Upload
others
View
4
Download
0
Embed Size (px)
Citation preview
1
1
Dynamic localization of Tat protein transport machinery components in 2
Streptomyces coelicolor 3
4
Joost Willemse1, #, Beata Ruban-Osmialowska2, #, David Widdick3, Katherine Celler1, Matthew I. 5
Hutchings3, Gilles P. van Wezel1 and Tracy Palmer2,4 6
7
1 Molecular Biotechnology, Institute of Biology, Gorlaeus Laboratories, Leiden University, P.O. Box 8
9502, 2300 RA Leiden, The Netherlands. 9
2 Division of Molecular Microbiology, College of Life Sciences, University of Dundee, Dundee DD1 10
5EH. United Kingdom. 11
3 School of Biological Sciences, University of East Anglia, Norwich Research Park, Norwich, NR4 12
7TJ. United Kingdom. 13
4 For correspondence telephone +44 (0)1382 386464, fax +44 (0)1382 388216, e-mail 14
16
# these authors contributed equally to this work 17
18
Key words: Streptomyces coelicolor, protein transport, twin arginine signal peptide, Tat pathway, 19
fluorescence microscopy. 20
21
Short title: Localization of Tat components at the tips of germinating hyphae. 22
23
Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.01425-12 JB Accepts, published online ahead of print on 21 September 2012
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
2
ABSTRACT 24
The Tat pathway transports folded proteins across the bacterial cytoplasmic membrane and is a 25
major route of protein export in the Streptomyces genus of bacteria. In this study we have examined 26
the localization of Tat components in the model organism Streptomyces coelicolor by constructing 27
eGFP and mCherry fluorescent fusions to the TatA, TatB and TatC proteins. All three components 28
co-localized dynamically in the vegetative hyphae, with foci of each tagged protein being prominent 29
at the tips of emerging germ tubes and of the vegetative hyphae, suggesting this may be a primary 30
site for Tat secretion. Time lapse imaging revealed that localization of the Tat components was 31
highly dynamic during tip growth, and again demonstrated the strong preference for apical sites in 32
growing hyphae. During aerial hyphae formation, TatA-eGFP and TatB-eGFP fusions relocalized to 33
pre-spore compartments, indicating re-positioning of Tat components during the Streptomyces 34
lifecycle. 35
36
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
3
INTRODUCTION 37
In bacteria, the general secretory (Sec) and twin arginine protein translocation (Tat) pathways 38
operate in parallel to transport proteins across the cytoplasmic membrane. In most bacteria Sec is 39
the predominant route of protein export. Proteins are targeted to the Sec machinery by the presence 40
of N-terminal signal peptides and are extruded across the membrane in an unfolded conformation 41
(14). Proteins are also targeted to the Tat pathway by N-terminal signal peptides, which in this case 42
contain a conserved twin-arginine motif (3, 4). The major difference between the Sec and Tat 43
pathways is that the Tat machinery transports folded proteins (reviewed in 18, 37). Protein transport 44
by the Tat pathway is powered solely by the protonmotive force (7, 56). 45
The Tat machineries of Gram-negative bacteria and Gram-positive Actinobacteria are comprised of 46
TatA, TatB and TatC proteins (5, 20, 40, 42, 50), whilst those of low G+C Gram positive bacteria 47
require only TatA and TatC (25, 26). TatB and TatC form a membrane-bound complex that binds 48
Tat substrate proteins through their twin-arginine signal peptides (e.g. 6, 8). TatA is the most highly 49
produced of all of the Tat components (23) and many copies of this monotopic membrane protein 50
are believed to cluster around a substrate-bound TatBC complex to bring about the transport of the 51
folded protein across the membrane (e.g. 9, 30, 34). 52
Although the Tat pathway is generally seen as a relatively minor route of protein traffic, bacteria of 53
the Streptomyces genus exceptionally seem to encode large numbers of Tat substrates (13). 54
Streptomycetes are mycelial organisms that undergo complex morphological differentiation (17) and 55
are of prime importance in industry and medicine since they produce a large number of 56
commercially important secondary metabolites, enzymes and other secreted protein products (21). 57
Proteomic analysis of Streptomyces coelicolor and the plant pathogenic Streptomyces scabies 58
indicate that a diverse array of hydrolytic enzymes utilize the Tat export pathway, as do substrate 59
binding proteins of ABC transporters which are subsequently lipid modified (27, 47, 51, 53). The 60
Streptomyces Tat machinery comprises TatA, TatB and TatC proteins that are functional 61
homologues of similar proteins found in Gram-negative bacteria such as Escherichia coli (20, 43, 62
44, 51). Inactivation of the Tat pathway in Streptomyces spp results in pleiotropic phenotypes 63
including impaired morphological differentiation, retarded growth rate and increased permeability of 64
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
4
the cell envelope (27, 44, 51). Given the importance of the Tat pathway to the biology of 65
Streptomyces, in this study we have examined the localization of the Tat transport machinery during 66
the lifecycle of S. coelicolor by constructing individual C-terminal fusions to enhanced green 67
fluorescent protein (eGFP) or mCherry which are commonly used as reporters for protein 68
localization in Streptomyces (e.g. 16, 39, 55). Our studies show that the three Tat components are 69
highly dynamic and that they frequently associate with the tips of vegetative hyphae. 70
71
MATERIALS AND METHODS 72
Bacterial growth conditions. E. coli strains were routinely grown in Luria Bertani medium (LB) and 73
supplemented with arabinose as necessary. S. coelicolor strains were grown on soya-flour mannitol 74
(SFM) agar, Difco nutrient broth agar (BD Diagnostics) and a 50:50 mix of tryptone soya broth (TSB 75
– Oxoid) and yeast extract-malt extract (YEME) agar. Liquid cultures were grown in Difco nutrient 76
broth or a 50:50 mix of TSB and YEME. All growth media recipes were taken from Kieser et al. (29). 77
For agarase assays, strains were cultured on MM medium (per liter: 10g Agar, 1g (NH4)2SO4, 0.5g 78
K2HPO4.7H2O, 0.2g Mg2SO4.7H2O. 0.01g FeSO4.7H2O). The inoculated plates were grown for 5 79
days at 30oC after which they were stained with lugol solution (Sigma). For fluorescence 80
microscopy, for germinating spores and young hyphae (up to 18 h), spores were incubated in liquid 81
culture in germination medium (29). Samples from liquid cultures were spotted onto a 1.5% agarose 82
bed on a glass microscope slide before microscopy analysis. Images of older vegetative hyphae (26 83
h onwards) and aerial hyphae/spore chains (collected at 44 or 72 h) were collected from samples 84
that had been inoculated at the acute-angle junction of coverslips inserted at a 45° angle in minimal 85
medium agar plates containing 1% mannitol (29). 86
87
Strain and plasmid construction. The strains and plasmids used in this study are shown in Table 88
1. Strains producing TatA-eGFP and TatC-eGFP fusion constructs from the native chromosomal 89
location were assembled in a similar manner, using the PCR targeting approach of Gust et al. (19). 90
Briefly, an egfp-aac3(IV)-oriT cassette (conferring apramycin resistance) was amplified with primer 91
pairs tatA-link-egfp fw (5’- CTCCCGTCCGGTCACCGAGCCGACGGACACGACCAAGCGCCTGCC 92
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
5
GGGCCCGGAGCTG-3) and tatA-link-egfp rv (5’- CTTGTTGCGGGCAGGCTTCAGCAACCCACGT 93
TCCCATCTCATATGTGTAGGCTGGAGCTGCTTC-3’) or tatC-link-egfp fw (5’-GGCCACGAAGGAC 94
CGGGTCAACGGCTACGACGACGTGACCCTGCCGGGCCCGGAGCTG-3’) and tatC-link-egfp rv 95
(5’-ATCATTATCGGGATCGGCCGTGTGGGGGTTCCGTGGGGGCCATATGTGTAGGCTGGAGCT 96
GCTTC-3’) and inserted downstream of tatA or tatC, respectively, in a kanamycin resistance (Kanr)-97
marked cosmid DNA, I41 (2). This approach includes an LPGPELPGPE linker sequence between 98
the end of the Tat protein and eGFP, an arrangement which has been observed to improve the 99
folding and activity of eGFP fusions (39). The resultant constructs were transferred separately to 100
either S. coelicolor M145 or FM145 by intergeneric conjugation. Apramycin resistant exconjugants 101
were screened for the loss of kanamycin resistance, indicating the double-crossover allelic 102
exchange of the tatA or tatC locus, and the strains were designated BRO1 (M145, tatA::tatA-eGFP), 103
BRO2 (M145, tatC::tatC-eGFP), BRO3 (FM145, tatA::tatA-eGFP) and BRO4 (FM145, tatC::tatC-104
eGFP). 105
Two tatB-expressing constructs were assembled in a similar manner, one of which produces 106
transcriptionally coupled TatB and eGFP as separate proteins (pTDW134) and the other of which 107
produces them as a fusion (pTDW135). To construct pTDW134, DNA encoding tatB along with 108
200bp of upstream DNA was amplified with oligonucleotides tatbpromf (5’-109
GGCGCGGGATCCGACGGCAAGGAGACGAAG and tatbcodcompr (5’- GGCGCGGGATCCTCAG 110
GTGGCGTCCATGTCGAAG-3’), the PCR product was digested with BamHI and cloned into 111
pIJ8660 (45). The clones were assessed to ensure that the tatB gene and eGFP were expressed in 112
the same orientation and the resultant plasmid designated pTDW134. To construct pTDW135, the 113
tatB gene was amplified with tatbpromf and tatbcodr (5’- GGCGCGGGATCCCATATGGGTGGCGT 114
CCATGTCGAAG-3’), the resulting PCR product was digested with BamHI and cloned it into BamHI 115
digested pBluescript. The cloned products were then excised by digestion with BamHI and NdeI and 116
cloned into similarly digested pIJ8660 to give pTDW135. These two constructs were then integrated 117
onto the chromosome of S. coelicolor strain TP5 (as M145, ΔtatB; 51) at the φC31 site, to give 118
strains TP6 (produces TatB and eGFP as separate proteins) and TP7 (produces TatB-eGFP 119
fusion). 120
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
6
To construct plasmids producing C-terminal mCherry fusions to TatB or TatC, the S. coelicolor tatB 121
gene was amplified with the primer pair tatBNdeI_fw (5’-GAGCTTCATATGGTGTTCAATGACATAG 122
GCG-3’) and tatBXbaI_rv (5’-GTACGTCTAGAGGTGGCGTCCATGTCGAAG-3’) and the tatC gene 123
was amplified with primer pair tatCNdeI_fw (5’-GCACGTCATATGCTGAAGCCTGCCCGCAAC-3’) 124
and tatCXbaI_rv (5’-GTGCATCTAGAGGTCACGTCGTCGTAGCCG-3’). The amplified genes were 125
digested with NdeI and XbaI and cloned into similarly digested pIJ6902 (22) to give pIJ6902-TatB 126
and pIJ6902-TatC, respectively. The gene coding for mCherry was amplified with primers 127
mCherryXbaI_fw (5’-CTACATTCTAGAGTGAGCAAGGGCGAGGAG-3’) and mCherryKpnI_rv (5’-128
GGCTAGGTACCTTACTTGTACAGCTCGTCC-3’), digested with XbaI and KpnI and cloned into 129
similarly digested pIJ6902-TatB and pIJ6902-TatC to give pTDW136 (pIJ6902-TatB-mCherry) and 130
pTDW137 (pIJ6902-TatC-mCherry), respectively. Plasmid pTDW136 was integrated onto the 131
chromosome of S. coelicolor strains BRO3 and BRO4 at the φC31 site, to give strains BRO5 and 132
BRO6, respectively. Plasmid pTDW137 was similarly integrated onto the chromosome of strain 133
BRO3 to give strain BRO7. 134
135
Protein methods. To assess subcellular localization of fusion proteins, suspensions of S. coelicolor 136
hyphae sonicated and subsequently separated into cytoplasmic and membrane fractions according 137
to (47). Fluorescent proteins were analysed following SDS PAGE (12% acrylamide; samples were 138
not boiled prior to separation) by scanning with a phosphorimager (FujiFilm FLA-5100) equipped 139
with a 473 nm laser and LBP filter as described previously (39). Protein concentration was 140
determined by the Lowry method (31). 141
142
Microscopy. Samples were analysed using a Zeiss Axio Imager M1 or Axioscope A1, equipped 143
with a 150x/1.35 and 100x/1.35 objective, respectively, a reflector (38 HE for eGFP or 63 HE for 144
mCherry) and a condenser contrast: DIC3 and images captured using an 5 Megapixel camera. 145
Images were examined using the Zeiss AxioVision software. Live imaging experiments were 146
conducted on MM agar plates. Samples were grown on cellophane squares for 12 hours and then 147
prepared for imaging as described (28). Imaging of time-lapse movies was performed as described 148
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
7
(54) with 2 minute time intervals between frames and 100 ms exposure times (for TatC exposure 149
times were 500 ms). 150
151
RESULTS 152
Fluorescent protein fusions to S. coelicolor Tat components are stable and retain Tat 153
transport activity. 154
We first assessed whether the S. coelicolor strains that produced eGFP-tagged variants of TatA, 155
TatB or TatC in place of the native protein retained Tat transport activity. Some functionality of the 156
Tat fusion proteins was suggested by the fact that each strain which harbored a replacement of the 157
native tat gene by a construct producing an –eGFP fusion protein showed wild-type growth and 158
differentiation on laboratory growth media. To obtain a more quantitative assessment of Tat 159
transport activity in these strains, we assessed the activity of the Tat substrate agarase. Agarase 160
secretion results in the breakdown of agar around S. coelicolor colonies which can be visualized 161
following staining with lugol. As shown in Fig 1A, strains producing TatA-eGFP (BRO1), TatB-eGFP 162
(TP7) or TatC-eGFP (BRO2) produced strong halos of agarase activity. Quantification of the 163
agarase activity by measuring zones of clearing around replicates (Fig 1B; 51, 52) indicated that the 164
level of agarase secretion for the strains producing TatA-eGFP, or TatC-eGFP was similar to wild-165
type. Since the tatA and tatC genes appear to be organized as a transcription unit, the observation 166
that the construct producing TatA-eGFP from the native chromosomal location has good Tat 167
transport activity gives a clear indication that the transcription/translation of tatC was not affected in 168
this strain. Whilst the TatB-eGFP also clearly retained function, the total exported agarase activity 169
was lower than that of the wild-type strain (Fig 1B). The reason for the lower level of agarase activity 170
for the strain producing the TatB-eGFP fusion is not clear – it may reflect a difference in expression 171
level of the single copy tatB-eGFP produced at a heterologous chromosomal location relative to the 172
native site. Alternatively, fusion of GFP to the C-terminus of TatB may reduce its functionality. 173
174
To confirm that each of the fusion proteins were stable, we briefly sonicated hyphal suspensions of 175
the strains and separated total proteins by semi-native PAGE (i.e. in the presence of SDS but 176
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
8
without heat-denaturing the samples). The presence of fluorescent proteins was then analyzed 177
using a phosphorimager. As shown in Fig 1C, each of the Tat-eGFP fusion proteins appeared to be 178
stable, and migrated close to their predicted masses. Comparison of the fluorescence intensity of 179
three fusions showed that the TatA-eGFP fusion was present at higher levels than the other two 180
constructs, consistent with findings in E. coli that TatA is far more abundant than TatB and TatC (23, 181
41). Taken together these observations indicate that fusions of eGFP to TatA, TatB and TatC are 182
stable and do not inactivate these proteins. 183
Before we analyzed cells producing these eGFP fusions by fluorescence microscopy, we next 184
investigated their subcellular localization. Hyphae from liquid-grown cultures were lysed by 185
sonication and the extract separated into cytoplasmic and membrane fractions. As shown in Fig 1D, 186
each of the Tat-eGFP fusion proteins localized predominantly to the membrane fraction, whilst free 187
eGFP (produced from strain TP6) was found mainly in the cytoplasmic fraction. We could detect no 188
TatB-eGFP protein in the cytoplasmic fraction, in contrast to TatB from S. lividans which has been 189
shown to have both membrane and cytoplasmic localization (10-12). However we did detect some 190
TatA-eGFP in the cytoplasmic fraction, which has been observed previously for untagged TatA from 191
S. lividans (10-12). 192
193
TatB-eGFP localizes at the tips of vegetative hyphae. 194
The first fusion that we analyzed by fluorescence microscopy was TatB-eGFP. Images were 195
captured from spores of strain TP7 that had been allowed to germinate in liquid culture for 6-8 h. As 196
shown in Fig 2, after 6-8 h and for each germinating spore examined, a strong focus of fluorescence 197
was visible at the hyphal tip, while frequently a second focus was visible further away from the tip. 198
Where two hyphae emerged from a germinating spore, foci were present at both tips (Fig 2, marked 199
with arrows). Analysis of 52 germinating hyphae indicated that foci were always present at the tips 200
(Table 2). When germinating spores were observed by time lapse imaging (54) again TatB-eGFP 201
was revealed to be primarily at the tips of the hyphae, but this localization was highly dynamic 202
throughout the germ tubes, moving to distinctly different sites within seconds (see Fig 5 row 2 and 203
supplemental movie SV1). 204
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
9
When vegetative hyphae were observed (12-24 h post germination, Fig 2, bottom panels), bright 205
fluorescence was still visible at the tips, but the frequency of tip-localization had declined, with only 206
around half of the hyphae examined showing this localization pattern (Table 2). In addition, further 207
less intense fluorescent foci could be seen at positions away from the tip. The same dynamic 208
localization of TatB as observed in germinating spores was also found in vegetative hyphae with 209
time lapse imaging, i.e. with foci of fluorescence moving through the hyphae over a timescale of 210
seconds (see Fig 6 row 2 and supplemental movie SV2). This indicates that the TatB-eGFP fusion 211
is highly mobile. It should be noted that an E. coli TatA-YFP fusion was also shown to be highly 212
mobile (30). 213
Interestingly, when aerial hyphae were observed (Fig 2, left), regularly spaced, punctate 214
fluorescence could be seen, which seemed to coincide with the positioning of pre-spore 215
compartments. In addition, some of the aerial hyphae examined also showed a brighter fluorescent 216
focus at the tip. Thus it appears that the TatB-eGFP fusion is highly mobile in substrate hyphae of S. 217
coelicolor and that it re-localizes to pre-spores during aerial growth. 218
219
TatC-eGFP co-localizes with TatB during vegetative growth. 220
In E. coli TatB forms a stoichiometric complex with TatC that functions as a receptor for substrates 221
(e.g. 6, 46). Since the S. coelicolor TatB and TatC proteins are each able to functionally substitute 222
for their E. coli counterparts (20), it suggests that the S. coelicolor TatB and TatC proteins similarly 223
function together. We therefore anticipated that we should see similar localization of the TatB and 224
TatC fusions. However, the fluorescence of the TatC-eGFP fusion in living cells was not as bright as 225
that of TatB-eGFP, thus requiring high exposure times (600ms) and therefore giving significant 226
background autofluorescence. Nevertheless foci could be seen at or close to the tips of emerging 227
hyphae in germinating spores (Fig 3, right). For this reason the TatC-eGFP construct was 228
introduced in strain FM145, a low autofluorescent derivative of M145 (55), allowing longer exposure 229
times (of up to 5 seconds). This revealed similar localization of TatC in both germinating spores and 230
growing hyphae for BRO4 (FM145 tatC::tatC-eGFP) as that seen for BRO2 (compare Fig 3 with 231
Figs 5 and 6; supplemental movies SV3 and SV4). The intensity of the fluorescent foci at the hyphal 232
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
10
tips for the TatC-eGFP fusion was less pronounced than for TatB-eGFP, and other equally bright 233
foci could be seen at regularly spaced intervals along the vegetative hyphae (Fig 3, bottom). 234
Examination of aerial hyphae and pre-spores (Fig 3 right and top) again indicated regularly spaced, 235
punctate fluorescence apparently coinciding with pre-spore compartments. We also noted that, 236
similar to TatB-eGFP, TatC-eGFP was also highly mobile, moving through the hyphae over a 237
timescale of seconds (Fig 6, bottom row and supplemental movie SV4). 238
Based on 166 images of hyphae emerging from germinating spores of strain BRO2, the frequency 239
of tip-localized fluorescence was estimated at 98% (Table 2). Since foci of TatB-eGFP were also 240
found at the hyphal tips at high frequency, this suggests that the two proteins co-localize. To 241
investigate this further we constructed a fusion of mCherry to the C-terminus of TatB encoded on 242
plasmid pIJ6902 and this was incorporated at single copy into strain BRO4, which produces TatC-243
eYFP from the native chromosomal location. Since TatB-mCherry expression in this new strain, 244
BRO6, depended on the leakiness of the uninduced tipA promoter, it accumulated at lower levels 245
than TatB–eGFP which was expressed from the tatB promoter. Therefore, imaging of TatB-mCherry 246
required long exposure times (in the order of 5 – 10 seconds). Nonetheless, analysis of the strain 247
producing both the TatC-eGFP and TatB-mCherry fusion proteins showed mostly co-localization of 248
the two proteins in vegetative hyphae (Fig 7, panel C). 249
250
Co-localization of TatA-eGFP with other Tat components in vegetative hyphae. 251
Finally we examined the behavior of TatA-eGFP. As shown in Fig 4, this fusion appeared to be 252
much brighter than the TatB- or TatC-eGFP fusion proteins, and showed a more dispersed 253
localization, but in all cases at the periphery of hyphae, consistent with membrane localization. In 254
germinating hyphae, fluorescence could be seen throughout the membrane, in some cases 255
appearing as continuous fluorescence and in other instances as more punctate spots (Fig 4, right). 256
A similar pattern of mixed punctate and disperse fluorescence has also been seen for a TatA-YFP 257
protein produced at native levels in E. coli, with punctate fluorescence only observed in the 258
presence of the other Tat components (30). In almost all instances a strong fluorescent focus was 259
also visible at the tip of germlings (Table 2). In older hyphae, fluorescent foci were visible 260
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
11
throughout, including at the tip region (Fig 4, bottom). Like the TatC-eGFP fusion, the TatA-eGFP 261
appeared to be reasonably evenly distributed over the hyphal length. In aerial hyphae and pre-262
spores, again distribution of the TatA fusion protein was along the entire length, with foci coinciding 263
with each pre-spore compartment (Fig 4 left and top; supplemental movie SV5). Time-lapse imaging 264
of TatA-eGFP in vegetative hyphae again showed dynamic localization of the fusion. Interestingly, it 265
appeared in some cases that foci of fluorescence assembled from more dispersedly fluorescent 266
regions (Fig 6, top row and supplemental movie SV6). This may potentially correspond to the 267
assembly of dispersed monomers or small oligomers of TatA into large assemblies, as inferred by 268
other studies (30). 269
To ascertain whether TatA co-localizes with the other Tat components, we constructed dual tagged 270
strains where either TatB-mCherry or TatC-mCherry was co-produced under control of the tipA 271
promoter with natively-encoded TatA-eGFP (strains BRO5 and BRO7, respectively). Very long 272
exposure times (5 – 10 seconds) were required to visualize mCherry, making co-localization studies 273
difficult. However, it appears that in vegetative hyphae all of the foci of TatB-mCherry co-localize 274
with foci of TatA-eGFP (Fig 7A). While all of the TatC-mCherry foci also co-localized with TatA-275
eGFP foci, some of the TatA-eGFP appeared to localize independently of TatC-mCherry (Fig 7B). 276
277
DISCUSSION 278
In this study we have used fluorescent protein fusions to determine the sub-cellular localization of 279
the S. coelicolor Tat components throughout the complex lifecycle of this organism. We clearly 280
observed foci of eGFP-tagged TatA, TatB and TatC at the tips of germinating hyphae. As the 281
vegetative hyphae aged, the proportion with foci of TatA-eGFP and TatB-eGFP at the hyphal tips 282
decreased, although even 24 h post germination almost 50% of the hyphae we examined had tip-283
localized foci of TatA and TatB. Co-localization experiments showed that TatA-eGFP foci co-284
localized with TatB-mCherry and TatC-mCherry foci, and that likewise TatC-eGFP foci also co-285
localized with TatB-mCherry foci. It is likely that these co-localizing Tat foci represent active Tat 286
transport complexes since it is known from studies in other organisms that TatA associates only 287
transiently with TatBC during the protein transport step (1, 34). 288
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
12
The localization of Tat proteins at the tips of vegetative hyphae suggests that one of the major sites 289
for protein secretion by the Tat pathway is at or near the hyphal tips, analogous to tip-dependent 290
secretion by fungi (e.g. 15). However, Tat complexes also assembled at other sites along the hyphal 291
wall, suggesting tip secretion is not the only route. Interestingly, during time lapse imaging TatA and 292
TatB appeared to be highly dynamically localized, and TatA foci were frequently seen to move away 293
from the tips and to settle at a position approximately 2 µm below the apical site. However, since 294
TatA is relatively highly abundant, we cannot rule out that some TatA remains at the tips, due to the 295
very short exposure times. TatB was always visible at the tips of vegetative hyphae, but in time-296
lapse imaging several foci were observed further away from the tip, which appeared to retrace back 297
to the tip during growth. We are currently analyzing the dynamics of the Tat components and their 298
colocalization in time and space. 299
We noted that the tip-localized fluorescent foci appeared to be brighter for TatB-eGFP than for TatA- 300
or TatC-eGFP, suggesting that, for reasons which are currently unclear, there is more TatB at the tip 301
compared to TatA and TatC. We also noted that the frequency and brightness of tip localized foci 302
appeared to increase when cells had stopped growing, for example when embedded in agarose 303
prior to imaging. This might suggest that energy is required to move the fluorescent proteins away 304
from the tip. It should also be noted that we attempted to investigate whether we could use an 305
agarase signal peptide-eGFP fusion to image Tat-dependent secretion, however we found that, as 306
previously noted for Bacillus subtilis (33), eGFP could not be exported in a fluorescent form by the 307
Streptomyces Tat pathway (Widdick, Fyans and Palmer, unpublished). 308
During aerial hyphae formation there was relocalization of the Tat-eGFP fusion proteins such that 309
foci of fluorescence appeared to coincide with pre-spore compartments. This would serve to ensure 310
that Tat components are partitioned to each spore during sporulation. Partitioning of protein clusters 311
has attracted some attention in recent years, with proteins of the MinD/ParA family being 312
increasingly implicated in protein segregation (32, 48). These protein partitioning ParAs are often 313
termed ‘orphan’ ParAs to reflect the fact that they do not function with ParB partner proteins. It is 314
interesting to note that in actinobacteria, including Streptomyces, whilst tatA and tatC are encoded 315
together at the same chromosomal location, tatB is found at a conserved location elsewhere on the 316
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
13
chromosome. The chromosomal neighborhood of tatB (SCO5150) includes genes predicted to code 317
for a σE-type ECF sigma factor (SCO5147), a HtrA/DegP protease (SCO5149) and a of particular 318
interest an ‘orphan’ ParA (SCO5152) (38). It would be interesting to ascertain whether any of these 319
genes, in particular SCO5152, plays a major role in the localization of Tat components. 320
In previous studies it was shown that the SsgA protein, which is an actinomycete-specific protein 321
that acts as an activator of cell-wall remodeling such as during septum formation, branching and 322
germination (24, 35), is required for proper secretion of the Tat substrate tyrosinase (49). Deletion of 323
ssgA strongly enhanced the expression of the tat genes, most likely as a compensation effect (35). 324
During germination and active growth both SsgA and the Tat proteins localize to the apical sites, 325
and both show a dynamic localization pattern. Strains of S. coelicolor overexpressing SsgA show 326
strong fragmentation of the mycelia during fermentation, and displayed a three-fold increased 327
secretion of Tat substrates (49). Data presented in this work suggest that this increased secretion 328
may be explained by the fact that Tat complexes preferentially localize to apical sites, which 329
increase dramatically when hyphae fragment. The localization of the protein secretion machinery is 330
highly relevant in strain improvement approaches. 331
In conclusion, fluorescence and time lapse imaging showed that components of the Tat export 332
pathway dynamically localize throughout the Streptomyces lifecycle, actively changing at each 333
growth phase. It will be interesting to ascertain whether other protein secretion machineries show 334
similar dynamic localization and to try and determine the localization of Tat substrates during 335
translocation in S. coelicolor during the same developmental time course. 336
337
Acknowledgements 338
This work is supported by the Biotechnology and Biological Sciences Research Council through 339
grants BB/F002947/1 to TP and by a VICI grant from the Netherlands Technology Foundation STW 340
to GPvW. We are grateful to Dagmara Jakimowicz for providing cosmid H24 parB-eGFP aac3(IV), 341
used as template to amplify the egfp-aac3(IV)-oriT cassette. We thank colleagues at the John Innes 342
Centre for helpful discussion. 343
344
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
14
References 345
1. Alami, M., I. Luke, S. Deitermann, G. Eisner, H. G. Koch, J. Brunner, and M. Muller. 346 2003. Differential interactions between a twin-arginine signal peptide and its translocase in 347 Escherichia coli. Mol Cell 12:937-946. 348
349 2. Bentley, S. D., K. F. Chater, A. M. Cerdeno-Tarraga, G. L. Challis, N. R. Thomson, K. D. 350
James, D. E. Harris, M. A. Quail, H. Kieser, D. Harper, A. Bateman, S. Brown, G. 351 Chandra, C. W. Chen, M. Collins, A. Cronin, A. Fraser, A. Goble, J. Hidalgo, T. 352 Hornsby, S. Howarth, C. H. Huang, T. Kieser, L. Larke, L. Murphy, K. Oliver, S. O'Neil, 353 E. Rabbinowitsch, M. A. Rajandream, K. Rutherford, S. Rutter, K. Seeger, D. Saunders, 354 S. Sharp, R. Squares, S. Squares, K. Taylor, T. Warren, A. Wietzorrek, J. Woodward, B. 355 G. Barrell, J. Parkhill, and D. A. Hopwood. 2002. Complete genome sequence of the 356 model actinomycete Streptomyces coelicolor A3(2). Nature 417:141-147. 357
358 3. Berks, B. C. 1996. A common export pathway for proteins binding complex redox cofactors? 359
Mol Microbiol 22:393-404. 360 361 4. Berks, B. C., F. Sargent, and T. Palmer. 2000. The Tat protein export pathway. Mol 362
Microbiol 35:260-274. 363 364 5. Bogsch, E. G., F. Sargent, N. R. Stanley, B. C. Berks, C. Robinson, and T. Palmer. 365
1998. An essential component of a novel bacterial protein export system with homologues in 366 plastids and mitochondria. J Biol Chem 273:18003-18006. 367
368 6. Bolhuis, A., J. E. Mathers, J. D. Thomas, C. M. Barrett, and C. Robinson. 2001. TatB 369
and TatC form a functional and structural unit of the twin-arginine translocase from 370 Escherichia coli. J Biol Chem 276:20213-20219. 371
372 7. Cline, K., W. F. Ettinger, and S. M. Theg. 1992. Protein-specific energy requirements for 373
protein transport across or into thylakoid membranes. Two lumenal proteins are transported 374 in the absence of ATP. J Biol Chem 267:2688-2696. 375
376 8. Cline, K., and H. Mori. 2001. Thylakoid DeltapH-dependent precursor proteins bind to a 377
cpTatC-Hcf106 complex before Tha4-dependent transport. J Cell Biol 154:719-729. 378 379 9. Dabney-Smith, C., H. Mori, and K. Cline. 2006. Oligomers of Tha4 organize at the 380
thylakoid Tat translocase during protein transport. J Biol Chem 281:5476-5483. 381 382 10. De Keersmaeker, S., L. Van Mellaert, E. Lammertyn, K. Vrancken, J. Anne, and N. 383
Geukens. 2005. Functional analysis of TatA and TatB in Streptomyces lividans. Biochem 384 Biophys Res Commun 335:973-982. 385
386 11. De Keersmaeker, S., L. Van Mellaert, K. Schaerlaekens, W. Van Dessel, K. Vrancken, E. 387
Lammertyn, J. Anne, and N. Geukens. 2005. Structural organization of the twin-arginine 388 translocation system in Streptomyces lividans. FEBS Lett 579:797-802. 389
390 12. De Keersmaeker, S., K. Vrancken, L. Van Mellaert, J. Anne, and N. Geukens. 2007. The 391
Tat pathway in Streptomyces lividans: interaction of Tat subunits and their role in 392 translocation. Microbiology 153:1087-1094. 393
394 13. Dilks, K., R. W. Rose, E. Hartmann, and M. Pohlschroder. 2003. Prokaryotic utilization of 395
the twin-arginine translocation pathway: a genomic survey. J Bacteriol 185:1478-1483. 396 397
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
15
14. Driessen, A. J., and N. Nouwen. 2008. Protein translocation across the bacterial 398 cytoplasmic membrane. Annu Rev Biochem 77:643-667. 399
400 15. Fischer, R., N. Zekert, and N. Takeshita. 2008. Polarized growth in fungi--interplay 401
between the cytoskeleton, positional markers and membrane domains. Mol Microbiol 402 68:813-826. 403
404 16. Flärdh, K. 2003. Essential role of DivIVA in polar growth and morphogenesis in 405
Streptomyces coelicolor A3(2). Mol Microbiol 49:1523-1536. 406 407 17. Flärdh, K., and M. J. Buttner. 2009. Streptomyces morphogenetics: dissecting 408
differentiation in a filamentous bacterium. Nat Rev Microbiol 7:36-49. 409 410 18. Frobel, J., P. Rose, and M. Muller. 2012. Twin-arginine-dependent translocation of folded 411
proteins. Philosophical transactions of the Royal Society of London. Series B, Biological 412 sciences 367:1029-1046. 413
414 19. Gust, B., G. L. Challis, K. Fowler, T. Kieser, and K. F. Chater. 2003. PCR-targeted 415
Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the 416 sesquiterpene soil odor geosmin. Proc Natl Acad Sci U S A 100:1541-1546. 417
418 20. Hicks, M. G., D. Guymer, G. Buchanan, D. A. Widdick, I. Caldelari, B. C. Berks, and T. 419
Palmer. 2006. Formation of functional Tat translocases from heterologous components. 420 BMC Microbiol 6:64. 421
422 21. Horinouchi, S. 2007. Mining and polishing of the treasure trove in the bacterial genus 423
streptomyces. Bioscience, biotechnology, and biochemistry 71:283-299. 424 425 22. Huang, J., J. Shi, V. Molle, B. Sohlberg, D. Weaver, M. J. Bibb, N. Karoonuthaisiri, C. J. 426
Lih, C. M. Kao, M. J. Buttner, and S. N. Cohen. 2005. Cross-regulation among disparate 427 antibiotic biosynthetic pathways of Streptomyces coelicolor. Mol Microbiol 58:1276-1287. 428
429 23. Jack, R. L., F. Sargent, B. C. Berks, G. Sawers, and T. Palmer. 2001. Constitutive 430
expression of Escherichia coli tat genes indicates an important role for the twin-arginine 431 translocase during aerobic and anaerobic growth. J Bacteriol 183:1801-1804. 432
433 24. Jakimowicz, D., and G. P. van Wezel. 2012. Cell division and DNA segregation in 434
Streptomyces: how to build a septum in the middle of nowhere? Mol Microbiol 85:393-404. 435 436 25. Jongbloed, J. D., U. Grieger, H. Antelmann, M. Hecker, R. Nijland, S. Bron, and J. M. 437
van Dijl. 2004. Two minimal Tat translocases in Bacillus. Mol Microbiol 54:1319-1325. 438 439 26. Jongbloed, J. D., R. van der Ploeg, and J. M. van Dijl. 2006. Bifunctional TatA subunits in 440
minimal Tat protein translocases. Trends Microbiol 14:2-4. 441 442 27. Joshi, M. V., S. G. Mann, H. Antelmann, D. A. Widdick, J. K. Fyans, G. Chandra, M. I. 443
Hutchings, I. Toth, M. Hecker, R. Loria, and T. Palmer. 2010. The twin arginine protein 444 transport pathway exports multiple virulence proteins in the plant pathogen Streptomyces 445 scabies. Mol Microbiol 77:252-271. 446
447 28. Jyothikumar, V., E. J. Tilley, R. Wali, and P. R. Herron. 2008. Time-lapse microscopy of 448
Streptomyces coelicolor growth and sporulation. Appl Environ Microbiol 74:6774-6781. 449 450 29. Kieser, T., Bibb, M.J., Buttner, M.J., Chater, K.F. and Hopwood, D.A. 2000. Practical 451
Streptomyces genetics. The John Innes Foundation, Norwich. 452
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
16
30. Leake, M. C., N. P. Greene, R. M. Godun, T. Granjon, G. Buchanan, S. Chen, R. M. 453 Berry, T. Palmer, and B. C. Berks. 2008. Variable stoichiometry of the TatA component of 454 the twin-arginine protein transport system observed by in vivo single-molecule imaging. Proc 455 Natl Acad Sci U S A 105:15376-15381. 456
457 31. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Protein 458
measurement with the Folin phenol reagent. J Biol Chem 193:265-275. 459 460 32. Lutkenhaus, J. 2012. The ParA/MinD family puts things in their place. Trends Microbiol 461
20:411-418. 462 463 33. Meissner, D., A. Vollstedt, J. M. van Dijl, and R. Freudl. 2007. Comparative analysis of 464
twin-arginine (Tat)-dependent protein secretion of a heterologous model protein (GFP) in 465 three different Gram-positive bacteria. Appl Microbiol Biotechnol 76:633-642. 466
467 34. Mori, H., and K. Cline. 2002. A twin arginine signal peptide and the pH gradient trigger 468
reversible assembly of the thylakoid [Delta]pH/Tat translocase. J Cell Biol 157:205-210. 469 470 35. Noens, E. E., V. Mersinias, J. Willemse, B. A. Traag, E. Laing, K. F. Chater, C. P. Smith, 471
H. K. Koerten, and G. P. van Wezel. 2007. Loss of the controlled localization of growth 472 stage-specific cell-wall synthesis pleiotropically affects developmental gene expression in an 473 ssgA mutant of Streptomyces coelicolor. Mol Microbiol 64:1244-1259. 474
475 36. Paget, M. S., L. Chamberlin, A. Atrih, S. J. Foster, and M. J. Buttner. 1999. Evidence that 476
the extracytoplasmic function sigma factor sigmaE is required for normal cell wall structure in 477 Streptomyces coelicolor A3(2). J Bacteriol 181:204-211. 478
479 37. Palmer, T., and B.C. Berks. 2012. The twin-arginine translocation (Tat) protein export 480
pathway. Nature Rev Microbiol 10:483-96. 481 482 38. Palmer, T. and M.I. Hutchings. 2010. Protein secretion in Streptomyces, p. 87-104. In P. J. 483
Dyson (ed.), Streptomyces molecular biology and biotechnology. Horizon Press. 484 485 39. Ruban-Osmialowska, B., D. Jakimowicz, A. Smulczyk-Krawczyszyn, K. F. Chater, and 486
J. Zakrzewska-Czerwinska. 2006. Replisome localization in vegetative and aerial hyphae 487 of Streptomyces coelicolor. J Bacteriol 188:7311-7316. 488
489 40. Sargent, F., E. G. Bogsch, N. R. Stanley, M. Wexler, C. Robinson, B. C. Berks, and T. 490
Palmer. 1998. Overlapping functions of components of a bacterial Sec-independent protein 491 export pathway. Embo J 17:3640-3650. 492
493 41. Sargent, F., U. Gohlke, E. De Leeuw, N. R. Stanley, T. Palmer, H. R. Saibil, and B. C. 494
Berks. 2001. Purified components of the Escherichia coli Tat protein transport system form 495 a double-layered ring structure. Eur J Biochem 268:3361-3367. 496
497 42. Sargent, F., N. R. Stanley, B. C. Berks, and T. Palmer. 1999. Sec-independent protein 498
translocation in Escherichia coli. A distinct and pivotal role for the TatB protein. J Biol Chem 499 274:36073-36082. 500
501 43. Schaerlaekens, K., M. Schierova, E. Lammertyn, N. Geukens, J. Anne, and L. Van 502
Mellaert. 2001. Twin-arginine translocation pathway in Streptomyces lividans. J Bacteriol 503 183:6727-6732. 504
505
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
17
44. Schaerlaekens, K., L. Van Mellaert, E. Lammertyn, N. Geukens, and J. Anne. 2004. The 506 importance of the Tat-dependent protein secretion pathway in Streptomyces as revealed by 507 phenotypic changes in tat deletion mutants and genome analysis. Microbiology 150:21-31. 508
509 45. Sun, J., G. H. Kelemen, J. M. Fernandez-Abalos, and M. J. Bibb. 1999. Green fluorescent 510
protein as a reporter for spatial and temporal gene expression in Streptomyces coelicolor 511 A3(2). Microbiology 145:2221-2227. 512
513 46. Tarry, M. J., E. Schafer, S. Chen, G. Buchanan, N. P. Greene, S. M. Lea, T. Palmer, H. R. 514
Saibil, and B. C. Berks. 2009. Structural analysis of substrate binding by the TatBC 515 component of the twin-arginine protein transport system. Proc Natl Acad Sci U S A 516 106:13284-13289. 517
518 47. Thompson, B. J., D. A. Widdick, M. G. Hicks, G. Chandra, I. C. Sutcliffe, T. Palmer, and 519
M. I. Hutchings. 2010. Investigating lipoprotein biogenesis and function in the model Gram-520 positive bacterium Streptomyces coelicolor. Mol Microbiol. 77:943-955. 521
522 48. Thompson, S. R., G. H. Wadhams, and J. P. Armitage. 2006. The positioning of 523
cytoplasmic protein clusters in bacteria. Proc Natl Acad Sci U S A 103:8209-8214. 524 525 49. van Wezel, G. P., P. Krabben, B. A. Traag, B. J. Keijser, R. Kerste, E. Vijgenboom, J. J. 526
Heijnen, and B. Kraal. 2006. Unlocking Streptomyces spp. for use as sustainable industrial 527 production platforms by morphological engineering. Appl Environ Microbiol 72:5283-5288. 528
529 50. Weiner, J. H., P. T. Bilous, G. M. Shaw, S. P. Lubitz, L. Frost, G. H. Thomas, J. A. Cole, 530
and R. J. Turner. 1998. A novel and ubiquitous system for membrane targeting and 531 secretion of cofactor-containing proteins. Cell 93:93-101. 532
533 51. Widdick, D. A., K. Dilks, G. Chandra, A. Bottrill, M. Naldrett, M. Pohlschroder, and T. 534
Palmer. 2006. The twin-arginine translocation pathway is a major route of protein export in 535 Streptomyces coelicolor. Proc Natl Acad Sci U S A 103:17927-17932. 536
537 52. Widdick, D. A., R. T. Eijlander, J. M. van Dijl, O. P. Kuipers, and T. Palmer. 2008. A 538
facile reporter system for the experimental identification of twin-arginine translocation (Tat) 539 signal peptides from all kingdoms of life. J Mol Biol 375:595-603. 540
541 53. Widdick, D. A., M. G. Hicks, B. J. Thompson, A. Tschumi, G. Chandra, I. C. Sutcliffe, J. 542
K. Brulle, P. Sander, T. Palmer, and M. I. Hutchings. 2011. Dissecting the complete 543 lipoprotein biogenesis pathway in Streptomyces scabies. Mol Microbiol 80:1395-1412. 544
545 54. Willemse, J., J. W. Borst, E. de Waal, T. Bisseling, and G. P. van Wezel. 2011. Positive 546
control of cell division: FtsZ is recruited by SsgB during sporulation of Streptomyces. Genes 547 Dev 25:89-99. 548
549 55. Willemse, J., and G. P. van Wezel. 2009. Imaging of Streptomyces coelicolor A3(2) with 550
Reduced Autofluorescence Reveals a Novel Stage of FtsZ Localization. PLoS ONE 551 4:e4242. 552
553 56. Yahr, T. L., and W. T. Wickner. 2001. Functional reconstitution of bacterial Tat translocation 554
in vitro. Embo J 20:2472-2479. 555 556
557
558
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
18
FIGURE LEGENDS 559
FIG 1. Fusions of eGFP to the TatA, TatB and TatC proteins of S. coelicolor are stable and do not 560
abolish Tat transport activity. A, B. Semi-quantitative analysis of extracellular agarase activity 561
mediated by S. coelicolor strains. The indicated strains were cultured on MM medium for 5 days at 562
30oC after which they were stained with lugol solution. In A. zones of clearing around colonies after 563
lugol staining are shown, whilst in B. relative agarase activity was estimated as described previously 564
(51). The error bars represent the standard error of the mean, n = 6 - 9. C, D. S. coelicolor strains 565
M145, TP6 (M145 ΔtatB φC31 tatBp-tatBstop-eGFP), BRO1 (M145 tatA::tatA-eGFP), TP7 (M145 566
ΔtatB φC31 tatBp-tatB-eGFP) and BRO2 (M145 tatC::tatC-eGFP), were cultured aerobically for 24 hr 567
at 30°C in a 1:1 mix of TSB:YEME media. C. Cell extracts (formed by sonication of hyphal 568
suspension) and D. subcellular fractions fractionated from extract (E) into cytoplasmic (C) and 569
membrane (M) fractions were separated by SDS PAGE (12% acrylamide; samples were not boiled 570
prior to separation) and fluorescent proteins analysed by phosphorimaging. 20 μg of total protein 571
was loaded in each lane. 572
573
FIG 2. Localization of TatB-eGFP in S. coelicolor during growth and development analyzed by 574
fluorescence microscopy. Representative images of strain TP7 at each lifecycle stage are shown. 575
The fluorescence images were all collected with a 400ms exposure time except for those indicated 576
with asterisks which were collected at 600ms exposure. The scale bar is 2 μM. 577
578
FIG 3. Localization of TatC-eGFP during growth and development of S. coelicolor. Representative 579
images are shown. Images of germinating spores (after 6 - 8h germination) of S. coelicolor strain 580
BRO2. Representative images of strain BRO4 at other lifecycle stages are shown. Fluorescence 581
images were collected with a 600ms exposure time for germinating spores and 5 seconds for other 582
stages, the scale bar is 2 μM. 583
584
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
19
FIG 4. Localization of TatA-eGFP during growth and development of S. coelicolor. Representative 585
images of strain BRO1 at each lifecycle stage are shown. All fluorescence images were all collected 586
with a 600 ms exposure time, the scale bar is 2 μM. 587
588
FIG 5. Dynamic localization of TatA-eGFP (BRO3), TatB-eGFP (BRO8), and TatC-eGFP (BRO4) at 589
the tips of germinating spores. Images were taken from supplemental movies SV5, SV1 and SV3, 590
respectively, and represent 4 minute time intervals. Images were collected using a Zeiss Observer 591
with a Hamamatsu EM-CCD C9100-02. Exposure times were 100 ms for TatA and TatB and 500 592
ms for TatC movies. For all constructs setting min/max intensity was used to show similar 593
fluorescence intensity. The scale bar is 2 μM. 594
595
FIG 6. Dynamic localization of TatA-eGFP, TatB-eGFP, and TatC-eGFP in vegetative hyphae. 596
Images were taken from supplemental movies SV6, SV2 and SV4, respectively, and represent 4 597
minute time intervals. Strains and image settings are the same as for Fig 5. The scale bar is 2 μM. 598
599
FIG 7. Co-localization of: A. TatA-eGFP and TatB-mCherry (strain BRO5); B. TatA-eGFP and TatC-600
mCherry (strain BRO7); and C. TatB-mCherry and TatC-eGFP (strain BRO6), in each case in 601
vegetative hyphae of S. coelicolor FM145. The white arrows indicate co-localizing foci. Images were 602
acquired using an Axioscope A1 and Mrc5 camera with 2 second (for eGFP) and 10 second 603
exposure times (for mCherry). The scale bar is 2 μM. 604
605
606
607
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
20
Escherichia coli Source/reference
DH5α DH5α F-, Φ80dlacZΔM15, recA1, endA1, gyrA96,
thi-1, hsdR17, (rk-,mk+), supE44, relA1, deoR,
Δ(lacZYA-argF)U169
Laboratory stock
BW25113/pIJ790 K-12 derivative; ΔaraBAD ΔrhaBAD/λ-Red(gam
bet exo) cat araC rep101(Ts)
(19)
ET12567/pUZ8002 dam-13::Tn9 dcm cat tet hsdM hsdR zjj-
201::Tn10/tra neo RP4
(36)
Streptomyces coelicolor
M145 SCP1-, SCP2- (2)
FM145 Derivative of M145 with reduced autofluorescence (55)
TP5 M145 ΔtatB (51)
TP6 TP5 harboring pTDW134 This work
TP7 TP5 harboring pTDW135 This work
BRO1 M145, tatA::tatA-eGFP aac3(IV)-oriT This work
BRO2 M145, tatC::tatC-eGFP aac3(IV)-oriT This work
BRO3 FM145, tatA::tatA-eGFP aac3(IV)-oriT This work
BRO4 FM145, tatC::tatC-eGFP aac3(IV)-oriT This work
BRO5 BRO3 harboring pTDW136 This work
BRO6 BRO4 harboring pTDW136 This work
BRO7 BRO3 harboring pTDW137 This work
BRO8 FM145 harboring pTDW135 This work
PLASMIDS
pTDW134 pIJ8660 tatBp-tatBstop-eGFP This work
pTDW135 pIJ8660 tatBp-tatB-eGFP This work
pTDW136 pIJ6902 tatB-mCherry This work
pTDW137 pIJ6902 tatC-mCherry This work
Table 1. Strains and plasmids used in this study. 608
609
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
21
TatC-eGFP
Time
% tips with foci
(vegetative
hyphae)
% tips with foci
(aerial hyphae and
spore chains)
% tips with foci
(vegetative hyphae)
% tips with foci
(aerial hyphae and
spore chains)
% tips with foci
(vegetative
hyphae)
6-8 h 87%
(65/75)
- 100%
(52/52) -
98%
(163/166)
12 h 52%
(68/131)
- 56%
(368/645) -
24 h 55%
(165/300)
- 44%
(497/1124) -
44 h 41%
(192/467)
* 24%
(498/2093)
65%
(33/51)
72 h 32%
(84/259)
53%
(26/49)
22%
(316/1452)
41%
(32/79)
Table 2. Frequency of occurrence of fluorescent foci at the hyphal tips of S. coelicolor producing 610
each of the Tat protein-eGFP fusions. 611
* almost no aerial hyphae could be detected at 44h for this strain. 612
613
614
615
TatA-eGFP TatB-eGFP
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
M145 (WT)
TP5(∆tatB)
A
100
120
145)
B
BRO1(tatA-eGFP)
TP7(tatB-eGFP)
BRO2(tatC-eGFP)
60
80
aras
e ac
tivity
ase
activ
ity fr
om M
1
( )
0
20
40Ag
(% o
f aga
ra
C
TatC-eGFP
TatB-eGFP
eGFP
TatA-eGFP
75
50
372520
D BRO1
E C M E C M E C M E C M
TP7TP6
TatC-eGFP
TatB-eGFPT tA GFP
75
50
BRO2D
eGFPTatA-eGFP37
2520
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
*
*Pre-spore/spore
chains *40-72h
SporesAerial hyphae
*
*Germinatedspores
12-24h
18-40h
6-8h
Substrate hyphae* Vegetative
hyphae
Fig 2
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
40 72hPre-spore/spore
chains
40-72h
SporesAerial hyphae
Germinatedspores
18-40h
6-8h
Substrate hyphae12-24h
Vegetative hyphae
Fig 3
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
40-72h
Germinatedspores
12-24h
18-40h 6-8h
VegetativeVegetative hyphae
Fig 4
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
t=0 4 8 12 16
TatA
TatB
TatC
Fig 5
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from
t=0 4 8 12 16 20
TatA
TatB
TatC
Fig 6
on August 21, 2020 by guest
http://jb.asm.org/
Dow
nloaded from