on January 19, 2018. © 2014 American Association for ...mcr.aacrjournals.org/content/molcanres/early/2014/12/17/1541-7786...22 important events necessary for efficient telomere maintenance

1 1

DNA-directed Polymerase Subunits Play a Vital Role in Human Telomeric Overhang 2 Processing. 3

4 5 Manuscript submitted to: 6

Molecular Cancer Research 7 8

Raffaella Diotti#, Sampada Kalan#, Anastasiya Matveyenko and Diego Loayza#* 9 10

Department of Biological Sciences 11 #CUNY Graduate Center 12

Hunter College, City University of New York 13 695 Park Avenue 14

New York, NY 10065 15 16

Ph. (212) 772 5312 17 Fax: (212) 772 5227 18

*corresponding author 19 [email protected] 20

21 running title: Polα and human telomeres 22

23 keywords: telomere, shelterin, Polα, S phase, lagging strand synthesis, telomerase 24

Conflict of Interest Statement: 25 The authors declare that no commercial or financial relationships exist that could be 26

construed as a potential conflict of interest. 27 on May 18, 2018. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 17, 2014; DOI: 10.1158/1541-7786.MCR-14-0381

http://mcr.aacrjournals.org/

2 1 2

3 ABSTRACT 4 Telomeres consist of TTAGGG repeats bound by the shelterin complex and end with a 5 3' overhang. In humans, telomeres shorten at each cell division, unless telomerase 6 (TERT) is expressed and able to add telomeric repeats. For effective telomere 7 maintenance, the DNA strand complementary to that made by telomerase must be 8 synthesized. Recent studies have discovered a link between different activities 9 necessary to process telomeres in the S-phase of the cell cycle in order to reform a 10 proper overhang. Notably, the human CST complex (CTC1/STN1/TEN1), known to 11 interact functionally with the polymerase complex (POLA/primase), was shown to be 12 important for telomere processing. Here, focus was paid to the catalytic (POLA1/p180) 13 and accessory (POLA2/p68) subunits of the polymerase, and their mechanistic roles at 14 telomeres. We were able to detect p68 and p180 at telomeres in S-phase using 15 chromatin immunoprecipitation (ChIP). We could also show that the CST, shelterin and 16 polymerase complexes interact, revealing contacts occurring at telomeres. We found 17 that the polymerase complex could associate with telomerase activity. Finally, depletion 18 of p180 by siRNA led to increased overhang amounts at telomeres. These data support 19 a model in which the polymerase complex is important for proper telomeric overhang 20 processing through fill-in synthesis, during S-phase. These results shed light on 21 important events necessary for efficient telomere maintenance and protection. 22 23 Implications: 24 25 This study describes the interplay between DNA replication components with proteins 26 that associate with chromosome ends, and telomerase. These interactions are 27 proposed to be important for the processing and protection of chromosome ends. 28 29 30

on May 18, 2018. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from



3 1 2 INTRODUCTION 3 Telomeres are structures located at the end of linear chromosomes, essential for their 4 stability and integrity. They consist of stretches of repetitive DNA sequences and the 5 protein complex bound to them, known in mammals as shelterin. Their role is to protect 6 the chromosome ends from being inappropriately recognized by the DNA damage 7 machinery (1). The ends of mammalian telomeres exhibit a 3’ overhang of 50-300 8 nucleotides, produced by competing actions of telomerase, extending it by repeat 9 additions, by ExoI and Apollo, which create the 5’ resected end (2), and by C-strand fill-10 in processing. Another complex, called the CST complex, is known to limit telomerase 11 activity in S phase (3), and to associate with the RNA primer synthesizing complex 12 Polα-primase (4), thereby contributing an additional activity likely to participate in 13 overhang processing. 14 In human cells, telomeres shorten at each cell division, unless telomerase is present 15 and active in adding TTAGGG repeats. During active telomere elongation in telomerase 16 positive cells, no significant change is observed in mean overhang length (5), 17 suggesting coordination between telomerase and the C-strand synthesis machinery. In 18 humans, the mechanism of C strand processing is tightly regulated, as demonstrated by 19 the observation that the 5’ ends in AATC-5’ eighty percent of the times and in AATCC-5’ 20 fifteen percent of the times (6). The terminal 5’ nucleotide, however, becomes 21 randomized upon the depletion of POT1 (7), the overhang binding protein in the 22 shelterin complex. Different models for the creation of the 3’ G-strand overhang have 23 been proposed and, in general, they invoke an interplay of leading and the lagging 24 strand processing due to the intrinsic properties of DNA replication and telomerase 25 activity (see for example (8)). Recently, it has been elegantly shown that the two strands 26 are in fact differentially processed during replication (9). The leading overhang is 27 initially a blunt end that is processed later in S phase for the creation of the overhang. 28 The lagging strand overhang length is first determined by the placement of the last RNA 29 primer, which is then removed before further processing (9). Final overhang processing 30 occurs in late S/G2. This study establishes the basis for a differential processing of the 31




4two strands without excluding other additional processing events for the C-strand. 1 Additional indication of differential metabolism for the two terminal strands was 2 described in the mouse system, in which the exonucleases Apollo and ExoI, were found 3 to be important for overhang production through 5’ end resection at the leading and 4 lagging strands respectively (2). This work also elucidated an important role for POT1b 5 in both leading and lagging strand overhang formation through the coordination of the 6 nucleases action and the C-strand fill-in through association with the CST complex. 7 In S. cerevisiae, as well as in most other eukaryotes, the CST complex, composed by 8 three RPA-like proteins, Cdc13-Stn1-Ten1 (CTC1-OBFC1-Ten1 in humans) was found 9 to be important for telomere protection and replication (10) (11). The role of the CST 10 complex in the coordination of telomere elongation in humans was corroborated by the 11 findings that it contributes to limiting telomerase activity at extending telomeres through 12 complex interactions with telomerase itself and TPP1/POT1 (3). In addition, it was 13 recently shown that CST plays a role both in general telomere replication and overhang 14 processing, particularly for longer telomeres that represent a challenge for the 15 replication machinery. Specifically, C-strand fill in was affected in OBFC1-depleted 16 cells, delaying the processing that leads to the final, mature G-overhang (12) (13). The 17 human CST complex, in addition, was isolated as a set of accessory factors for the 18 POLα-primase complex (4). In S. cerevisiae, Cdc13 is able to interact with POL1, the 19 POLα homolog, and STN1 interacts with POL12, the regulatory subunit of Polα-20 primase, which is named POLA2 in humans (14). The POLα-primase complex is 21 believed to be important for replication of the lagging strand and the C-strand fill in for 22 both strands after resection. The complex is composed by the catalytic subunit, Polα, 23 also termed p180, two primase subunits, and the regulatory subunit POLA2, or p68 (see 24 (15)). Although it has recently been established that telomeres, notwithstanding their 25 reported nature as fragile sites of DNA replication on chromosomes (16), do not 26 undergo a telomere specific replication program, but mainly a chromosome-specific one 27 (17), it has been found that partial altering of the replication machinery can have 28 telomere-specific effects. Mouse cells with a temperature sensitive p180 exhibit 29 overhang extension and concomitant overall telomere elongation (18). Therefore, 30 although defects in DNA replication and in particular in Polα-primase activity are 31




5predicted to affect general chromosomal DNA replication, it is possible that this activity 1 displays non-canonical, telomere-specific roles, in particular in overhang processing. 2 In addition, telomerase was found physically associated with primase and the lagging 3 strand replication machinery in the ciliate Euplotes crassus (19). This association 4 appeared to be developmentally regulated as it occurred specifically in mated cells, and 5 not in vegetatively growing cells. Genetic evidence in fission and budding yeast also 6 implicate primase subunits in telomere replication (14) (20) (21), although the 7 mechanisms at play remain unclear. 8 Our study investigates these possible roles at human telomeres, and focuses on p68 9 (POLA2) and p180 (POLA1). We show that they are present at telomeres in S phase, 10 interact with the shelterin complex and with the CST subunit OBFC1, as well as with 11 telomerase itself, and that they are important for the regulation of telomeric overhang 12 amounts in human cells. 13 14 MATERIAL AND METHODS 15 16 Cell lines and antibodies: 17 The HeLaII line is a subclone of HeLa S3 (ATCC CCL-2.2), with telomere length in the 18 3-6.5kb range (22), and used in (23). The HTC75 cell line is a HT1080 derivative 19 described in (24). The cells were grown in DMEM/10%BCS, and the retroviral 20 transduction protocol was identical to that described in (25). Cells were selected for the 21 plasmid with 2μg/mg Puromycin, where applicable. All rabbit sera used were generated 22 against a peptide conjugated to KLH and used for immunization into rabbits, as per the 23 protocol set by the manufacturer (BioSynthesis, Lewisville, TX). The peptides were: 24 NH2- GCKGRQEALERLKKAKAGEK -OH for p180, and NH2- 25 GCRLYLRRPAADGAERQSP-OH for p68. The peptide for FEN1 NH2-26 GCSTKKKAKTGAAGKFKRGK–OH, for TRF1 NH2-GCGSIEKEHDKLHEEIQNLI-OH (as 27 described in (24)), for POT1 NH2-CYGRGIRVLPESNSDVDQLKKDLES (as described 28 in (26)), for TPP1 NH2-GCTGPRAGRPRAQARGVRGR-OH, and for OBFC1 NH2-29 GCKTKIEIGDTIRVRGSIRT-OH. The p53BP1 antibody was purchased from Novus 30 (NB100-304). The TRF2 antibody used for immunofluorescence was purchased from 31




6Millipore, clone 4A794 (05-521). The Chk1-p-Ser345 antibody was purchased 1 from Cell Signalling (#2348). The p68 and p180 antibodies used for Western 2 blots and TRAP assays were purchased from Abcam (Ab57002 and Ab65009). The 3 POT1∆OB and FLAG-TRF1 constructs and cell lines are described in (26) (24). 4 5 Plasmids: 6 The cDNA for p68 (gene name POLA2) was purchased as a full-length clone from the 7 EST collection maintained by Invitrogen. The full-length cDNA was amplified by PCR 8 using primers with appropriate cloning sites (5’ BamHI and 3’ EcoRI) and cloned into 9 pLPC-MYC (see (25)) to generate a MYC tagged version driven by the CMV promoter. 10 The PCR oligonucleotides were: 5’-TGCTTAGGATCCGCATCCGCCCAGCAGCTG-3’ 11 and 5’-TGGAGAGAATTCTCAGATCCTGACGACCTGCACAG-3’ corresponding to 12 target sites for codons 2-7 at the 5’ end and the last 7 codons of the cDNA including the 13 stop codon. The OBFC1 cDNA was PCR-cloned from a complete EST purchased from 14 ATCC as a template, and with the following two oligonucleotides: 5’-15 ATAACACAGATCTCAGCCTGGATCCAGCCGGTGTG-3’ and 5’-16 TTCACCTCTCGAGTCAGAACGCTGTGTAGTAGTGC-3’, yielding a BglII-XhoI 17 fragment as a PCR product. The TPP1 EST was purchased from Invitrogen and PCR-18 cloned with the following two oligonucleotides 5’-19 AGGAGGATCCCCTGGCCGCTGTCAGAGTGACG-3’ and 5’-20 GAGGACTCGAGTCACATCGGAGTTGGCTCAGAC-3’, yielding a BamHI-XhoI 21 fragment as a PCR product. 22 23 Depletions by siRNA or shRNA: 24 HeLaII cells were maintained in DMEM (Invitrogen) supplemented with 1% penicillin and 25 streptomycin and 10% fetal bovine serum (FBS). The siRNAs used were synthesized by 26 Dharmacon RNA Technologies. For p68 RNAi, double-stranded siRNA were designed 27 to target the following sequences: p68-1 siRNA 5’-UGGAAGAAGAAGAGGAAAUUU-28 3’ (target in the 5’ UTR, exon 3) and p68-2 siRNA 5’-29 UAUCUGAGCUUAAGGAAUAUU-3’ (coding sequence, exon 7). For p180: p180-1 30 siRNA 5’-CUGAGUACUUGGAAGUUAA-3’ (coding sequence, exon 13); p180-2 siRNA 31




75’-CAGAUCAUGUGUGAGCUAA-3’ (coding sequence, exon 21); p180-3 siRNA 5’-1 GAGAGUAGCUGGAAUGUAA-3’ (3’UTR, exon 37). HeLaII cells were transfected using 2 Lipofectamine (Invitrogen) according to the manufacturer’s instructions. Briefly, cells at 3 a confluency of approximately 50-60% were plated in a 6-well plate 18-24 hr prior to 4 transfection. Transfections were done once and cells were processed 48 hr after 5 transfection for protein extraction or immunofluorescence. As a control siGFP 6 (Dharmacon) was used. For shRNA, the LMP vector from Open Biosystems was used, 7 which is based on the miR30 miRNA. The target sequences were PCR cloned 8 according to the manufacturer’s protocol based on the NM_002689.2 sequence for the 9 p68 cDNA. The target sequences were: sh5’UTR, 5’-10 CTCTGCCACCGTCACTGAGAAGTAGTGAAGCCACAGATGTACTTCTCAGTGACGG11 TGGCAGAA -3’; sh664, 5’-12 CCCTCTTGAACTCTTACACCACTAGTGAAGCCACAGATGTAGTGGTGTAAGAGTTC13 AAGAGGA-3’; sh1088, 5’-14 ACCTGTCACTCTGCTGGGCCAGTAGTGAAGCCACAGATGTACTGGCCCAGCAGAG15 TGACAGGC-3’; sh3’UTR, 5’-16 AATGCTCCGTGTCCAGAAGTAATAGTGAAGCCACAGATGTATTACTTCTGGACACG17 GAGCATG-3’. 18 19 Immunofluorescence: 20 Immunostaining for p53BP1 and TRF2 was performed for HeLaII cells plated onto glass 21 coverslips and processed for RNAi. After the 48 hour transfection period, cells were 22 extracted with Tx buffer [0.5% Triton X-100, 20mM Hepes-KOH pH 7.9, 50mM NaCl, 23 3mM MgCl2, 300mM sucrose] for 10 min at RT. After two PBS washes, the cells were 24 fixed with PBS/3% paraformaldehyde, 2% sucrose for 10 min at RT. After two PBS 25 washes, cells were permeabilized with Tx buffer for 10 min at RT, washed twice with 26 PBS and blocked with PBG [PBS/0.2% fish gelatin. 0.5% BSA] for 30 minutes. 27 Coverslips were then incubated with the rabbit anti-p53BP1 antibody (Novus NB100-28 304A-1), at a concentration of 1:500 in PBG overnight. Cover slips were then rinsed 29 three times with PBG solution and incubated with secondary TRITC-conjugated goat 30 anti-rabbit antibody (Jackson Immunoresearch) in PBG at a concentration of 1:500 for 31




845 min at RT. Cover slips were rinsed two times with PBG. Coverslips were then 1 incubated with PBG and 4,6-diamidino-2-phenylindole (DAPI) at 100 ng/ml to visualize 2 the nuclei. Coverslips were mounted onto slides with embedding media. Images were 3 collected with an Olympus BX61 fluorescence microscope using a 60X objective 4 connected to a Hamamatsu ORCA-ER CCD camera, controlled by the SlideBook 5.1 5 image capture software. The telomere FISH shown in figure S1C was performed as 6 described in (2). 7 8 Cell synchronization and FACS 9 HeLaII were plated 106 cells in 10cm plates. After 24hrs, thymidine to a final 10 concentration of 2mM was added to the media. The cells were treated with thymidine for 11 14hrs, and then they were rinsed 3 times with warm PBS and fresh medium without 12 thymidine. The cells were released for 11hrs and then thymidine, 2mM final 13 concentration, was added to the medium again for the second block. After 14 hours the 14 cells were released as above and collected at the appropriate time points for ChIP and 15 FACS. For FACS, cells were collected and rinsed twice in cold PBS, resuspended in 0.2 16 mL of PBS/2mM EDTA, 2mL of cold 70% Ethanol was added dropwise and the cells 17 were kept at 4°C 24hrs for fixation. The cells were then spun down and resuspended in 18 0.5 ml of PBS/2 mM EDTA.10ul of heat inactivated RNase A (10 mg/ml) and 25ul of 19 Propidium Iodide (1mg/mL) were added and the cells were incubated at 37°C for 30 20 minutes. The samples were then analyzed using a FACSCalibur Flow Cytometer. 21 22 Cell extracts and Immunoprecipitations 23 Cell extracts and immunoprecipitations were performed as described in (26). The 24 quantitations shown in figure 4 were done using the Image J analysis software. For 25 siRNA and shRNA Western blots, the relative ratios were obtained by normalizing the 26 p180 and p68 signal to GAPDH and by dividing by the untreated sample signal. For the 27 co-immunoprecipitation experiments, the enrichment values were obtained by 28 subtracting the signal from the pre-immune from the serum signal for each antibody. 29 30 TRAP assays 31




9The TRAP assays were performed as per the manufacturer’s protocol (Millipore, 1 S7710). For the IP-TRAP assays, the immunoprecipitations were performed as 2 described above, and the beads were washed six times in cold lysis buffer. The beads 3 were then resuspended in 40µl of lysis buffer, and 2µl of the resuspended beads were 4 used as input for the TRAP assay. For RNAse treated controls, 20µl of resuspended 5 beads were removed and treated with 10µg of RNAse A at 37°C for 30 minutes and 6 washed twice with cold lysis buffer. 7 8 Chromatin Immunoprecipitations 9 The chromatin immunoprecipitations were performed as described in (26) on HeLaII 10 cells synchronized by double thymidine block as described. 11 12 In-gel hybridization 13 Genomic DNA was isolated from cells as described in (25) and processed for in-gel 14 hybridization. The DNA was digested with AluI and MboI, and control samples were 15 further digested with ExoI to digest the signal derived from the 3’ overhang. 4ug of DNA 16 for each sample was loaded on a 0.7% agarose gel in 0.5X TBE. Following 17 electrophoresis, the gels were dried at room temperature for at least 3 hrs, and then 18 prehybridized with in Church mix [0.5 M Na2PO4, pH 7.2, 1mM EDTA, pH 8.0, 7& SDS, 19 1% BSA] for 30 minutes at 50°C and hybridized overnight with end labeled (CCCTAA)4 20 or (TTAGGG)4 oligonucleotides at 50°C. After hybridization the gels were washed 3X 21 with 4X SCC and 1X with 4X SCC, 0.1% SDS at 55°C, and exposed overnight to a 22 PhosphorImager screen. To detect the total telomere signal the gels were then 23 denatured in [0.5 M NaOH and 1.5 M NaCl] for 30 min and neutralized in [3 M NaCl, 24 0.5M Tris-HCl, pH 7.0] twice for 15 minutes, rinsed with dH2O and hybridized with the 25 end-labeled oligonucleotides. The gels were then exposed overnight to a 26 PhosphorImager screen, and the G-overhang signal was calculated by dividing the 27 native (CCCTAA)4 signal by that obtained with the denatured gel. 28 29 Telomeric 3’overhang analysis by double-strand specific nuclease (DSN) 30 31




10The DSN reaction was performed as previously described (32). Four micrograms of 1 genomic DNA in 1X DSN buffer was digested with 0.2 unit/µg of DNA of DSN (Axxora 2 cat. EVN-EA001-KI01) at 37°C for 2 hrs. As a control, 10 units of ExoI were added to 3 the genomic DNA prior to DSN and incubated at 37°C for 1 hr to digest terminal single 4 stranded DNA. The digestions were stopped with 0.5 μl of 0.5 M EDTA and an equal 5 volume of formamide prior to heating the samples at 65°C for 5 minutes. The samples 6 were ran on a 6% denaturing polyacrylamide gel containing 8 M urea. Electrophoresis 7 was performed at 15V/cm in 0.5X TBE. The gel was then electroblotted onto a Hybond 8 N membrane (Amersham-GE) in 0.5X TBE buffer at 4°C and 30V for 90 minutes. The 9 membrane was then air-dried, UV cross-linked and hybridized to a C-rich telomeric 10 probe at 42°C. The membrane was washed with 0.2 M wash buffer (0.2 M Na2HPO4 pH 11 7.2, 1mM EDTA, and 2% SDS). The overhang signal was calculated by subtracting the 12 ExoI signal from the DSN signal, and by calculating the ratio of each sample over the 13 untreated condition. 14 15 RESULTS 16 17 Depletion of p180 by siRNA, but not of p68, leads to a DNA damage response 18 In order to study the roles of p180 and p68, we performed depletions of both proteins by 19 siRNA and p68 by shRNA in HeLaII cells (Fig 1, S4). Among the three siRNA targets 20 used for p180, the depletion was consistent down to about 30% of control endogenous 21 levels (Fig. 1A, C). For p68, the first target site resulted in slightly over 50% depletion, 22 and the second one yielded a higher level of depletion, of 65% (Fig. 1B, D). These 23 levels of depletion correlated with mild effects on cell cycle progression, in the case of 24 p180, with a slight delay in S/G2-M (Fig. S1A,S1B), and no obvious effect was seen in 25 the case of p68. The depletions we report in this study are milder than those previously 26 reported by others (15), and may explain our capacity to detect the telomeric effects 27 reported here without major inhibition of cell cycle progression elicited with more 28 significant reduction of Polα activity. Knock down of p180 generated a broad DNA 29 damage response in the cell, as judged by the induction of p53BP1 foci (Fig 2A). This 30 effect was not observed upon depletion of p68. The average number of nuclei with 3 or 31




11more p53BP1 foci went from below 8% in control or p68 siRNA, to 35% with our best 1 p180 siRNA targets (Fig. 2C). This observation likely corresponds to a broad induction 2 of DNA damage, and not telomere deprotection, because no co-localization with 3 telomeres was observed in this case (fig.S1C). The DNA damage response seen with 4 p180 depletions is compatible with replication stress, as a significant activation of Chk1 5 was observed (Fig.2B), known to result from induction of ATR. Upon quantitation of the 6 signal detected for Chk1-Ser-345 phosphorylation, the levels of activated Chk1 7 increased by at least five fold upon p180 depletion (Fig. 2D). We did not detect a 8 significant effect with p68 depletion, as the signal obtained was not significantly different 9 from the siGFP negative control (Fig. 2B, 2D). 10 Thus, disruption of Polα activity led to an apparent ATR-dependent DNA damage 11 response as well as a mild S phase delay in the case of p180 depletion, while no overt 12 effects on cell cycle progression or induction of DNA damage in the case of our p68 13 knock down experiments was observed. 14 15

POLα-primase components can be detected at telomeres by chromatin 16 immunoprecipitation. 17 To determine if p180 and p68 could be detected at telomeres, we performed chromatin 18 immunoprecipitation (ChIP), a technique widely used to study proteins localization at 19 telomeres. The assay was carried out on asynchronous as well as synchronized cell 20 lines using anti-peptide rabbit sera against p180, p68, and OBFC1, the latter being a 21 subunit of the CST complex. ChIP done on asynchronous HTC75 control cell lines 22 yielded a low but reproducible signal for both p68 and p180 (Fig. 3A, B). We were able 23 to visualize shelterin components at telomeres in these cells, such as TRF1 and POT1, 24 as previously reported, as well as FEN1, with a yield of 4% of the total telomeric signal, 25 likely representing a S phase population (see (27) (28)). In these cells we were able to 26 detect a low but reproducible signal for p68, with a yield of 3%. The p180 subunit was 27 not detected at telomeres in this setting. We also performed the ChIP on HTC75 cells 28 with normal or elongated telomeres (through POT1∆OB expression) and found that 29 OBFC1 and p68 were also present at elongated telomeres (not shown). As the roles of 30 Polα-primase are primarily related to DNA replication in S phase, we sought to 31




12determine if a telomeric association would be occurring for p68, and perhaps also p180, 1 during this phase, as has been reported for FEN1 (27). HeLaII cells were synchronized 2 through a double thymidine block, and the cells were collected at 0, 2, 4, 6, and 8 hours 3 after release (Fig. 3C, 3D, and S2). We found that, in staged S phase cells, both p68 4 and p180 could be reliably detected at telomeres, albeit at low levels. While p180 5 peaked in the early S-phase and in late S/G2, p68 associated with telomeres more 6 stably throughout S phase. These results could indicate a possible role for Polα at 7 telomeres specifically during S phase. 8 9 The POLα-primase complex interacts with shelterin. 10 We then sought to determine whether an association between the Polα complex and the 11 telomeric shelterin complex could be detected. We also examined possible interactions 12 with OBFC1, given the known relationship with the Polα-primase complex (4). To that 13 end, we used HTC75 cells expressing tagged versions of OBFC1, POT1, TRF1 or TPP1 14 and asked whether each component could individually be immunoprecipitated with anti-15 p68 or anti-p180 antibodies. 16 We were able to detect an association between shelterin subunits POT1 and TPP1, and 17 OBFC1 (Fig. 4A). In addition, we confirmed the association between OBFC1 and p180 18 reported previously (4) (Fig 4A). We then extended our studies to possible interactions 19 between p180 or p68 with shelterin components. HTC75 cells overexpressing MYC-20 TTP1 (Fig.4B) and both HTC75 and HeLa 1.2.1.1 overexpressing MYC-p68 (Fig. S3A, 21 S3B) were used to test the potential interaction. MYC-TPP1 was found to 22 coimmunoprecipitate with p180 (Fig. 4B), suggesting an interaction between the Polα 23 and shelterin complexes. Similarly, MYC-p68 could be immunoprecipitated in HTC75 24 and HeLa 1.2.1.1 with POT1 or TRF2 antibodies (Fig. S3A, S3B). We confirmed these 25 finding by immunoprecipitating endogenous p68 in HeLaII cells with antibodies against 26 POT1, TRF1, TRF2 and TPP1 (Fig.4C). In addition, we found that FLAG-TRF1 could be 27 pulled down with p68 or p180 antibodies, confirming the interactions between shelterin 28 and Polα in a different cell line. Therefore, it is possible that the amounts of p180 and 29 p68 observed at telomeres by ChIP (Fig.3) result from interactions at the protein level 30 with the CST and shelterin complexes. The protein interactions found did not require cell 31




13synchronization as the chromatin immunoprecipitations did. Our results therefore 1 demonstrate interactions between three known complexes, the shelterin, CST and Polα-2 primase complexes, in three different human cell lines, which are likely to reflect 3 associations occurring at telomeres. 4 5 The POLα-primase complex interacts with telomerase. 6 Our observation that Polα-primase is associated with telomeres and shelterin places 7 p180 and p68 in prime position to interact with the telomerase complex. We thus asked 8 whether an association could be detected. To this end, a HeLaII extract was prepared 9 for immunoprecipitations with p180 antibodies, and the resulting pulled down material 10 was used as input for TRAP activity assay to assess a possible association with 11 telomerase. In figure 5A, we show that p180 antibodies can specifically pull down 12 telomerase activity. As controls, no TRAP activity was detected with preimmune serum, 13 nor with RNase-treated material (fig.5A, S4B). We found similar yields for FEN1, which 14 was previously shown to associate with telomerase activity (29), and could precipitate 15 TRAP activity with p68 antibodies as well (Fig. S4A). Such an interaction was also 16 described by others for TPP1 (30). OBFC1, in our hands, did not pull down TRAP activity 17 (Fig.S4A). We could confirm the association between Polα-primase and telomerase by 18 co-immunopreciation between p180 and hTERT, the catalytic subunit of telomerase 19 (Fig.5B): p180 antibodies could precipitate MYC-hTERT from a HTC75 extract, whereas 20 OBFC1 antibodies did not. Thus, we are able to show the telomerase-Polα-primase 21 interaction in two ways, by the IP-TRAP assay and by co-immunoprecipitation. 22 23 Depletion of p180 leads to increased telomeric overhang amounts. 24 As both shelterin and CST play important roles in telomere protection through overhang 25 processing, we looked at the telomeric overhang amounts in conditions where p180 or 26 p68 were depleted. We examined both short-term depletion (48 hours) via siRNA for 27 both p68 and p180 (Fig. 6) and long-term depletion using shRNAs for p68 (Fig. S4). 28 This assay involves separating restricted genomic DNA by size on an agarose gel and 29 probing the gel in native conditions with a labeled TTAGGG oligonucleotide (Fig.6A, left 30




14panel). The amounts of overhang detected for each cell line are normalized to the total 1 telomeric DNA detected in denatured conditions (Fig.6A right panel). 2 A role for p180 in limiting overhang length was observed in our siRNA experiments 3 (Fig.6A, B). Of the three targets sites used against p180, two showed an overhang 4 increase of 35% (target site 2) and 24% (target site 3) representing values of 5 significance below p=0.05 on three independent experiments. No significant effect was 6 observed with the siRNAs against p68. 7 We also performed this assay on long-term depletions for p68. The p68 shRNAs were 8 introduced in HeLaII cells through retroviral transduction; p68 was knocked down using 9 four different shRNAs targeting different sites on the predicted mRNA (Fig. S4). In this 10 case we detected a mild effect for one of the target site (sh644) with a statistically 11 significant p-value (Fig.S4C). The increase in overhang amounts averaged 15% in this 12 case. No obvious effect on telomere length was observed. To confirm these results with 13 a different technique, we applied the double-strand nuclease (DSN) assay (32) to p180-14 depleted HelaII cells (Fig.S6). The DSN assay allows the detection of undigested single 15 stranded telomeric overhangs by hybridization to a labeled C-rich oligonucleotide. We 16 found that the telomeric overhangs increased in amounts in p180-depleted cells 17 (Fig.S6A), to an extent similar to that seen with the native hybridization assay (Fig.S6B). 18 We conclude that a decrease in p180 leads to increased overhang amounts, suggesting 19 a role in the regulation of the length of the telomeric overhang without affecting the 20 resection process creating the telomeric 5’ end. It is possible that p68 is also involved in 21 this process, although the effect appears weaker. 22 23 DISCUSSION 24 The results presented here provide a link between the Polα-primase complex, and two 25 other telomeric complexes, shelterin and the CST complex. While shelterin and CST 26 have well-documented roles in telomere function, pertaining to the protection and 27 maintenance of telomeres, the implication of Polα-primase in these processes poses a 28 question: are its roles at telomeres related to conventional chromosome DNA 29 replication, or are there telomere-specific, non-canonical roles for Polα-primase at 30 telomeres? Although the final answer requires additional work, we would argue based 31




15on our findings that the observed effect on overhang processing reflects a telomere-1 specific role for Polα not related to origin-initiated DNA replication. First, we report here 2 for the first time an interaction between p180, and p68 with shelterin. These types of 3 associations were described in budding and fission yeast (21) (20), but never, to our 4 knowledge, in human cells. Second, we did not observe major defects in the cell cycle 5 profiles of p180- or p68- depleted cells in our study, arguing for mild effects, if any, in 6 chromosomal DNA replication (Fig.2, S2). These observations could be simply 7 explained by arguing that the remaining amounts of p180 or p68 in our depletion 8 experiments are sufficient to support DNA replication, but limiting for effective overhang 9 processing. And finally, we documented an association between telomerase and the 10 p180 and p68 subunits of Polα-primase. This association can be detected at the protein 11 level with hTERT, the catalytic subunit of telomerase, and likely reflects a functional role 12 since we can precipitate telomerase activity with primase subunits p68 and p180. This 13 idea is in our view interesting in that it could uncover a telomere-specific set of events 14 implicating Polα-primase, which could be targeted in tumor cells, for instance, to limit 15 their proliferation. Such a role could be highly conserved in evolution, and be related to 16 the finding that a special mutant allele in the budding yeast POL12 gene, which 17 represents the p68 ortholog, displays dysregulated telomere function, including longer 18 telomere length, and telomere deprotection (14). In addition, the yeast POL12 gene 19 interacts genetically with STN1, the OBFC1 ortholog in this organism (14). In human 20 cells, dominant-negative approaches could allow for a finer analysis of telomere-specific 21 functions for Polα-primase. 22 An important future direction will be to understand the mechanism of action of Polα-23 primase at telomere, if different from or more complex than mere association with the 24 replication fork progressing through the telomere. At present, we think it valuable to 25 interpret these results in light of recent work showing that the CST complex, in particular 26 OBFC1, limits telomerase activity, thereby participating in telomere length homeostasis 27 (3) and has a specific role in C-strand fill in (31). Knowing that OBFC1 is part of an 28 “alpha activating factor” complex (4), but has no obvious role in the recruitment of the 29 complex to telomeres, leads us to suggest that Polα-primase is recruited through 30 telomere-specific interactions, perhaps involving shelterin, to lay down the terminal RNA 31




16primer and restrict the length of the overhang. Depleting amounts of Polα-primase 1 would render this step limiting and result in increasing overhang length overall. It will be 2 interesting to analyze the nature of the potential direct contacts between shelterin and 3 Polα-primase, as well as between Polα-primase and the telomerase complex. 4

Additionally, although we did not observe any significant change in the terminal 5’ 5 nucleotide in our conditions using the STELA assay (not shown), 5’ end resection may 6 be altered upon stronger inactivation of the Polα-complex. This would present an 7 interesting synergy with POT1, which does influence the terminal 5’ nucleotide in human 8 cells (7). As a result of the interactions reported here, the overhang phenotype we 9 describe is predicted to be dependent on telomerase activity, and it would thus be 10 interesting and important to perform the depletion experiments for p68 and p180 in 11 telomerase-negative primary cells. In this context, targeting Polα-primase, or the 12 specific interactions with shelterin, would possibly result in immediate or premature 13 senescence in primary cells, thereby activating an important tumor suppressor system. 14 It is relevant to note that in mouse cells POT1b is the recruiting activity for the CST 15 complex, itself mediating fill-in synthesis, likely through Polα-primase recruitment (2). 16 Our data is compatible with these findings, and it would be valuable to test the possibility 17 that POT1 is the recruiting factor for CST and Polα in human cells. Two issues remain 18 of note in our opinion. First, as we did not detect obvious telomere deprotection (by 19 looking at telomeric p53BP1 foci), this pathway for overhang processing is not expected 20 to lead to immediate effects such as apoptosis or premature senescence. However, one 21 could hypothesize that lack of effective fill-in synthesis would exacerbate the so-called 22 “end replication problem” and limit the proliferative potential of cells, and perhaps even of 23 telomerase-positive tumor cells. Longer-term experiments than those reported here in 24 primary human cells would be required to examine this possibility. The second issue is 25 whether the overhang phenotype requires cells to be passing through S phase, or 26 whether the specific function of Polα-primase suggested here is independent of actual 27 DNA replication. Even though we did detect an increase in p68 and p180 at telomeres 28 in S phase, it remains possible that some of these interactions occur outside of the 29 context of chromosomal DNA replication and be important for telomere protection. 30 Therefore, it would be valuable to assess the possible effects of Polα-primase in cells 31




17that are in G0, which do not experience progression through the cell cycle, S phase or 1 proliferation. 2 Our view, based on the results presented here, is that telomere function relies on 3 multiple interactions among three important complexes, shelterin, CST and Polα-4 primase. In addition, Polα-primase appears to associate with the telomerase complex, 5 presumably at telomeres. Shelterin is known to be quantitatively associated with 6 telomeres, whereas the CST and Polα-primase complexes could be viewed as 7 telomere-associated factors, acting only transiently at telomeres in S phase. We 8 provide evidence here for Polα-primase as an important complex to consider in the 9 context of telomere protection and maintenance, which potentially offers additional 10 targets to counteract cell transformation and proliferation during tumorigenesis. 11 12 SUPPLEMENTARY DATA 13 There are four supplementary figures. 14 15 GRANT SUPPORT 16 This work was funded by a SC3 score award # 1SC3GM094071-01A1 from the NIGMS. 17 18 19 ACKNOWLEDGEMENTS 20 21 The authors thank the D.L. laboratory for help and advice, especially S. Uddin and C. 22 Vuong for excellent technical support, and for comments on the manuscript. 23 24 25 FIGURE LEGENDS 26 27 Figure 1. 28 Depletion of p68 (POLA2) or p180 (POLA) by siRNA in HeLaII cells. 29 A. Western blot showing p180 depletion with three different target sites. B. Depletion of 30 p68, with two different target sites. C. Quantitation of the depletion of p180. D. 31 Quantitation of the depletion of p68. The signal obtained for p180 or p68 was 32 normalized to GAPDH, and divided by the signal detected for the untreated control. The 33 values shown are averages and standard errors on three independent experiments. 34




18Figure 2. 1 Depletion of p180, but not p68, leads to formation of p53BP1 foci and Chk1 activation. 2 A. Detection of p53BP1 in HeLaII cells 48 hours after siRNA treatment for p68 or p180, 3 with the indicated target sites. Blue: DAPI; Red: p53BP1; Green: TRF2. B. Western blot 4 showing pChk1-Ser345 for the control and siRNA against p68 or p180. The top two 5 panels represent different exposures of the same blot. The GAPDH loading control is 6 shown below. C. Quantitation of p53BP1 foci in HeLaII cells treated with p68 and p180 7 siRNAs as indicated. A hundred nuclei were counted for each sample, and the averages 8 and standard errors were calculated from three independent experiments. D. 9 Quantitation of Chk1 phosphorylation, as shown in B. The relative ratio was obtained by 10 normalizing the pChk1-Ser345 signal to GAPDH and dividing by the siGFP control 11 (mean ± SEM for 3 experiments). 12 13 Figure 3. 14 Association of p68 and p180 with telomeres by chromatin immunoprecipitations.A. ChIP 15 in unsynchronized HTC75 cells. The Alu probe was used as a non-telomere control. 16 The antibodies used are indicated on top; PI=preimmune serum. B. Quantitation of the 17 DNA yields for the HTC75 ChIP. The yield for each sample was divided by the total 18 DNA value after subtraction of the pre-immune background value. C. ChIP in 19 synchronized HeLaII cells. Cells were subjected to a double Thymidine block, and 20 processed for ChIP at 2hr intervals after release. Probes are indicated at the bottom of 21 the blots. D. Quantitation of the yields for p180, p68 and OBFC1 at indicated time points 22 after release. STY: values obtained with the TTAGGG (telomeric) probe. An Alu probe 23 was used as a control. 24 25 Figure 4. 26 Interactions between Polα and shelterin components detected by IP-Western. A-C. 27 Extracts prepared from HTC75 cells expressing tagged constructs, indicated on the 28 right, were used for immunoprecipitations with the antibodies indicated at the top of the 29 lanes. The input fractions and amounts precipitated with beads only (no antibody) are 30 shown on the leftmost lanes of each blot. The numbers below the blots represent the 31




19fold enrichment for a specific antibody as compared to its pre-immune serum. The 1 antibodies used to probe the Western blots were anti-MYC 9E10 antibody (A, B) and an 2 anti-POLA2 serum (C). The antibodies used for immunoprecipitations are indicated at 3 the top of the lanes. The blot was probed with a commercial mouse anti-p68 antibody. 4 Figure 5. 5 Interaction between p180 and telomerase. A. TRAP assay performed on HelaII extract 6 (left lane), and on immunoprecipitated material with p180 serum (S) or a p180 7 monoclonal purchased from Abcam. Controls include RNase treated lysates, as well as 8 beads only, as indicated. B. IP-Western showing immunoprecipitation of hTERT with 9 p180 serum. The lysate was prepared from HTC75 cells expressing MYC-tagged 10 hTERT. The blot was probed with the 9E10 anti-MYC antibody. 11 12 Figure 6. 13 Increased overhang amounts upon siRNA depletion of p180. A. In-gel hybridization for 14 genomic DNA from HeLaII cells treated with siRNA for p68 and p180. Left panel: native 15 gel probed with the labeled oligonucleotide (CCCTAA)4 hybridizing to the telomeric 16 overhang. Right panel: same gel reprobed after denaturation to detect all telomeric 17 sequences. Samples treated with ExoI were run alongside to control for detection of 18 single strand DNA in the native gel. B. Overhang intensity is indicated as the ratio of the 19 native signal over the denatured, normalized to the siGFP control. Error bars represent 20 the standard error for three independent experiments. The two-tailed Student t test for 21 the two significant values (<0.05) are shown. 22 23 REFERENCES 24 25 1. Palm, W, de Lange, T. 2008. How shelterin protects mammalian telomeres. Annu. 26

Rev. Genet. 42:301–334. 27 2. Wu, P, Takai, H, de Lange, T. 2012. Telomeric 3’ Overhangs Derive from 28

Resection by Exo1 and Apollo and Fill-In by POT1b-Associated CST. Cell 150:39–29 52. 30

3. Chen, LY, Redon, S, Lingner, J. 2012. The human CST complex is a terminator 31 of telomerase activity. Nature 488:540–544. 32

4. Casteel, DE, Zhuang, S, Zeng, Y, Perrino, FW, Boss, GR, Goulian, M, Pilz, RB. 33 2009. A DNA polymerase-α-primase cofactor with homology to replication protein 34




20A-32 regulates DNA replication in mammalian cells. J Biol Chem 284:5807–5818. 1

5. Cristofari, G, Lingner, J. 2005. Telomere length homeostasis requires that 2 telomerase levels are limiting. EMBO 25:565–574. 3

6. Sfeir, AJ, Chai, W, Shay, JW, Wright, WE. 2005. Telomere-end processing the 4 terminal nucleotides of human chromosomes. Mol Cell 18:131–138. 5

7. Hockemeyer, D, Sfeir, AJ, Shay, JW, Wright, WE, de Lange, T. 2005. POT1 6 protects telomeres from a transient DNA damage response and determines how 7 human chromosomes end. EMBO J. 24:2667–2678. 8

8. Price, CM, Boltz, KA, Chaiken, MF, Stewart, JA, Beilstein, MA, Shippen, DE. 9 2010. Evolution of CST function in telomere maintenance. Cell Cycle 9:3157–3165. 10

9. Chow, TT, Zhao, Y, Mak, SS, Shay, JW, Wright, WE. 2012. Early and late steps 11 in telomere overhang processing in normal human cells: the position of the final 12 RNA primer drives telomere shortening. Genes Dev 26:1167–1178. 13

10. Surovtseva, YV, Churikov, D, Boltz, KA, Song, X, Lamb, JC, Warrington, R, 14 Leehy, K, Heacock, M, Price, CM, Shippen, DE. 2009. Conserved telomere 15 maintenance component 1 interacts with STN1 and maintains chromosome ends 16 in higher eukaryotes. Mol Cell 36:207–218. 17

11. Miyake, Y, Nakamura, M, Nabetani, A, Shimamura, S, Tamura, M, Yonehara, 18 S, Saito, M, Ishikawa, F. 2009. RPA-like mammalian Ctc1-Stn1-Ten1 complex 19 binds to single-stranded DNA and protects telomeres independently of the Pot1 20 pathway. Mol Cell 36:193–206. 21

12. Wang, F, Stewart, JA, Kasbek, C, Zhao, Y, Wright, WE, Price, CM. 2012. 22 Human CST has independent functions during telomere duplex replication and C-23 strand fill-in. Cell Rep 2:1096–1103. 24

13. Huang, C, Dai, X, Chai, W. 2012. Human Stn1 protects telomere integrity by 25 promoting efficient lagging-strand synthesis at telomeres and mediating C-strand 26 fill-in. Cell Res 22:1681–1695. 27

14. Grossi, S, Puglisi, A, Dmitriev, PV, Lopes, M, Shore, D. 2004. Pol12, the B 28 subunit of DNA polymerase alpha, functions in both telomere capping and length 29 regulation. Genes Dev 18:992–1006. 30

15. Chattopadhyay S, Bielinsky, AK. Human Mcm10 regulates the catalytic subunit 31 of DNA polymerase-alpha and prevents DNA damage during replication. Mol 32 Biol Cell. 18:4085– 4095. 33 16. Sfeir, A, Kosiyatrakul, ST, Hockemeyer, D, MacRae, SL, Karlseder, J, 34

Schildkraut, CL, de Lange, T. 2009. Mammalian telomeres resemble fragile sites 35 and require TRF1 for efficient replication. Cell 138:90–103. 36

17. Drosopoulos, WC, Kosiyatrakul, ST, Yan, Z, Calderano, SG, Schildkraut, CL. 37 2012. Human telomeres replicate using chromosome-specific, rather than 38 universal, replication programs. J Cell Biol 197:253–266. 39

18. Nakamura, M, Nabetani, A, Mizuno, T, Hanaoka, F, Ishikawa, F. 2005. 40 Alterations of DNA and chromatin structures at telomeres and genetic instability in 41 mouse cells defective in DNA polymerase alpha. Mol Cell Biol 25:11073–11088. 42

19. Ray, S, Karamysheva, Z, Wang, L, Shippen, DE, Price, CM. 2002. Interactions 43 between telomerase and primase physically link the telomere and chromosome 44 replication machinery. Molecular and Cellular Biology 22:5859–5868. 45

20. Dahlen, M, Sunnerhagen, P, Wang, TS. 2003. Replication proteins influence the 46 on May 18, 2018. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from



21maintenance of telomere length and telomerase protein stability. Mol Cell Biol 1 23:3031–3042. 2

21. Qi, H, Zakian, VA. 2000. The Saccharomyces telomere-binding protein Cdc13p 3 interacts with both the catalytic subunit of DNA polymerase alpha and the 4 telomerase- associated est1 protein. Genes Dev 14:1777–1788. 5

22. Saltman, D, Morgan, R, Cleary, ML, de Lange, T. 1993. Telomeric structure in 6 cells with chromosome end associations. Chromosoma 102:121–128. 7

23. Takai, KK, Hooper, SM, Blackwood, SL, Gandhi, R, de Lange, T. 2010. In vivo 8 stoichiometry of shelterin components. J Biol Chem 285: 1457-1467. 9

24. van Steensel, B, de Lange, T. 1997. Control of telomere length by the human 10 telomeric protein TRF1. Nature 385:740–743. 11

25. Karlseder, J, Smogorzewska, A, de Lange, T. 2002. Senescence induced by 12 altered telomere state, not telomere loss. Science 295:2446–2449. 13

26. Loayza, D, de Lange, T. 2003. POT1 as a terminal transducer of TRF1 telomere 14 length control. Nature 424:1013–1018. 15

27. Saharia, A, Guittat, L, Crocker, S, Lim, A, Steffen, M, Kulkarni, S, Stewart, SA. 16 2008. Flap endonuclease 1 contributes to telomere stability. Curr Biol 18:496–500. 17

28. Saharia, A, Teasley, DC, Duxin, JP, Dao, B, Chiappinelli, KB, Stewart, SA. 18 2010. FEN1 ensures telomere stability by facilitating replication fork re-initiation. J 19 Biol Chem 285:27057–27066. 20

29. Sampathi, S, Bhusari, A, Shen, B, Chai, W. 2009. Human flap endonuclease I is 21 in complex with telomerase and is required for telomerase-mediated telomere 22 maintenance. J Biol Chem 284:3682–3690. 23

30. Xin, H, Liu, D, Wan, M, Safari, A, Kim, H, Sun, W, O’Connor, MS, Songyang, Z. 24 2007. TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit 25 telomerase. Nature 445:559–562. 26

31. Wang, F, Stewart, J, Kasbek, C, Zhao, Y, Wright, W, Price, C. 2012. Human 27 CST Has Independent Functions during Telomere Duplex Replication and C-28 Strand Fill-In. Cell Reports 2:1096–1103. 29

32. Zhao, Y., Hoshiyama, H., Shay, J.W., Wright, W.E. 2008. Quantitative telomeric 30 overhang determination using a double-strand specific nuclease. Nucl.Acids.Res. 31 36:e14. 32 33






















Published OnlineFirst December 17, 2014.Mol Cancer Res Raffaella Diotti, Sampada Kalan, Anastasiya Matveyenko, et al. Telomeric Overhang ProcessingDNA-directed Polymerase Subunits Play a Vital Role in Human

Updated version

10.1158/1541-7786.MCR-14-0381doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2014/12/18/1541-7786.MCR-14-0381.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mcr.aacrjournals.org/content/early/2014/12/17/1541-7786.MCR-14-0381To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-14-0381

http://mcr.aacrjournals.org/content/suppl/2014/12/18/1541-7786.MCR-14-0381.DC1

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/early/2014/12/17/1541-7786.MCR-14-0381


Documents

on January 19, 2018. © 2014 American Association for ...mcr.aacrjournals.org/content/molcanres/early/2014/12/17/1541-7786...22 important events necessary for efficient telomere maintenance