Research ArticleNonhuman Primate Model of Oculocutaneous Albinism with TYRand OCA2 Mutations

Kun-Chao Wu ,1,2 Ji-Neng Lv,1,2 Hui Yang ,1,2 Feng-Mei Yang,3 Rui Lin,1,2 Qiang Lin,1,2

Ren-Juan Shen ,1,2 Jun-Bin Wang,3 Wen-Hua Duan,4 Min Hu,4 Jun Zhang,2,5

Zhan-Long He ,3 and Zi-Bing Jin 1,2

1Division of Ophthalmic Genetics, The Eye Hospital, Laboratory for Stem Cell & Retinal Regeneration, Institute of Stem Cell Research,Wenzhou Medical University, Wenzhou 325027, China2National Center for International Research in Regenerative Medicine and Neurogenetics, National Clinical Research Center forOcular Diseases, State Key Laboratory of Ophthalmology, Optometry and Visual Science, Wenzhou 325027, China3Institute of Medical Biology, Chinese Academy of Medical Sciences, And Peking Union Medical College (CAMS & PUMC),Yunnan Key Laboratory of Vaccine Research Development on Severe Infectious Disease, Kunming 650118, China4Department of Ophthalmology, The Second People’s Hospital of Yunnan Province, Fourth Affiliated Hospital of KunmingMedical University, Key Laboratory of Yunnan Province for the Prevention and Treatment of Ophthalmology,Kunming 650021, China5Laboratory of Retinal Physiology & Disease, The Eye Hospital, Wenzhou Medical University, Wenzhou 325027, China

Correspondence should be addressed to Zhan-Long He; hzl@imbcams.com.cn and Zi-Bing Jin; jinzb@mail.eye.ac.cn

Received 31 October 2019; Accepted 4 February 2020; Published 11 March 2020

Copyright © 2020 Kun-Chao Wu et al. Exclusive Licensee Science and Technology Review Publishing House. Distributed under aCreative Commons Attribution License (CC BY 4.0).

Human visual acuity is anatomically determined by the retinal fovea. The ontogenetic development of the fovea can be seriouslyhindered by oculocutaneous albinism (OCA), which is characterized by a disorder of melanin synthesis. Although people of allethnic backgrounds can be affected, no efficient treatments for OCA have been developed thus far, due partly to the lack ofeffective animal models. Rhesus macaques are genetically homologous to humans and, most importantly, exhibit structures ofthe macula and fovea that are similar to those of humans; thus, rhesus macaques present special advantages in the modeling andstudy of human macular and foveal diseases. In this study, we identified rhesus macaque models with clinical characteristicsconsistent with those of OCA patients according to observations of ocular behavior, fundus examination, and optical coherencetomography. Genomic sequencing revealed a biallelic p.L312I mutation in TYR and a homozygous p.S788L mutation in OCA2,both of which were further confirmed to affect melanin biosynthesis via in vitro assays. These rhesus macaque models of OCAwill be useful animal resources for studying foveal development and for preclinical trials of new therapies for OCA.

1. Introduction

High spatial resolution vision in humans is anatomicallydetermined by the retinal fovea, which is characterized by ahigh-density distribution of cone photoreceptors in an avas-cular zone [1–3]. The human fovea contains approximately25% retinal ganglion cells, and the synaptic connectionsbetween cones, bipolar cells, and ganglion cells in a 1 : 1 : 1ratio underlie the precise transmission of visual signals[4, 5]. The ontogenetic development of the fovea initiallybegins in fetal week 12, followed by the centripetal and cen-trifugal displacement of the cones and inner retinal layers

separately at birth, and the fovea finally becomes mature atapproximately 4 years postnatally [1–3]. A healthy developedfovea plays a critical role in accurate visual acuity. However,visual acuity can be seriously reduced by a disorder of mela-nin biosynthesis known as oculocutaneous albinism (OCA).OCA is a group of autosomal recessive disorders character-ized by the loss of or a reduction in pigmentation in the eyes,hair, and skin. Populations of all ethnic backgrounds can beaffected by OCA, with an estimated global prevalence of1 : 17,000 [6–9]. Very rarely, OCA may be accompanied bysystematic defects such as Hermansky-Pudlak and Chediak-Higashi syndromes [10–13]. To date, six disease-causing

AAASResearchVolume 2020, Article ID 1658678, 11 pageshttps://doi.org/10.34133/2020/1658678

genes of nonsyndromic OCA have been reported [14–19],among which the TYR and OCA2 genes are the most com-monly implicated in OCA [20, 21]. Tyrosine, encoded bythe TYR gene, regulates the rate-limiting step that convertsL-tyrosine to L-DOPA and subsequently to dopaquinone[14, 22]. On the other hand, OCA2 is a melanosome-specific transmembrane protein that plays an important rolein modulating the pH of melanosomes as well as the activityof chloride-selective anions, which are critical for maintain-ing the normal process of pigment formation [23, 24]. OCAis always associated with severe visual system damage,including iris translucency, congenital nystagmus, strabis-mus, misrouting of optic nerves, color vision defects, hypo-pigmentation of the retinal pigment epithelium (RPE), andfoveal hypoplasia, which lead to poor vision and seriouslyaffect the quality of life of OCA patients [6, 25–27].

The mechanisms of OCA pathogenesis have beenreported in rodents, dogs, and water buffaloes [28–31]. How-ever, these OCA animal models present the major limitationof the absence of a foveal structure similar to that of thehuman retina. To date, no effective treatments for OCA havebeen developed, due at least in part to the bottleneck of thelack of an appropriate animal model with a macula andfoveal centralis. Rhesus macaques are Old World primatesthat present several special advantages for the study ofhuman retinopathies. First, the phototransduction mecha-nism and immune microenvironment of rhesus macaquesare similar to those of humans [32, 33]. Second, the intraoc-ular structure of rhesus macaques is highly similar to that ofthe human eye, most notably in the presence of a macula andfovea [33]. Moreover, the color vision of rhesus monkeysmakes them more comparable to humans than to NewWorld primates such as capuchin monkeys [34, 35]. To thebest of our knowledge, no systematic ocular disorders clari-fied by defined causative mutations of OCA have beendescribed in rhesus macaques in previous studies.

Herein, we report rhesus macaque models with sponta-neous oculocutaneous albinism. The characteristic symp-toms, clinical manifestations, and functional testing results

of these albinotic rhesus macaques are highly parallel to thoseof OCA patients. Moreover, the causative mutations wererevealed by whole-genome sequencing. The pathogenicityof the candidate mutations was finally validated by in vitrofunctional assays.

2. Results

2.1. Albino NHPs Display Clinical Manifestations of OCA.Weidentified six rhesus macaques with an albino appearancecharacterized by red hair and pink skin (Figure 1(a)). Thesealbino monkeys were 1-10 years old, and both male (Ab-2,Ab-3, Ab-5, and Ab-6) and female (Ab-1, Ab-4) individualswere affected. Apparent horizontal nystagmus was observedin these monkeys, which is a typical clinical behavioral char-acteristic of OCA patients (Table 1 and SupplementaryVideos 1 and 2). Compared with healthy individuals, the iriscolor was different in the albino subjects (Figure 1(b)). Ana-tomically, the fovea lies slightly below the center of the opticdisk at the temporal fundus in healthy rhesus macaques(Figures 2(a) and 2(b)). Fundography of these albino subjectsshowed extensive hypopigmentation and the absence of afoveal centralis, while the choroid vasculature appeared toshow the loss of pigmentation (Figures 2(c)–2(l)).

According to the presence or absence of the extrusion ofthe plexiform layers, foveal pit, outer segment lengthening,

Table 1: Basic clinical information of the albino rhesus macaques.

Monkey ID Sex Age (years) Skin/hair color Nystagmus

Ab-1 F 2 Pink/red +

Ab-2 M 1 Pink/red NA

Ab-3 M 1 Pink/red +

Ab-4 F 3 Pink/red +

Ab-5 M 6 Pink/red +

Ab-6 M 10 Pink/red +

Ab: albinism; F: female; M: male; +: positive; NA: not available.

AlbinoControl

Control Ab-1 Ab-3 Ab-5 Ab-6

(a)

(b)

Figure 1: Clinical manifestations of albino rhesus macaques. (a) Representative photos of the monkeys. (b) Iris characterization and fundusreflection of albino and healthy rhesus macaques.

2 Research

and outer nuclear layer (ONL) widening, foveal hypoplasiacan be divided into four grades in humans [36]. Spectraldomain optical coherence tomography (SD-OCT) confirmedthe absence of a foveal centralis in the albino rhesusmacaques, and these albinotic subjects exhibited an obviousabsence of the extrusion of the plexiform layers and outersegment lengthening (Figure 3(a)). Compared with healthyindividuals, larger areas of the choroid and even sclera couldbe imaged, indicating extensive retinal hypopigmentation inthe albino macaques (Figure 3(a)). The foveal depth in thealbinotic subjects was significantly shallower than that inhealthy individuals (Figure 3(b)), indicating that the char-acteristics of the OCA monkeys were consistent with ahigh degree of OCA in humans. Thicker inner retinal layersat the fovea were found in the albino subjects (Figure 3(c)).In addition, there were marked changes in the thickness ofdifferent retinal layers in the disease subjects (Figures 3(d)–3(g)), and the thinner IS/OS and ONL layers of the retinawere a general indication of visual impairment. These resultscollectively suggest that albino rhesus macaques mimic ocu-locutaneous albinism in human patients.

2.2. Identification of Genetic Mutations in the TYR and OCA2Genes. Genomic DNA was extracted from six albino rhesus

macaques and their available parents (Figure 4(a)), followedby whole-genome sequencing. Candidate mutations of thereported genes responsible for nonsyndromic OCA inhumans were analyzed. The sequencing results showed thatall of these albino monkeys carried a homozygous missensemutation, c.2363C>T, in the OCA2 gene. Additionally, threealbino subjects (Ab-1, Ab-2, and Ab-5) were found to exhibita homozygous missense mutation, c.934C>A, in the TYRgene. We then performed cosegregation analysis to deter-mine whether the mutations cosegregated with the diseasein the albino monkeys and their available parents. The par-ents of Ab-2 were both heterozygous for the two identifiedmutations. In family 3, the mother of individual Ab-4 washeterozygous for the OCA2 mutation (Figure 4(a)). To con-firm whether these mutations exist in normal NHPs, we fur-ther screened the identified variants in 35 unrelated wild-typerhesus monkeys by Sanger sequencing and found that noneof these monkeys carried these mutations. These results indi-cated that the identified mutations in the TYR and OCA2genes partially cosegregated with OCA in an autosomalrecessive manner.

The c.934C>A mutation in the TYR gene resulted ina change from leucine to isoleucine at position 312 ofthe TYR protein (p.L312I), and the c.2363C>T mutation

(a) (b) (c) (d)

(e) (f) (g) (h)

(i) (j) (k) (l)

ONH ONH

Ab-1R Ab-1L

Ab-3R Ab-3L Ab-4R Ab-4L

Ab-5R Ab-5L Ab-6R Ab-6L

2 years 2 years

3 years 3 years1 year 1 year

10 years 10 years6 years 6 years

⁎⁎

Figure 2: Fundography of the rhesus macaques with oculocutaneous albinism. (a, b) Representative fundi of healthy subjects. (c–l) OCAmonkeys displayed extensive depigmentation. The asterisk indicates the central retina. ONH: optical nerve head.

3Research

in the OCA2 gene led to the replacement of serine withleucine at position 788 of the OCA2 protein (p.S788L).Alignment analysis among multiple species showed thatthe amino acids affected by each mutation are highlyconserved (Figures 4(b) and 4(c)). Notably, the TYRmutationfound in the monkeys has been identified in OCA patients(Albinism Database, http://www.ifpcs.org/albinism/). Thethree-dimensional structures of the TYR and OCA2 proteinswere simulated by using SwissProt and visualized by usingPyMOL. The modeling results (Figures 4(d) and 4(e))indicated that L312 of the TYR protein is likely connected

to alanine at position 241, which is also highly conservedamong species. The modeled structure of the OCA2 proteinindicated that S788 is located at an α-helix and is likelyconnected to two other highly conserved amino acids: valineresidues at positions 791 and 792 (Figures 4(f) and 4(g)).These results suggested that L312 of TYR and S788 ofOCA2 might be important for these proteins. Further-more, the computational prediction of pathogenicity showedthat each identified mutation in the TYR or OCA2 gene ishighly pathological (Supplementary Table S2). Consideringthese results together, we concluded that the identified

Right eye Left eyeCo

ntro

l A

b-1

Ab-

4A

b-5

Ab-

6Foveal centralis

Extrusion of inner retina

ONL wideningOS lengthening

Foveal depth

Control Ab

0

50

100

150

AbControl

Fove

al d

epth

(𝜇m

)Th

ickn

ess o

f inn

er re

tinal

laye

rs at

fove

al (𝜇

m)

0

50

100

200

250

300

350

–2000

T

–1000 0 1000 2000

Distance from ONH (𝜇m)

Thic

knes

s of

who

le re

tina (

𝜇m

)

N

(d) (e)

(a) (c)

(b)

(f) (g)

20

40

60

80

–2000 –1000 0 1000 2000

Thic

knes

s of

IS/O

S la

yer (𝜇

m)

T N

Distance from ONH (𝜇m)

Thic

knes

s of O

NL

laye

r (𝜇

m)

25

50

75

100

–2000 –1000 0 1000 2000

T N

Distance from ONH (𝜇m)

IS/OSONL

RPE

0

20

40

60

–2000 –1000 0 1000 2000

Thic

knes

s of

RPE

laye

r (𝜇

m)

T N

Distance from ONH (𝜇m)

ControlAlbino

⁎⁎⁎⁎⁎⁎ ⁎⁎⁎

⁎⁎⁎

⁎⁎⁎⁎⁎

⁎⁎⁎⁎⁎

⁎⁎⁎ ⁎⁎⁎⁎⁎⁎

⁎⁎ ⁎⁎⁎

⁎⁎

⁎⁎⁎

⁎⁎⁎⁎⁎⁎

⁎⁎⁎⁎⁎⁎

⁎⁎⁎

⁎⁎⁎⁎⁎⁎

⁎⁎ ⁎⁎⁎ ⁎⁎⁎ ⁎⁎ ⁎⁎⁎⁎⁎ ⁎⁎⁎

⁎⁎⁎ ⁎⁎⁎⁎⁎

⁎⁎⁎

⁎⁎⁎

⁎⁎⁎

Figure 3: Foveal hypoplasia and retinal thickness changes in rhesus macaques with oculocutaneous albinism. (a) OCT imaging of the OCAmonkeys. No obvious foveal pit was observed. ONL: outer nuclear layer; IS/OS: inner segment/outer segment; RPE: retinal epithelium cell.(b) Comparison of foveal depth between healthy individuals and albinotic subjects. (c) Statistical analysis of the thickness of the inner retinallayers between normal and albinotic rhesus macaques. The inner retinal layers include the inner nuclear layer, inner plexiform layer, retinalganglion cell layer, and retinal nerve fiber layer. Each black plot represents the value of each eye, the red plot represents the mean value, andthe black line in the boxplot represents the median value. (d, e) Thickness changes in the whole retina, ONL, IS/OS, and RPE layer in albinoNHPs. The blue and red lines represent normal and albino individuals, respectively. N ≥ 4. ∗p < 0:05, ∗∗p < 0:01, and ∗∗∗p < 0:001.

4 Research

homozygous mutations in TYR (c.934C>A, p.L312I) andOCA2 (c.2363C>T, p.S788L) are strong candidates fordisease-causing mutations in OCA in NHPs.

2.3. The TYR-L312I Mutation Results in Defective MelaninSynthesis. To ultimately determine the pathogenicity ofthe identified mutation in TYR, we performed biologicalvalidation in vitro. Human HEK293T cells were transientlytransfected with either the wild-type or mutant TYR gene

(Figures 5(a) and 5(b)). After culture for 72 h, considerablemelanin formation was apparent in 293T cells transfectedwith wild-type TYR, whereas a significant reduction inmelanin was observed in the mutant cells (Figures 5(b)and 5(c)). Next, we examined tyrosinase activity and melanincontent. We found that the TYR-L312I-transfected cells pre-sented significant decreases in tyrosinase activity and mela-nin content in contrast to the same cells with wild-typeTYR (Figures 5(d) and 5(e)). Taken together, we concluded

Homo sapiensMacaca mulattaBos taurusFelis catusMus musculusGallus gallusDanio rerio

Homo sapiensMacaca mulattaBos taurusFelis catusMus musculusGallus gallusDanio rerio

L312I

791S788L 792

(a) (c)

(d) (e)

(f) (g)

(b)

LEU-312 ALA-241

SER-788

VAL-791

VAL-792

F4F3

(Ab-4)

F2

(Ab-3)

F1

(Ab-2)

I-1 I-2 I-1 I-2I-3

(Ab-1)

I-1 I-2

TYR: c.934C>A ,homOCA2: c.2363C>T, hom

TYR: c.934C>A, homOCA2: c.2363C>T, hom

(Ab-5)

I-1 I-2

TYR: c.934C>A, homOCA2: c.2363C>T, hom

OCA2: c.2363C>T, hom

OCA2: c.2363C>T, hom

F5

(Ab-6)

I-1 I-2

OCA2: c.2363C>T, hom

OCA2: c.2363C>T, het

TYR: c.934C>A, hetOCA2: c.2363C>T, het

TYR: c.934C>A, hetOCA2: c.2363C>T, het

Figure 4: Mutation assessments. (a) Pedigree and cosegregation analysis of albino rhesus macaques. The black plot represents the OCAmonkeys (Ab-1 to Ab-6). Subjects with a horizontal line underwent whole-genome sequencing. A diagonal line indicates a decrease.F: family; hom: homozygous mutation; het: heterozygous mutation. (b, c) Multiple species alignment comparison of the identified mutations(p.L312I in TYR and p.S788L in OCA2) in the albino monkeys. (d–g) 3D homology modeling of TYR and OCA2. Homology modelingshowed that S788 of the OCA2 protein was likely connected to valine at positions 791 and 792, which were also highly conserved amongmultiple species.

5Research

that the TYR mutation identified in rhesus macaques withOCA led to impaired tyrosinase activity.

2.4. The OCA2-S788L Mutation Led to Reduced Production ofMelanin. To elucidate the biological consequences of theOCA2 mutation identified in the albino macaques, weattempted to examine melanin formation following OCA2knockdown by using shRNA and the cotransfection ofOCA2 and TYR in HEK293T cells. In the OCA2-silencedHEK293T cells overexpressing wild-type TYR, no pigmen-tation was observed (Figure 6(a)). The simultaneous over-expression of wild-type OCA2 and wild-type TYR in thesame cells resulted in apparent pigmentation, while thecotransfection of mutant OCA2 and wild-type TYR ledto significant depigmentation (Figures 6(a) and 6(b)) andreduced melanin production (Figure 6(c)). We confirmedthat there was no difference in expression levels when the cellswere cotransfected with either TYR/OCA2 or TYR/mutantOCA2, excluding the deflected effects on melanin synthesis(Figures 6(d) and 6(e)). These results demonstrated that the

OCA2 mutation (c.2363C>T, p.S788L) identified in theOCA monkeys could biologically affect melanin production.

3. Discussion

Because of their high genomic homology and similar ana-tomical eye structure and ontogenetic development of thefovea to humans, rhesus macaques present great potentialas models for studying OCA and other neurological disorders[32, 33, 37–40]. In this study, we identified rhesus macaquemodels that were characterized by classical ocular character-istics comparable to those of OCA patients, including nystag-mus, retinal hypopigmentation, and foveal hypoplasia. Wealso identified two homozygous missense mutations in theTYR (c.934C>A) andOCA2 (c.2363C>T) genes and obtainedbiological evidence that each mutation significantly affectsmelanin synthesis via functional assays.

On the basis of the genetic predisposition concerning theTYR and OCA2 genes, OCA has been classified into twotypes: OCA1 and OCA2 [6, 14]. OCA1 is further divided into

TYR-WT TYR-L312I

48 h Tyrosinase activity

Melanin content72 h

(h)

Plas

mid

cDN

Aco

nstr

uctio

nCe

ll tr

ansfe

ctio

n(H

EK29

3T)

Func

tiona

l tes

ts

Rela

tive t

yros

inas

e act

ivity

(%)

0

25

50

75

100

TYR-WT TYR-L312I

0

30

60

90

120

TYR-WT TYR-L312I

Mel

anin

cont

ent (𝜇

g/m

g)

NC TYR-WT TYR-L312I

TYR-

WT

TYR-

L312

I

(b)(a)

(e)(d)(c)

GFP Brightfield

100 𝜇m

100 𝜇m

CMV GFP CMV

GFP

⁎⁎⁎ ⁎⁎⁎

Figure 5: Functional assay of the TYR mutation. (a) Schematic diagram of the assay. (b) The transfection of mutated TYR into humanHEK293T cells resulted in defective melanin synthesis. Scale bar, 100μm. (c) Cell pellets. NC: negative control. (d) Melanin content inHEK293T cells. (e) Tyrosinase activity. N = 3. ∗p < 0:05, ∗∗p < 0:01, and ∗∗∗p < 0:001.

6 Research

subtypes OCA1A, characterized by the complete absence ofmelanin, and OCA1B, characterized by the accumulation ofsome pigments over time [8, 41]. The pathogenesis ofOCA1A and OCA1B can be distinguished by the completeloss or partially reduced activity of tyrosine [8, 14, 41]. Partialpigmentation is also present in OCA2 patients [42]. Thealbino rhesus macaques identified in this study showed redhair and pink skin, indicating partial pigmentation. Throughwhole-genome sequencing, we identified two homozygousmissense mutations in TYR (c.934C>A, p.L312I) and OCA2(c.2363C>T, p.S788L). Functional assays validated theimpairment of melanin synthesis caused by each mutation.This evidence suggests that albino rhesus macaques can begenetically characterized as the OCA1B or OCA2 type. Twodecades ago, Ding et al. discovered a rhesus macaque modelof OCA1A with a possible mutation (p.S184X) in the TYRgene [43], and Prado-Martinez et al. reported an albino west-ern lowland gorilla with a homozygous missense mutation(p.G518R) in SLC45A2 [44]; however, the ocular phenotypewas not described. In this study, we initially described theophthalmologic clinical characteristics of the albino mon-keys. As an experimental condition, the unevaluated retinalfunction of the albino monkeys will be assessed using electro-retinography in future studies. The albino macaques identi-fied in this study not only extend the known mutationspectrum of OCA in rhesus macaques but also provide newtypes of nonhuman primate models of OCA disease.

To date, hundreds of mutations in TYR and OCA2 havebeen reported in OCA patients [24]; most of the relevant

studies have determined mutation pathogenicity on the basisof cosegregation analysis or computational prediction. Fewstudies have included biological assays to validate the effectof the mutations on melanin synthesis. In pigmented cells,melanin is synthesized and sorted within a membrane-bound intracellular organelle, the melanosome, and the mel-anosomal maturation process includes four stages regulatedby key melanogenic factors [28, 45, 46]. Recently, Songet al. transfected a plasmid carrying TYR cDNA into humanHEK293T cells and observed melanin levels in vitro [47],indicating that the forced expression of TYR promotedmelanin synthesis in HEK293 cells. Using this approach, wedemonstrated that TYR mutation resulted in defectivemelanin synthesis. In addition, we developed a TYR/OCA2coexpression approach to investigate the biological effect ofOCA2 mutation on melanin synthesis in HEK293T cells,providing a simple assay for elucidating the functionalimpact of OCA2 mutation.

Great efforts have been made to develop new treatmentsfor OCA disease [47–49]. Onojafe et al. treated a Tyrc-h/-ch

mouse model with oral nitisinone, an FDA-approved inhibi-tor of tyrosine degradation, and proved that it could improvepigmentation in the fur, irises, choroid, and retinal pigmentepithelia (RPE) [49–52]. Because mice lack a macula andfovea, they exhibit much lower spatial visual acuity than pri-mates with a structural fovea [37]. Therefore, it remains achallenge to precisely evaluate the efficacy of nitisinone.The albinotic rhesus macaques identified in this study pro-vide a model without this shortcoming and could be a useful

Rela

tive e

xpre

ssio

n (%

)

0

40

80

120

OCA2

Rela

tive e

xpre

ssio

n (%

)

TYR

0

40

80

120 N.S. N.S.

Mel

anin

cont

ent (𝜇

g/m

g)

0

50

100

150

200

TYR-WT &OCA2-WT

TYR-WT &OCA2-S788L

TYR-WT &OCA2-WT

TYR-WT &OCA2-S788L

TYR-WT &OCA2-WT

TYR-WT &OCA2-S788L

TYR-WT & OCA2-WT TYR-WT & OCA2-S788L

(a)

(c) (d) (e)

(b)

100 𝜇m

TYR-WT OCA2-WT

OCA2-S788L

++–

+–

+

+–

–

⁎

100100101001001000100001001001001001000000100100100100100010000100100100000010001010000100001100 𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇𝜇mmmmmmmmmmmmmmmmmmmmmmmm

TL

++–

+–

+

+–

–

Figure 6: Functional assay of the OCA2 mutation. (a) Evaluation of cell pellets from the human HEK293T cell line transfected with TYR andOCA2. (b) Defect of melanin synthesis. (c) Measurement of melanin content. (d) Expression levels of the TYR and OCA2 genes in transfectedHEK293T cells. N = 3. ∗p < 0:05, ∗∗p < 0:01, and ∗∗∗p < 0:001.

7Research

candidate animal model. In human patients, Lee et al. evalu-ated the foveal changes in 44 children with OCA aged 0 to 6years and provided evidence that photoreceptor layers con-tinue to elongate at a reduced rate in albinism [53], indicatingresidual plasticity in the developing retina of patients withOCA and suggesting that earlier-stage treatment might resultin a better outcome for these patients. This hypothesis couldbe tested in albino rhesus macaques. We have implementedan available breeding plan for these albino monkeys withthe aim of generating a stable cohort of OCA NHPs fortherapeutic development.

In the primate retina, melanin synthesis in the retinal pig-ment epithelium plays an important role in regulating theproliferation and differentiation of the neural retina [54].Normal development of the foveal pit requires the absenceof retinal vasculature inhabited by macula pigment [55]. InOCA patients, the higher the degree of foveal hypoplasia,the poorer the vision tends to be [56, 57]. In a recent study,Adams et al. reported that the number of letters read by fiveadult OCA1B patients showed a mild improvement after oralnitisinone treatment for 1 year [58]. It was hypothesized thatif the physiological levels of melanin in the posterior segmentof the eye could be maintained at early onset, foveal pit for-mation and visual acuity could be rescued in early-stagepatients. To test this hypothesis, a preclinical trial in albinorhesus macaques will be required in the future [59–62]. Theacceptable capacity of the cDNA lengths of the TYR andOCA2 genes makes it feasible to conduct AAV-mediatedgene therapy [63] and promote macular pigment formationin early-stage albinotic subjects. Another possibility is thatthe mutations could be precisely corrected in vivo throughbase-editing technology [45, 64]. For the cell transplantationstrategy, RPE cells or RPE scaffolds with polarity are used asthe cell source for replacing damaged RPE cells [63, 65–67].These potential treatments could be tested preclinically inour NHP models with OCA.

In conclusion, we successfully identified novel rhesusmacaque models of spontaneous oculocutaneous albinismwith specific genetic mutations leading to defective melaninsynthesis. This is the first well-established nonhuman pri-mate model of oculocutaneous albinism, offering newopportunities for studies regarding disease mechanisms andtherapeutic development.

4. Methods

4.1. Rhesus Macaques with Albinism. Rhesus macaques weremaintained at the Institute of Medical Biology of the ChineseAcademy of Sciences. This study was reviewed and approvedby the institutional animal ethics committee. In total, weidentified six rhesus monkeys with albinism, and clinicalophthalmic examinations were performed to evaluate theirocular phenotypes.

4.2. General Ophthalmic Examinations. Nystagmus is a com-mon manifestation of OCA in human patients. To identifywhether nystagmus existed in these albino rhesus macaques,we examined eye movement in the natural state. The anteriorsegment of the eyes was evaluated via slit lamp examination.

Color fundus photography was performed using a CF-1 reti-nal camera (Canon, Japan). The NHP subjects were anesthe-tized with ketamine (10mg/kg) and sodium pentobarbital(5mg/kg). Their pupils were dilated with 0.5% tropicamideand 0.5% phenylephrine hydrochloride for 5 minutes. Eyedrops consisting of artificial tears were applied to the cornealsurface to avoid overdrying.

4.3. Spectral Domain Optical Coherence Tomography(SD-OCT). High-resolution SD-OCT (Heidelberg Spectralis,Germany) was used to scan the retinal longitudinal sectionnoninvasively. A horizontal b-scan across the fovea was alsocaptured. For each b-scan, 25 scans were performed. Retinalthickness in the central or perimacular region was comparedbetween albinotic subjects and healthy individuals.

4.4. Whole-Genome Sequencing and Genetic Analysis. Periph-eral blood samples were obtained, and genomic DNA wasextracted for the whole-genome sequencing (WGS) of thesix albino NHPs and control NHPs. Briefly, 1μg of genomicDNA was sheared using ultrasound and then purified withAMPure XP beads. The shortened fragments underwentend repair and A-tailing, followed by the addition of indexadaptors. After purification, the products were subjected topreamplification. Then, a library was constructed for high-throughput sequencing (HiSeq2500, Illumina). The sequenc-ing results were aligned to the reference genome (rhesusmacaque Mmul_8.0.1) by using the BWA program. The call-ing of single-nucleotide variants (SNVs) and indels was per-formed using ANNOVAR. Genetic variants were validatedby Sanger sequencing (primers in Supplementary Table S1).

4.5. Computational Assessment of Mutation Pathogenicity.To predict the pathogenicity of the identified mutations, aseries of computational analyses were performed. First, mul-tiple species alignments were performed using ESPript3.0.The three-dimensional homology modeling of the candidateproteins was analyzed by using SwissProt and visualizedwith the PyMOL algorithm. Then, the pathogenicity of theidentified causative mutations was predicted using multiplebioinformatics programs, including MutationTaster, Muta-tionAssessor, and SIFT, as described previously [68, 69].

4.6. Melanin Formation Assay In Vitro. We then askedwhether the identified mutations impact melanin formationin human cells. Total RNAwas extracted from the retinal pig-ment epithelium/choroid tissue using an RNeasy Mini Kit(Qiagen, 74204). Two micrograms of RNA was reverse tran-scribed into cDNA with M-MLV reverse transcriptase andrandom primers. The coding region of the TYR gene wasamplified (primer sequences are provided in SupplementaryTable S1) and then cloned into the pLVX-IRES-ZsGreen1vector. The coding sequence of OCA2 was directlysynthesized and then cloned into the pcDNA3.1 vector. Site-directed mutagenesis was performed by overlapping PCR(primer information in Supplementary Table S1).

The HEK293T human kidney epithelial cell line was cul-tured in DMEM supplemented with 10% fetal bovine serum(Gibco), 100U/ml penicillin, and 100μg/ml streptomycinat 37°C in an incubator with 5% CO2. The cells were

8 Research

seeded into 6-well plates and transfected using Lipofecta-mine 2000 according to the manufacturer’s instructions.The pLVX-TYRwt-IRES-ZsGreen1 and pLVX-TYRmut-IRES-ZsGreen1 plasmids were transiently transfected intoHEK293T cells. Human OCA2-targeted shRNAs (GCACTGTTGGGATGTGTTATCTTCAAGAGAGATAACACATCCCAACAGTGCTTTTTT) were cloned into pLent-U6-GFP-puro followed by transfection into 293T cells (Lipofectamine2000). OCA2-arrested HEK293T cells were selected usingpuromycin (500 ng/ml). Transfected HEK293T cells weretested for melanin formation after 3 days of incubation aspreviously described [16, 17]. In brief, transfected cells werewashed twice with phosphate-buffered saline (PBS, pH 7.4)and subsequently harvested using 0.05% trypsin and 0.02EDTA. Thereafter, the cell pellets were lysed with 1ml of1N NaOH containing 10% DMSO for 1 h at 80°C. After cool-ing, the lysates were centrifuged at 3000 rpm for 10min, andthe absorbance of the solutions at 405 nm was measured. Themelanin content was quantified on the basis of a standardcurve generated with synthetic melanin (Sigma).

4.7. Tyrosinase Activity Assay. The oxidation of L-DOPA todopachrome was used to measure tyrosinase activity as previ-ously described [16, 70]. In brief, cells were washed twicewith PBS and then lysed with 50mM PBS (pH 7.5) contain-ing 1% Triton X-100 and 0.1mM phenylmethylsulfonyl fluo-ride (PMSF). The reaction mixture containing 100μl of L-DOPA solution (5.0mM in 50mM PBS) and 100μl of cellextract was incubated at 37°C. The absorbance at 490nmwas measured using a microplate reader after incubationfor 5 minutes, and tyrosinase activity was calculated fromthe obtained OD values.

4.8. Statistical Analysis. All results are presented as themean ± SEM, and the statistical analysis was performed usingStudent’s t-test and two-way ANOVA. A p value of less than0.05 was deemed significant.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

Authors’ Contributions

Z.-B. Jin, K.-C. Wu, and Z.-L. He designed the study. K.-C.Wu, J.-N. Lv, H. Yang, F.-M. Yang, and W.-H. Duan exam-ined the ocular characteristics of albino monkeys. R. Lin, Q.Lin, and M. Hu assisted in the collection of retinal OCTimages. K.-C. Wu, H. Yang, F.-M. Yang, Q. Lin, and R.-J.Shen performed mutational screening. K.-C. Wu, J.-N. Lv,J.-B. Wang, and J. Zhang evaluated melanin biosynthesis.K.-C.Wu, J.-N. Lv, Z.-L. He, and Z.-B. Jin performed the dataanalysis. Z.-B. Jin, K.-C. Wu, and Z.-L. He wrote the manu-script. Ji-Neng Lv, Hui Yang, and Feng-Mei Yang contrib-uted equally to this work.

Acknowledgments

We thank Drs. Xiao-Long Fang, Guang-Hui Jin, Chang-JunZhang, and Fei-Fei Cheng for the technical assistance. This

study was supported by the Natural Science Foundation ofChina (81522014, 81970838), the National Key Researchand Development Program of China (2017YFA0105300),the Zhejiang Provincial Natural Science Foundation of China(LQ17H120005), China Postdoctoral Science Foundation(2017M620235), the CAMS Innovation Fund for MedicalSciences (CIFMS, 2016-I2M-2-001), and the Chinese Insti-tute for Brain Research, Beijing (CIBR, Z18110000151800).

Supplementary Materials

Supplementary 1. Supplementary Video 1: nystagmus of theNHP model with oculocutaneous albinism.

Supplementary 2. Supplementary Video 2: nystagmus ofanother NHP model.

Supplementary 3. Supplementary Table 1: primers foridentification of candidate mutations and overlay PCR.Supplementary Table 2: computational assessment of themissense mutations. The scoring results were based on eachcomputational algorithm.

References

[1] H. Wassle and B. B. Boycott, “Functional architecture of themammalian retina,” Physiological Reviews, vol. 71, no. 2,pp. 447–480, 1991.

[2] A. Hendrickson, D. Possin, L. Vajzovic, and C. A. Toth, “His-tologic development of the human fovea from midgestation tomaturity,” American Journal of Ophthalmology, vol. 154, no. 5,pp. 767–778.e2, 2012.

[3] A. M. Dubis, B. R. Hansen, R. F. Cooper, J. Beringer, A. Dubra,and J. Carroll, “Relationship between the foveal avascular zoneand foveal pit morphology,” Investigative Opthalmology &Visual Science, vol. 53, no. 3, pp. 1628–1636, 2012.

[4] C. A. Curcio and K. A. Allen, “Topography of ganglion cells inhuman retina,” The Journal of Comparative Neurology,vol. 300, no. 1, pp. 5–25, 1990.

[5] J. M. Provis, A. M. Dubis, T. Maddess, and J. Carroll, “Adapta-tion of the central retina for high acuity vision: cones, the foveaand the avascular zone,” Progress in Retinal and Eye Research,vol. 35, pp. 63–81, 2013.

[6] K. Grønskov, J. Ek, and K. Brondum-Nielsen, “Oculocuta-neous albinism,” Orphanet Journal of Rare Diseases, vol. 2,no. 1, p. 43, 2007.

[7] S. M. Hutton and R. A. Spritz, “A comprehensive genetic studyof autosomal recessive ocular albinism in Caucasian patients,”Investigative Opthalmology & Visual Science, vol. 49, no. 3,pp. 868–872, 2008.

[8] C. Rooryck, F. Morice-Picard, N. H. Elçioglu, D. Lacombe,A. Taieb, and B. Arveiler, “Molecular diagnosis of oculocuta-neous albinism: newmutations in the OCA1-4 genes and prac-tical aspects,” Pigment Cell & Melanoma Research, vol. 21,no. 5, pp. 583–587, 2008.

[9] Z. Zhong, L. Gu, X. Zheng et al., “Comprehensive analysis ofspectral distribution of a large cohort of Chinese patients withnon-syndromic oculocutaneous albinism facilitates geneticdiagnosis,” Pigment Cell & Melanoma Research, vol. 32,no. 5, pp. 672–686, 2019.

[10] F. Hermansky and P. Pudlak, “Hermansky F, Pudlak P.Albinism associated with hemorrhagic diathesis and unusual

9Research

pigmented reticular cells in the bone marrow: report of twocases with histochemical studies. Blood. 1959;14(2):162-169,” Blood, vol. 127, no. 14, p. 1731, 2016.

[11] S. Ammann, A. Schulz, I. Krägeloh-Mann et al., “Mutations inAP3D1 associated with immunodeficiency and seizures definea new type of Hermansky-Pudlak syndrome,” Blood, vol. 127,no. 8, pp. 997–1006, 2016.

[12] H. Antunes, A. Pereira, and I. Cunha, “Chediak-Higashi syn-drome: pathognomonic feature,” The Lancet, vol. 382,no. 9903, p. 1514, 2013.

[13] M. D. F. S. Barbosa, Q. A. Nguyen, V. T. Tchernev et al., “Iden-tification of the homologous beige and Chediak-Higashi syn-drome genes,” Nature, vol. 382, no. 6588, pp. 262–265, 1996.

[14] K. Ray, M. Chaki, and M. Sengupta, “Tyrosinase and oculardiseases: some novel thoughts on the molecular basis of oculo-cutaneous albinism type 1,” Progress in Retinal and EyeResearch, vol. 26, no. 4, pp. 323–358, 2007.

[15] E. M. Rinchik, S. J. Bultman, B. Horsthemke et al., “A gene forthe mouse pink-eyed dilution locus and for human type II ocu-locutaneous albinism,” Nature, vol. 361, no. 6407, pp. 72–76,1993.

[16] X. Lai, H. J. Wichers, M. Soler-Lopez, and B. W. Dijkstra,“Structure of human tyrosinase related protein 1 reveals abinuclear zinc active site important for melanogenesis,” Ange-wandte Chemie, vol. 56, no. 33, pp. 9812–9815, 2017.

[17] J. M. Newton, O. Cohen-Barak, N. Hagiwara et al., “Mutationsin the HumanOrthologue of theMouse underwhiteGene (uw)Underlie a New Form of Oculocutaneous Albinism, OCA4,”American Journal of Human Genetics, vol. 69, no. 5,pp. 981–988, 2001.

[18] A. H. Wei, D. J. Zang, Z. Zhang et al., “Exome sequencingidentifies SLC24A5 as a candidate gene for nonsyndromic ocu-locutaneous albinism,” The Journal of Investigative Dermatol-ogy, vol. 133, no. 7, pp. 1834–1840, 2013.

[19] M. T. Bassi, M. V. Schiaffino, A. Renieri et al., “Cloning of thegene for ocular albinism type 1 from the distal short arm of theX chromosome,” Nature Genetics, vol. 10, no. 1, pp. 13–19,1995.

[20] K. Grønskov, J. Ek, A. Sand et al., “Birth prevalence and muta-tion spectrum in Danish patients with autosomal recessivealbinism,” Investigative Opthalmology & Visual Science,vol. 50, no. 3, pp. 1058–1064, 2009.

[21] S. M. Hutton and R. A. Spritz, “Comprehensive analysis ofoculocutaneous albinism among non-Hispanic Caucasiansshows that OCA1 is the most prevalent OCA type,” The Jour-nal of Investigative Dermatology, vol. 128, no. 10, pp. 2442–2450, 2008.

[22] A. B. Lerner, T. Fitzpatrick, E. Calkins, and W. Summerson,“Mammalian tyrosinase: the relationship of copper to enzy-matic activity,” The Journal of Biological Chemistry, vol. 187,no. 2, pp. 793–802, 1950.

[23] S. Rosemblat, D. Durham-Pierre, J. M. Gardner, Y. Nakatsu,M. H. Brilliant, and S. J. Orlow, “Identification of a melanoso-mal membrane protein encoded by the pink-eyed dilution(type II oculocutaneous albinism) gene,” Proceedings of theNational Academy of Sciences, vol. 91, no. 25, pp. 12071–12075, 1994.

[24] Y. Wang, Z. Wang, M. Chen et al., “Mutational analysis of theTYR and OCA2 genes in four Chinese families with oculocuta-neous albinism,” PLoS One, vol. 10, no. 4, article e0125651,2015.

[25] C. J. Witkop, “Albinism: hematologic-storage disease, suscep-tibility to skin cancer, and optic neuronal defects shared inall types of oculocutaneous and ocular albinism,” The Ala-bama Journal of Medical Sciences, vol. 16, no. 4, pp. 327–330,1979.

[26] M. F. Abalem, P. K. Rao, and R. C. Rao, “Nystagmus and plat-inum hair,” JAMA, vol. 319, no. 4, pp. 399-400, 2018.

[27] K. Tripathy and Y. R. Sharma, “Poor vision in a patient withwhite hair and pale skin,” BMJ, vol. 352, p. i24, 2016.

[28] P. Manga, R. E. Boissy, S. Pifko-Hirst, B.-K. Zhou, and S. J.Orlow, “Mislocalization of melanosomal proteins in melano-cytes from mice with oculocutaneous albinism type 2,” Exper-imental Eye Research, vol. 72, no. 6, pp. 695–710, 2001.

[29] W. M. Blaszczyk, L. Arning, K. P. Hoffmann, and J. T. Epplen,“A tyrosinase missense mutation causes albinism in theWistarrat,” Pigment Cell Research, vol. 18, no. 2, pp. 144-145, 2005.

[30] M. Caduff, A. Bauer, V. Jagannathan, and T. Leeb, “OCA2splice site variant in German Spitz dogs with oculocutaneousalbinism,” PLoS One, vol. 12, no. 10, article e0185944, 2017.

[31] M. C. Damé, G. M. Xavier, J. P. Oliveira-Filho et al., “A non-sense mutation in the tyrosinase gene causes albinism in waterbuffalo,” BMC Genetics, vol. 13, no. 1, p. 62, 2012.

[32] Y. Ikeda, K. M. Nishiguchi, F. Miya et al., “Discovery of acynomolgus monkey family with retinitis pigmentosa,” Inves-tigative Opthalmology & Visual Science, vol. 59, no. 2,pp. 826–830, 2018.

[33] A. Bringmann, S. Syrbe, K. Görner et al., “The primate fovea:structure, function and development,” Progress in Retinaland Eye Research, vol. 66, pp. 49–84, 2018.

[34] B. B. Lee, L. C. L. Silveira, E. S. Yamada et al., “Visual responsesof ganglion cells of a New-World primate, the capuchin mon-key, Cebus apella,” The Journal of Physiology, vol. 528, no. 3,pp. 573–590, 2000.

[35] L. C. L. Silveira, C. A. Saito, B. B. Lee et al., “Morphology andphysiology of primate M- and P-cells,” Progress in BrainResearch, vol. 144, pp. 21–46, 2004.

[36] M. G. Thomas, A. Kumar, S. Mohammad et al., “StructuralGrading of Foveal Hypoplasia Using Spectral-Domain OpticalCoherence Tomography: A Predictor of Visual Acuity?,” Oph-thalmology, vol. 118, no. 8, pp. 1653–1660, 2011.

[37] G. T. Prusky, N. M. Alam, S. Beekman, and R. M. Douglas,“Rapid quantification of adult and developing mouse spatialvision using a virtual optomotor system,” Investigative Opthal-mology & Visual Science, vol. 45, no. 12, pp. 4611–4616, 2004.

[38] A. Moshiri, R. Chen, S. Kim et al., “A nonhuman primatemodel of inherited retinal disease,” The Journal of ClinicalInvestigation, vol. 129, no. 2, pp. 863–874, 2019.

[39] H. Zhou, L. Niu, L. Meng et al., “Noninvasive ultrasound deepbrain stimulation for the treatment of Parkinson’s diseasemodel mouse,” Research, vol. 2019, article 1748489, 13 pages,2019.

[40] D. J. Marciani, “Promising results from Alzheimer’s diseasepassive immunotherapy support the development of a preven-tive vaccine,” Research, vol. 2019, article 5341375, 14 pages,2019.

[41] D. R. Simeonov, X. Wang, C. Wang et al., “DNA variations inoculocutaneous albinism: an updated mutation list and cur-rent outstanding issues in molecular diagnostics,” HumanMutation, vol. 34, no. 6, pp. 827–835, 2013.

[42] M. N. Preising, H. Forster, M. Gonser, and B. Lorenz,“Screening of TYR, OCA2, GPR143, and MC1R in patients

10 Research

with congenital nystagmus, macular hypoplasia, and fundushypopigmentation indicating albinism,” Molecular Vision,vol. 17, pp. 939–948, 2011.

[43] B. Ding, O. A. Ryder, X. Wang, S. C. Bai, S. Q. Zhou, andY. Zhang, “Molecular basis of albinism in the rhesus monkey,”Mutation Research/Fundamental and Molecular Mechanismsof Mutagenesis, vol. 449, no. 1-2, pp. 1–6, 2000.

[44] J. Prado-Martinez, I. Hernando-Herraez, B. Lorente-Galdoset al., “The genome sequencing of an albino Western lowlandgorilla reveals inbreeding in the wild,” BMC Genomics,vol. 14, no. 1, p. 363, 2013.

[45] K. Chen, P. Manga, and S. J. Orlow, “Pink-eyed dilution pro-tein controls the processing of tyrosinase,” Molecular Biologyof the Cell, vol. 13, no. 6, pp. 1953–1964, 2002.

[46] G.-E. Costin, J. C. Valencia, W. D. Vieira, M. L. Lamoreux, andV. J. Hearing, “Tyrosinase processing and intracellular traffick-ing is disrupted in mouse primary melanocytes carrying theunderwhite (uw) mutation. A model for oculocutaneous albi-nism (OCA) type 4,” Journal of Cell Science, vol. 116, no. 15,pp. 3203–3212, 2003.

[47] Y. Song, Y. Zhang, M. Chen et al., “Functional validation of thealbinism-associated tyrosinase T373K SNP by CRISPR/Cas9-mediated homology-directed repair (HDR) in rabbits,” eBio-Medicine, vol. 36, pp. 517–525, 2018.

[48] T. Peters, S. W. Kim, V. Castro et al., “Evaluation of polyester-amide (PEA) and polyester (PLGA) microspheres as intravit-real drug delivery systems in albino rats,” Biomaterials,vol. 124, pp. 157–168, 2017.

[49] I. F. Onojafe, L. H. Megan, M. G. Melch et al., “Minimal effi-cacy of nitisinone treatment in a novel mouse model of oculo-cutaneous albinism, type 3,” Investigative Opthalmology &Visual Science, vol. 59, no. 12, pp. 4945–4952, 2018.

[50] E. A. Lock, P. Gaskin, M. K. Ellis, W. McLean Provan,M. Robinson, and L. L. Smith, “Tissue distribution of 2-(2-nitro-4-trifluoromethylbenzoyl)-cyclohexane-1,3-dione (NTBC)and its effect on enzymes involved in tyrosine catabolismin the mouse,” Toxicology, vol. 144, no. 1-3, pp. 179–187,2000.

[51] E. A. Lock, P. Gaskin, M. Ellis, W. M. Provan, and L. L. Smith,“Tyrosinemia produced by 2-(2-nitro-4-trifluoromethylben-zoyl)-cyclohexane-1,3-dione (NTBC) in experimental animalsand its relationship to corneal injury,” Toxicology and AppliedPharmacology, vol. 215, no. 1, pp. 9–16, 2006.

[52] I. F. Onojafe, D. R. Adams, D. R. Simeonov et al., “Nitisinoneimproves eye and skin pigmentation defects in a mouse modelof oculocutaneous albinism,” The Journal of Clinical Investiga-tion, vol. 121, no. 10, pp. 3914–3923, 2011.

[53] H. Lee, R. Purohit, V. Sheth et al., “Retinal development inalbinism: a prospective study using optical coherence tomog-raphy in infants and young children,” The Lancet, vol. 385,p. S14, 2015.

[54] R. A. Rachel, C. A. Mason, and F. Beermann, “Influence oftyrosinase levels on pigment accumulation in the retinalpigment epithelium and on the uncrossed retinal projection,”Pigment Cell Research, vol. 15, no. 4, pp. 273–281, 2002.

[55] R. F. Gariano, “Special features of human retinal angiogene-sis,” Eye, vol. 24, no. 3, pp. 401–407, 2010.

[56] C. G. Summers, “Vision in albinism,”Transactions of the Amer-ican Ophthalmological Society, vol. 94, pp. 1095–1155, 1996.

[57] K. Pakzad-Vaezi, P. A. Keane, J. N. Cardoso, C. Egan, andA. Tufail, “Optical coherence tomography angiography of

foveal hypoplasia,” British Journal of Ophthalmology,vol. 101, no. 7, pp. 985–988, 2017.

[58] D. R. Adams, S. Menezes, R. Jauregui et al., “One-year pilotstudy on the effects of nitisinone on melanin in patients withOCA-1B,” JCI Insight, vol. 4, no. 2, article e124387, 2019.

[59] J. W. B. Bainbridge, M. S. Mehat, V. Sundaram et al., “Long-term effect of gene therapy on Leber’s congenital amaurosis,”The New England Journal of Medicine, vol. 372, no. 20,pp. 1887–1897, 2015.

[60] I. Trapani and A. Auricchio, “Seeing the light after 25 years ofretinal gene therapy,” Trends in Molecular Medicine, vol. 24,no. 8, pp. 669–681, 2018.

[61] L. da Cruz, K. Fynes, O. Georgiadis et al., “Phase 1 clinicalstudy of an embryonic stem cell-derived retinal pigment epi-thelium patch in age-related macular degeneration,” NatureBiotechnology, vol. 36, no. 4, pp. 328–337, 2018.

[62] M. Mandai, A. Watanabe, Y. Kurimoto et al., “Autologousinduced stem-cell–derived retinal cells for macular degenera-tion,” New England Journal of Medicine, vol. 376, no. 11,pp. 1038–1046, 2017.

[63] J. Jüttner, A. Szabo, B. Gross-Scherf et al., “Targeting neuronaland glial cell types with synthetic promoter AAVs in mice,non-human primates and humans,” Nature Neuroscience,vol. 22, no. 8, pp. 1345–1356, 2019.

[64] C. Long, H. Li, M. Tiburcy et al., “Correction of diverse muscu-lar dystrophy mutations in human engineered heart muscle bysingle-site genome editing,” Science Advances, vol. 4, no. 1,article eaap9004, 2018.

[65] W. L. Deng, M. L. Gao, X. L. Lei et al., “Gene correctionreverses ciliopathy and photoreceptor loss in iPSC-derived ret-inal organoids from retinitis pigmentosa patients,” Stem CellReports, vol. 10, no. 4, pp. 1267–1281, 2018.

[66] P. Xiang, K. C. Wu, Y. Zhu et al., “A novel Bruch’s membrane-mimetic electrospun substrate scaffold for human retinal pig-ment epithelium cells,” Biomaterials, vol. 35, no. 37,pp. 9777–9788, 2014.

[67] R. Sharma, V. Khristov, A. Rising et al., “Clinical-grade stemcell–derived retinal pigment epithelium patch rescues retinaldegeneration in rodents and pigs,” Science Translational Med-icine, vol. 11, no. 475, article eaat5580, 2019.

[68] Z. B. Jin, Z. Li, Z. Liu, Y. Jiang, X. B. Cai, and J. Wu, “Identifi-cation of de novo germline mutations and causal genes forsporadic diseases using trio-based whole-exome/genomesequencing,” Biological Reviews of the Cambridge PhilosophicalSociety, vol. 93, no. 2, pp. 1014–1031, 2018.

[69] X. B. Cai, Y. H. Zheng, D. F. Chen et al., “Expanding the phe-notypic and genotypic landscape of nonsyndromic high myo-pia: a cross-sectional study in 731 Chinese patients,”Investigative Ophthalmology & Visual Science, vol. 60, no. 12,pp. 4052–4062, 2019.

[70] J.-y. Yang, J.-h. Koo, Y.-g. Song et al., “Stimulation of melano-genesis by scoparone in B16 melanoma cells,” Acta Pharmaco-logica Sinica, vol. 27, no. 11, pp. 1467–1473, 2006.

11Research