Eur. J. Biochem. 173,459-463 (1988) (<I FEBS 1988

Nucleotide sequence of cDNA and predicted amino acid sequence of rat liver uricase Masaki ITO', Masami SUZUKI' and Yasuyuki TAKAGI' ' Division of Molecular Genetics and

Division of Biomedical Polymer Science, Institute for Comprehensive Medical Science, Fujita-Gakuen Health University, Toyoake, Aichi

(Received December I4,1987/January 26, 1988) - EJB 87 1401

A cDNA clone for rat liver uricase (EC 1.7.3.3), which is localized in the core of peroxisomes, was isolated from a rat liver cDNA library in lg t l l . The clone, referred to as ArURC-1, induced formation of a fusion protein (molecular mass 140 kDa) in the presence of isopropyl b-D-thiogalactoside. Immunoglobulin G reactive with the fusion protein recognized only a protein with molecular mass of 33 kDa, corresponding to the molecular mass of uricase. The nucleotide sequence of the isolated cDNA was determined and the amino acid sequence was predicted. An open reading frame was identified and found to encode a polypeptide of 280 amino acids with a molecular mass of 32226 Da. The cDNA contained 14 base pairs of 5'-untranslated sequence and 192 base pairs of 3'-untranslated sequence. The sequences of four internal peptide fragments, determined by Edman degradation, were identical to parts of the sequence predicted from the cDNA. The complete amino acid sequence predicted for rat liver uricase was compared with that of soybean nodulin uricase and nine highly homologous regions of the two enzymes were found.

The final product of purine metabolism varies from urate to ammonia, depending on the species. The final product is urate in man, other primates and birds because they do not possess a uricase catalyzing the reaction from urate to allantoin. In other mammals and some reptiles, the final prod- uct is allantoin. In amphibia and fishes, allantoin is degraded to urea. In some marine invertebrates, urea is hydrolyzed to ammonia and carbon dioxide. Thus, the enzymes responsible for the degradation of urate have been lost one by one during evolution [l , 21.

In rat liver, uricase is localized in the core of peroxisomes [3, 41 and its molecular mass has been estimated as 31- 33 kDa by sodium dodecyl sulfate/polyacrylamide gel electrophoresis [5, 61. This enzyme is synthesized on free polysomes and the in vitro translation product is transferred to peroxisomes without post-translational processing [5]. All rat liver peroxisomal enzymes except 3-oxoacyl-CoA thiolase [7 - 91 are transported to their final location without observ- able processing, and peroxisomal proteins have been proposed to be sorted by an internal sorting signal in these proteins [lo, 111. Moreover, firely luciferase, which was expressed in monkey kidney cells, was imported into the peroxisomes of the transfected mammalian cells [12]. This observation suggests that protein transport to peroxisomes might share a common process among various organisms. However, no common sequence in peroxisomal enzymes has yet been found on the transport process.

One approach to the problems of the evolution of the enzymes responsible for urate degradation and the signal re- sponsible for sorting peroxisomal proteins, is determination of the primary sequences of peroxisomal enzymes and their

Correspondence to M . Ito, Division of Molecular Genetics, Insti- tute for Comprehensive Medical Science, Fujita-Gakuen Health Uni- versity, Toyoake, Aichi, Japan 470-1 1

Enzyme. Uricase (EC 1.7.3.3).

comparison. For this purpose, we isolated a cDNA clone for rat liver uricase. This paper reports the nucleotide sequence of the cDNA and the complete amino acid sequence of uricase predicted from the nucleotide sequence. The predicted amino acid sequence of rat liver uricase was found to show 33% homology with that of soybean nodulin uricase deduced from its cDNA [13]. The possible functions of nine highly homolo- gous regions in the two enzymes are discussed.

MATERIALS AND METHODS

Materials

A rat liver cDNA library in Ig t l l was purchased from Clontech laboratories. Restriction endonucleases were obtained from Takara Shuzo Co. (Kyoto, Japan). '251-labeled protein A and ~-~'P-labeled dCTP were purchased from Amersham. Lysyl endopeptidase from Achromobacter lyticus M497-1 was provided by Dr K. Titani (Fujita-Gakuen Health University).

Purification of uricase and preparation of anti-uricase IgG

Rat liver uricase was purified as described by Watanabe et al. [14]. The purified preparation gave a single band (33 kDa) on SDS/polyacrylamide gel electrophoresis. Anti- body against rat liver uricase was raised by injecting the en- zyme into rabbits. The IgG fraction of the serum was precipi- tated with 20 - 33% saturated ammonium sulfate and purified on uricase-bound Sepharose 4B for use in screening of cDNA.

Western blotting

Proteins separated by electrophoresis were transferred to a nitrocellulose membrane (Schleicher & Schull, BA85) as described by Towbin et al. [15]. The membrane was incubated

460

with anti-uricase IgG and then with goat anti-rabbit-IgG - horseradish-peroxidase conjugate (Bio-Rad). Uricase on the membrane was detected by its activity in oxidizing 4-chloro- 1-naphthol in the presence of hydrogen peroxide.

Cloning of uricase cDNA

A rat liver cDNA library in Agtll was screened in Escherichia coli Y1090 (AlacU169 Alon araD139 strA supF [trpC22: :TnlO] pMC9) as described by Young and Davis [16] using antigen-purified anti-uricase IgG. To detect a fusion protein with P-galactosidase, Igtl 1 -cDNA recombinant was lysogenized in a high-frequency lysogeny mutant strain Y1089 (AlucU169 Alon araD139 strA hfrAl50 [chr: :TnlO] pMC9). The cDNA insert of a positive clone was excised with EcoRI, subcloned in a plasmic vector pUCll8 and analyzed by re- striction mapping.

Nucleotide sequence determination

cDNA for rat liver uricase was sequenced by the dideoxy- chain termination method of Sanger et al. [17] after subcloning of restriction fragments into M13mp phages [18]. Some re- gions of cDNA were sequenced by exonuclease III/mung bean nuclease-deletion method [ 19, 201 of PstIIBamHI-digested pUCl18-cDNA recombinant.

Amino acid sequence and amino acid composition

Purified rat liver uricase was digested with lysyl endo- peptidase from Achromobacter lyticus M497-1 at an enzyme/ substrate mass ratio of 1 : 10 for 2 h at 37°C in 50 mM Tris/ HC1 (pH 9.0) containing 1.5 M urea for determination of the amino acid sequences of internal peptide fragments. The peptides were separated in a reverse-phase Waters high-per- formance liquid chromatography (HPLC) system on a Synchropak RP-8 (C8) column (0.41 x 25 cm, Synchrom). The amino acid sequence of the purified oligopeptide was deter- mined by automated Edman degradation with a gas-phase sequencer 470A (Applied Biosystems). The resulting phenylthiohydantoin derivatives were analyzed with a 120 A analyzer (Applied Biosystems).

For determination of its amino acid composition, purified uricase was desalted by passage through a reverse-phase column of Synchropak RP-8 ( C Q and then hydrolyzed with 6 M HCl for 24 h, 48 h or 72 h. The hydrolyzate was then analyzed in an amino acid analyzer L-8500 (Hitachi).

RESULTS

Isolation of cDNA

A rat liver cDNA library constructed in the expression vector Agtll [16] was screened for rat liver uricase. In all lo6 clones were screened with anti-uricase IgG and ten possible clones were obtained. Clone IrURC-1, which gave the strongest signal, was examined to determine whether it carried cDNA for rat liver uricase. This clone was lysogenized in E. coZi Y1089 and a fusion protein (molecular mass 140 kDa) with P-galactosidase was induced in the presence of isopropyl

Fig. 1. Identification of IrURC-1 which contains a cDNA clone coding the antigenic determinant of rat liver uricase. (A) A log-phase culture of E. coli Y1089 lysogenized with IrURC-1 was shaken for 1 h at 37°C in the absence or presence of 1 mM isopropyl fi-D- thiogalactoside (IPTG). A rat liver homogenate (I), an extract of lysogenized cells without IPTG (2) and an extract of lysogenized cells induced with IPTG (3) were subjected to SDS/polyacrylamide gel electrophoresis. Proteins were transferred to a nitrocellulose mem- brane and protein that reacted with anti-uricase IgG was detected using goat anti-rabbit-IgG - horseradish-peroxidase conjugate. (B) The region of the nitrocellulose membrane corresponding to the fusion protein (140 kDa) was cut out and IgG reactive with the fusion protein was eluted with 0.2 M glycine/HCl buffer (pH 2.5) , and promptly neutralized by addition of Tris powder. The rat liver homogenate separated by electrophoresis was transferred to a nitro- cellulose membrane and incubated with anti-uricase IgG (1) or IgG that reacted with the fusion protein (2)

_____, 4

Fig. 2. Restriction map and sequence strategy of cDNA (prURC-I) for rat liver uricase. The sequence coding for protein is indicated by the thick line and untranslated sequences by thin continuous lines. Sequences of the vector pUCl18 are indicated by dotted lines. The horizontal arrows represent the directions and lengths of the se- quences determined

P-D-thiogalactoside (Fig. 1 A). IgG that reacted with the fusion protein was prepared by elution in acidic buffer and found to recognize only a protein (33 kDa) corresponding to uricase in a rat liver homogenate (Fig. 3 B). This result showed that IrURC-3 coded for at least the antigenic determinant of rat liver uricase.

Nucleotide sequence and predicted amino acid sequence

The cDNA carried by ArURC-1 was subcloned into the plasmid vector pUC118. Fig. 2 shows the restriction map of the cDNA insert and the strategy for sequence analysis. The nucleotide sequence is shown in Fig. 3. The translation ini- tiation site is assigned to the methionine codon ATG at

46 1

-14 CCGCTATGGAAAGA

1 * * * * * * * 90 ATGATGAAGTGGAGTTTGTCCGAACTGGCTATGGGAAGGACATGGTCAAAGCTTCTCCATATTCAGAGGGATGG~TACCACAGCATC MetMetLysTrpSerLeuSerGluLeuAlaMetClyArgThrTrpSerLysLeuLeuHisIleGlnArgAspGlyLysTyrHisSerIle

* * * * * * * * 180 A A A G A G G T G G C G A C T T C G G T G C A G T T G A C T C T G A G G T C C A A C A C C LysGluValAlaThrSerValGlnLeuThrLeuArgSerLysLyaLysAspTyrLeuH~aGlyAspAsnSerAspIleIleProThrAspThr

* * * * * * * * 270 ATCAAGAACACAGTGCATGTCCTGGCGAAGTTCAAAGGGATC~GCATCGAGACCTTCG~rATG~CAT~TGCCAGCACTTCCTCTCT IleLysAsnThrValHisValLeuAlaLysPheLyaGlyIleLyaSerIleGluThrPheAl~etAsnIleCysCluHisPheLeuSer

* * * 360 TCCTTTAGCCATGTCACCCGAGCCCATGTCTACGTGGAAGAGGTCCCCTGG~GCGTTTTG~GAATGGAGTC~CACGTCCATGCC SerPheSerHisValThrArgAlaHisValTyrValGluGluValProTrpLysArgPheGluLysAsnGlyValLysHisValHisAla

* * * * * * * 450 TTCATCCACACCCCGACGGAACTCACTTCTGTGACGTGGAGCAGGGTGAGGAACGGACCTCCCATCATTCACTCTGGAATCAAAGACCTC PhelleHisThrProThrG1uLeuThrSerValThrTrpSerArgValArgAsnGlyProProIleIleHlsSerGlyIleLyaAspLeu

* * * * * * * * 540 AAGGTCTTGAAAACAACCCAGTCTGGATTTG~GGATTCATC~CGACCAGTTCACTACTCTCCCCGAGGTGAAGGACCGATGCTTTGCC LysValLeuLysThrThrGlnSe~GlyPheGluGlyPheIleLysAspGlnPheThrThrLeuProGluValLysAspArgCysPheAla

* * * * * * * 630 ACTCAAGTGTACTGCAAGTGGCGCTACCAGAATCGCGACGTGGATTTCGAGGCTACCTGGGGACGCTGTCCGGACATTGTCCTGAAGAAA ThrGlnValTyrCysLysTrpArgTyrGlnAsnArgAspValAspPheGluAlaThrTrpGlyArgCysProAspIleValLeuL~sLys

* * * * * * * * 720 TTTGCTGGGCCCTATGACAGAGGTGAATACTCACCTTCCGTGCAGAAGACCCTCTATGACATACAAGTGC~GACCCTGAGCCAGCTTCCT PheAlaGlyPrcTyrAspArgGlyGluTyrSerProSerV~lGlnLysThrLeuTyrAsplleGlnValLeuThrLeuSerGlnLeuPKo

* * * * * * * 810 GAGATAGAAGACATGGAAATAGCCTTCCAAACATTCACTACTTTAACATCGACATGTCC~TCGGGCTCGATCAAC~GG~GAGtiT? GluIleGluAspMetGlulleAlaPheGlyThrPheThrThrLeuThrSerThrCysProLysTrpGl~SeKIleAsnLysGluGluVa~

9 00 TTGCTGCCTCTGGACAACCCTACGGCAAAATAACGGGACGGTAGCAGGAAGCTCGTCCAGGCTGTGACGTTATGCTCCAGCCAGTTGTGA LeuLeuProLeuAspAsnProThrAlaLys***

990 TGCTTGGGATAACTGTGTGCTCACCTGCAAAAATTTCAACTCAGCATACTGATTGCTCTGCTCTGTGTGAAGTAATTGCTCTTCCGTTTC

-

TAGTTTAGCAAGGGGCTTGCAGCTGTGGCCACGTGCGGAATT 1046

Fig. 3. Mucleotide sequence of cDNA for rat liver uricase und deduced amino acid sequence. Nucleotides are numbered in the 5' to 3' direction beginning with the first residue of the initiation methionine codon. The nucleotides upstream of residue 1 are indicated by negative numbers. The stop codon is represented by ***. The deduced amino acids are indicated below the nucleotide triplets starting at the initiation methionine codon. The four peptide sequences determined by Edman degradation are underlined

nucleotide positions 1 - 3. The possibility that the methionine codon ATG at nucleotide positions -9 to -7 was the trans- lation initiation site was excluded for the following three reasons. First, the nucleotide sequence from -6 to -1 (GAAAGA) is highly homologous to that (GAAAAG) before the translation initiation site of cDNA for soybean nodulin uricase [13]. Second, the nucleotide sequence (- 12 G C T A B A A A G A m 3) before nucleotides 1 - 3 (doubly underlined) agrees with the consensus initiation sequence be- cause adenosine (bold face) is found at position -3 [21], whereas the sequence before nucleotides -9 to -7 (under- lined) does not. Third, premature rat liver uricase was found by amino acid analysis to have five methionine residues, as described below.

The protein coded by the cDNA is predicted to have 280 amino acid residues and a molecular mass of 32226 Da. The latter values is consistent with that determined by electrophoresis of the enzyme [14]. The predicted number of charged amino acid residues (Arg + His + Lys = 48 versus Asp + Glu = 32) is consistent with the basic nature of the enzyme indicated by elution of the enzyme from the core of peroxisomes under alkaline conditions [14].

Amino acid composition and internal amino acid sequence

The amino acid composition of the purified rat liver uricase was consistent with that predicted from the nucleotide sequence (Table 1). The amino-terminal residue was found to

Table 1 . Amino acid composition of rat liver uricase Values determined with purified enzyme were calculated from the molecular mass of 32226 Da; they are average results after hydrolysis for 24 h, 48 h and 72 h. n.d. = not determined

Residue Number of residues

deduced from determined with cDNA purified enzyme

Ala Arg Asn ASP CYS Gln Glu GlY His Ile Leu LYS Met Phe Pro Ser Thr TrP TYr Val

11 12 8

15 5

10 17 1 3 1 1 18 22 25

5 14 13 20 26

7 8

20

9.7 11.6 23.5

n. d. 27.6

16.2 13.5 17.1 19.5 24.5

3.8 13.3 11.3 18.0 24.4 n.d.

8.6 22.6

462

R 1 - 5 0 : s 1 - 5 2 :

R 5 1 - 1 0 4 : s 5 3 - 1 1 1 :

H 1 0 5 - 1 6 4 : 5 1 1 2 - 1 7 0 :

R 1 6 5 - 2 1 7 : S 1 7 1 - 2 3 0 :

R 2 1 8 - 2 7 3 : S 2 3 1 - 2 9 0 :

R 2 7 4 - 2 8 0 : S 2 9 1 - 3 0 9 :

Fig. 4. Comparison of amino acidsequences of rat liver uricase andsoybean nodulin uricase. The amino-terminal amino acid residue is indicated as residue 1. Gaps are introduced to increase the homology. Boxes indicate identical amino acid residues in rat liver (R) and soybean nodulin (S) uricases. The amino acid sequence of soybean nodulin uricase is cited from Nguyen et al. [13].

be blocked and could not be determined by Edman degrada- tion. Since the first methionine at the amino-terminal position is usually processed in blocked proteins [22, 231, it is reason- able that the number of methionine residues determined in the purified enzyme is one less than that predicted from the cDNA sequence.

The purified uricase was digested with lysyl endopeptidase from Achronzobacter lyticus M497-1 and the amino acid se- quences of four oligopeptides separated by a reverse-phase HPLC were determined by Edman degradation. The amino acid sequences of these oligopeptides coincided with the pre- dicted sequences of residues 155 - 164, residues 166- 175, residues 21 1 - 225 and residues 227 - 242 (underlined in Fig. 3). These results strongly support the conclusion that the cDNA obtained indeed codes for the amino acid sequence of rat liver uricase.

Comparison of the amino acid sequences or rat liver uricase and soybean nodulin uricase

A cDNA for soybean nodulin uricase has been cloned and its amimo acid sequence has been predicted from the nucleotide sequence [13]. We compared the predicted amino acid sequences of rat liver uricase and soybean nodulin uricase. Soybean nodulin uricase is predicted to consist of 309 amino acid residues with a molecular mass of 35 170 Da. The basic nature of this protein deduced from its charged amino acids (Arg + His + Lys = 45 versus Asp + Glu = 36) is comparable to that of rat liver uricase. The amino-terminal residue of soybean nodulin uricase is blocked like that of rat liver uricase [13].

When a few gaps are introduced in the sequence of rat liver uricase to increase the homology, nine stretches of highly homologous amino acid sequences are observed in the two enzymes (boxed and underlined in Fig. 4). These regions show 73% homology (63 of 86 residues). If the three hydrophobic amino acids between positions 51 and 65 are substituted, this stretch of the enzyme shows 100% homology. There is also another long homologous stretch (20 amino acid residues) in the central regions of the two enzymes (the amino acids at positions 145-164 or rat liver uricase and positions 151 - 170 of soybean nodulin uricase). Fig. 5 shows the hydropathy profile analysis of the two uricases by the method of Kyte and Doolittle [24]. The analysis demonstrated that the two enzymes are both rather hydrophilic along the entire sequence and their amino-terminal halves have more similar profiles than their carboxyl-terminal halves.

I I ,d,X . . . . . . . .

3 A =1

- L .

I I G* ,.,, lOB z i a zta :;5g

Amino acid number

..

Fig. 5 . Hydropathy profiles or rat liver ( A ) and soybean nodulin f B) uricases. The amino acid sequence of rat liver uricase is taken from Fig. 3, and that of the soybean nodulin enzyme from Nguyen et al. [13]. Hydropathy profiles were obtained as described by Kyte and Doolittle [24]. Each hydropathic value is an average for six successive residues

DISCUSSION

When we compared the amino acid sequences deduced from cDNA for rat liver uricase and soybean nodulin uricase, a high homology between the two enzymes was found (Fig. 4). It seems likely that the two enzymes have a common signal for the transport process into peroxisomes and a common active center for enzyme activity. In connection with the for- mer, the importance of the carboxyl-terminal region has been shown in the process of transport into Neurospora mitochon- dria [25] or dog microsomes [26]. However, it has been pro- posed that positively charged amino acids might be important in the process of transport into rat peroxisomes [27, 281, Trypanosoma glycosomes [29,30], rat mitochondria 1311, yeast mitochondria [32] or frog nucleus [33]. When we searched for positively charged regions around the nine homologous stretches in the rat liver and soybean nodulin uricases, the sequences of fifteen amino acid residues at positions 17 - 31 of rat liver uricase and the corresponding sequence of soybean nodulin uricase were found to contain six positively charged residues. Moreover, the sequence of fourteen residues at posi- tions 86-99 of rat liver uricase and the corresponding se- quence of soybean nodulin uricase contained four positively

463

charged residues (Fig. 4). Accordingly, it may be possible that these positively charged regions in the amino-terminal halves play an important role in the process of transport of uricase into peroxisomes.

We could not identify the site essential for enzyme activity. Hydrophathy analysis showed that profiles in amino-terminal halves of the two uricases resemble each other better than those in carboxyl-terminal halves (Fig. 5) . Therefore, the longest homologous stretches in the central regions of the two enzymes (amino acid positions 145-164 or rat liver uricase and positions 151 - 170 of soybean nodulin uricase) or the stretches of fifteen amino acid close to amino-terminus (amino acid positions 51 - 65 or rat liver uricase and positions 51 - 71 of soybean nodulin uricase) might be active center of the enzyme.

The two enzymes also have other homologous regions besides these nine stretches and the total amino acid sequence shows 33% homology without considering the presence of gaps (Fig. 4). This homology suggests that the two enzymes originated from a common ancestor. The main differences in rat liver uricase are the presence of an additional eight amino acid residues at the amino-terminus not found in soybean nodulin uricase, and the deletions of three regions correspond- ing to amino acid positions 43 - 56, 224- 231 and 298 - 309 of soybean nodulin uricase. The addition and deletions could reflect changes during evolution of uricase, however it is in- teresting that such high homology is found between the uricases of an animal and a plant. Furthermore, studies on the primary structures of uricases from other organisms should clarify which regions are essential for enzyme activity and the transport process.

We thank Drs K. Titani for providing lysyl endopeptidase from .4chromobucter lyticus M497-1, R. Oyama for separating oligo- peptides digested with the lysyl endopeptidase and E. Ichihara for reading the manuscript.

REFERENCES 1. White, A., Handler, P. & Smith, E. L. (1973) in Principles of

2. Noguchi, T., Takada, Y. & Fujiwara, S. (1978) J . Biol. Chem.

3. Baudhuim, P., Beaufay, H. & De Duve, C. (1965) J . Cell Biol. 26,

4. Angermiller, S. & Fahimi, D. (1986) J . Histochem. Cytochem. 34,

5. Goldman, B. M. & Blobel, G. (1978) Proc. Nut1 Acad. Sci. USA

6. Watanabe, T. & Suga, T. (1978) Anal. Biochenz. 89, 343-347.

biochemistry, McGraw-Hill, New York.

254,5272- 5275.

219 - 243.

159 - 165.

74,2059 - 2063.

7. Furuta, S., Hashimoto, T., Miura, S., Mori, M. & Tatibana, M. (1982) Biochem. Biophys. Res. Cornrnun. 105, 639 -646.

8. Miura, S., Mori, M., Takiguchi, M., Tatibana, M., Furuta, S., Miyazawa, S. & Hashimoto, T. (1984) J. Biol. Chem. 259,

9. Fujiki, Y., Rachubinski, R. A,, Mortensen, R. M. & Lazarow, P.

10. Goldman, B. M. & Blobel, G. (1978) Proc. Nutl Acud. Sci. USA

f1. Lazarow, P. B. & Fujiki, Y. (1985) Annu. Rev. Cell Biol. I , 489- 530.

12. Keller, G., Gould, S., Deluca, M. & Subramani, S. (1987) Proc. Nutl Acud. Sci. USA 84, 3264-3268.

13. Nguyen, T., Zelechowska, M., Foster, V., Bergmann, H. & Verma, D. P. S. (1985) Proc. Natl Acad. Sci. USA 82, 5040- 5044.

14. Watanabe, T., Suga, T. & Hayashi, H. (1 977) J. Biochem. (Tokyo)

15. Towbin, H., Staehelin, T. & Gordon, J. (1979) Proc. Nut1 Acad.

16. Young, R. A. & Davis, R. W. (1983) Proc. Natl Acad. Sci. USA

17. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Nutl Acad.

18. Messing, J. & Vieira, J. (1982) Gene 19, 269-276. 19. Henikoff, S. (1984) Gene 28, 351-359. 20. Yanisch-Perron, C., Vieira, J. & Messing, J. (1985) Gene 33,103 -

21. Kozak, M. (1984) Nucleic Acids Res. 12, 857-872. 22. Wold, F. (1981) Annu. Rev. Biochem. 50, 783-814. 23. Tsunasawa, S. & Sakiyama, F. (1984) Methods Enzymol. 106,

24. Kyle, J. & Doolittle, R. F. (1982) J . Mol. Bid. 157, 105-132. 25. Stuart, R. A,, Neupert, W. & Tropschug, M. (1987) EMBO J . 6,

26. Miiller, G. & Zimmermann, R. (1987) EMBO J . 6, 2099-2107. 27. Miyazawa, S., Hayashi, H., Hijikata, M., Ishii, N., Furuta, S.,

Kagamiyama, H., Osumi, T. & Hashimoto, T. (1987) J . Bid. Chem. 262, 8131 -8137.

28. Hijikata, M., Ishii, N., Kagamiyama, H., Osumi, T. & Hashimoto, T. (1987) J . Bid. Chem. 262,8151 -8158.

29. Michels, P. A. M., Poliszczak, A., Osinga, K. A., Misset, O., Beeumen, J. V., Wierenga, R. K., Borst, P. & Opperdoes, F.

30. Swinkels, B. W., Gibson, W. C., Osinga, K. A., Kramer, R., Veenemen, G. H., van Boom, J. H. & Borst, P. (1986) EMBO

31. Arakawa, H., Takiguchi, M., Amaya, Y., Nagata, S., Hayashi,

32. Hurt, E. C., Muller, U. & Schatz, G. (1985) EMBO J . 4, 3509-

33. Burgh, T. R. & De Robertis, E. M. (1987) EMBO J . 6, 2617-

6397 - 6402.

B. (1985) Biochem. J. 226,697-704.

75, 5066 - 5074.

82,607 - 609.

Sci. USA 76,4350 - 4354.

80,1194-1198.

Sci. USA 74, 5463 - 5467.

119.

165-170.

2131-2137.

R. (1986) EMBO J. 5,1049- 1055.

J . 5, 1291 - 1298.

H. & Mori, M. (1987) EMBO J. 6,1361 -1366.

3518.

2625.