Int J Clin Exp Med 2018;11(1):173-182www.ijcem.com /ISSN:1940-5901/IJCEM0058111

Original Article Paeoniflorin strongly reduces the skin inflammation in psoriasis mice by inhibition of VEGF

Na Li1,2, Lifeng Wang3, Ying Zhao2, Weining Li2, Yu Fan2, Shuna Sun2, Yun Ji2, Xiaojie Zhang2

1Shandong University of Traditional Chinese Medicine, Ji’nan, Shandong, China; 2Department of Dermatology, The Affiliated Hospital of Shandong University of Traditional Chinese Medicine, Ji’nan, Shandong, China; 3Department of Gynaecology and Obstetrics, Shandong Maternal and Child Health Hospital, Shandong, China

Received January 15, 2017; Accepted October 4, 2017; Epub January 15, 2018; Published January 30, 2018

Abstract: Psoriasis, an immune-mediated inflammatory skin disease, is associated with increased dermal vascular-ization. Vascular remodeling is a hallmark of many chronic inflammatory disorders and vascular endothelial growth factor (VEGF) is key regulator in pathogenesis of psoriasis. Paeoniflorin (PF) is a monoterpene glucoside that widely used in Traditional Chinese Medicine. In this study, we attempt to elucidate therapeutic effect of PF on psoriasis, by its inhibitive role on VEGF production. Forty female mice were subjected to this experiment and randomly divided into four different groups. Psoriasis was induced by giving imiquimod (IMQ) cream for a week and treated with PF and/or PF-VEGF recombinant treatment. The expression levels of VEGF and its isotopes VEGF1 and VEGF2 were measured at serum level by ELISA, mRNA level by quantitative RT-PCR and protein level by western blot analysis. Epidermal abnormality of psoriatic skin lesions was determined by measuring keratin 6, keratin 10, loricrin and Ki67 at mRNA and protein level with RT-PCR and western blot analysis. Pro-inflammatory cytokines TNF-α, IL-1β, IL-6 and innate immune mediators IL-22 and IL-12 p40 were detected by quantitative RT-PCR and western blot. Typical psoriatic histological features were observed in our histopathological analysis and epidermal abnormality of psoriatic skin lesions improved with PF treatment leading to a reduction in the number of blood vessels, this improvement was attenuated in PF-VEGF-treated mice. Expressions of VEGF, VEGF1 and VEGF2 at serum, mRNA and protein levels were significantly redued in PF-treated mice compared with normal control mice, and this reduc-tion was reversed by PF-VEGF treatment. The related markers keratin 6, keratin 10, loricrin, Ki67, TNF-α, IL-1β, IL-6, IL-22 and IL-12 p40 were decreased in PF-treated mice indicating the improvement in epidermal keratinocytes and inflammatory cells in psoriatic skin lesions. In contrast, these improvements were eliminated in PF-VEGF treated mice. In conclusion, our results suggest that systemic treatment of PF could induce inhibition of VEGF production and provide a proof for anti-inflammatory and anti-angiogenic effect of PF against psoriasis.

Keywords: Psoriasis, paeoniflorin, vascular endothelial growth factor (VEGF)

Introduction

Psoriasis is T-cell-mediated chronic inflamma-tory disease with overall prevalence of 2%-3% in the worldwide population [1]. Psoriasis has been characterized by epidermal hyperplasia with dysregulation of keratinocyte and inflam-matory cell infiltration as well as increased vas-cularization [2, 3]. In psoriasis, angiogenesis has been featured with enlarged, tortuous, hyperpermeable blood vessels and enlarged lymphatic vessels [4, 5]. Vascular endothelial growth factor (VEGF) plays crucial role in regu-lating the neovascularization during the patho-logical processes and VEGF-induced angiogen-esis is known to be one of the pathogenetic

mechanisms in psoriasis [6]. Several studies have presented that high serum levels of VEGF were detected in psoriatic patients with signifi-cant correlation with psoriatic severity [7, 8]. Moreover, psoriasis has also reported to be associated with pronounced vascular permea-bility abnormality and excess VEGF production [2]. Thereby, great amount of efforts made on psoriasis therapy by regulating VEGF [9, 10]. However, due to its complex etiology and vi- ciousness of chemical therapy, currently ap- plied drugs for psoriasis is not fully satisfactory in clinical treatment.

Paeoniflorin (PF) is the principal component of total glucosides of paeony (TGP). With its anti-

PF strongly reduces the skin inflammation in psoriasis mice

174 Int J Clin Exp Med 2018;11(1):173-182

of mice were completely shaved and wiped up with Na2S. The grouping of mice was random-ized as following criteria: 1) for Normal Control (Normal) group, the mice received Vaseline on the shaved back on daily basis for consecutive 7 days with no other treatment; 2) for Negative Control (NC) group, the mice received imiqui-mod (IMQ) cream (Mingxi Pharma, Sichuan, China) for a week and intraperitoneal injection of normal saline for consecutive 10 days; 3) for paeoniflorin treatment (PF) group, the imiqui-mod was given to mice for a week prior to intra-peritoneal injection of PF (Liwah Plant Extrat Technology, Ningbo, China) at the dose of 200 mg/kg/day, with purity of 96%, for consecutive 10 days; 4) for PF-VEGF recombinant treatment (PF-VEGF) group, inquimod was given as des- cribed previously. After 6 hours of intraperito-neal injection of PF, subcutaneous injection of VEGF protein was given on the back of mice and this procedure was conducted for consecu-tive 10 days. The appearance of the psoriasis-like phenotype was determined by macroscopi-cally visible scaly areas on the back of mice. Mice were euthanized at 18th day of treatment prior to preparing tissue and blood samples.

H&E staining

The skin of the euthanized mice was removed and fixed in 4% paraformaldehyde solution to be paraffin embedded. Tissue slices were cut with thickness of 4 μm from paraffin sections and stained with H&E and examined by light microscopy for histological analysis.

Quantitative real-time PCR

Total mRNA was extracted from the back skin tissue samples obtained from euthanized mi- ce, using TRIzol (Invitrogen, US) according to the manufacturer’s instructions. RNA (1 μg) was used for reverse transcription reaction with cDNA synthesis kit (Promega, US). The se- quences of RT-PCR primers used for amplifica-tion of GADPH, VEGFA, VEGFR1, VEGFR2, Ke- ratin 6A, Keratin 10, Loricrin, Ki67, TNF-α, IL-1β, IL-6, IL-22, IL-12 p40 are shown in Table 1. The reactions were setup in 25 μL of total volume and 0.1 μL of HotstartTaq DNA polymerase (GIAGEN, Germany), with 2 μL of template. The PCR cycle conditions was 95°C for 3 mins, 40 cycles of 95°C for 15 s, 60°C for 1 min, and 72°C for 5 min for final extension. Bio-Rad iQ-5 (Bio-Rad, US) was performed for the amplifica-

inflammatory, immune-regulatory and hepato-protective functions, PF has been widely used in Traditional Chinese Medicine [11, 12]. Uti- lization of PF in treatment has been well docu-mented in diverse disease, such as inflamma-tion in Parkinson’s disease [13], chronic renal failure [14], ischemia and neurodegeneration [15], rheumatoid arthritis [16]. Although several studies attempt to define the anti-inflammatory effect of PF in psoriasis [17], potential role of PF on increased vascularization in pathogene-sis of psoriasis is not fully elucidated.

A recent study reported that neutrophils relea- se pro inflammatory factors and, interestingly, IL-17 as well in psoriatic skin lesion [18]. Cu- taneous macrophages also reported to pro-duce diverse mediators and cytokines, such as TNF-α, IL-1β and IL-6, which play important role in the development of skin inflammation in pso-riasis [19]. It has been demonstrated that T-cell dysregulation considered to be another patho-genetic explanation for psoriasis that usually present as increased level of Th1/Th17 in pso-riatic lesions [20]. Although biochemical drugs used as TNF and IL-12/23 inhibitors (etaner-cept, adalimumab, infliximab and ustekinumab) widely applied in psoriasis treatment with re- latively high efficacy, high rates of serious ad- verse events and propensity for viral infection have been observed in previous reports [21, 22].

In this study, we attempt to investigate the anti-inflammatory effects of PF in psoriasis-like phe-notype rat model via regulation of VEGF in pso-riasis skin lesions and to define the molecular pathogenesis by measuring the inflammato- ry related factors in different biological pro- cesses.

Materials and methods

Animals

Forty female 8-11w Balb/c mice were pur-chased from the Shanghai Laboratory Animal Center, Chinese Academy of Science (Shang- hai, China). The mice were maintained under pathogen-free conditions. All of the experi-ments were performed according to the Ani- mal Care and Use Committee guidelines.

Grouping, induction of psoriasis and treatment

All the mice were divided into four different groups, with ten mice each (n = 10). Back hair

PF strongly reduces the skin inflammation in psoriasis mice

175 Int J Clin Exp Med 2018;11(1):173-182

Table 1. Primer sequence of candidate genes (5’→3’)Genes Forward ReverseGAPDH CGGAGTCAACGGATTTGGTCGTAT AGCCTTCTCCATGGTGGTGAAGACVEGFA CACTGGACCCTGGCTTTACTGCT CTCACCGCCTTGGCTTGTCACVEGFR1 GAAACCACAGCAGGAAGACG CTTTATGCCCAGCAAGATCGVEGFR2 ATGGCATCGTGTACATCACC TGCCTCACAGAAGACCATGCKeratin 6A GTGGCCTCAGCTCTTCTACC TCTGAGCACGGGATTCTGCKeratin 10 ACGAGAAGCATGGCAACTCA GCCAGCTCTTCGTTCAGACTLoricrin TCACATCAGCATCACCTCCTTC GGGAGTGGGCTGCTTTTTCTGKi67 CAGAGCTAACTTGCGCTGACT AGGCAGCTGGATACGAATGTTNF-α GGCAGGTCTACTTTGGAGTCATTGC ACATTCGAGGCTCCAGTGAATTCGGIL-1β TGCCACCTTTTGACAGTGATG AAGGTCCACGGGAAAGACACIL-6 CCATCCAGTTGCCTTCTTGG TTTCTGCAAGTGCATCATCGIL-22 AGCAGGTGCTCAACTTCACCR TGGATGTTCTGGTCGTCACCIL-12 p40 GCTGGTGTCTCCACTCATGG GGTCAGGGTCTTTCCAGAGC

tion and analysis of the PCR productions. GADPH was used as internal reference. The 2-ΔΔCT method was used for analyzing the rela-tive mRNA expression.

Western blot analysis

A total of 30 mg of protein samples extracted from back skin tissues of mice using lysis buf-fer. BCA protein assay kit was used to measure the quality and concentration of proteins in supernatants. The cell lysates were separated on 10% SDS-PAGE gel and transferred to PVDF membranes. The membrane was blocked with 3% BSA and incubated with primary antibodi- es against VEGF, VEGFR1, VEGFR2, Keratin 6, Keratin 10, loricrin and Ki67 (Abcam, US) at dilution rate of 1:1000 with TBST. The mem-branes were then washed five times with TB- ST. The membranes were incubated with se- condary antibodies (Beyotime Biotechnology, Shanghai, China) for 40 min at room tempera-ture and washed as described above. The tar-get proteins were examined using the ECL sy- stem (Millipore) and visualized using autoradi-ography film. Finally, the films were scanned and bands quantified using the Quantity one analysis software.

Enzyme-linked immunosorbent assay (ELISA)

The VEGF level in peripheral blood was mea-sured by commercial ELISA assay kit (eBiosci-ence, USA). The procedure was conducted as following the manufacturer’s instructions. After 15-30 min of antibody-antigen complex reac-

tion, optical density (OD) was determined using a benchmark multiplate re- ader at 415  nm (Bio-Rad, Hercules, CA, USA).

Statistical analysis

For statistical evaluation SPSS 19.0 software was applied. For assessment of relative values, one-sa- mple Student’s -tests was used by assessment of statistical significance of differences. One-way AN- OVA analysis of variance with Tukey test was used to evaluate the differenc-

es between absolute means, when data were of normal distribution and homogeneity of vari-ances was confirmed. Differences were consid-ered statistically significant if the probability value was below 0.05 (P < 0.05).

Results

The relief of psoriasis-like phenotype in mice by paeoniflorin (PF) was antagonized by re-combinant VEGF

First symptoms of a psoriatic phenotype we- re determined macroscopically observation of scaly areas on back skin of mice. The negative control and the mice treated with PF-VEGF recombinant injection showed predominant scaly skin lesion. In contrast, the mice treated with PF showed an almost complete reduction of scaliness, skin inflammation. The normal control mice did not show any epidermal ab- normality (Figure 1A).

Histological analysis was performed to charac-terize the reduction of psoriasis-like skin inflam-mation in the mice treated with PF and scaly skin lesions on the back skin of mice injected with PF-VEGF recombinant agent. H&E staining exhibited the typical pathological features of the psoriasis-like phenotype in the negative control and PF-VEGF treated mice. In these mice, histopathological signs of psoriasis were observed, such as thicken epidermis and stra-tum corneum, retention of nuclei in the stratum corneum, downward thickenings of epidermis-known as rete pegs- and microabscesses. In

PF strongly reduces the skin inflammation in psoriasis mice

176 Int J Clin Exp Med 2018;11(1):173-182

Figure 1. Macroscopic observation and H&E staining of skin lesions of differently treated mice. A. Macroscopic observation of scaly areas on back skin of mice; B. Histopathological signs of psoriasis in mice treated differently; C. Quantification of number of blood vessels in accordance with the histological observation (*P < 0.05 compared with normal group; #P < 0.05 compared to negative control).

contrast, no pathological abnormality was ob- served in normal control mice and noticeable reduction of psoriatic histological features was shown in mice treated with PF-VEGF recombi-nant agent (Figure 1B). In accordance with his-tological observation, number of blood vessels in each group of mice was counted. Blood ves-sel numbers were significantly higher in nega-tive control mice compared to normal mice (P < 0.05) and significant reduction was shown in PF-treated mice compared to negative control (P < 0.05) (Figure 1C). However, PF-VEGF treat-ment group showed no significant reduction in number of blood vessels compared to negati- ve control group. These results indicated that VEGF affected the anti-angiogenesis effect of PF, and therefore it may at least partly partici-pate in the PF-mediated psoriasis inhibition.

PF exerted inhibitive effect on VEGF secretion and the expression of its receptors, but recom-binant VEGF abolished it

To investigate the effect of PF on expression of VEGF in serum at transcriptional and transla-tional level, we examined the expression of VE- GF, VEGFR1 and VEGFR2. ELISA analysis exhi- bited that peripheral blood serum in normal

group and PF group contained significantly less VEGF thannegative control mice and this scar-city in serum wasrestored after recombinant treatment of PF-VEGF (P < 0.05) (Figure 2A). In accordance with our western blot analysis, it was shown that protein expressions of VEGF, VEGFR1 and VEGFR2 were higher in negative control mice and significantly reduced with PF treatment (P < 0.01), and this reduction was significantly altered in mice treated with PF- VEGF (P < 0.05) (Figure 2B and 2C). Quantita- tive RT-PCR analysis was performed to exami- ne the change at mRNA level of VEGF, VEGFR1 and VEGFR2 between different groups and we found that alteration of these genes at mRNA level had same trend as protein expression. The mRNA expression of these three genes was higher in negative control mice and signifi-cantly decreased with PF treatment (P < 0.05), and mRNA expression level increased again by PF-VEGF administration (P < 0.05) (Figure 2D).

PF-induced inhibition of hyperplasia and keratinization of epidermis was eliminated by recombinant VEGF

Histological analysis demonstrated that epider-mal differentiation in psoriasis-like phenotype

PF strongly reduces the skin inflammation in psoriasis mice

177 Int J Clin Exp Med 2018;11(1):173-182

Figure 2. Protein and mRNA levels of peripheral and skin VEGF, VEGFR1 and VEGFR2 after treatment with PF. A. Peripheral serum VEGF measured with ELISA. B, C. VEGF, VEGFR1 and VEGFR2 in the skin lesions measured with western blotting. D. Transcriptional levels of VEGF, VEGFR1 and VEGFR2 in the skin lesions measured with qRT-PCR. **P < 0.01, *P < 0.05, compared with Normal control; ##P < 0.01, #P < 0.05, compared with NC (negative con-trol); ※※P < 0.01, ※P < 0.05, compared with PF treatment group.

mice was normalized with PF treatment and this effect was vanished by recombinant VEGF treatment. Western blot and quantitative RT- PCR analysis were performed to confirm this result at molecular level, examining the expres-sion level of epidermal hyperplasia marker ker-atin 6, epidermal differentiation-related protein keratin 10, epidermal keratinization marker lo- ricrin and proliferating cell nuclear antigen

Ki67. These markers are kn- own to be overexpressed in psoriasis lesions. Our western blot analysis showed that pro-tein expression levels of kera-tin 6, keratin 10, loricrin and Ki67 were significantly decre- ased in mice treated with PF (P < 0.05) compared with psori- asis-like phenotype mice, and this reduction was significantly increased (P < 0.05) by admin-istration of PF-VEGF recombi-nant agent (Figure 3A and 3B). This trend was further con-firmed with the measurement of mRNA expressions of kera-tin 6, keratin 10, loricrin and Ki67 genes by quantitative RT- PCR. We found that mRNA ex- pression level of these genes significantly decreased (P < 0.05) after PF treatment com-pared to psoriasis mice with no treatment (negative con-trol), and this fall in mRNA ex- pression was reverted to the increased level by PF-VEGF recombinant administration wi- th statistical significance (P < 0.05) compared to PF treat-ment group (Figure 3C).

Inhibition of skin inflamma-tion by PF was neutralized by recombinant VEGF

To better define the inhibitive effect of PF in pathogenesis of psoriasis by regulating the VE- GF, we examined the protein and mRNA expression levels of TNF-α, L-1β, IL-6I, L-22 and IL-12 p40, which are known as markers of inflammatory infil-trate and innate immune medi-

ators that overexpressed in psoriasis. Western blot analysis revealed that protein expression levels of these inflammatory factors were sig-nificantly reduced (P < 0.05) in PF-treated mice compared with psoriasis-like phenotype mice and these decreased levels of proteins were remarkably increased (P < 0.05) after PF-VEGF administration (Figure 4A and 4B). Our quanti-tative RT-PCR analysis demonstrated the same

PF strongly reduces the skin inflammation in psoriasis mice

178 Int J Clin Exp Med 2018;11(1):173-182

Figure 3. Protein and mRNA levels of epidermal hyperplasia marker keratin 6, epidermal differentiation-related protein keratin 10, epidermal keratinization marker loricrin and proliferating cell nuclear antigen Ki67. A, B. Keratin 6, keratin 10, loricrin and Ki67 in the skin lesions measured with western blotting. C. mRNA levels of keratin 6 and loricrin in the skin lesions measured with qRT-PCR. **P < 0.01, *P < 0.05, compared with Normal control; ##P < 0.01, #P < 0.05, compared with NC (negative control); ※※P < 0.01, ※P < 0.05, compared with PF treatment group.

tendency as western blot results. The mRNA expression levels of these markers were elev- ated in psoriasis-like phenotype mice and sig-nificantly decreased (P < 0.05) with PF treat-ment. PF-VEGF recombinant agent reversed this result with significantly increased (P < 0.05) mRNA expression level of these factors in PF-VEGF group compared with PF treatment group (Figure 4C).

Discussion

Psoriasis is chronic autoimmune disease whi- ch has been reported to be characterized by poor differentiation and hyper-proliferation of epidermal keratinocytes [1]. PF has been re- ported to have anti-inflammatory, anti-allergic and immunoregulatory effects [11]. Our study, employing a unique therapeutic intervention model, reveals that systemic administration of PF could effectively alleviate the psoriasis-like phonotype skin inflammation and this effect is eliminated by PF-VEGF recombinant treatment. Histopathological characteristics of psoriasis-like symptoms were observed in the skin le- sions of mice in experimental groups, such as

epidermal hyperplasia, dermal and epidermal inflammatory infiltration, dilation and growth of dermal vessel, and elevated levels of related inflammatory cytokines, were markedly amelio-rated following treatment with PF. In contrast, these improvements were exacerbated by ad- ministration of PF-VEGF recombinant agent.

To provide further confirmation for our histolo- gical observation, molecular parameters that related to epidermal proliferation and differen-tiation markers, such as keratin 6, keratin 10, loricrin and Ki67 were detected at mRNA and protein level in skin lesions. Our results show- ed that these markers were up-regulated in psoriatic phenotype mice and normalized with PF treatment in both mRNA and protein level. However, PF-VEGF recombinant treatment al- tered this normalization to the level of psoria- tic skin lesions. Using Zenon labeling tech-nique, van Duijnhoven MW et al. demonstrated that expression levels of Ki-7, keratin 6 and keratin 10 were normalized by treatment of psoriasis with short-term topical steroid [23]. Although, keratin 6 and keratin 10 are both expressed suprabasal layer of skin, their ex-

PF strongly reduces the skin inflammation in psoriasis mice

179 Int J Clin Exp Med 2018;11(1):173-182

Figure 4. Inhibition of skin inflammation by PF was neutralized by recombinant VEGF. A, B. Protein expressions of TNF-α, IL-1β, IL-6, IL-22 and IL-12 p40 were examined with western blotting analysis. C. mRNA expressions of these markers were detected with qRT-PCR analysis. **P < 0.01, *P < 0.05, compared with Normal control; ##P < 0.01, #P < 0.05, compared with NC (negative control); ※※P < 0.01, ※P < 0.05, compared with PF treatment group.

pression patterns (co-or single-expression) in different stage of psoriatic lesions had been controversial till 2000. The more proportion of keratin 6-expressing cells presented in inner margin, while keratin 10-expressing cells are exist in the outer margin and K6/K10-co ex- pressing cells were found in the inner margin of the lesions [24]. Thereby, we did not conduct further experiment for localization of these markers in different skin lesions with psoriasis, since this is not the scope of the present stu- dy. A study reported that treatment of NHKS with S100A7 significantly reduced the expres-sion levels of keratin 10 and loricrin in psoria-sis, and yet increased the expression of keratin 6, keeping certain discrepancy from our results [25].

There are three receptors for VEGF: VEGFR-1, VEGFR-2 [26] and VEGFR-3 [27]; all are tyrosine kinase receptors (RTKs), with high affinity. The potential role of VEGF in psoriatic pathogenesis is strongly correlated with the polymorphisms of VEGF gene [28, 29] and the overexpression of VEGF-receptors-1/2/3 in the psoriatic pa- tients [30]. VEGFR-1 plays important role in nor-mal blood vessel development, recruiting the hematopoietic precursors and leading migra-

tion of monocytes, while the VEGFR-2 deter-mines the migration and the proliferation of ECs, and most importantly, the increased vas-cular permeability [31-33]. In our study, all three factors VEGF, VEGF1 and VEGF2 were overexpressed in psoriasis-like phenotype mi- ce at serum, mRNA and protein levels, respec-tively. And this dysregulation was normalized with PF treatment. Reversed effect of PF-VEGF treatment in psoriasis mice could be a better explanation for important role of VEGF in main-taining the functioning of epidermis barrier and for a link existing between keratinocytes hyper-plasia and epidermal VEGF [34]. Some studies have reported that in experimentally induced cutaneous inflammation mice VEGF was over-expressed in epidermis and induced inflamma-tion showed resemble features as psoriasis, morphologically, histologically and immunolo- gically [4, 35]. This provides support for the hypothesis that one of the key early features in psoriatic pathogenesis might be upregulation of VEGF and its receptors that is responsible for the epidermal and immunological changes.

The multifunctional cytokine tumor necrosis factor-alpha (TNF-α) is another regulatory fac-tor in psoriatic angiogenesis [36]. A strong in-

PF strongly reduces the skin inflammation in psoriasis mice

180 Int J Clin Exp Med 2018;11(1):173-182

crease of TNF-α was detected at both mRNA and protein levels in psoriatic mice model and significant reduction occurred with PF treat-ment. This trend was observed in expression levels of IL-1β, IL-6, IL-22 and IL-12 p40 in our results. It has been reported that TNF-α res- ponsible for the upregulation of genetic tran-scription of VEGF [37] and increases the pro-duction of pro-inflammatory cytokines, IL-8 [38]. TNF-α was able to induce increase pro-duction of IL-6 and VEGF in HaCaT cells [39]. In a report on potential use of Cold atmospheric plasma (CAP) in the treatment of psoriasis, it is also demonstrated that CAP induced release of interleukin (IL)-6, TNF-α, VEGF and enhanc- ed the mRNA expression of IL-1β, IL-6, IL-8, IL-10, TNF-α [40]. IL-22 is produced by T-helper 22 cells, a new subset of CD4+ cells and IL-22 is the most studied cytokine in allergic inflam-matory disorders [41]. Moreover, ectopic ex- pression of IL-12 p40 from the keratin 14 pro-moter led to enhanced expression of IL-23 p19 in mouse keratinocytes [42]. In this study, we elucidated the anti-inflammatory effect of PF by inhibiting the VEGF production in keratino-cytes, which is mediated by a cytokine-depen-dent mechanism.

In this study, we propose paeoniflorin as an anti-angiogenic therapy for psoriasis. These findings might provide essential information about therapeutic effect of PF on inhibition of VEGF, particularly elucidating its anti-angiogen-ic function in psoriasis.

Acknowledgements

This work was supported by Natural Science Foundation of Shandong Province, China (Grant No.: ZR2015HL121), the “Shandong Medical Science and Technology Development Plan Project” (No. 2017WS433).

Disclosure of conflict of interest

None.

Address correspondence to: Dr. Xiaojie Zhang, De- partment of Dermatology, The Affiliated Hospital of Shandong University of Traditional Chinese Medi- cine, 42 West Wenhua Road, Ji’nan 250011, Shan- dong, China. Tel: +86-18853192526; Fax: +86-531-68616666; E-mail: xzhang_12@sina.com

References

[1] Ma HL, Liang S, Li J, Napierata L, Brown T, Ben-oit S, Senices M, Gill D, Dunussi-Joannopoulos

K, Collins M, Nickerson-Nutter C, Fouser LA and Young DA. IL-22 is required for Th17 cell-mediated pathology in a mouse model of pso-riasis-like skin inflammation. J Clin Invest 2008; 118: 597-607.

[2] Griffiths CE and Barker JN. Pathogenesis and clinical features of psoriasis. Lancet 2007; 370: 263-271.

[3] Hegyi Z, Zwicker S, Bureik D, Peric M, Koglin S, Batycka-Baran A, Prinz JC, Ruzicka T, Schauber J and Wolf R. Vitamin D analog calcipotriol sup-presses the Th17 cytokine-induced proinflam-matory S100 “alarmins” psoriasin (S100A7) and koebnerisin (S100A15) in psoriasis. J In-vest Dermatol 2012; 132: 1416-1424.

[4] Xia YP, Li B, Hylton D, Detmar M, Yancopoulos GD and Rudge JS. Transgenic delivery of VEGF to mouse skin leads to an inflammatory condi-tion resembling human psoriasis. Blood 2003; 102: 161-168.

[5] Kunstfeld R, Hirakawa S, Hong YK, Schacht V, Lange-Asschenfeldt B, Velasco P, Lin C, Fiebig-er E, Wei X, Wu Y, Hicklin D, Bohlen P and Det-mar M. Induction of cutaneous delayed-type hypersensitivity reactions in VEGF-A transgenic mice results in chronic skin inflammation as-sociated with persistent lymphatic hyperplasia. Blood 2004; 104: 1048-1057.

[6] Marina ME, Roman II, Constantin AM, Mihu CM and Tataru AD. VEGF involvement in psoriasis. Clujul Med 2015; 88: 247-252.

[7] Nielsen HJ, Christensen IJ, Svendsen MN, Han-sen U, Werther K, Brunner N, Petersen LJ and Kristensen JK. Elevated plasma levels of vas-cular endothelial growth factor and plasmino-gen activator inhibitor-1 decrease during im-provement of psoriasis. Inflamm Res 2002; 51: 563-567.

[8] Nofal A, Al-Makhzangy I, Attwa E, Nassar A and Abdalmoati A. Vascular endothelial growth fac-tor in psoriasis: an indicator of disease severity and control. J Eur Acad Dermatol Venereol 2009; 23: 803-806.

[9] Chen HQ, Li X and Tang R. Effects of narrow band ultraviolet B on serum levels of vascular endothelial growth factor and interleukin-8 in patients with psoriasis. Am J Ther 2016; 23: e655-662.

[10] Wen J, Wang X, Pei H, Xie C, Qiu N, Li S, Wang W, Cheng X and Chen L. Anti-psoriatic effects of Honokiol through the inhibition of NF-kap-paB and VEGFR-2 in animal model of K14-VEGF transgenic mouse. J Pharmacol Sci 2015; 128: 116-124.

[11] Sun Y, Dong Y, Jiang HJ, Cai TT, Chen L, Zhou X, Chen T and Xu Q. Dissection of the role of pae-oniflorin in the traditional Chinese medicinal formula Si-Ni-San against contact dermatitis in mice. Life Sci 2009; 84: 337-344.

[12] Zhang LL, Wei W, Wang NP, Wang QT, Chen JY, Chen Y, Wu H and Hu XY. Paeoniflorin sup-

PF strongly reduces the skin inflammation in psoriasis mice

181 Int J Clin Exp Med 2018;11(1):173-182

presses inflammatory mediator production and regulates G protein-coupled signaling in fibroblast-like synoviocytes of collagen induced arthritic rats. Inflamm Res 2008; 57: 388-395.

[13] Smith PF. Inflammation in Parkinson’s disease: an update. Curr Opin Investig Drugs 2008; 9: 478-484.

[14] Meng XJ, Wan YG, Wei QX, Chen HL, Shi XM, Huang YR and Yao J. [Overview research of ure-mic ulearance granule treating chronic renal failure]. Zhongguo Zhong Yao Za Zhi 2013; 38: 3651-3655.

[15] Lin B. Polyphenols and neuroprotection against ischemia and neurodegeneration. Mini Rev Med Chem 2011; 11: 1222-1238.

[16] Zhang W and Dai SM. Mechanisms involved in the therapeutic effects of Paeonia lactiflora Pallas in rheumatoid arthritis. Int Immuno-pharmacol 2012; 14: 27-31.

[17] Sun Y, Zhang J, Huo R, Zhai T, Li H, Wu P, Zhu X, Zhou Z, Shen B and Li N. Paeoniflorin inhibits skin lesions in imiquimod-induced psoriasis-like mice by downregulating inflammation. Int Immunopharmacol 2015; 24: 392-399.

[18] Lin AM, Rubin CJ, Khandpur R, Wang JY, Riblett M, Yalavarthi S, Villanueva EC, Shah P, Kaplan MJ and Bruce AT. Mast cells and neutrophils release IL-17 through extracellular trap forma-tion in psoriasis. J Immunol 2011; 187: 490-500.

[19] Clark RA and Kupper TS. Misbehaving macro-phages in the pathogenesis of psoriasis. J Clin Invest 2006; 116: 2084-2087.

[20] Lowes MA, Kikuchi T, Fuentes-Duculan J, Cardi-nale I, Zaba LC, Haider AS, Bowman EP and Krueger JG. Psoriasis vulgaris lesions contain discrete populations of Th1 and Th17 T cells. J Invest Dermatol 2008; 128: 1207-1211.

[21] Adelzadeh L, Jourabchi N and Wu JJ. The risk of herpes zoster during biological therapy for psoriasis and other inflammatory conditions. J Eur Acad Dermatol Venereol 2014; 28: 846-852.

[22] Tovey MG and Lallemand C. Immunogenicity and other problems associated with the use of biopharmaceuticals. Ther Adv Drug Saf 2011; 2: 113-128.

[23] van Duijnhoven MW, Hagenberg R, Pasch MC, van Erp PE and van de Kerkhof PC. Novel quan-titative immunofluorescent technique reveals improvements in epidermal cell populations after mild treatment of psoriasis. Acta Derm Venereol 2005; 85: 311-317.

[24] Mommers JM, van Rossum MM, van Erp PE and van De Kerkhof PC. Changes in keratin 6 and keratin 10 (co-)expression in lesional and symptomless skin of spreading psoriasis. Der-matology 2000; 201: 15-20.

[25] Son ED, Kim HJ, Kim KH, Bin BH, Bae IH, Lim KM, Yu SJ, Cho EG and Lee TR. S100A7 (pso-

riasin) inhibits human epidermal differentia-tion by enhanced IL-6 secretion through Ikap-paB/NF-kappaB signalling. Exp Dermatol 2016; 25: 636-641.

[26] Heidenreich R, Rocken M and Ghoreschi K. An-giogenesis drives psoriasis pathogenesis. Int J Exp Pathol 2009; 90: 232-248.

[27] Grossman HB, Soloway M, Messing E, Katz G, Stein B, Kassabian V and Shen Y. Surveillance for recurrent bladder cancer using a point-of-care proteomic assay. Jama 2006; 295: 299-305.

[28] Young HS, Summers AM, Bhushan M, Brench-ley PE and Griffiths CE. Single-nucleotide poly-morphisms of vascular endothelial growth fac-tor in psoriasis of early onset. J Invest Dermatol 2004; 122: 209-215.

[29] Young HS, Summers AM, Read IR, Fairhurst DA, Plant DJ, Campalani E, Smith CH, Barker JN, Detmar MJ, Brenchley PE and Griffiths CE. Interaction between genetic control of vascular endothelial growth factor production and reti-noid responsiveness in psoriasis. J Invest Der-matol 2006; 126: 453-459.

[30] Man XY, Yang XH, Cai SQ, Bu ZY and Zheng M. Overexpression of vascular endothelial growth factor (VEGF) receptors on keratinocytes in psoriasis: regulated by calcium independent of VEGF. J Cell Mol Med 2008; 12: 649-660.

[31] Ferrara N, Gerber HP and LeCouter J. The biol-ogy of VEGF and its receptors. Nat Med 2003; 9: 669-676.

[32] Olsson AK, Dimberg A, Kreuger J and Claes-son-Welsh L. VEGF receptor signalling-in con-trol of vascular function. Nat Rev Mol Cell Biol 2006; 7: 359-371.

[33] Shibuya M. Vascular endothelial growth factor receptor-1 (VEGFR-1/Flt-1): a dual regulator for angiogenesis. Angiogenesis 2006; 9: 225-230.

[34] Elias PM, Arbiser J, Brown BE, Rossiter H, Man MQ, Cerimele F, Crumrine D, Gunathilake R, Choi EH, Uchida Y, Tschachler E and Feingold KR. Epidermal vascular endothelial growth fac-tor production is required for permeability bar-rier homeostasis, dermal angiogenesis, and the development of epidermal hyperplasia: implications for the pathogenesis of psoriasis. Am J Pathol 2008; 173: 689-699.

[35] Detmar M, Brown LF, Schon MP, Elicker BM, Velasco P, Richard L, Fukumura D, Monsky W, Claffey KP and Jain RK. Increased microvascu-lar density and enhanced leukocyte rolling and adhesion in the skin of VEGF transgenic mice. J Invest Dermatol 1998; 111: 1-6.

[36] Hurlimann D, Forster A, Noll G, Enseleit F, Che-nevard R, Distler O, Bechir M, Spieker LE, Nei-dhart M, Michel BA, Gay RE, Luscher TF, Gay S and Ruschitzka F. Anti-tumor necrosis factor-alpha treatment improves endothelial function

PF strongly reduces the skin inflammation in psoriasis mice

182 Int J Clin Exp Med 2018;11(1):173-182

in patients with rheumatoid arthritis. Circula-tion 2002; 106: 2184-2187.

[37] Campanati A, Goteri G, Simonetti O, Ganzetti G, Giuliodori K, Giuliano A, Sabato S, Stramaz-zotti D, Gulini E, Dusi D, De Blasio S, Fabris G and Offidani A. Angiogenesis in psoriatic skin and its modifications after administration of etanercept: videocapillaroscopic, histological and immunohistochemical evaluation. Int J Im-munopathol Pharmacol 2009; 22: 371-377.

[38] Young CN, Koepke JI, Terlecky LJ, Borkin MS, Boyd Savoy L and Terlecky SR. Reactive oxygen species in tumor necrosis factor-alpha-activat-ed primary human keratinocytes: implications for psoriasis and inflammatory skin disease. J Invest Dermatol 2008; 128: 2606-2614.

[39] Balato A, Lembo S, Mattii M, Schiattarella M, Marino R, De Paulis A, Balato N and Ayala F. IL-33 is secreted by psoriatic keratinocytes and induces pro-inflammatory cytokines via kerati-nocyte and mast cell activation. Exp Dermatol 2012; 21: 892-894.

[40] Zhong SY, Dong YY, Liu DX, Xu DH, Xiao SX, Chen HL and Kong MG. Surface air plasma-in-duced cell death and cytokine release of hu-man keratinocytes in the context of psoriasis. Br J Dermatol 2016; 174: 542-552.

[41] Hofmann MA, Kiecker F and Zuberbier T. A sys-tematic review of the role of interleukin-17 and the interleukin-20 family in inflammatory aller-gic skin diseases. Curr Opin Allergy Clin Immu-nol 2016; 16: 451-457.

[42] Kopp T, Lenz P, Bello-Fernandez C, Kastelein RA, Kupper TS and Stingl G. IL-23 production by cosecretion of endogenous p19 and trans-genic p40 in keratin 14/p40 transgenic mice: evidence for enhanced cutaneous immunity. J Immunol 2003; 170: 5438-5444.