OCCURRENCE AND QUANTIFICATION OF VIBRIO PARAHAEMOLYTICUS IN SHRIMP AQUACULTURE

AND ENVIRONMENT

Nur Bainun Binti Mohd Zin

27601

QR 67 Bachelor of Science with Honours N974 (Biotechnology Resource) 2013 2013

Pusat Khidmat Maklumat Akademik UNTVERSrn MALAYSIA SARAWAK

Occurrence and quantification of Vibrio parahaemolyticus in shrimp aquaculture and

environment

NUR BAINUN MOHD ZIN (27601) P,KHIOMAT MAKLUMAT AKAOEMIK

III

A final report submitted in partial fulfillment of the Final Year Project (STF 3012) Course

Supervisor: Dr. Lesley Maurice Bilung

Co-Supervisor: Dr. Micky Vincent

Resource Biotechnology

Department of Molecular Biology

Faculty of Resource Science and Technology

UNIVERSITI MALAYSIA SARAWAK

2013

Declaration

I, hereby declare that this Final Year Project is based on my original work except for

quotations and citations which have been properly acknowledged. I also declared that it has

not been previously or concurrently submitted for any other degree in UNIMAS or other

institutions.

I

Date: !)Jj 1uN .).f) '3

11

/

Acknowledgement

First, I would like to thank my supervisor, Dr. Lesley Maurice Bilung for giving me

the trust and opportunity to undertake this project and for all her supervision and guidance

throughout the project.

Furthermore, I also want to thank to all my fellow friends in the Microbiology

Laboratory 4; Nurulhuda Najihah bt Zainal Abidin, Sze Fan, Siaw Yew, Poh Yiin, Lilian,

Jesmie, Zhao Ning, Lee Tze and post-garquate student, Velnetti Linang for all their

continuous help and support. Of course, Encik Aziz for all his assistance with equipment

needed.

Last but not least, to my family and all my coursemates for all their advices and

endless support.

iii

Pusat Khidmat Maklumat Akademik UNIVERSm MALAYSIA SARAWAK

TABLE OF CONTENTS

Page

TITLE AND FRONT COVER I DECLARATION II ACKNOWLEDGEMENT III TABLE OF CONTENTS IV LIST OF TABLES VI LIST OF FIGURES VII LIST OF ABBREVIATIONS VIII

ABSTRACT 1

CHAPTER 1 INTRODUCTION 2

..J

CHAPTER 2 LITERATURE REVIEW 5

2.1 Family Vibrionaceae 5 2.2 Vibrio parahaemolyticus 6

2.2.1 Morphology and culture 6 2.2.2 Virulence factors 7 2.2.3 Vibriosis 8 2.2.4 Human diseases and economic loss to aquaculture industry 9

CHAPTER 3 MATERIALS AND METHOD 11

3.1 Materials 11 3.1.1 Water samples 3.1.2 Shrimp samples 11

3.2 Methods 11 3.2.1 Isolation ofpathogenic Vibrio species 11

3.2.1.1 Processing and enrichment ofbacteria sample 11 3.2.1.2 Enumeration ofbacteria sample 12

3.2.2 Molecular analysis 12 3.2.2.1 DNA extraction 12 3.2.2.2 Species specific PCR 13 3.2.2.3 Agarose gel electrophoresis 14

3.2.3 Statistical analysis 15

CHAPTER 4 RESULT 16

4.1 Enumeration of bacteria sample 16 4.2 Species specific PCR 16 4.3 Statistic analysis 18

iv

..."

CHAPTERS DISCUSSION 22

CHAPTER 6 CONCLUSION 26

REFERENCES 27

APPENDICES 31

v•

LIST OF TABLES

Table Page

Table 1 Materials for PCR analysis to detect toxR gene 13

toxR gene

MPN/ml

Table 2 Conditions for PCR analysis to detect toxR gene 14

Table 3 Oligonucleotide primers used for species specific to detect 14

Table 4 The mean ofwater samples for paired-samples t test 19

Table 5 Pearson correlation coefficient and P value between variables 19

Table 6 Total samples positive for V. parahaemolyticus and MPN value, 31

Table 7 Data for paired-sample t test between ponds 31

Table 8 Data for Pearson correlation analysis between water samples 32

and environmental parameters

Table 9 Data for Pearson correlation analysis between shrimp samples 33

and environmental parameters

Table 10 Data for Pearson correlation analysis between water samples and 33

shrimp samples

V1

• ....

LIST OF FIGURES

Figure Page

Figure 1 Agarose gel electrophoresis for detection of toxR gene of 17

V. parahaemolyticus for water samples

/ Figure 2 Agarose gel electrophoresis for detection of toxR gene of 17

V. parahaemolyticus for shrimp samples

Figure 3 The relationships between incidence of V. parahaemolyticus 20

(log CFU/ml) for water samples with enviromnental parameters

Figure 4 The relationships between incidence of V. parahaemolyticus 20

(log CFU/ml) for shrimp samples with enviromnental parameters

Figure 5 The relationships between incidence of V. parahaemolyticus in water 21

samples and shrimp samples

vii

I

AGE

APW

bp

CFU

DNA

DO

FAO

FOOD

g

kg

mg

MgCh

ml

mM

MPN

PCR

sp

LIST OF ABBREVIATIONS

Agarose gel electrophoresis

Alkaline Peptone Water

Base pairs

Colony fonning unit

Deoxyribonucleic acid

Dissolved oxygen

Food and Agriculture Organization ofUnited Nations

Foodbome Outbreaks Online Database

Gram

Kilogram

Milligram

Magnesium chloride

Millilitre

Millimolar

Most Probable Number

Degree Celcius

Polymerase Chain Reaction

Species

Vlll

spp Species

TBE Tris borate EDT

TeBS Thiosulphate citrate bile salt sucrose agar

TDH Thermostable direct hemolysin

tdh Thermostable direct hemolysin

toxR Toxin operon gene

TRH TDH related hemolysin

trh TDH related hemolysin

USD US dollar

UV Ultraviolet

V Vibrio

~m Micromolar

IX

Occurrence and quantification of Vibrio parahaemolyticus in aquaculture of shrimp and

environment

By Nur Bainun binti Mohd Zin (27601)

Resource Biotechnology F acuity of Resource Science and Technology

Universiti Malaysia Sarawak

ABSTRACT

Vibrio spp. occurs naturally in aquatic environments and are one of the most commonly­occuring bacteria in shrimp farming. At least 14 species had been found in panaeid shrimp culture system. V. parahaemolyticus can cause outbreak of gastroenteritis due to the consumption of raw or undercooked seafood. V. parahaemolyticus in the aquaculture may cause vibriosis to shrimp. This project was conducted using water and shrimp samples taken from a shrimp aquaculture in Bako, Sarawak to study the presence of toxR gene of V. parahaemolyticus by utilizing species specific PCR and enumeration with MPN method. Statist ic analyses were carried out to identify the relationship and correlation between the occurrence of V. parahaemolyticus and environmental parameters comprises of paired­sample t test and Pearson correlation analysis. The findings indicated 86% water samples and 14% shrimp samples harboured toxR gene for V. parahaemolyticus. There were no significant difference in both statistical analyses. Hence, the present study highlighted the potential risk of V. parahaemolyticus from shrimp aquaculture and environment to infect human and animal upon consumption.

Keywords: Vibrio parahaemolyticus, toxR gene, PCR, MPN, statistic analysis.

ABSTRAK

Vibrio spp. adalah hidupan semulajadi dalam persekitaran akuatik dan salah satu bakteria yang selalu dijumpai dalam penternakan udang. Sekurang-kurangnya 14 spesies telah ditemui di dalam akuakultur udang panaeid. fa boleh menyebabkan wabak gastroentiritis apabi/a mengambil makanan laut mentah atau kurang masak. V. parahaemolyticus dalam akuakultur terutamanya berpotensi mengakibatkan vibriosis kepada udang. Kajian ini dijalankan dengan menggunakan sampel air dan udang yang diambil dari Bako, Sarawak untuk mengkaji kehadiran gen toxR V. parahaemolyticus dengan menggunakan PCR spesies tertentu dan penghitungan dengan kaedah MPN. Analisis statistik telah dijalankan untuk mengenal pasti hubungan dan korelasi antara kehadiran V. parahaemolyticus dan parameter persekitaran menggunakan ujian sampel berpasangan t dan analisis korelasi Pearson. Hasil kajian mendapati 86% sampel air dan 14% sampel udang mengandungi gen toxR untuk V. parahaemolyticus. Tiada signifikan di dalam kedua-dua analysis statistik. Oleh itu, kajian ini menekankan potensi risiko V. parahaemolyticus daripada akuakultur udang dan persekitaran untuk menjangkiti manusia dan haiwan.

Kata kunci: Vibrio parahaemolyticus, gen toxR, PCR, MPN, analisis statistik.

..:

CHAPTER 1

INTRODUCTION

V parahaemolyticus is a Vibrio species originated from the phylum Y-proteobacteria

of domain Bacteria. It is Gram negative bacteria with curved, comma shaped rod or straight

rod by having a capsule. This facultative anaerobes are motile with having one or more polar

flagella and fermentative with the production of acid rather than gas. V parahaemolyticus

possessed positive oxidase reaction and require sodium ions for growth. The organisms can

be found in the environment especially in the aquatic environment (Pina et al., 2005).

In aquaculture of shrimp, there are several Vibrio species that had been recognized

such as V parahaemolyticus that is the natural micro flora of aquatic environment (Norma et

al., 2009). But, Vibrio species can be an opportunistic pathogen if the natural defense

mechanism is suppressed (Brock and Lightner, 1990). According to Food and Agriculture

Organization of the United Nations (2013b), one of the major diseases sufferred by Penaeus

vannamei is vibriosis that is caused by Vibrio spp. particularly V harveyi and V

parahaemolyticus.

Vibriosis may cause high mortality when shrimps' environment are stressed. It

usually occurs in postlarvae and young juvenile shrimps. According to Najiah and Lee

(2008), shrimp suffering from vibriosis will exhibit decreased appetite, become darker and

light or dark brown focal lesion and necrosis appeared on appendage tips.

Among the Vibrio species, V parahaemolyticus had been identified as foodbome

pathogen besides V mimicus, V cholerae and V vulnificus (Reham and Amani, 2012). Based

on the data from Foodbome Outbreak Online Database (FOOD) (2010), there was an

2

....

incidence offoodborne outbreak caused by V. parahaemolyticus in August~ 2010 occurred in

Washington, United States.

This species is the important cause of gastroenteritis associated with the consumption

of raw or undercooked seafood (Pina et al., 2005). Based on Reham and Amani (2012), the

infection may cause septicemia that is life threatening to immunocompromised people as well

as prolonged steroid use. The pathogenicity of V. parahaemolyticus is due to the presence of

tdh gene encoding thermostable direct haemolysin and trh gene encoding thermostable direct

related haemolysin which make the strains capable of producing TDH, TRH or both are

virulent strains (Pina et al., 2005).

Experimentally, samples from the shrimp aquaculture site in Bako were extracted

either from water or shrimp. These samples were examined for the identification of V.

parahaemolyticus via Polymerase Chain Reaction (PCR) for the detection of regulatory genes

such as toxR gene as this method is comparatively easy, efficient, accurate, less time

consuming than phenotypic methods (Zulkifli et al., 2009). In this study, species specific

peR was used to confirm the presence of toxin operon (toxR) gene which is the regulatory

gene of Vibrio spp. (Zulkifli et ai., 2009). According to Ubong et al. (2011), specific forward

and reverse primer pairs were used to detect Vibrio spp. Kim et al. (1999) also stated that

specific forward and reverse primers are used to detect V. parahaemolyticus toxR region with

50 percent G/C contents. Detection of trh and tdh gene were done to confirm the

pathogenicity of V. parahaemolyticus isolates. Additionally, most probable number technique

and CFU counting were performed in this study to enumerate the target organism in the

samples.

The main objective of this study was to investigate the occurrence and to enumerate

V. parahaemolyticus in the aquaculture farm in Bako from water and shrimp samples. Thus,

3

~.

this study provides informations on the prevalence of V. parahaemolyticus and its risk to

human.

Objectives of the study are to:

1) Detect the presence of V. parahaemolyticus from water and shrimp samples of shrimp

aquaculture and environment by using species specific peR, targeting the species specific

gene, toxR.

2) Enumerate V. parahaemolyticus from the samples collected by utilizing most probable

number (MPN) method.

3) Determine the correlation and its significance between the occurrence of V.

parahaemolyticus and environmental parameters by performjng paired-sample t test and

Pearson correlation analysis.

4

P~~EKRSh~~mat Maklumat Akademik I III MALAYSIA SARAWAK

CHAPTER 2

LITERATURE REVIEW

2.1 Family Vibrionaceae

The family Vibrionaceae is a member of Y-proteobacteria which is the subdivision of

phylum Proteobacteria in the domain Bacteria. Nishiguchi and Jones (2004) reported that the

bacteria are divided into five subdivisions (a, p, Y, 0, and €) on the basis of 168 rRNA

sequence data. Then, Y-proteobacteria is divided into three major subgroups that are Y-l, Y-2

and y-3 which consist of family Vibrionaceae. According to Holt (1994), Vibrionaceae

consists of five genera which are Vibrio, Aeromonas, Enhydrobacter, Photobacterium, and

Plesiomonas. However, genus Aeromonas have been transferred into family

Aeromonadaceae while Plesiomonas into family Enterobacteriaceae which Plesiomonas

had been suggested transferred to genus Proteus in the family Enterobacteriaceae due to its

58 rRNA is closely related to that of Proteus mirabilis (Holt, 1994).

Vibrionaceae was firstly proposed by Veron in 1965 as they are fermentative bacteria

and have polar flagella and a positive oxidase reaction for purpose ofdifferentiation between

Vibrionaceae from closely related family Enterobacteriaceae. Many species of Vibrionaceae

are widely distributed in the environment by contributing to the cycling of organic and

inorganic compounds (Martin et at., 2006). According to Bergey and Holt (2000), the

species is primarily aquatic inhabitants that can be found in seawater and fresh water and in

association with aquatic animals. It can be found either at the water surface, shrimp or in the

sediment (Shubha et at., 2005).

. Species of this family can be pathogenic or non-pathogenic. Healthy shellfish is

protected with its own immune system so that, Vibrio spp. cannot grow on its flesh. But,

5

when the shellfish dies, Vibrio spp. can proliferate and with poor food handling and

undercooked shellfish, this can cause health risk to the consumers (Aberoumend, 2010).

Since 1996, Vibrio parahaemolyticus cases had increased across the world which it can

cause gastroenteritis (Aberoumend, 2010).

2.2 Vibrio parahaemolyticus

2.2.1 Morphology and culture

Vibrio parahaemolyticus are Gram negative bacteria that appear as either curved,

comma-shaped rod or straight rod microscopically which ressemble Vibrio cholerae but

having a capsule (Parija, 2009). The bacteria is small in size with 0.5-0.8 ~m in width and

1.4-2.6 I.lID in length. The species are motile with polar flagella which are enclosed in a

sheath continuous with the outer membrane of the cell wall (Holt, 1994). V.

parahaemolyticus is oxidase positive and fennentative without producing gas. V.

parahaemolyticus fennent glucose, arabidose, maltose, mannitol, and mannose with the

production of acids but does not fennent sucrose, lactose and salicin, and it is capable to

reduce nitrate to nitrite while requiring sodium ions for growth (Parija, 2009). V.

parahaemolyticus can multiply rapidly between 20°C and 40°C but its optimum temperature

is at 37°C (Aberoumend, 2010).

The oftenly used medium to isolate Vibrio spp. is thiosulfate citrate bile salts sucrose

(TeBS) agar. When the bacteria are grown onto the medium, Vibrio parahaemolyticus

produce smooth green colonies on TCBS agar because of sucrose negative (Engelkirk and

Engelkirk, 2008). V. parahaemolyticus is acid sensitive and grow best at pH 7.5 to 8.5

(Aberoumend, 2010). For the use of identification of Vibrio spp., salt tolerance can be applied

according to their salt requirement. Other key characteristics for identification for Vibrio spp.

are positive for production of catalase, oxidase, cell lysis and sodium desoxychollate,

6

productions of ge1atinase, decarboxylation of lysine and ornithine and fermentation of

glucose, sucrose and mannitol (Pina et al., 2005).

The combination between identification method and traditional enumeration method,

the most probable number (MPN) are usually performed to detect and enumerate V.

parahaemolyticus (Nishibuchi, 2006). The major drawbacks of this technique are amount of

workload, the materials and the time needed to complete identification.

Hence, this problem can be overcome by using MPN method coupled with species

specific polymerase chain reaction (PCR). Martin et al. (2004) stated that the combination

between MPN method and species specific PCR enables the completion of enumeration

within 2 days. Other researchers have reported the success of MPN combined with PCR for

detection and quantification of pathogens (Savill et al., 2001; Freds1und et al., 2001; Martin

et al., 2004; Chai et al., 2007; Lee et al., 2009).

2.2.2 Virulence factors

As reported by Hassan et al. (2012), Vibrio is one of the genus in Vibrionaceae with

65 species in the genus had been described (Twedt, 1989) with twelve species are recognized

as human pathogens (Nair et al., 2006) with eight species considered to be foodborne

pathogens. Among the recognized human pathogens from Vibrio species are V. cholerae

0110139, V. cholerae non-01/non-0139, V. mimicus, V. parahaemolyticus, V. fluvialis, V.

furnissii, V. hollisae, V. vulnificus, V. damsel, V. alginolyticus, V. metschnikovii, V.

cincinnatiensis and V. harveyi (Engelkirk and Engelkirk, 2008). On the other hand, foodborne

pathogens from Vibrio species are V. parahaemolyticus, V. mimicus, V. cholerae and V.

vulnificus (Reham and Amani, 2012).

7

As reported by Duangkhae et al. (2011), the toxR is found as regulatory gene in

Vibrio spp. which is about 368 bp. However, the toxR gene also is the regulatory gene

specific for V. parahaemolyticus with size about 368 bp (Zulkifli et al., 2009). Based on

previous studies, the occurrence of V. parahaemolyticus can be detected by using species

specific peR by targeting the toxR gene as regulatory gene and as an taxonomic marker in

Vibrio spp. with size about 368 bp (Zulkifli et al., 2009; Duangkhae et al., 2011).

V. parahaemolyticus carried tdh gene encoding thermostable direct hemolysin and

also has trh gene encoding for TDH related hemolysin which make the strains capable of

producing TDH, TRH or both are virulent strains (Duangkhae et al., 2011).

2.2.3 Vibriosis

In aquatic environment, Vibrio spp. is widely distributed on the surface of the water,

at the shrimp and sediment (Shubha, 2005). It has mutualistic relationship between aquatic

organisms in which they assist in the digestion process with the presence of chitinase

(Seckbach, 2004). However, it can be an agent of disease that affects the aquatic organisms

and causes disease outbreak because shrimp lacks an adaptive immune system and rely on

innate immune responses against microbial invasion (Rajasekar et al., 2011). Vibriosis is one

ofthe major disease that occur in shellfish and fmfish aquaculture typically in shrimp culture,

particularly by V. parahaemolyticus (FAO, 2013a).

According to Sinderman (1990), Vibrio spp. are part ofthe natural micro flora of wild

and cultured shrimps whereas Brock and Lightner (1990) reported that it becomes

opportunistic pathogens when natural defense mechanisms are suppressed. The V.

parahaemolyticus may enter the host through wounds in the exoskeleton or pores. Sizemore

and Davis (1985) stated that outbreaks may occur when environmental facto~s trigger the

multiplication of bacteria that already tolerated at low levels within shrimp blood or by

8

bacterial penetration of host barriers. This situation can worsen at temperature above 20°C

because proliferation of Vibrio spp. ispromoted (Boer et al., 2010). According to Najiah and

Lee (2008), shrimp suffering from vibriosis will exhibit decreased appetite, become darker

and light or dark brown focal lesion and necrosis appeared on appendage tips.

2.2.4 Human diseases and economic loss to aquaculture industry

Nowadays, the consumption of shellfish such as shrimp had increased due to · the

awareness of its low cholesterol, fat content, important source of vitamins, minerals,

polyunsaturated fatty acids of the n-3 family and high quality animal protein content that

make it component in human diet (Reham and Amani, 2012). However, some Vibrio species

like V. cholerae, V. parahaemolyticus, V. mimicus, V. vulnificus and V. hollisae can cause

severe human disease such as food poisoning due to the consumption of raw or undercooked

seafood.

According to Pina et al. (2005), after ingestion, viable cells may reach the small

intestine. If the cells survive in acidic environment of the stomach, they start to produce toxin

which can cause alteration of the ions transport. Subsequently, this condition will lead to

voluminous secretory diarrhea.

According to Vasanthakumari (2007), V. parahaemolyticus was originally isolated in

an outbreak of food poisoning due to sea fish in Japan and India. Strains isolated from human

usually hemolytic due to the tdh or trh gene (Pina et al., 2005) which is the most important

cause of gastrointestinal illness associated with the consumption of raw or undercooked

seafood (Zulkitli et al., 2009). The patient will suffer watery and bloody diarrhea, abdominal

pain, vomiting, fever, headache, nausea and chill (Pina et al., 2005). Based on studies by

Reh8rn. and Amani (2012), although the illness is self-limited, the infection may cause

9

septicemia that is life threatening to immunocompromised people as well as prolonged

steroid user.

Therefore, bacterial disease such as vibriosis and human foodborne disease due to

Vibrio species could become the biggest problem to the economy of shrimp aquaculture in

Malaysia as aquaculture is the fastest growing food sector globally. As one of the most

popular seafood in the world, the market demand for shrimp continues to grow rapidly.

According to Food and Agriculture Organization of United Nations (F AO) (2013a),

aquaculture bas been identified as one of the critical activities to ensure food security since

the Seventh Malaysia Plan (1996-2000) which the value of production of black tiger shrimp

bas continued to be the leading species for the last five years at a value of USD 160 186.

Vibrio species can cause great damage and loss to the economy of aquaculture especially

aquacultured shrimp in Malaysia.

10

CHAPTER 3

MATERIALS AND METHOD

3.1 Materials

3.1.1 Water samples

The 500 ml water were obtained from two different ponds identified as pond 1 and

pond 14 from shrimp aquaculture farm and environment at Bako, Sarawak. The samples were

placed in sterile 500 ml falcon tubes and were stored in 4°C inside the ice box and were

transported to UNlMAS Microbiology Lab for further processing.

3.1.2 Shrimp samples

About 30 g fresh shrimp samples were obtained from two different ponds identified as

Pond 1 and Pond 14 from shrimp aquaculture farm and environment at Bako, Sarawak. The

shrimp samples were placed in sterile plastic bag and stored in 4°C inside the ice box and

were transported to UNlMAS Microbiology Lab for further processing.

3.2 Methods

3.2.1 Isolation of V. parahaemo[yt;cus

3.2.1.1 Processing and enrichment of bacteria sample

Isolation of V. parahaemolyticus from sampling area were performed by pre­

enrichment step in Alkaline Peptone Water (APW). Each sample was homogenized in

Allcaline Peptone Water (APW) with pH 8.6 and 1-2% (w/v) of NaCI (Elliot et al., 1978;

Kaysner et a/., 1992; Harwood et al., 2004). For water samples, 10 m1 from each sample were

added with 90 m1 APW while for shrimp samples, 25 g from each sample were added with

225 ml APW. The sample were incubated at 37°C for 18 hours.

11

3.2.1.2 Enumeration of bacteria sample

Enumeration was performed by using most probable number (MPN) method. The

eminched culture of Vibrio species were introduced to a three-tube MPN method. The serial

dilutions of fluid into 10-1 , 10-2 and 10-3 were performed with 9 mL of APW in each tubes.

All tubes were incubated at 37°C for 18 hours. After incubation, the turbid tubes were

subjected to further analysis using species specific PCR for the detection of regulatory gene,

toxR gene.

About 0.1 ml of each serial dilution from 10-3 until 10-7 were transferred onto a TCBS

agar. Then, spread plate were carried out. The plates were incubated at 37°C for 18 hours.

3.2.2 Molecular analysis

3.2.2.1 DNA extraction

In this study, boiled cell extraction method were carried out based on Vengadesh et at.

(2012). Briefly 1 mL of the overnight cultures were centrifuged at 10000 rpm for 2 minutes.

Then, the supernatants were removed and 500 III of sterile distilled water were added and

vortexed. The micro centrifuge tubes were subjected to boiling at 100°C for 10 minutes and

were immersed into ice for 10 minutes immediately. The mixtures were centrifuged at 13 000

rpm for 3 minutes. The supernatants were transferred into a new 1.5 mL micro centrifuge tube

and were used for further species specific PCR analysis.

12

3.2.2.2 Species specific peR

Species specific PCR were carried out to detect toxR gene with the oligonucleotide

sequences shown in Table 3. About 20.0 ~l reaction mixture was put into 1.5 ml microfuge

tubes which consist of the materials shown in Table 1 while the PCR were conducted based

on the conditions shown in Table 2.

Table 1: Materials for peR analysis to detect toxR gene.

Materials Volume (~l)

Sterile distilled water 12.5

10 times PCR buffer 4.0

25mMMgCh 3.0

10 mM deoxyribonucleotide phosphates 1.0

Primer 1.0

5 units TaqDNA 0.5

Template DNA 2.0

Total 25

13

Table 2: Conditions for PCR analysis to detect toxR gene.

Step Temperature (OC) Duration (minute)

Pre-denaturation 96 5

Denaturation 94 1

Annealing 63 1.5

Extension 72 1.5

Final extension 72 7

Table 3: Oligonucleotide primer sequences used for species specific to detect toxR gene. Targeted Pathogens Primer sites (5'-3') Amplicon Sources

genes size (bp)

toxR V. F: 5'- GTCTTCTGACGCAATCGT- 368 Kimet parahaemolyticus 3 ' al., 1999

R: 5'­ATACGAGTGGTTGCTGTCATG­3'

.1.2.3 Agarose gel electrophoresis (AGE)

The PCR products were loaded into sample wells of 1.0% (w/v) agarose gel. The gel

stained with 0.5 ~glml ethidium bromide solution for 15 minute in IX TBE. The gel

destained in distilled water for 15 minutes. The voltage were set at 85 volt for 1 hour.

'lben, the gel were visualized and photographed under UV transilluminator.

14