell proliferation and cell movements during earlydevelopment of Xenopus, Cell Cycle 6 (2007) 3132–3144.

[39] V. Hamburger, H.L. Hamilton, A series of normal stages in thedevelopment of the chick embryo. 1951, Dev. Dyn. 195 (1992)231–272.

[40] L. De Angelis, S. Borghi, R. Melchionna, L. Berghella, M. Baccarani-Contri, F. Parise, S. Ferrari, G. Cossu, Inhibition of myogenesis bytransforming growth factor beta is density-dependent andrelated to the translocation of transcription factor MEF2 to thecytoplasm, Proc. Nat. Acad. Sci. U.S.A. 95 (1998) 12358–12363.

[41] R. Barsacchi, C. Perrotta, S. Bulotta, S. Moncada, N. Borgese,E. Clementi, Activation of endothelial nitric-oxide synthase bytumor necrosis factor-alpha: a novel pathway involving sequen-tial activation of neutral sphingomyelinase, phosphatidylinositol-3′ kinase, and Akt, Mol. Pharmacol. 63 (2003) 886–895.

[42] Y. Piestun, M. Harel, M. Barak, S. Yahav, O. Halevy, Thermalmanipulations in late-term chick embryos have immediate andlonger term effects on myoblast proliferation and skeletal musclehypertrophy, J. Appl. Physiol. 106 (2009) 233–240.

[43] T.M. Schultheiss, S. Xydas, A.B. Lassar, Induction of avian cardiacmyogenesis by anterior endoderm, Development 121 (1995)4203–4214.

[44] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expressiondata using real-time quantitative PCR and the 2-DDCT method,Methods 25 (2001) 402–408.

[45] D. Cervia, D. Martini, C. Ristori, E. Catalani, A.M. Timperio,P. Bagnoli, G. Casini, Modulation of the neuronal response toischaemia by somatostatin analogues in wild-type and knock-outmouse retinas, J. Neurochem. 106 (2008) 2224–2235.

[46] E. Clementi, G.C. Brown, M. Feelisch, S. Moncada, Persistentinhibition of cell respiration by nitric oxide: crucial role ofS-nitrosylation of mitochondrial complex I and protective actionof glutathione, Proc. Nat. Acad. Sci. U.S.A. 95 (1998) 7631–7636.

[47] C. Perrotta, L. Bizzozero, S. Falcone, P. Rovere-Querini, A. Prinetti,E.H. Schuchman, S. Sonnino, A.A. Manfredi, E. Clementi, Nitricoxide boosts chemoimmunotherapy via inhibition of acidsphingomyelinase in a mouse model of melanoma, Cancer Res.67 (2007) 7559–7564.

[48] C. De Palma, S. Falcone, S. Pisoni, S. Cipolat, C. Panzeri, S.Pambianco, A. Pisconti, R. Allevi, M.T. Bassi, G. Cossu, T. Pozzan,S. Moncada, L. Scorrano, S. Brunelli, E. Clementi, Nitric oxideinhibition of Drp1-mediated mitochondrial fission is critical formyogenic differentiation, Cell Death Differ. 17 (2010) 1684–1696.

[49] F.E. Stockdale, Myogenic cell lineages, Dev. Biol. 154 (1992) 284–298.[50] H.Q. Zhang, W. Fast, M.A. Marletta, P. Martasek, R.B. Silverman,

Potent and selective inhibition of neuronal nitric oxide synthaseby Nomega-propyl-L-arginine, J. Med. Chem. 40 (1997)3869–3870.

[51] D.W. Burt, Chicken genome: current status and future opportu-nities, Genome Res. 15 (2005) 1692–1698.

[52] P.B. Antin, S. Kaur, S. Stanislaw, S. Davey, J.H. Konieczka, T.A.Yatskievych, D.K. Darnell, Gallus expression in situ hybridizationanalysis: a chicken embryo gene expression database, Poult. Sci.86 (2007) 1472–1477.

[53] M. Burkhardt, M. Glazova, S. Gambaryan, T. Vollkommer, E. Butt,B. Bader, K. Heermeier, T.M. Lincoln, U. Walter, A. Palmetshofer,KT5823 inhibits cGMP-dependent protein kinase activity in vitrobut not in intact human platelets and rat mesangial cells, J. Biol.Chem. 275 (2000) 33536–33541.

E X P E R I M E N T A L C E L L R E S E A R C H 3 2 0 ( 2 0 1 4 ) 2 6 9 – 2 8 0280

[54] Y. Zhao, P.E. Brandish, M. Di Valentin, J.P. Schelvis, G.T. Babcock,M.A. Marletta, , Inhibition of soluble guanylate cyclase by ODQ,Biochemistry 39 (2000) 10848–10854.

[55] M.J. Potthoff, E.N. Olson, MEF2: a central regulator of diversedevelopmental programs, Development 134 (2007) 4131–4140.

[56] Y. Hinits, S.M. Hughes, Mef2s are required for thick filamentformation in nascent muscle fibres, Development 134 (2007)2511–2519.

[57] A.S. Al Madhoun, V. Mehta, G. Li, D. Figeys, N. Wiper-Bergeron,I.S. Skerjanc, Skeletal myosin light chain kinase regulates skeletalmyogenesis by phosphorylation of MEF2C, EMBO J. 30 (2011)2477–2489.

[58] K. Ma, J.K. Chan, G. Zhu, Z. Wu, Myocyte enhancer factor 2acetylation by p300 enhances its DNA binding activity, tran-scriptional activity, and myogenic differentiation, Mol. Cell. Biol.25 (2005) 3575–3582.

[59] B.A. Danalache, J. Paquin, W. Donghao, R. Grygorczyk, J.C. Moore,C.L. Mummery, J. Gutkowska, M. Jankowski, Nitric oxide signal-ing in oxytocin-mediated cardiomyogenesis, Stem Cells 25(2007) 679–688.

[60] J.J. Cho-Lim, V.J. Caiozzo, B.P. Tseng, E. Giedzinski, M.J. Baker,C.L. Limoli, Satellite cells say NO to radiation, Radiat. Res. 175(2011) 561–568.

[61] G. Wang, F.J. Burczynski, B.B. Hasinoff, K. Zhang, Q. Lu, J.E.Anderson, Development of a nitric oxide-releasing analogue ofthe muscle relaxant guaifenesin for skeletal muscle satellite cellmyogenesis, Mol. Pharm. 6 (2009) 895–904.

[62] Z.X. Ji, C. Du, G.S. Wu, S.Y. Li, G.S. An, Y.X. Yang, R. Jia, H.T. Jia,J.H. Ni, Synergistic up-regulation of muscle LIM protein expres-sion in C2C12 and NIH3T3 cells by myogenin and MEF2C, Mol.Genet. Genomics 281 (2009) 1–10.

[63] J.S. Stamler, G. Meissner, Physiology of nitric oxide in skeletalmuscle, Physiol. Rev. 81 (2001) 209–237.

[64] T. Wang, Z. Xie, B. Lu, Nitric oxide mediates activity-dependentsynaptic suppression at developing neuromuscular synapses,Nature 374 (1995) 262–266.

[65] E. Nisoli, S. Falcone, C. Tonello, V. Cozzi, L. Palomba, M. Fiorani,A. Pisconti, S. Brunelli, A. Cardile, M. Francolini, O. Cantoni, M.O.Carruba, S. Moncada, E. Clementi, Mitochondrial biogenesis byNO yields functionally active mitochondria in mammals, Proc.Nat. Acad. Sci. U.S.A. 101 (2004) 16507–16512.

[66] J.E. Anderson, A role for nitric oxide in muscle repair: nitricoxide-mediated activation of muscle satellite cells, Mol. Biol. Cell11 (2000) 1859–1874.

[67] R. Buono, C. Vantaggiato, V. Pisa, E. Azzoni, M.T. Bassi, S. Brunelli,C. Sciorati, E. Clementi, Nitric oxide sustains long-term skeletalmuscle regeneration by regulating fate of satellite cells viasignaling pathways requiring Vangl2 and cyclic GMP, Stem Cells30 (2012) 197–209.

[68] C. De Palma, E. Clementi, Nitric oxide in myogenesis andtherapeutic muscle repair, Mol. Neurobiol. 46 (2012) 682–692.

[69] C. Colussi, C. Mozzetta, A. Gurtner, B. Illi, J. Rosati, S. Straino,G. Ragone, M. Pescatori, G. Zaccagnini, A. Antonini, G. Minetti,F. Martelli, G. Piaggio, P. Gallinari, C. Steinkuhler, E. Clementi,C. Dell'Aversana, L. Altucci, A. Mai, M.C. Capogrossi, P.L. Puri,C. Gaetano, HDAC2 blockade by nitric oxide and histone deace-tylase inhibitors reveals a common target in Duchenne musculardystrophy treatment, Proc. Nat. Acad. Sci. U.S.A. 105 (2008)19183–19187.

[70] N. Cordani, V. Pisa, L. Pozzi, C. Sciorati, E. Clementi, Nitric oxidecontrols fat deposition in dystrophic skeletal muscle by regulat-ing fibro-adipogenic precursor differentiation, Stem Cells (inpress) http://dx.doi.org/10.1002/stem.1587.