Letter to the Editor

Novel Mutation of the Myelin Po Gene in aPedigree With Charcot-Marie-Tooth DiseaseType 1B

To the Editor:

Charcot-Marie-Tooth disease type 1B (CMT1B) is anautosomal dominant peripheral neuropathy associatedwith mutations of the major peripheral myelin protein(Po) gene [Hayasaka et al., 1993b,c; Kulkens et al.,1993]. Po is a small integral membrane glycoprotein ofthe immunoglobulin superfamily and is a homophilicadhesion molecule with a single variable-like immuno-globulin (Ig) domain [Lemke et al., 1988]. Alterationsin the structure or expression of Po disturb the forma-tion and/or maintenance of compact myelin, as shownin experiments with knock-out mice and in patientswith Po mutations [Giese et al., 1992; Hayasaka et al.,1993b,c; Kulkens et al., 1993; Martini et al., 1995]. Todate, at least 28 different Po mutations including pointmutations, deletions, and insertions have been re-ported [Hayasaka et al., 1993b,c,d; Kulkens et al.,1993; Rautenstrauß et al., 1994; Ikegami et al., 1996].Some patients present severe clinical manifestationsand severe cases with de novo mutations have beendiagnosed as Dejerine-Sottas disease [Hayasaka et al.,1993d; Ikegami et al., 1996]. It is important to identifythe primary defect and type of mutation for the classi-fication of peripheral neuropathies based on their eti-ologies and for the study of the relationship betweenthe genotype and clinical phenotype. Here we report afamily with CMT1B associated with a novel Popointmutation, glutamate substitution for glycine 93 inexon 3.

The proposita of the family first walked at 18 months(Fig. 1A). She was referred at age 7 because of an un-usual gait with atrophy of the lower legs and foot drop.On examination, muscular weakness and atrophy ofthe distal lower limbs and absence of all tendon re-flexes were noted. She showed swaying and steppagegait. Right and left median motor nerve conduction ve-

locities were 6.1 and 4.8 m/sec, respectively. No nerveaction potentials were elicited from stimulation of theright or left sural nerves. There were no abnormalitiesin the cranial nerves, auditory brainstem responses, orrenal function. As shown in Figure 1a, there were sev-eral relatives complaining of gait disturbance and dis-tal atrophy of the leg muscles, indicating an autosomaldominant trait. Her grandfather had proteinuria andauditory disturbance due to unknown causes.

All coding regions of the Po gene in the propositawere screened for mutations with single strand confor-mational polymorphism(SSCP) analysis. An additionalfragment was observed in exon 3 as shown in Figure1B. This fragment was also detected in her affectedfather, but not in healthy control individuals. The di-rect sequencing of exon 3 in the proband demonstratedthe presence of a mutant allele, a guanine to adeninesubstitution at nt 275, leading to a glutamate substi-tution for glycine at amino acid position 93 of exon 3(Fig. 1C). The proposita was heterozygous for the mu-tated allele and the normal allele. This mutation wasnot detected in 100 healthy control individuals.

CMT1 is a heterogenous peripheral neuropathy andits loci map to 17p11.2-p12 (CMT1A) [Vance et al.,1989], 1q21.3-q23 (CMT1B) [Bird et al., 1982], andother unknown autosome (CMT1C) [Chance et al.,1990]. Most CMT1A patients have a large DNA dupli-cation in 17p11.2-p12 [Lupski et al., 1991; Raeymaek-ers et al., 1991]. Several point mutations of the PMP-22gene have been identified in non-duplicated CMT1Afamilies [Valentijn et al., 1992]. CMT1B is related tomutations in the Po gene [Hayasaka et al., 1993b,c;Kulkens et al., 1993]. Despite progress in geneticanalysis, we do not yet understand the relationshipbetween the clinical manifestation and genotype. Ion-asescu et al. [1996] reported the relationship betweenthe genotype and clinical phenotype in 27 families withCMT linked to chromosome Xq13.1 (CMTX). To date, atleast 28 different Po mutations have been reported. Allbut two cases of homozygous mutation [Ikegami et al.,1996] were heterozygous for the mutation and mostmutations were located in the functional extracellulardomain of Po, which consists of exons 2 and 3. In thisreport, we studied a patient with moderate symptomsand found a novel point mutation, glutamate substitu-tion for glycine at amino acid position 93 in exon 3 of

Contract grant sponsor: The Mother and Child Health Foun-dation; Contract grant sponsor: Japan Brain Foundation; Con-tract grant sponsor: Ministry of Education, Science and Culture.

*Correspondence to: Dr. Kiyoshi Hayasaka, Department of Pe-diatrics, Yamagata University School of Medicine, Iidanishi 2-2-2, Yamagata 990-23, Japan.

Received 19 September 1996; Accepted 5 January 1997

American Journal of Medical Genetics 71:246–248 (1997)

© 1997 Wiley-Liss, Inc.

Fig. 1. A: Pedigree of a family with CMT1B (A). B: SSCP analysis of part of exon 3 of the Po gene. Part of exon 3 was amplified using a set of primers(58–38): a, TCATTAGGGTCCTCTCACATGC; b, TTCCCATACCCTTGTCC, which were designed on the genome information [Hayasaka et al., 1993a]. PCRproducts were separated on a polyacrylamide gel in the presence of glycerol and detected by standard silver staining method. Lane 1, proband. Lane 2,the father. Lanes 3 and 4, healthy controls. C: Identification of the G275 to A mutation in the Po gene. Genomic DNA from the proband and a healthycontrol was amplified and sequenced. The sequence shown was obtained with primer PO3RH [Hayasaka et al., 1993c]. Nucleotide numbering of the PocDNA starts at the initiation site of the translation.

Letter to the Editor 247

the Po gene. This substitution causes a difference incharge. In addition, Glycine 93 is conserved amongmany other species including bovine, rat, chicken, andshark, suggesting that it is important in the formationof an extracellular Ig domain [Uyemura et al., 1992].The proposita and her father (data not shown) showedextremely low nerve conduction velocities (<10 m/sec);however, their clinical symptoms were not as severe asin Dejerine-Sottas disease. Thus, this mutation relatesto moderate CMT1B. Accumulation of additional ge-netic data on peripheral neuropathies is important todetermine the relationship between clinical pheno-types and genotypes.

REFERENCESBird TD, Ott J, Giblett ER (1982): Evidence for linkage of Charcot-Marie-

Tooth neuropathy to the Duffy locus on chromosome 1. Am J HumGenet 34:388–394.

Chance PF, Bird TD, O’Connell P, Lipe H, Lalouel JM, Leppert M (1990):Linkage and heterogeneity in type 1 Charcot-Marie-Tooth disease (he-reditary motor and sensory neuropathy 1). Am J Hum Genet 47:915–925.

Giese KP, Martini R, Lemke G, Soriano P, Schachner M (1992): Mouse Pogene disruption leads to hypomyelination, abnormal expression of rec-ognition molecules, and degeneration of myelin and axons. Cell 71:565–576.

Hayasaka K, Himoro M, Wang Y, Takata M, Minoshima S, Shimizu N,Miura M, Uyemura K, Takada G (1993a): Structure and chromosomallocalization of the gene encoding the human myelin protein zero (MPZ).Genomics 17:755–758.

Hayasaka K, Himoro M, Sato W, Takada G, Uyemura K, Shimizu N, BirdTD, Conneally PM, Chance PF (1993b): Charcot-Marie-Tooth neurop-athy type 1B is associated with mutations of the myelin Po gene. NatGenet 5:31–34.

Hayasaka K, Takada G, Ionasescu VV (1993c): Mutation of the myelin Pogene in Charcot-Marie-Tooth neuropathy type 1B. Hum Molec Genet2:1369–1372.

Hayasaka K, Himoro M, Sawaishi Y, Nanao K, Takahashi T, Takada G,Nicholson GA, Ouvrier RA, Tachi N (1993d): De novo mutation of themyelin Po gene in Dejerine-Sottas disease (hereditary motor and sen-sory neuropathy type III). Nat Genet 5:266– 268.

Ikegami T, Nicholson G, Ikeda H, Ishida A, Johnston H, Wise G, OuvrierR, Hayasaka K (1996): A novel homozygous mutation of the myelin Pogene producing Dejerine-Sottas disease (hereditary motor and sensoryneuropathy type III). Biochem Biophys Res Commun 222:107–110.

Ionasescu V, Ionasescu R, Searby C (1996): Correlation between connexin32 gene mutations and clinical phenotype in X-linked dominant Char-cot-Marie-Tooth neuropathy. Am J Med Genet 63:486–491.

Kulkens T, Bolhuis PA, Wolterman RA, Kemp S, te Nijenhuis S, ValentijnLJ, Hensels GW, Jennekens FGI, de Visser M, Hoogendijk JE, Baas F(1993): Deletion of the serine 34 codon from the major peripheral my-elin protein Po gene in Charcot-Marie-Tooth disease type 1B. NatGenet 5:35–39.

Lemke G, Lamar E, Patterson J (1988): Isolation and analysis of the geneencoding peripheral myelin protein zero. Neuron 1:73–83.

Lupski JR, de Oca-Luna RM, Slaugenhaupt S, Pentao L, Guzzetta V, TraskBJ, Saucedo- Cardenas O, Barker DF, Killian JM, Garcia CA, Chakrav-arti A, Patel PI (1991): DNA duplication associated with Charcot-Marie-Tooth disease type 1A. Cell 66:219–232.

Martini R, Zielasek J, Toyka KV, Giesel KP, Schachner M (1995): Proteinzero (PO)-deficient mice show myelin degeneration in peripheralnerves characteristic of inherited human neuropathies. Nat Genet 11:281–286.

Raeymaekers P, Timmerman V, Nelis E, De Jonghe P, Hoogendijk JE,Baas F, Barker DF, Martin JJ, De Visser M, Bolhuis PA, Van Broeck-hoven C, HMSN Collaborative Research Group (1991): Charcot-Marie-Tooth neuropathy type 1a (CMT1a) is most likely caused by a duplica-tion in chromosome 17p11.2. Neuromuscl Disord 1:93–97.

Rautenstrauß B, Nelis E, Grehl H, Pfeiffer RA, Van Broeckhoven C (1994):Identification of a de novo insertional mutation in Po in a patient witha Dejerine-Sottas syndrome (DSS) phenotype. Hum Molec Genet 3:1701–1702.

Uyemura K, Kitamura K, Miura M (1992): Structure and molecular biologyof Po protein. In Martenson R (ed): ‘‘Myelin: Biology and Chemistry.’’Boca Raton: CRC Press, pp 481–507.

Valentijn LJ, Baas F, Wolterman RA, Hoogendijk JE, van den Bosch NH,Zorn I, Gabreels-Festen AW, de Visser M, Bolhuis PA (1992): Identicalpoint mutations of PMP22 in Trembler-J mouse and Charcot-Marie-Tooth disease type 1A. Nat Genet 2:288–291.

Vance JM, Nicholson GA, Yamaoka LH, Stajich J, Stewart CS, Speer MC,Hung WY, Roses AD, Barker D, Pericak-Vance MA (1989): Linkage ofCharcot-Marie-Tooth neuropathy type 1a to chromosome 17. Exp Neu-rol 104:186–189.

Tohru IkegamiHiroyuki IkedaTetsuo MitsuiKiyoshi Hayasaka*Department of PediatricsYamagata University School of MedicineYamagata, Japan

Shougo IshiiDivision of PediatricsEastern Shimane Rehabilitation CenterMatsue, Japan

248 Ikegami et al.