Upload
levvis-aicrag
View
220
Download
0
Embed Size (px)
Citation preview
7/30/2019 On the Evolutionary Origins of the Cacti
1/17
On the Evolutionary Origins of the Cacti
Author(s): Mark A. Hershkovitz and Elizabeth A. ZimmerReviewed work(s):Source: Taxon, Vol. 46, No. 2 (May, 1997), pp. 217-232Published by: International Association for Plant Taxonomy (IAPT)Stable URL: http://www.jstor.org/stable/1224092 .
Accessed: 02/12/2012 11:34
Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at .http://www.jstor.org/page/info/about/policies/terms.jsp
.JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of
content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms
of scholarship. For more information about JSTOR, please contact [email protected].
.
International Association for Plant Taxonomy (IAPT) is collaborating with JSTOR to digitize, preserve and
extend access to Taxon.
http://www.jstor.org
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/action/showPublisher?publisherCode=iapthttp://www.jstor.org/stable/1224092?origin=JSTOR-pdfhttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/stable/1224092?origin=JSTOR-pdfhttp://www.jstor.org/action/showPublisher?publisherCode=iapt7/30/2019 On the Evolutionary Origins of the Cacti
2/17
TAXON 46 - MAY 1997
On the evolutionaryoriginsof the cactiMarkA. Hershkovitz1l2 ElizabethA. Zimmer2
SummaryHershkovitz,M. A. & Zimmer, E. A.: On the evolutionaryorigins of the cacti. - Taxon 46:217-232. 1997.- ISSN 0040-0262.Understandingvolutionaryresponsesof plantsto desertenvironmentsdependsuponphylogeneticknowledgeof desertplants.The diverse AmericandesertfamilyCactaceae has been presumed,onthe basis of distinctiveness,to be phylogeneticallyisolatedand relatively ancient(> 65 millionyears old). Using maximum likelihood and parsimonyanalysesof the rapidlyevolving internaltranscribed pacer(ITS) sequencesof nuclear ribosomal DNA (nrDNA),we show that the cactiarephylogeneticallynestedamongotheraridity-adaptedineagesof the angiosperm amily Portu-lacaceae. The ITS divergencebetweenpereskioidcacti and the genus Talinum Portulacaceae) isless than thatbetweenmanyPortulacaceae genera. Synthesisof the ITS datawith morphologicalandchloroplastDNA evidencesuggestsan originof cacti in mid-Tertiary, . 30 million years ago,and a laterTertiarydiversificationcoincidentwith developmentof the American desert.This, inturn,implies that the diversificationratein cacti was much higherthanin their nearest relatives.The presentresults illustrate the central role of phylogeneticreconstruction n ecological andevolutionary heory.
IntroductionWithapproximately 500 speciesin c. 100 generaandthreesubfamilies,Cacta-ceae representone of the most conspicuousand diverseangiosperm amilies ofwarm,aridAmerica Cronquist, 981;A. C. Gibson& Nobel, 1986;Mauseth,1990;Barthlott& Hunt, 1993; Rzedowski, 1993). Cactusdiversityis most obvious invegetative habit, which encompasses eafy shrubsand trees, columnars,barrels,pricklypears,Christmas acti,and elaborations f photosynthetictems into formsresemblingpalmfrondsandagave plants.Cacti arealso diversechemicallyandintheirarrayof pollination yndromesA. C. Gibson&Nobel, 1986;Barthlott& Hunt,1993).Thisdiversityposesseveralbiologicalquestions,ncludinghe time of originand diversification ate. Cactussuccess in arid environments lso invitesinvestiga-tion into ecologicalstimuli and their effects on adaptiveresponsesand speciation.We considerherethe most fundamental uestion,phylogeneticoriginsof cacti andtheimplications n cactusdiversification.Cactaceaeare membersof the unequivocallymonophyletic rderCaryophyllales(Bittrich, 1993; Cronquist& Thome, 1994), which includes 12-18 traditionalfamiliescomprising . 10,000species. Caryophyllales re characterizedy distinc-tive floral,vegetative,embryological, hemical,andphysiological raitscommonlyto universallypresentwithin the order,and rare or absentin otherangiosperms(Cronquist, 981;Bittrich,1993).Mostnotableamong hesetraits s thereplacement,in mostCaryophyllales,f the flavonoid-derivednthocyanins ithtyrosine-derived
National Center for BiotechnologyInformation Genbank),National Libraryof Medicine, Bldg. 38A, Na-tional Institutesof Health,8600 RockvillePike, Bethesda,MD 20894, U.S.A.2 Laboratory f MolecularSystematics,MuseumSupportCenter,MRC534,Smithsonian nstitution,Washing-ton, DC 20560, U.S.A.
217
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
3/17
TAXON 46 - MAY 1997
betalainpigments,whichdo notoccur n anyotherplants.AlthoughCaryophyllalesare distributed orld-wide n allkindsof terrestrialabitats ndfeature ssentiallyallangiospermife forms,they areespeciallydiverse n aridenvironmentsCronquist,1981).In addition o cacti,the order ncludesAizoaceae,especiallydiverse in Afri-can deserts,and Chenopodiaceae,"themost important amily of the desertflora[world-wide]"Shmida,1985).Opinionshave variedwidely regardingphylogenyof Caryophyllales,ncludingthepositionof cacti therein Takhtajan,980;Cronquist, 981;Rodman& al., 1984;A. C. Gibson & Nobel, 1986; Hershkovitz,1989; Rodman, 1990, 1994; Thorne,1992; Bittrich, 1993; Barthlott& Hunt, 1993; Cronquist& Thorne,1994; A. C.Gibson, 1994;Leins & Erbar,1994;Turner,1994;Clement& Mabry,1996). Thebasalpositionof subfamilyPereskioideaeamongcacti,however, s well evidenced(A. C. Gibson& Nobel, 1986;Leuenberger, 986;Barthlott& Hunt,1993).Exceptforthepresenceof typicalcactus horns, lowers,andareoles pubescenthort-shootswherethornsarise),some Pereskiaspecies appear s ordinary icotyledonouswoodyplants.Analysesof ribulosebisphophate arboxylase argesubunit rbcL)DNA se-quencesandchloroplastDNA (cpDNA)restrictionragmentengthpolymorphisms(RFLPs)corroboratemorphological vidence for the basalpositionof pereskioidsamongcacti(Wallace,1995).Although here are no relevant ossils (Barthlott& Hunt,1993),cactihave beenascribedanoriginduringhe lateCretaceous, erhaps 5-90millionyearsago(mya),immediately ollowingthe break-up f GondwanaAxelrod,1979; Shmida, 1985;Mauseth,1990).Therelativeantiquity f cactiamongotherdesertangiosperms asbeen presumedon the groundsof both their distinctiveness nd the degreeof taxo-nomic isolationpresumedo be impliedby theirfamily-level or sometimesorder-level) classificatoryank Axelrod,1979;Shmida,1985).Inaddition,Axelrod 1979)argued hat the antiquity f cacti(amongotherdesert axa)was evidencedby theiroccurrencen non-desertvegetation hought o have geologicallyprecededmodernAmericandeserts.Nonetheless,the relativerecencyof modernAmericandeserts,hence much of moderncactushabitats, s widely acknowledged Axelrod, 1979;Mauseth,1990).Thepresentpaper ocuseson evidenceof cactusoriginsrevealedby phylogeneticanalysesof Portulacaceae Carolin,1987;Hershkovitz,1993), which have some-timesbeenregarded s closely allied withthe familiesCactaceae,Basellaceae,andDidiereaceae Luitolf, 969;A. C. Gibson& Nobel, 1986;Hershkovitz, 991, 1993;Bittrich,1993;Manhart& Rettig,1994;Rodman,1994).Portulacaceaenclude400-450 mostlyfleshy-leaved peciesdistributed ainly n the Americas, outhernAfrica,andAustraliaCarolin,1993).Cladisticnterpretationf morphologicalharacters fPortulacaceaehadsuggestedrelationshipsncongruentwith most of the traditionalsupraspecificaxonboundariesCarolin,1987;Hershkovitz, 993).Coincidentally,tpartitionedhetaxa intoa "westernAmerican" roupdistributed rimarilyrom theAmerican ordillerawestward, ndan "easternAmerican/African"roup,distributedprimarily rom the Americancordilleraeastwardand in Africa.The eastern andwesterngroupsmightbe aptlycharacterized s adapted o warm/arid ndmediter-ranean/alpinelimaticconditions, espectively.The Portulacaceae analysis also indicated that the families Cactaceae, Basella-ceae, Didiereaceae (collectively, the portulacaceousalliance or portulacaceousfamilies) were relatedto, specifically,membersof the easternAmerican/African
218
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
4/17
TAXON 46 - MAY 1997
Portulacaceae,with whichthey share wo leaf traitsandcopious mucilageproduc-tion(Hershkovitz, 993).Inaddition,henodalpubescence ypicalof cacti is similarto thatof eastern axacharacterizedy a chromosomebase number = 9. Pereskiaspecies(andothercacti)differfromotherportulacaceousaxabythe combination ftheirwoodierhabit, horns,numerousepal (sepalsandpetals, ntergradingn cacti)whorls, specializedovary, and chromosomebase numberx = 11. The same, orsimilar,traitsoccur in otherportulacaceousaxa, but only one or two in a givenspecies(Hershkovitz, 993).Analysesof interfamilialelationshipsn Caryophyllales singrbcL(Manhart&Rettig, 1994)and RFLPsof the cpDNAinverted epeat Downie& Palmer,1994),bothregarded s conservative hylogeneticmarkers, ieldedequivocalresultson themonophylyof the few includedrepresentativesf the portulacaceouslliance.Bothanalyses,however,includedsamplesfromPereskiaandPortulaca,and these ap-pearedas sister-taxan thecladograms.Taxonsamplingn thesemolecularanalysessuggeststhat familialcircumscriptionsn the Caryophyllaleswere assumed o de-limitphylogeneticallyndependent ndsubstantially ivergentanalyticalunits. Thevalidityof thisassumption asneverbeensupported y phylogenetic vidence,butithad been taken for granted n manyinvestigations f familialrelationships mongCaryophyllales,ncluding ladisticones(Hershkovitz, 989).Morphological nalysisof relationships mongPortulacaceae Hershkovitz, 993)suggested hat hisfamilywas not phylogenetically distinct from Cactaceae, Basellaceae or Didiereaceae. Inotherwords,while thesetaxa aretraditionally ecognizedas families,ananalysisoftheirrelationshipshouldbe conceptuallynvisionedas an infrafamilialhylogeneticproblem.We therefore hose to explore heserelationshipssinga relatively apidlyevolvingmolecularmarker,he two internal ranscribedpacersequences ITS1 andITS2)separatinghe threecodingregions(18s, 5.8s, and26s) of the nuclearriboso-malDNA (nrDNA;Baldwin&al., 1995).Materials and methods
DNA isolation. - Total genomicDNA from fresh, frozen(>70?C), or, rarely,silica gel-dried tissue of species of Portulacaceae, Basellaceae, Didiereaceae, Cac-taceae,andselectedotherCaryophyllales as isolatedusinga CTABprotocol Mil-ligan, 1992), with the amount of tissue, concentrations of CTAB, NaCl, EDTA, andnumberof reprecipitationteps adjustedn various axato improveyield andPCRamplification. hesourcesof plantmaterial re isted nTable 1.Insomecases,plantfragmentswere receivedfrom collectorswho were unable o providevoucherspe-cimens. The identityof these as well as of voucheredmaterialwas verified onmorphological asesbythe firstauthor.Data orunvoucheredmaterialwereincludedin the analysisbecausethey help documentportulacaceous rDNA-ITS equencediversityand behavedin the phylogeneticanalysis as predictedon the basis ofmorphologicalvidence.
Phemeranthus nd the Australian alandrinias re here regardedas genericallydistinctfrom,respectively,Talinumand Calandrinia Carolin,1987; Hershkovitz,1993). Nomenclatural ombinationsor the Phemeranthuspecies included n thisanalysisareprovidednfootnotes o Table 1.PCR amplification, cloning, and DNA sequencing. - The ITS regions were ampli-fied usingthe primerpairs: 1) ITS4(Baldwin, 1992)and ITS5 modifiedfor plants
219
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
5/17
TAXON 46 - MAY 1997
Table 1. Sources of plant materials and sequence accession numbers. The listbelow includes livingcollection accession numbers, vouchers, and other specimendocumentation. The identityof all plantmaterialswas determined by the firstauthor.New combinations in Phemeranthus are validated in footnotes.TaxonAlluaudia umosa DrakeAlluaudia roceraDrakeAmaranthus etroflexusL.AnacampserosaustralianaJ. M.BlackAnacampseroskurtziiBacig.AnacampserosquinariaE. Meyerex FenzlAnacampserosrecurvataubsp.buderiana Poelln.)GerbauletAnacampserossp. 1
Anacampserossp. 2 (? Ana-campseros)Anacampseros p. 3 (? Ana-campseros)Anredera ordifoliaTen.)SteenisBasella albaL.Basella excavata Scott-ElliotBougainvilleapectabilisWilld.'Camarillo estival'CalandriniaffinisGilliesex Am.CalandriniailiataDC.CalandriniatychospermaF. Muell.4CerariaongipedunculataMerxm.&PodlechCerarianamaquensisPearson&StephensCerariapygmaea PillansChenopodiumlbumL.CistanthedensifloraBarneoud)HershkovitzCistanthequadripetalaS. Watson)HershkovitzCistanthe p. (? Cistanthe;CalandriniamucronulataMeyen.)Cistanthe p. (? Philippiamra(Philippi)Hershkovitz)
Source1/voucher nformation2UCDBCB67.568,Mar1997, Stone(DAV)UCDBCB59.147,unvoucheredSep 1993, HershkovitzUS)unvouchered,ragment eceived romFerguson,incultivationyfirstauthorZSS 92-1903, Kirschnek 203 (ZSS)UCDBCB90.315, unvouchered3UCDBCB81.171, Mar1997, Stone(DAV)UCDBC 0-1239, unvouchered,ragmentreceived romHogan Argentina,Prov.Jujuy,Hogan3669UCBG95-0913;unvouchered,ragmentreceived romHogan SouthAfrica,CapeProv.,Hogan4265bunvouchered,ragment eceived romFerguson,reportedly riginatingn SouthAfricaMar1997, Stone (DAV)3UCDBCB86.4873ZSS, 5 Nov1992, Roosli(ZSS)UCDBCB81.998;Mar1997, Stone(DAV)14 Oct1992, HershkovitzUS)1993, HershkovitzUS)cultivated romseed, ex West4244 (CANB)ZSS 90-1396;Mar1987, Lavranos&Bleck(ZSS)UCBG95-0919, unvouchered,ragmentreceived romHogan- SouthAfrica,CapeProv.,Hogan4353ZSS 89-2123;Lavranos&Bleck27238 (ZSS)Sep 1993, HershkovitzUS)22 Nov1987, Peralta&Kiesling MERL)1993, HershkovitzUS)cultivated rom eed, ex Ford12230(MO)cultivated rom eed, ex Ford746 (MO)
SequenceaccessionL78011L78084L78085L78013
L78063L78012L78014L78059
L78016
L78015L78086L78018L78019L78087L78020L78021L78050L78022L78023
L78044L78088L78025L78062L78026L78024
220
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
6/17
TAXON 46 - MAY 1997
Table 1 (continued).TaxonCistanthe weedyi A. Gray)HershkovitzClaytoniamegarhiza A.Gray)Parryex S. WatsonGrahamia racteataGilliesexHookerGypsophila legans M.Bieb.LewisiacanteloviiJ. T. HowellLewisiaredivivaPurshMaihuenia atagonicaBritton&RoseMaihuenia oeppigii Ottoex Pfeif-fer)F. A. C. Weberex SchumannMirabilisjalapa.Mollugoverticillata .Montia arvifolia Moc.)E. GreeneMontiopsis ayana (Barneoud)D. I.FordMontiopsisumbellataRuiz&Pavon)D. I.FordPereskia aculeata MillerPereskiagrandifoliaHaw.
PereskiopsisporteriBritton& RosePhemeranthusbrevifoliusTorr.)Hershkovitz5Phemeranthus onfertiflorus(E. Greene)Hershkovitz6PhytolaccaamericanaL.Phemeranthus pinescens (Torr.)Hershkovitz7PortulacamolokiniensisHobdyPortulacaacobsenianaRowley
Source'/voucher nformation2UCBG89-1408, unvouchered,ragmentreceived romHogan U.S.A.,Washington,KittitasCo., Hogan1173HershkovitzUS)27 Nov1992, Peralta&HershkovitzUS)HershkovitzUS)UCBG89-1364, unvouchered,ragmentreceived romHogan U.S.A., California,PlumasCo., Hogan1047HershkovitzDAV)3UCBG89-1472, unvouchered,ragmentreceived romHogan Argentina,Prov.Chubut,Hogan3935UCBG89-1429, unvouchered,ragmentreceived romHogan Argentina,Prov.Neuquen,Hogan3886Sep 1994, HershkovitzWS)Sep 1993, HershkovitzWS)Hershkovitzphoto,US)3cultivated rom eed, ex Ford424b (MO)cultivated rom eed, ex Ford12535 (MO)UCDBCB59.064, Mar1997, Stone(DAV)unvouchered,U.S.A.,California, oloCo.,campusof Universityf California,Davis,Hershkovitz3ZSS 92-1623, Eggli&Nyffeler 005 (ZSS)UCBG89-1418, unvouchered,ragmentreceivedfromHogan U.S.A.,Arizona,CoconinoCo., 5 Sep 1988,ZadnikUCBG90-1500, unvouchered, ragmentreceived romHogan- U.S.A.,NewMexico,HidalgoCo., Ferguson1081Sep 1993,HershkovitzWS)UCBG89-1406, unvouchered,ragmentreceived romHogan- U.S.A.,Washington,GrantCo., Hogan1170ZSS 92-1793, Wong ZSS)UCBG90-0986, unvouchered,ragmentreceived romHogan Argentina, an JuanProvince,Hogan3508Sep 1993, HershkovitzUS)
SequenceaccessionL78089
L78027L78028L78090L78029L78030L78031
L78091
L78092L78093L78034L78032L78033L78035L78036
L78037L78038
L78039
L78041L78040
L78046L78045
221
Portulaca oleracea L. L78047
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
7/17
TAXON 46 - MAY 1997
Table 1 (continued).Taxon Source'/voucher nformation2 SequenceaccessionPortulacaquadrifida .Portulaca p. (aff.P. quadrifida)PortulacariafraJacq.(variegatedform)Portulacaria rmianaVan Jaarsv.
Stellariamedia(L.)Vill.TalinariaalmeriBrandegeeTalinella oivinianaBaill.
ZSS 81-1227; 1981, Stunzi ZSS)ZSS 90-1917, 1986, Taylor ZSS)UCDBCB59.096,Mar1997, Stone(DAV)UCBG95-0922, unvouchered,ragmentreceived romHogan SouthAfrica,CapeProv.,Hogan4325.1cSep 1993,HershkovitzUS)unvouchered,ragment eceived romHoganRauh32242 (HEID)
Talinellap. (T.aff.grevei Danguy) 1989, Roosli &Rechberger ZSS)TalinopsisrutescensA. Gray unvouchered,ragment eceived romHoganMexico,Ferguson1372TalinumaffrumThunb.)Eckl.& ZSS 93-2096, 17 Mar1960, Bally ZSS)Zeyh.TalinumaniculatumJacq.)Gaertn. HershkovitzUS)Talinum araguayenseSpeg.Talinumortulacifoliumsch. exSchweinf.TetragoniaetragonioidesPallas)Kuntze
cultivated rom eed, ex Zardini 636 (MO)ZSS 89-2123, Lavranos ZSS)Sep 1994, HershkovitzWS)
Xeniavulcanensis Anon)Gerbaulet ZSS 90-4035, Leuenberger 534 (ZSS)
L78048L78049L78042L78043
L78051L78052L78053L78054L78058L78055L78094L78056L78057L78095L78060
Hogan: S. B. Hogan,horticulturist ndplantexplorer,Universityof CaliforniaBotanicalGarden,Berkeley,CA 94720, U.S.A.; Ferguson:D. Ferguson,horticulturist nd plantexplorer,Mesa Gardens,P.O. Box 72,Belen, NM 87002, U.S.A.2 The following abbreviationsare used (in addition to standardherbariumacronyms):UCBG, UniversityofCaliforniaBotanicalGarden,Berkeley,CA 94720, U.S.A.; UCDBC, BotanicalConservatory,Department fPlant Biology, Universityof California,Davis CA 95616, U.S.A.; ZSS, Gartenbauamt er Stadt Zurich,StadtischeSukkulenten-Sammlung,Mythenquai88, CH-8002Zurich,Switzerland.3 Spirit-preservedmaterial s present n the collectionof the firstauthor.4 Morphologicalanalysis(Carolin,1987;Hershkovitz,1993) indicatesthat the Australian pecies classified inCalandrinia s.l. are not closely relatedto this genus andare best segregated.Carolin(1987, 1993) proposedthat RumicastrumUlbrich,describedas a genus of Chenopodiaceae,was the oldest availablename for theAustralian alandrinias.Wilson(1984) also commented hat this genus apparently elongedto Portulacaceae.NeitherCarolinnor Wilson commentedon the synonymybetweenthe type, R. chamaecladum Diels) Ulbr.(syn.AtriplexchamaecladaDiels) andany speciesof Portulacaceae.According o W. GreuterandB. Zimmer(pers. comm., Feb 1997), a specimenfrom the type locality of A. chamaecladawhich fits Ulbrich's (admit-tedly non-portulacaceous)descriptionof Rumicastrumdoes not appearto be, if portulacaceousat all, anAustraliancalandrinia.Given this situation,the first authoragrees with Greuterand Zimmer's assessmentthat,pendingadditional esearch, t is unadvisable o recombineAustralian alandrinias nderRumicastrum.5 Phemeranthusbrevifolius(Torr.)Hershkovitz,comb. nov. = TalinumbrevifoliumTorr.in Sitgreaves,Rep.Exp.: 156. 1853.6 Phemeranthus confertiflorus(E. Greene)Hershkovitz,comb. nov. = TalinumconfertiflorumE. Greene inBull. TorreyBot. Club8: 121. 1881.7 Phemeranthus spinescens (Torrey) Hershkovitz,comb. nov. _ Talinum pinescensTorr.,U.S. Expl. Exp.17:250. 1874.
222
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
8/17
TAXON 6 - MAY 1997
(GGAAGGAGAAGTCGTAACAAGG);r (2) 26A (Suh & al., 1993) and Nncl8S10(bases 4-21 of the modified ITS5). Cloned or direct amplification products weresequenced in both directions using either manual or automated protocols. For themanual protocol, single-strandedDNA (both coding andnon-coding) was derived viaasymmetric amplification of 2 1l of crude double-stranded amplification productusing the ITS4 or N18L18 (AAGTCGTAACAAGGTTTC)rimer. 7-deaza-dGTPwassubstituted for dGTP in order to relax secondary structure in the single-strandedsequencing template. Asymmetric amplification productswere purified according tothe Gene Clean protocol (Bio 101, Inc.) and sequenced with the primersITS3 (Bald-win, 1992), C58S (Suh & al., 1993), ITS4, and N18L18, following the Sequenaseversion 2.0 protocol (U.S. Biochemical) for the 7-deaza-dGTP reagent kit and 35S-dATP labelling. Sequencing reactions were electrophoresedand the gels exposed toradiographic film according to standardprotocols. Automated sequencing used thesame primer set and followed the dye-terminatorcycle-sequencing protocol for theABI model 373A sequencer (Applied Biosystems, Inc.). Chromatogramswere ana-lysed using Sequencher (Gene Codes, Inc.). For apparentlyITS-polymorphic taxa,double-stranded amplification product was ligated and cloned following the T/Acloning protocol (Invitrogen, Inc.) and double-strandedproducts amplified directlyfrom recombinantcolonies were sequenced as described above.
The sequences analysed in this paper are available in the public databases (e.g.,GenBank) and have accession numbers L48800, L49495, L78011-L78060, L78062-L78095.Sequence analysis. - Sequences were aligned manually with the aid of the GDEversion 2.2 (Smith, 1994) multiple sequence editor. A data matrix of alignable sites(available from the first author upon request) was analysed using maximum likeli-hood (ML), maximum parsimony(MP), and minimum evolution (ME) algorithms inprereleasetest versions of PAUP* 4.0 (Swofford, 1997). Some sites were alignable inonly a subset of the taxa, with the remainderscored as missing. For MP analysis,aligned gaps were treated as a fifth characterstate, but were scored as such only onceper insertion/deletion (indel) per sequence, with the remaining gap positions scoredas missing. This procedurehas the same effect as treatingeach of the analysed indels,regardless of length, as a single independent character.MP trees were generatedusing the tree bisection-reconnection(TBR) swapping algorithm,with 100 trees heldduring each step of stepwise taxon addition. One thousandbootstrap replicates wereperformedwith 10 trees held at each step of randomtaxon addition,with MAXTREESset at 100. ML searches were performed with stepwise taxon addition and TBRswapping using a general time-reversible (GTR) base substitution model with
among-site rate heterogeneity (gamma rates). Relative substitution rates and thegamma rate shape parameter(a) were estimated from the data using an arbitrarilyselected MP tree. ML branch-lengthsand parameterestimates ignored missing data(gaps and ambiguities). ME searches were performedusing stepwise addition, TBRswapping,and log-det distances under the invariantsmodel (a fraction of constantsitesremoved proportionally o base frequenciesestimated from constantsites; Swofford &al., 1996) and GTR distances with gamma rates.Distance for missing data in pairwisecomparisonswas extrapolated rom the distance inferred from non-missing data. Be-cause ITS sequenceswere relativelyhomogeneousamongthe westernAmerican Portu-lacaceae, only threerepresentativeswere included n the phylogeneticanalysis.
223
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
9/17
TAXON 46 - MAY 1997
BASELLACEAE:
DIDIEREACEAEanacampseroids
westernAmericanaxaAustraliancalandrinia ....:::... ......:: iiii\ ,,,, , ,.,~~!':,.
Talinumcaffrum CACTACEAE
Portulaca
AIZOACEAETetragoniatetragonioides MOLLUGINACEAEMollugoverticillata
PHYTOLACCACEAEPhytolaccaamericana
CHENOPODIACEAEChenopodium, album
I.Bougain-M\ NAM/ villea AmMiilis spectabilis \ re
jalapai / Gypsophila Stellariaelegans mediaNYCTAGINACEAECARYOPHYLLACEAE
ANTHACEAElaranthustroflexus
Fig. 1. Clustal W guide tree (phenogram) for ITS sequences of Caryophyllales. The portula-caceous taxa, including Cactaceae, Basellaceae, and Didiereaceae, are clustered relative torepresentatives romother families. Shadedgroupingsarethe same as those delimited in Fig. 2.
224
k A JIAAn
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
10/17
TAXON 46 - MAY 1997
Becauseanalysesof alignedpositions gnores nformationn unalignable egions,alignabilityperse was examinedusingthe guidetree featureof CLUSTALW (T. J.Gibson & al., 1994).The guidetree,prescribed s a preliminary hylogeneticesti-mate for iterativemultiplesequence alignment, s a phenogrambased on optimalpairwisealignment cores.The distancesareinherently on-additive, nd correctionsfor distanceand variable ransformationates are not allowed.Nevertheless, hisprocedureoffers the advantage f estimating imilaritybetweenentirelength-vari-able sequences Hershkovitz& Zimmer,1996).Theguidetreeanalysis ncludedallof the taxa listed in Table 1. The data consistedof contiguousITS1 and ITS2sequencesseparated y a decamerof N's as placeholdersortheessentiallyuninfor-mative 5.8s sequence.Gap-opening/-extensionenaltiesof 9/0.1 were estimatedfrom gap frequenciesper sequence engthand gap lengthsin an alignmentof 40western American Portulacaceae.Results
PCRproducts romamplified TSregionsof abouthalf of thetotalsampled axaof Cactaceae, Basellaceae, Didiereaceae, and eastern American/AfricanPortulaca-ceae were sufficientlyheterogeneouso preventdirectsequencing.Sequencingofclonedamplificationproductsn these taxa revealed hatthe infragenomic ariantswere mainlyof two types:(1) obviouslydegenerate, on-functionalopies, as evi-dencedby numerous ndels and/orsubstitutionsn highly conservedITS and 5.8spositions Hershkovitz& Lewis, 1996;Hershkovitz& Zimmer,1996);and(2) trivialvariants ontainingone to a few indels and/or ubstitutionswhich,uponcomparisonacross axa,showedno usefulphylogenetic ignal.Sequencevariants f the firsttypewere not included n the analysis.For variantsof the secondtype, one variant, fpossiblethe leastdivergent romrelated axa,was selected for the analysis.In onesample,Anacampseros p. 2 (sect.Anacampseros),wo ITS variants ppearedo bedivergent romeach otheratpotentiallynformative ositions,yet sufficientlynormalas to be functional.Both of thesewere includedntheanalysis.PortulacaceousTSregionsequences including5.8s) arevariablen length(585-625 bp).Thealignment f all thesequences xpandedo 713 bp,because ndelsweresituated n differentpositions n different axa.Onlyabout60 % of these 713 basepositionsalignedin all taxa. Positionsnot alignableacross all taxa, however,arehighlyalignablewithintaxon subsets.Thus,the guide-treedemonstrateslusteringamong groupsof portulacaceousTS sequences,as well as clusteringof portulaca-ceous taxa amongCaryophyllalesFig. 1). Branch engths n Fig. 1 reflectoptimalpairwisesequencesimilarity.Becausethis calculationnumberof identitiesdividedby numberof bases)excludesgap positions,branch engthssuggest"divergences"among portulacaceousequencesas greatas among he non-portulacaceousample.Thereare no formal"robustness"riteria,but the strongest lustershave low diver-gencebothabsolutelyandrelative o the branch f the nexthigherorder.In all of the phylogeneticanalysesof thealignableportionsof the sequences, hecacti, including four from Pereskioideae and one (Pereskiopsis) from Opuntioideae(A. C. Gibson& Nobel, 1986;Barthlott& Hunt,1993;Wallace,1995), orma discretelineage emergingfrom a poorlyresolved bush. The trees could not be outgroup-rootedunambiguouslyasedon available TS or independente.g.,rbcL;Manhart&Rettig, 1994)evidence.
225
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
11/17
TAXON 46 - MAY 1997
-Alluaudia umosaAlluaudiarocera Dldlereaceae(11Ispp.)Portulacariafra7 PortulacariarmianaCeraria amaquensis9j Ceraria ygmaeajL Cerariaongipedunculata PCBDclade40 spp.
ITalinum affrum * 70
anacampserolds (37spp.)99 Anacampserosp. 1 U 76J~'. Anacampserosurtzii U 77Grahamia racteata U 74Xeniavulcanensis U 6699 TalinopsisrutescensTalinariaalmeri
7599Anacampserosp. 3Anacampserosp. 2BAnacampserosp. 2AA.recurvataBbuderiana98 75' Anacampseros uinariaAnacampserosustraliana100 PortulacaleraceaPortulacamolokiniensisPortulacaacobsenianaPortulacauadrifida99 Portulacaff.quadrifidax=9 cade
77 -annd
0 68o 77* 81* 79* 75* 73* 77V 74 IP
P
LTalinum paniculatum P 60Talinella ff.9reyei 0 62Talinella oivinianaI 0 64alinum ortulacifolium 0 60Talinumaraguayense 56Pereskiopsis orteri Cactaceae 0 54Pereskia grandiflora 1500 spp. 61Maihuenia patagonica I?D 62697 aihuenia poeppigii I607 Pereskia culeata 58
100 Phemeranthuspinescens PAWclade 0 62Phemeranthus brevifolius 200 spp. 0 637 Phemeranthusonfertiflorus 0 6295 IIIClnr iCalandrinia ptychosperma V 54istanthedensiflora U 5876 Cistantheweedyi western 0 56Montia arvifolia American taxa 0 48(125 spp.)E NorthAmerica* SouthAmericaV Australia* Hawaii
P PantropicalO Madagascar* Southern Africa
Basellaceae
63 o 780 78000
7173737171
4746505159
-LC~~~~~~~~~~~~~~~~~~
i
r .1 -I
-.11
N -
226
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
12/17
TAXON 46 - MAY 1997
Fig. 2 shows the midpoint-rootedML tree (-In likelihood = 4649.87), which wasderived using six reversiblerelativesubstitutionrateparameters A-C = 1; A-G = 2.4;A-T = 1.3;C-G= 0.8; C-T= 4.5; G-T= 1) and a gammarateshapeparametera = 0.42).These parameterswere rounded from likelihood estimates derived from a maximumparsimony (MP) tree. Fig. 2 also indicates branches recovered in > 50 % of 1000unweighted parsimonybootstrapreplicates.For the MP analysis, 209/582 aligned sites were informative;60/209 were scoredas gaps in at least two taxa; and 141/209 included at least one missing datapoint. The24 MP trees (not shown) had length (1)= 851, consistency index excluding autapo-morphies (CI) = 0.52; retention index (RI)= 0.73; and rescaled consistency index(RC) = 0.42. Under the ML model parametersabove, their -In likelihood values were4653.98-4664.58. Forcomparison,underparsimony, he ML treehas 1= 863, CI= 0.51,RI = 0.72, and RC = 0.41.The MP and ML trees were topologically similar and united cacti, most Talinumspecies, and the x = 9 portulacaceous taxa (Portulaca and the "anacampseroid"clade). In the MP strict consensus, Talinumcaffrum, cacti, and the remaining Tali-num species are successive outgroupsto the x = 9 clade. MP and ML both diagnosed"PAW" (Phemeranthus,Australiancalandrinias,western taxa) and "PCBD" (Portu-lacaria, Ceraria, Basellaceae, Didiereaceae) clades. The x = 9 and PCBD clades aresupported by morphology (Hershkovitz, 1993); their modest bootstrap supportderives in partfrom differential GC contents in Portulaca versus the anacampseroidsand the labile position of the Talinumcaffrumsequence, which is strikingly differentfrom other Talinumsequences (cf. Fig. 1).
The bootstrap analysis strongly supportsthe anacampseroidclade, but the presentwork does not adequately analyse relationships among these taxa. Aside from poorsampling among the African members (cf. Gerbaulet, 1992), considerable ITS poly-morphism was encountered in this group. Although infragenomic variants in all butone taxon appeared to be either degenerate copies or only trivially diverged, thepossibility remains that additional paralogs exist and/or that lineage sorting has oc-curred (cf. Baldwin & al., 1994). Nonetheless, the present data do seem to supportGerbaulet's segregation of the ArgentinianXenia vulcanensis from Anacampseros.Unfortunately, Gerbaulet did not analyse the Argentinian Anacampseros kurtzii noranotherpossibly distinct Argentinian anacampseroid(Anacampseros sp. 1 in Fig. 2).The present analysis does not show these as sister to Xenia vulcanensis, althoughthemarkedlydifferent GC contents might have caused spuriousbranchattractions.The ME trees (not shown) yielded the clades recovered by > 70 % MP bootstrapvalues, but the phylogenetic arrangements among some of these were inconsistentwith morphology (e.g., anacampseroids nested between Basellaceae and Didiere-
Fig. 2. Midpoint-rootedmaximum ikelihood(ML ) tree of ITS region sequencesfor 44portulacaceousaxa.The branches how all recoveries> 50 % from 1000unweightedparsi-mony bootstrapreplicates.The shaded and boxed groupingscircumscribe ineages thatincludeall but22 portulacaceouspecies (Talinum,Talinella,andthe unsampledCalyptro-theca, Amphipetalum,Hectorella, and Lyallia; the last two sometimes segregatedasHectorellaceae).Speciesnumbers reapproximatedBarthlott& Hunt, 1993;Carolin,1993;Hershkovitz, 993). Symbolsandnumbers o therightof the tree ndicate eographic istribu-tionsandpercentGC contentof aligned,parsimony-informativeites.
227
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
13/17
TAXON 46 - MAY 1997
aceae). Moreover,ME trees scoredpoorlyunderML and parsimony riteria -Inlikelihood= 4678.72 and4756.51, 1= 881 and895, for log-detandGTR,respec-tively). We attributehe spuriousresults o distancedistortion romheterogeneousevolutionary atesand (in the case of GTR)base compositions Swofford& al.,1996),both evident n Fig. 2. Nevertheless,he distancesbetweenPereskiaaculeataandTalinum aniculatumlog-det:0.11;GTR:0.05) are ess than hose betweenanyof the examinedTalinum pecies andany other examinedPortulacaceae log-det:0.13-0.32;GTR:0.06-0.19).The ITS data indicate hat the geneticdivergenceof CactaceaefromPortulaca-ceae is equal o or less than hatbetweenmanyPortulacaceae enera.Thisinterpre-tationfollows fromthe Fig. 2 divergencepattern, egardless f which cactusneigh-bouris the exact sister-group. urther esolutionof cactusoriginswill hingeuponanalysesof Portulacaceae at the specific and genericlevels. The ITS trees alsosuggestthatcactusdiversification as beengreater ndmorerapid han n anyof thewell-supported ortulacaceousineages.ThePAWclade(Fig.2), notlikelyto be theimmediate actussisterbasedon morphologicalvidence Hershkovitz, 993),is thenext most diverseclade,with c. 200 speciesdistributed mongninegeneraand 32subgenericaxa.Still,this clade includesonly c. 1/8 as many speciesas Cactaceae.Moreover,he western axa are all low-growingherbaceouspecies,c. 100 of whicharesufficientlysimilar o once have beenassigned o the singlegenusCalandrinia(Hershkovitz, 993).
Followingpresentationf the above resultsat the FifthInternational ongressofSystematicand EvolutionaryBiology in Budapest(Aug 1996), WernerGreuterkindlyalerted he first author o the existence of a thesis by Ltitolf(1969), whichconcluded hat Cactaceaewere especiallyclosely related o Portulaca.This workapparently as not been cited in any subsequent onsiderations f Caryophyllalesrelationships nd/or he phylogeneticpositionof cacti therein.Ltitolf(1969) exam-ined floral anatomy n Pereskia and 10 species of PortulacaceaerepresentinghegeneraPortulaca,Anacampseros,Talinum,Portulacaria, Lewisia, Calandrinia,Cistan-the,Montiopsis,and Lewisia. Ltitolfs conclusionscan be regarded s precociouslyaccurate iven opinionson cactusoriginsprevalent t that ime(see, e.g., Cronquist,1968). Nonetheless, he conclusion hat Portulaca s the cactussistergroupis notevidencedby the rDNAdataand conflictswithotherevidence hatPortulaca s thesistergroupof theanacampseroids. oreover,Ltitolfcompared ereskiaonlywithalarge-flowered ortulaca,P. grandiflora.The ITS datacorroborate eesink's 1969,1987)opinion hatthis and other arge-floweredpeciesalliedwithPortulacapilosa(representednthepresentdatabyP.jacobseniana)arederivedn thegenus,and hatthebasalspecieshadmuchsmaller lowers,as in P. quadrifidacf. Fig.2).Discussion
Previousspeculations Axelrod, 1979; Shmida,1985; A. C. Gibson & Nobel,1986;Mauseth,1990)have supposed hatcacti musthave evolvedbefore or at thebeginningof the Tertiaryperiod,immediately ollowingthe separationof SouthAmerica romAfrica.Thiswould account or the absenceof endemiccactiin Africaandthe presumedaxonomic solationof cactifrom otherCaryophyllalesAxelrod,1979;Shmida,1985),whilemaximizinghe timeallowedto achievemoderncactusdiversity.Synthesisof theITS withmorphologicalndcpDNAdatado notsupport
228
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
14/17
TAXON 46 - MAY 1997
presumedpre-Tertiaryr earlyTertiary actusorigin,at leaston the basis of taxo-nomic or phylogeneticisolation.Lackingdefinitivepalaeontological alibration,however, hemoleculardatado notprovidea clockfordating he cactusdivergence.A guide tree representingdiverse angiosperms Hershkovitz& Zimmer, 1996)showedslightlyhigherhomogeneityof portulacaceousllianceITS sequences hanin RosaceaesubfamilyMaloideae,some representativesf which are recorded nlate-middleEocene(c. 40 mya)andbasalOligocene c. 35 mya)deposits Axelrod&Raven, 1985).Likewise,portulacaceousllianceITS homogeneitywas comparableto thatapparentorAsteraceae, ribeLactuceae, irst recorded s suchin themiddleMiocene(c. 18mya;Cronquist, 981).RbcLevolutionaryatesestimatedorwoodyandherbaceous ngiospermpecies(Albert& al., 1994)woulddatethe Portulaca-Pereskiasplitat72-330mya(woodyrate)or 40-55mya(herbaceousate).The moreancientestimate s virtually nconceivable onsidering he fossil-basedestimateof90-130 myaforthe majorradiation f angiosperms s a whole(Crane& al., 1995).Both the portulacaceousTS and Caryophyllales bcL trees show branch engthasymmetry,however,whichindicates hattheevolutionaryateshave not been con-stant clocklike),so that hesequencedivergencesmightbe a misleading stimator ftemporaldivergence.The collectivephylogenetic videnceandpresenthabitatsof portulacaceousaxaseem to corroborateate Eoceneto MioceneCactaceaeoriginssuggestedabovebycomparisonsof angiosperm TS homogeneity,variableevolutionary atesnotwith-standing.The ITStree (Fig. 2) illustrates oincident adiations f plantsadapted oarid,mediterranean,nd alpineclimates(derivedcacti and the x = 9, PAW, andPCBDclades,excludingBasellaceae).Portulacaceousutgroups ndgeographic is-tributions ndecologicaladaptationsemainunknown, utthemoder habitats ccu-pied by the derivedportulacaceousaxa were formedduring he Miocene or later(Axelrod& Raven, 1978;Axelrod, 1979). Portulacaceousaxa as a whole have asuperficially"Gondwanan"istribution attern endemicgenera n SouthAmerica,southernAfrica,Madagascar,ndAustralia; ig. 2), whichmight suggesta pre-Ter-tiary origin.The low ITSdivergences crossnumerous 000-15000kmdisjunctions,however,suggeststhatmany,if not all, disjunctionsderive fromrelativelyrecentlong-distancedispersals.Morphologyprovidesadditional easonto assume recentanddistantdispersalamong closely related peciesof Talinum,Phemeranthus,ev-eralwesterngenera(Carolin,1993;Hershkovitz,1993),andprobablya substantialnumberof cacti(A. C. Gibson&Nobel, 1986;Barthlott& Hunt,1993).Thus,cactiandotherportulacaceousaxaprobablybelongto the categoryof desert axa whosepresent-day istributionsnddiversitycan be attributedo lateTertiary ndQuater-nary geoclimaticevents that formed modem arid habitats,providingunoccupiednichesfor the establishment f immigrants,ndharsh,unstable onditions hatpro-motedspeciation Axelrod,1979; Shmida,1985).Whileit is likelythatmuchearlierTertiary nvironmentsould have accommodatedmanycacti (especiallyPereskia),thereremainsno evidencethat these habitatswere so occupied.Finer-levelgeneticanalysisshouldhelpdeterminehe extent o which cactigrowing n semi- and non-desertvegetationrepresent he immediateantecedentsof forms betteradapted oaridity Axelrod,1979)or, rather,opportunistic escendants f plants hat had suc-cessfully conqueredess favourable eserthabitats.Pre-cladistic ccountsof evolutionary hytogeographyeliedon a presumed losecorrelationof traditionalaxonomicassignmentsand rankswith biotic divergence
229
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
15/17
TAXON 46 - MAY 1997
patternsand ages (Stevens, 1986). Cactaceae, an importantphytogeographicelementin American deserts, provide a hallmark example in which classificatory rank hasmisled phytogeographic interpretation. (Cactaceae and other traditional Caryo-phyllales families also provide an example of how emphasis on rank has misledattempts at explicitly cladistic reconstruction,e.g., Rodman & al., 1984, Rodman,1990; cf. Hershkovitz, 1989, 1991). Similar misinterpretationscould be avoided byadhering to a strictly cladistic criterion at all levels of hierarchical classification(Stevens, 1986; Queiroz & Gauthier, 1992; Panchen, 1992), but the challenge ofimplementing this criterion is underscoredby the universal acceptance of Portulaca-ceae and Cactaceae at familial rank,especially as phylogeny of intertwinedportula-caceous taxa remains unresolved, perhaps unrecoverablyso. Nevertheless, the pres-ent data illustrate the value of phylogenetic investigation for testing and advancinghypotheses of the vegetational history of deserts and other well-defined, often bioti-cally and physically well-characterized habitats.
AcknowledgementsWe are indebted o Dave Swofford or access to andpermissiono publishresultsusingpre-release ersionsof PAUP*4.0, andto theNIH-NationalCancerResearchnstitute, rede-rick,MD, for access to theircomputers nd GeneticsComputerGroup oftwareusedduringthe course of this project.We gratefullyacknowledgeE. Dean, U. Eggli, D. Ferguson,H. Forbes,D. Ford,S. Hogan,H. T. Metcalfe, . Peralta, .Rohwer,andM. Stone forprovid-
ing and/orvouchering pecimens; . Peralta or fieldassistance; nd V. Bittrich,U. Eggli,T.Glenn,R. Nyffeler,J. Sullivan,and G. L. Webster orhelpfulcommentson the manuscript.Finally,we thank W. Greuterand B. Zimmer or their careful and prompteditingof ourmanuscript.Literature itedAlbert,V. A., Backlund,A., Bremer,K., Chase,M. W., Manhart, . R., Mishler,B. D. &Nixon, K. C. 1994. Functional onstraints nd rbcL evidence for land plantphylogeny.Ann. Missouri Bot. Gard. 81: 534-567.Axelrod, D. I. 1979. Age and origin ofSonoran Desert vegetation. San Francisco.- & Raven,P. H. 1978. LateCretaceous ndearlyTertiary egetationhistoryof Africa.Pp.77-130 in. Werger, M. J. A (ed.), Biogeography and ecology of Southern Africa. TheHague.- & - 1985. Originsof thecordilleranlora.J. Biogeogr.12:21-47.Baldwin,B. G. 1992. Phylogeneticutilityof the internal ranscribedpacersof nuclear ibo-somal DNA in plants:an example from the Compositae.Molec. Phylogenet. Evol. 1: 3-16.- , Sanderson,M. J., Porter, .M., Wojciechowski,M. F., Campbell,C. S. & Donoghue,M.J. 1995. The ITS regionof nuclearribosomalDNA: a valuable source of evidence onangiospermphylogeny. Ann. Missouri Bot. Gard. 82: 247-277.Barthlott,W. & Hunt,D. R. 1993. Cactaceae.Pp. 161-197 in: Kubitzki,K., Rohwer,J. &Bittrich,V. (ed.), The amilies and genera of vascularplants, 2. Berlin.Bittrich,V. 1993. Introductiono Centrospermae. p. 13-19in. Kubitzki,K., Rohwer,J. &Bittrich,V. (ed.), The amilies and genera of vascularplants, 2. Berlin.Carolin,R. C. 1987. A reviewof thefamilyPortulacaceae.Austral. . Bot. 35: 383-412.- 1993. Portulacaceae.Pp. 544-545 in. Kubitzki,K., Rohwer,J. G. & Bittrich,V. (ed.),Families and genera offlowering plants, 2. Berlin.Clement,J. S. & Mabry,T. J. 1996. Pigmentevolution n the Caryophyllales. systematicoverview.Bot.Acta109:360-367.
230
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
16/17
TAXON46 - MAY 1997
Crane, P. R, Friis, E. M., & Pedersen, K. R. 1995. The origin and early diversification ofangiosperms.Nature 374: 27-33.Cronquist,A. 1968. The evolution and classification offloweringplants. Boston.- 1981. An integrated system of classification offlowering plants. New York.- & Thorne, R. F. 1994. Nomenclatural and taxonomic history. Pp. 1-26 in: Behnke, H.-D& Mabry, T. J. (ed.), Caryophyllales, evolution and systematics. Berlin.Downie, S. R. & Palmer,J. D. 1994. A chloroplastDNA phylogeny of Caryophyllales basedon structuraland invertedrepeatrestriction site variation.Syst. Bot. 19: 236-252.Geesink, R. 1969. An account of the genus Portulaca in Indo-Australia and the Pacfic.Blumea 17: 275-301.- 1987. Theory of classification of organisms. Pp. 91-126 in: Vogel, E. F. de (ed.), Manualof herbariumtaxonomy. Jakarta.Gerbaulet, M. 1992. Die Gattung Anacampseros L. (Portulacaceae), I. Untersuchungen zur
Systematik.Bot. Jahrb. Syst. 113: 477-564.Gibson, A. C. 1994. Vascular tissues. Pp. 45-74 in. Behnke, H.-D & Mabry, T. J. (ed.),Caryophyllales, evolution and systematics. Berlin.- & Nobel, P. S. 1986. The cactus primer. Cambridge,MA.Gibson, T. J, Thompson, J. D., & Higgins, D. G. 1994. CLUSTAL W: improving the sensi-tivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties, and weight matrix choice. Nucl. Acids Res. 22: 4673-4680.Hershkovitz, M. A. 1989. Phylogenetic studies in Centrospermae. a brief appraisal. Taxon38: 602-608.- 1991. More Centrospermae. I: The portulacaceous alliance. II: The phytolaccaceous al-liance and the chen-ams. III: The caryophyllaceous alliance, Aizoaceae, odd taxa, andsummary.Amer. J. Bot. 68 (6, 2): 191-192.- 1993. Revised circumscriptionsand subgenerictaxonomies of Calandrinia and Montiopsis(Portulacaceae) with notes on phylogeny of the portulacaceous alliance. Ann. Missouri Bot.Gard. 80: 333-365.- & Lewis, L. A. 1996. Deep-level diagnostic value of the rDNA-ITS region. Mol. Biol.Evol. 13: 1276-1295.- & Zimmer, E. A. 1996. Conservationpatternsin angiosperm ITS2 sequences. Nucl. AcidsRes. 24: 2857-2867.Leins, P. & Erbar,C. 1994. Putative origin and relationshipsof the order fromthe viewpointof developmental flower morphology. Pp. 303-316 in: Behnke, H.-D & Mabry, T. J. (ed.),
Caryophyllales, evolution and systematics. Berlin.Leuenberger, B. E. 1986. Pereskia (Cactaceae). Mem. New YorkBot. Gard. 41: 1-141.Lutolf, G. A. 1969. Beziehungenzwischen Portulacaceae und Cactaceae. PhD thesis, Univer-sity of Zirich.Manhart, J. R. & Rettig, J. H. 1994. Gene sequence data. Pp. 235-246 in. Behnke, H.-D &Mabry, T. J. (ed.), Caryophyllales, evolution and systematics. Berlin.Mauseth, J. D. 1990. Continental drift,climate, andthe evolution of cacti. Cact. Succ. J. (LosAngeles) 62: 301-308.Milligan, B. G. 1992. Plant DNA isolation. Pp. 59-88 in: Hoelzel, A. R. (ed.), Molecularanalysis ofpopulations. Oxford.Panchen, A. L. 1992. Classification and the nature of biology. Cambridge, U.K.Queiroz, K. de & Gauthier, J. 1992. Phylogenetic taxonomy. Annual Rev. Ecol. Syst. 23:449-480.Rodman, J. E. 1990. Centrospermaerevisited, part 1. Taxon 39: 383-393.- 1994. Cladistic and phenetic studies. Pp. 279-302 in: Behnke, H.-D & Mabry, T. J. (ed.),Caryophyllales, evolution and systematics. Berlin.
, Oliver, M. K., Nakamura, R. R., McClammer, J. U. & Bledsoe, A. H. 1984. A taxo-nomic analysis and revised classification of Centrospermae. Syst. Bot. 9: 297-323.
231
This content downloaded by the authorized user from 192.168.72.227 on Sun, 2 Dec 2012 11:34:40 AMAll use subject to JSTOR Terms and Conditions
http://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsphttp://www.jstor.org/page/info/about/policies/terms.jsp7/30/2019 On the Evolutionary Origins of the Cacti
17/17
TAXON 46 - MAY 1997
Rzedowski, J. 1993. Diversity and origins of the phanerogamic flora of Mexico. Pp. 129-146in. Ramamoorthy,T. P., Bye, R., Lot, A. & Fa, J. (ed.), Biological diversity of Mexico, NewYork.Shmida, A. 1985. Biogeography of the desert flora. Pp. 23-78 in: Evenari, M., Noy-Meir, I.& Gooddall, D. (ed.), Ecosystems of the world, 12A. Amsterdam.Smith, S. 1994. GDE, version 2.2. Urbana,IL.Stevens, P. F. 1986. Evolutionaryclassification in botany, 1960-1985 [sic]. J. Arnold Arbor.67: 313-339.Suh, Y., Thien, L. B., Reeve, H. & Zimmer, E. A. 1993. Molecular evolution and phylo-genetic implications of internal transcribed spacer regions of ribosomal DNA inWinteraceae.Amer. J. Bot. 80: 1042-1055.Swofford, D. L. 1997. PAUP*: phylogenetic analysis using parsimony (and other methods).Sunderland,MA. In press.- , Olsen, G. J., Waddell, P. J. & Hillis, D. M. 1996. Phylogenetic inference. Pp. 407-514in. Hillis, D. M. & Moritz, C. (ed.), Molecular Systematics. Sunderland,MA.Takhtajan,A. 1980. Outline of the classification of flowering plants (Magnoliophyta). Bot.Rev. (Lancaster)46: 225-359.Thorne, R. F. 1992. An updated phylogenetic classification of the flowering plants.Aliso 13:365-390.Turner,B. L. 1994. Chromosome numbers and their phyletic interpretations.Pp. 27-44 in:Behnke, H.-D & Mabry, T. J. (ed.), Caryophyllales,evolution and systematics. Berlin.Wallace, R. S. 1995. Molecular systematic study of the Cactaceae. using chloroplast DNAvariation to elucidate cactus phylogeny. Bradleya 13: 1-12.
232