Oat Molecular Toolbox: Toward Better Oats

Oat Molecular Toolbox:Toward Better Oats

Nick Tinker, 2014-March-5Agriculture and Agri-Food Canada

Collaborative Oat Research Enterprise

* Mexico:Julio HuertaEduardo Villa senior MirEduardo Espitia

What makes oats different, which differences make a better oat ?

3

CORE Concept Summary

4

Representative DNA Sequence

Discover genetic differences among oat varietiesDiverse germplasm

Marker assays + gene databaseMapping germplasm Breeder Germplasm

Evaluate field & seed TraitsGenotype / Trait database

Consensus map

Analyse population structure

Associate markers with traits

Breeding assays + genomic selection

Trust what you can see, beware of abstraction

5

• A shadow is an abstraction of a 3-dimension object. • Our data has thousands of dimensions. • We need data abstractions to make decisions from “big-data”


7





Consensus map




This is what we were looking for

A

T

Functional difference

Single Nucleotide Polymorphism

= SNP

SNP = Marker

= Gene Locus

Allele

SNP assays:

9

GTACCATGATCGCTAACTGGCATGGCTTACGGCTTGAC(A) ..................G...................(B) ..................G...................(C) ..................A...................(D) ..................A...................(E) ..................G...................

• A SNP is a SNP …. no matter how you find it !• “Old” non-sequence-based methods (AFLP, DArT)

• Discover by sequence / assay by design (Illumina Array) – 6000 SNPs

• Discover and assay by sequencing (GBS) > 50,000 SNPs

6K SNP array annotations

10

Estimated chromosome (relative to Oliver et al. 2013)Estimated map position (cM relative to Oliver et al. 2013)Flag=1 for framework marker (relative to Oliver et al. 2013)Best match to Brachypodium distachyon genome

Best match to Oryza sativa genome

Best match to Hordeum vulgare genomeBest BLAST description from BLAST2GO

Minimum E value from BLAST2GO Gene Ontology terms from BLAST2GO Enzyme Code from BLAST2GO Protein Accession (NCBI) from SNPmetaShort protein name of best match from SNPmetaPredicted SNP position in coding sequence from SNPmetaPredicted SNP position in codon from SNPmetaPredicted codon for allele 1 from SNPmetaPredicted codon for allele 2 from SNPmetaPrediction if amino acid change is silent, from SNPmetaPredicted amino acid for SNP allele 1 from SNPmetaPredicted amino acid for SNP allele 2 from SNPmeta

38 important annotations (consolidated from many more)

SNP Locus NameSNP Discovery method (from Table 1)Reason for inclusion / in-silico predicted performance a

Bead Type (1 a transition SNP, 2=transvesion SNP)Illumina design scoreSuccessful conversion to 6K BEAD assaySuccessful assay based on MAF>0 and H<=10 in 595 progenySNP bases (A,T,G,C in format [A/T] ) SNP design sequence (SNP in square brackets)Full contig sequence (for SNPs called from an assembly)Comments made in GenomeStudio Genotyping ModuleComments made in GenomeStudio Clustering ModuleNumber of clusters formed in Clustering ModuleIllumina Gentrain scoreNon-missing calls across 1055 progeny (%)Number of AA (alleles 1) calls in 595 breeding linesNumber of BB (alleles 2) calls in 595 breeding linesPercentage of AB calls in 595 breeding linesMinor Allele Frequency in 595 breeding lines

Developing functional gene assays…..

11Eric Jackson et al. (unpublished)


12





Consensus map




13

CORE Diversity Phenotypes

14

Disease data Agronomic Milling Nutritive

BYDV Crown Rust Single Isolates Cold tolerence Thins Milling characters Avenanthramide isoforms BYDV(IT)_IL_2010 CR_236_2010 SURVIVAL(%)_NC_2011 THINS(Proprot)_Ott-ON_2011 HULL_WT(g)_AB-ID_2010 Avenan-2C(mg/kg)KG_AB-ID_2010BYDV(IT)_IL_2011 CR_245_2010 SUR(1)_NC_2011 THINS(g)_Cass-ND_2010 GROAT_WT(g)_AB-ID_2010 Avenan-2F(mg/kg)_AB-ID_2010BYDV(IT)_IN_2010 CR13_2010 LOG(SUR+1)(best)_NC_2011 THINS(g)_Cass-ND_2011 TRASH_WT(g)_AB-ID_2010 Avenan-2P(mg/kg)_AB-ID_2010BYDV(IT)_WINN_2010 CR223_2010 THINS(g)_AB-ID_2010 GROAT(%)_AB-ID_2010 Avenan-5P(mg/kg)_AB-ID_2010BYDV(IT)_WINN_2011 CR241_2010 Heading date THINS(g)_AB-ID_2011 BREAKAGE(%)_AB__2010 TOTALAVA(mg/kg)_AB-ID_2010

CR249_2010 HD(Actual)_AB-ID_2010 THINS(g)_TET-ID_2011 GROAT_COLOR(Vis)_AB__2010 Avenan-2C(mg/kg)KG_Cass-ND_2010Crown Rust CR254_2010 HD(Julian)_AB-ID_2011 THINS(g)_Sask-SK_2010 GROAT_WT(g)_Cass-ND_2010 Avenan-2F(mg/kg)_Cass-ND_2010CR(Sev)_Baton-Rouge-LA_2011 CR257_2010 HD(Julian)_TET-ID_2011 THINS(g)_LAC-MB_2010 HULL_WT(g)_Cass-ND_2010 Avenan-2P(mg/kg)_Cass-ND_2010CR(Sev)_Cass-ND_2010 CR258_2010 HD(Actual)_LAC-MB_2010 TRASH_WT(g)_Cass-ND_2010 Avenan-5P(mg/kg)_Cass-ND_2010CR(IT)_Cass-ND_2010 CR259_2010 HD(Actual)_Cass-ND_2010 Kernel weight (1000) GROAT(%)_Cass-ND_2010 TOTALAVA(mg/kg)_Cass-ND_2010CR(Index)_Cass-ND_2010 HD(Actual)_SASK-SK_2010 KWT(g)_Ott-ON_2011 BREAKAGE(%)_ND__2010CR(Sev)_Cass-ND_2011 Stem Rust HD(Actual)_ITH-NY_2010 KWT(g)_Sask-SK_2010 GROAT_COLOR(Vis)_ND__2010 Tocol isoformsCR(IT)_Cass-ND_2011 SR(Sev)_CDL-MN_2010 HD(Actual)_CDL-MN_2010 KWT(g)_LAC-MB_2010 ALPHAT(mg/kg)_AB-ID_2010CR(Index)_Cass-ND_2011 SR(IT)_CDL-MN_2010 HD(Days from mean)_CDL-MN_2011 KWT(g)_Aber-UK_2010 GAMMAT(mg/kg)_AB-ID_2010CR(Sev)_Fargo-ND_2010 SR(Sev)_WINN-MB_2010 HD(Days from mean)_IL_2010 BETAT(mg/kg)_AB-ID_2010CR(IT)_Fargo-ND_2010 SR(IT)_WINN-MB_2010 HD(Actual)_Ott-ON_2011 Test weight DELTAT(mg/kg)_AB-ID_2010CR(Sev)_Fargo-ND_2011 SR(IT)WINN-MB_2011 HD(Actual)_Aber-UK_2010 TWT(kg/hl)_OTT-ON_2011 ALPHAT3(mg/kg)_AB-ID_2010CR(Sev time1)_CDL-MN_2010 SR(IT)_Cass-ND_2010 TWT(kg/hl)_Cass-ND_2010 GAMMAT3(mg/kg)_AB-ID_2010CR(Sev time2)_CDL-MN_2010 SR(IT)_IN_2010 Height TWT(kg/hl)_Cass-ND_2011 BETAT3(mg/kg)_AB-ID_2010CR(IT time1)_CDL-MN_2010 HT(cm)_Ott-ON_2011 TWT(kg/hl)_Ab-ID_2010 DELTAT3(mg/kg)_AB-ID_2010CR(IT time 2)_CDL-MN_2010 HT(cm)_Cass-ND_2010 TWT(kg/hl)_Ab-ID_2011 TOTAL(mg/kg)_TOCOL_AB-ID_2010CR(Sev time1)_CDL-MN_2011 HT(cm)_AB-ID_2010 TWT(kg/hl)_TET-ID_2011 ALPHAT(mg/kg)_Cass-ND_2010CR(IT time1)_CDL-MN_2011 Stem Rust Single Isolates HT(cm)_AB-ID_2011 TWT(kg/hl)_Sask-SK_2010 GAMMAT(mg/kg)_Cass-ND_2010CR(Sev time2)_CDL-MN_2011 NA16(NGB)_2010 HT(cm)_ LAC-MB_2010 TWT(kg/hl)_LAC-MB_2010 BETAT(mg/kg)_Cass-ND_2010CR(IT time2)_CDL-MN_2011 NA25(TDD)_2010 HT(cm)_Ith-NY_2010 DELTAT(mg/kg)_Cass-ND_2010CR(Sev)_WINN_2010 NA27(TGB)_2010 HT(cm)_Aber-UK_2010 Yield ALPHAT3(mg/kg)_Cass-ND_2010CR(IT)_WINN_2010 NA28(TGL)_2010 Yield(g)_Ott-ON_2011 GAMMAT3(mg/kg)_Cass-ND_2010CR(Sev)_WINN-MB_2011 NA67(TJJ)_2010 Lodging Yield (g)_Cass-ND_2010 BETAT3(mg/kg)_Cass-ND_2010CR(IT)_WINN_2011 NA8(FDJ)_2010 LDG(Scale-0-9)_AB-ID_2010 Yield (g)_Cass-ND_2011 DELTAT3(mg/kg)_Cass-ND_2010CR(IT)_OTT_2011 LDG(Scale-0-9)_AB-ID_2011 Yield (g)_AB-ID_2010 TOTAL(mg/kg)_TOCOL_Cass-ND_2010CR(Sev)_IN_2010 Smut LDG(Scale-0-9)_TET-ID_2011 Yield (g)_Sask-SK_2010CR(IT)_IN_2010 SMUT(Sev)_WINN_2010 LDG(Scale-0-9)_Sask-SK_2010 Yield(g)_LAC-MB_2010 Beta glucanCR(IT)_WI_2010 SMUT(Sev)_WINN_2011 LDG(Scale-0-9)_LAC-MB_2010 Yield(g)_LAC-MB_2011 Beta_glucan_AB-ID_2010

LDG(Scale-0-9)_Ith-NY_2010 Yield(g)_Aber-UK_2010Powdery mildewMildew(%)_Aber-UK_2010 Grain Character Plump

Color_AB-ID_2010 Plump(g)_Cass-ND_2010Color_Aber-UK_2010 Plump(g)_AB-ID_2010Hulled-Hulless_WINN-MB_2010 Plump(g)_Sask-SK_2010Hulled-Hulless_Aber-UK_2010 Plump(g)_LAC-MB_2010


15





Consensus map




16

High Density Hexaploid Oat Map

1C 2C 3C 4C 5C 6C 7C 8A 9D 10D 11A 12D 13A 14D 15A 16A 17A 18D 19A 20D 21D

The consensus map challenge

• Consensus map is an abstraction from many maps• Smooth out errors in component maps • Put all markers on one map• Find ‘most popular order’ when real differences exist • Why ?

– Merge information from diverse studies– Plan experiments– Organize database– Predict optimum genotypes – Sequence genome, clone genes, perfect predictions

17

18

Building block populations (“component maps”)

Population Abbr. Pop. Size Marker Type Contributed by Reference

GS-7 x Boyer GB 76 6K Bonman et al. Babiker et al. in press

Provena x GS-7 PGS 98 6K, GBS Bonman et al. Babiker et al. in press

Provena x Boyer PB 139 6K Bonman et al. Babiker et al. in press

86-1156 x Clintland 64 IL4 112 6K Kolb et al. Foresman et al., in press

86-6404 x Clintlant 64 IL5 171 6K Kolb et al. Foresman et al., in press

Assiniboia x MN841801 AM 161 6K Mitchell-Fetch et al. Nanjappa et al. in press

Otana x PI269616 OP 98 6K, GBS Carson et al. Oliver et al., 2013

CDC SolFi x HiFi SH 53 6K, GBS Beattie et al Oliver et al., 2013

Dal x Exeter DE 145 6K,GBS Tinker et al. Hizbai et al., 2012

Hurdal x Z-597 HZ 53 6K,GBS Bjørnstad et al. Oliver et al., 2013

Ogle x TAMO 301 OT 53 6K, GBS Jackson et al. Portyanko et al., 1995

Kanota x Ogle KO 52 6K, GBS Tinker et al. O'Donoughue et al., 1995


19





Consensus map




Spring and Winter are definitely different:

20

Model-based analysis reveals structure of 17 different breeding programs / regions

21

NDSU Winn Ottawa NordTexas Idaho

Model: Groups defined by characteristic gene frequencies

K = 10 groups (10 colours)

% membership in each group for 600 oat varieties

Why does structure matter ?

22

“Winter” alleles

Texas varieties Northern Prairie Varieties

SN

P a

nd G

BS

mar

kers

“Spring” alleles


23





Consensus map




Genome Wide Association Mapping (GWAS)

• Concept is simple:• which markers are correlated with a trait• which varieties have the good alleles at those loci

• Hundreds of good predictions from CORE• Specialists are refining these predictions

• Correlate with known disease resistance• Genotype x Environment interaction• Explore candidate genes

24

Genomic selection

• Give every marker a weight– Predictions can be made entirely from markers

• Advantages– Simple: one abstraction, one inference: “best breeding value”

• Drawbacks– Tends to improve within a good population– Not good at introducing new alleles– Artifacts can go un-noticed

25

Integrating multiple inferences

26

Conclusions

• CORE data is a rich foundation– Already supporting new oat science – Moving toward a “universal” public oat database– Now mobilizing to support molecular breeding

• Challenges:– Develop “comfort level” with big-data and abstractions– Build smart-tools into database (“automated abstractions”)– Commit to continue sharing (experience, data and germplasm)– Predict crosses, not just selections– Use tools to access wild relatives

27

AcknowledgementsCoauthors: Jesse PolandEric JacksonShiaoman ChaoGerard LazoBecky Oliver

Tinker Lab: Charlene WightYung-Fun HuangKyle GardnerPhil CourouxJiro HattoriBiniam HizbaiBenazir Marquez

CORE: Rick Jellen, Marty Carson, Howard Rines, Don Obert, Joe Lutz, Irene Shackelford, Abraham Korol, Aaron Beattie, Åsmund Bjørnstad, Mike Bonman, Jean-Luc Jannink, Mark Sorrells, Gina Brown-Guedira, Jennifer Mitchell Fetch, Steve Harrison, Catherine Howarth, Amir Ibrahim, Fred Kolb, Mike McMullen, Paul Murphy, Herb Ohm, Brian Rossnagel, Weikai Yan, Kelci Miclaus, Jordan Hiller, Jeff Maughan, Rachel Redman, Joe Anderson, Emir Islamovic …. And others

Documents

Oat Molecular Toolbox: Toward Better Oats