Overexpression of poplar cellulase accelerates growth and disturbs

1

Title: Overexpression of poplar cellulase accelerates growth and disturbs the closing

movements of leaves in sengon

Running title: Overexpression of poplar cellulase

Corresponding author: Taka Hayashi

Kyoto University, RISH

Gokasho, Uji, Kyoto 611-0011, Japan

Tel & Fax: +81 774 38 3618

Email: [email protected]

Appropriate Journal Research Area: Cell Wall

Plant Physiology Preview. Published on April 16, 2008, as DOI:10.1104/pp.108.116970

Copyright 2008 by the American Society of Plant Biologists

www.plantphysiol.orgon March 25, 2018 - Published by Downloaded from Copyright © 2008 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

Overexpression of poplar cellulase accelerates growth and disturbs the

closing movements of leaves in sengon

Sri Hartati, Enny Sudarmonowati, Yong Woo Park, Tomomi Kaku, Rumi Kaida, Kei’ichi

Baba and Takahisa Hayashi*

Research Centre for Biotechnology, LIPI, Cibinong 16911, Indonesia (S.H., E.S.)

Kyoto University, RISH, Uji 611-0011, Japan (Y.W.P., T.K., R.K., K.B., T.H.)

*Corresponding author. Email: [email protected]



3

This work was supported partly by the Program for the Promotion of Basic Research

Activities for Innovative Biosciences (PROBRAIN) and partly by JSPS KAKENHI (No.

19208016 and 19405030). This paper is also a part of the outcome of the JSPS Global COE

Program (E-04): In Search of Sustainable Humanosphere in Asia and Africa.



4

ABSTRACT

In this study, poplar cellulase (PaPopCel1) was overexpressed in a tropical Leguminosae tree,

sengon (Paraserianthes falcataria), by the Agrobacterium method. PaPopCel1

overexpression increased the length and width of stems with larger leaves, which showed a

moderately higher density of green color than leaves of the wild type. The pairs of leaves on

the transgenic plants closed more slowly during sunset than those on the wild-type plants.

When main veins from each genotype were excised and placed on a paper towel, however, the

leaves of the transgenic plants closed more rapidly than those of the wild-type plant. Based on

carbohydrate analyses of cell walls, the leaves of the transgenic plants contained less

wall-bound xyloglucan than those of the wild-type plants. In situ xyloglucan

endotransglucosylase activity showed that the incorporation of whole xyloglucan, potentially

for wall tightening, occurred in the parenchyma cells (motor cells) of the petiolule pulvinus

attached to the main vein, although the transgenic plant incorporated less whole xyloglucan

than the wild-type. These observations support the hypothesis that the paracrystalline sites of

cellulose microfibrils are attacked by poplar cellulase, which loosens xyloglucan intercalation,

resulting in an irreversible wall modification. This process could be the reason why the

overexpression of poplar cellulase both promotes plant growth and disturbs the biological

clock of the plant by altering the closing movements of the leaves of the plant.



5

INTRODUCTION

Overexpression of plant cellulase in plants does not lead to a lack of cellulose, but rather,

modifies the cell walls by trimming off disordered glucose chains from the microfibrils. This

action has been demonstrated in Arabidopsis thaliana overexpressing poplar cellulase (Park et

al., 2003). Transgenic Populus tremula overexpressing Arabidopsis cellulase (cel1) had

longer internodes and longer fiber cells (Shani et al., 2004). Overexpression does not increase

xyloglucan depolymerization (Harpster et al., 2002) because the reaction efficiency of plant

cellulase for xyloglucan is very low compared with that for amorphous 1,4-β-glucans (the

amorphous regions of cellulose microfibrils). This is confirmed by the fact that the enzyme has

high reactive efficiency for artificial substrates such as carboxymethylcellulose,

phospho-swollen cellulose, and (1→3),(1→4)-β-glucan (Nakamura and Hayashi, 1993).

Nevertheless, the trimming of microfibrils by cellulase might solubilize some xyloglucan that

would otherwise have been intercalated within the disordered paracrystalline domains of the

microfibrils (Hayashi, 1989). This kind of cell wall modification in Arabidopsis causes an

increase in the size of cells in the petioles and blades of rosette leaves and stems (Park et al.,

2003). Based on relative load-extension curves, a cross-linking component appeared to be

reduced in the walls of the transgenic plants compared to those of the wild-type plants. The

decreased cross-linking component is attributable to a decreased amount of tethering

xyloglucan, and could in turn accelerate growth by increasing plastic extensibility under

turgor pressure. Thus, the overexpression of cellulase could affect wall dynamics, particularly

the turgor-related movements of plant organs such as the opening and closing movements of

leaves and stomata, etc.

Poplar cellulase cDNA with 35S promoter has been used in sengon because the

overexpression of poplar cellulase in Arabidopsis and poplar produced more visible effects in

their leaves (Ohmiya et al., 2003; Park et al., 2003). In these species, leaf length and width

were increased to the same extent as the length of the blade and petiole. The question is,



6

therefore, whether Leguminosae plants that overexpress cellulase (in this case, sengon) show

any phenotype for leaf movements related to the walls of motor cells.

Sengon (Paraserianthes falcataria) belongs to the subfamily Mimosoideae of

Leguminosae, and is native to Haiti, Indonesia, and Papua New Guinea. The sengon variety

used for reforestation is the fastest-growing tree in industrial forests. It even thrives in

marginal land, where it grows symbiotically with nitrogen-fixing Rhizobium and

phosphorus-promoting mycorrhizal fungi. It is, therefore, a suitable species for industrial

timber estates in Southeast Asian countries (Binkley et al., 2003; Shively et al., 2004;

Kurinobu et al., 2007; Siregar et al., 2007). The sengon tree typically gains 7 m in height per

year and reaches a mean height of 25.5 m and a bole diameter of 17 cm after 6 years. After 15

years, it reaches 39 m in height and 63.5 cm in diameter. The tree is useful not only for timber

material but also for pulp and paper. Due to its soft timber and leaves that can be used as

animal feed (Merkel et al., 2000), the tree has a wider range of end-uses than Acacia species

(Otsamo, 1998). It is, therefore, expected to be one of the most useful tree species for

industrial forests. However, despite attempts with tree cuttings, tissue culture techniques with

multiple propagations, and stable gene transfer using Agrobacterium tumefaciens, attempts to

propagate the tree clonally have failed. In this paper, we demonstrate the production of

transgenic sengon for the first time.

Cellulose is an important component of plants and serves as the most abundant

bio-polymer on the earth, with about one hundred billion tons produced annually. In addition,

it is a significant biological sink for CO2. It has been suggested that cellulases may have

originally been involved in either the repair or arrangement of cellulose microfibrils during

their biosynthesis, rather than in cellulose degradation (Hayashi et al., 2005). It has also been

reported that membrane-bound cellulase (Korrigan) is required for cellulose biosynthesis

(Nicol et al., 1998), but nothing is known about its role in cellulose biosynthesis.

In the present study, we used the overexpression of poplar cellulase in the sengon tree in

order to increase its growth rate. We hope, thereby, to increase the plant’s production of raw



7

material, not only for timber, pulp, and paper, but also for use as a biofuel (Ragaukas et al.,

2006). Ultimately, experiments like this that result in an increased deposition of cellulose in

the stem could produce the fastest-growing tree in the world.

RESULTS

Transformation

Two-week-old hypocotyls germinated from seeds were cut into 2- to 4-mm long stems, the

explants of which were used for transformation in the same manner as leaf disks for the

Agrobacterium-mediated transformation. The explants from the cut hypocotyls formed a

callus-like tissue, which was followed by green color and shoot formation on

Murashige-Skoog (MS) medium containing 4 µM benzylaminopurine. The transformants

were selected in MS medium containing kanamycin.

During several transfers of explants to fresh medium each month, shoots were induced by

the addition of benzylaminopurine (Figure 1A) under light (4,000 lux). Benzylaminopurine

alone was used as a plant hormone to induce shoots because auxin did not affect the formation

of callus tissue or shoots in the presence of benzyladenine (Bon et al., 1998).

During direct adventitious shoot formation, parts of the explants turned green and

produced green nodular structures to form adventitious buds at the apical ends. The

adventitious shoots (5 mm long) were transplanted into the medium in the absence of

benzylaminopurine. After the shoots elongated to 3 cm (Figure 1B), they were again

transplanted into fresh MS medium in the absence of any plant hormone for the induction of

roots (Figure 1C). No plant hormone was used for rooting because auxin and cytokinin

prevented the induction of roots (Bon et al., 1998).

Pinnate leaflets were formed during shoot elongation and root formation, although young

trees and shoot apical meristems in adult trees form pinnate leaves. About thirty shoots were

regenerated from 400 co-cultivated explants; 10 of these shoots produced roots. Ultimately,

seven independent seedlings were obtained. Shoots and roots were also induced from the



8

young shoots of wild-type plants in the presence and absence of benzylaminopurine,

respectively (Figure 1D).

It should be noted that it took about 5 to 6 months to get produce transgenic seedlings and

about 2 to 3 months to produce wild-type seedlings.

Cellulase expression

To study the effects of cellulase on cell wall structure and growth, we generated transgenic

sengon plants that expressed poplar cellulase (PaPopCel1) under the control of a constitutive

promoter. To assay the expression of the transgene, we performed RT-PCR Southern blot

analysis of mRNAs derived from small sections excised from the petiolule pulvinus (Figure

2A). PopCel1 mRNA was accumulated in trg1 to trg7, and weak signals were detected in trg4

to trg7. Also, we used an antibody against a 15-amino-acid sequence

(163CWERPEDMDTPRNVY167) for PaPopCel1 gene product (Ohmiya et al., 2003).

In each transgenic line (trg1 to trg7), the antibody recognized a single, 50-kDa band on a

Western blot, present in the petiolule pulvinus, running at a position corresponding to the

expected and actual size of the mature cellulase (Figure 2B). No signal was detected in the

wild-type plants.

In the pulvinus attached to the veins of the transgenic plants, cell wall fractions showed

cellulase activity that was approximately 1.05- to 5.25-fold higher than that of the wild-type

(Figure 2C). The activity of cellulase was also assessed by measuring soluble

cello-oligosaccharides which are presumably released by the enzyme (Figure 2D). These

oligosaccharides accumulated in the transgenic plants, as all the transgenic plants were found

to contain far more oligosaccharides than the wild-type plants contained. The amount of

oligosaccharides was closely related to cellulase activity levels in each of the seven nic lines.

Thus, the levels of expression and activity varied among the transgenic plants: they were

relatively high in trg1 to trg3 and relatively low in trg7, although a trace of

cello-oligosaccharides were detected even in trg7. This was probably because the poplar



9

cellulase expressed was discretely localized in the cellulose microfibrils of the apoplastic

spaces.

Based on the carbohydrate analyses of cell walls, it appears that the petiolule pulvinus

and the main vein in the transgenic plants contained less wall-bound xyloglucan than those in

the wild-type plants (Table 1). Increased cellulase activity in the wall did not decrease the

levels of cellulose; rather, cellulose content per plant increased with plant growth, i.e.,

cellulose per mg dry weight was not changed. The methylated sugars due to the minor

components consisted of 4-linked xylose, 4-linked galactose, and 4-linked mannose at a

constant proportion in both the transgenic and the wild-type plants (data not shown). These

methylated sugars are probably derived from xylan, galactan, and mannan at a ratio of

4.7:3.2:1. Therefore, the transgenic plants differ from the wild-type plants only in the amount

of xyloglucan present in the cell walls.

Admittedly, there is no correlation between cellulase activity (Figure 2B) and the extent

of xyloglucan solubilization (Table 1). Nevertheless, the levels of soluble

cello-oligosaccharides, which could be related to in vivo cellulase activity, were closely

related to cellulase activity levels across the seven transgenic lines and were consistently

higher in the transgenic plants than in the wild type, which again corresponds to cellulase

activity.

Growth response of transgenic plants

We generated seven independent transgenic sengon lines, four of which (trg1 to trg4) grew

significantly better than the wild type, although the overall morphology of these transgenic

plants was similar to that of the wild type (Figure 3). Two other transgenic lines (trg5 and trg6)

grew slightly better than the wild type, and one (trg7) grew about as well as the wild type.

Based on the expression of the transgene, the four lines which showed a high growth rate

(approximately 20-cm stem length) were selected for further analysis.

The transgenic sengon plants (trg1 to trg4) grew faster than the wild-type plants, although



10

the young seedlings (less than 30 cm in height) of both types sometimes grew at the same rate.

The stems of the transgenic plants elongated faster than those of the wild-type and had larger

diameters (Figure 3). The overall morphology of the transgenic plants was similar to that of

the wild type (Figure 4A). As with stem growth, the leaves of the transgenic plants were

greener and larger than those of the wild type (Figure 4B). In both types, the length and width

of the leaves increased to the same extent as the length of the main and minor veins, and this

increase in size was even distributed among all leaves of the plant. Parenchyma cells in leaves

of both types were identified in the central part of the petioles. Finally, both palisade and

epidermal cells were a little larger in the leaves of the transgenic plants than in the leaves of the

wild-type plants (data not shown).

Figure 5 shows the times at which the transgenic and wild-type plants started

leaf-opening before sunrise and completed leaf-closure during sunset. There was no difference

between transgenic and wild-type plants in the starting time of leaf opening (Figure 5A); the

leaves in both types of plants started opening around midnight and completed opening by 5:25

am. In contrast, the leaf pairs closed more slowly in the transgenic plants than in the wild-type

plants. This difference was visible in the upper, middle, and lower parts of the petioles (Figure

5B). In the transgenic plants, older leaves located at the middle and bottom part of the stems

started closing 30 min later than corresponding leaves in the wild-type plants. Likewise, in the

transgenic plants, leaves at the bottom part of the stem completed closing more than one hour

later than corresponding wild-type leaves. However, both the transgenic and wild-type plants

closed their leaves within a few minutes when they were placed in darkness at noon (data not

shown). In spite of this change to their normal conditions, they also started opening their

leaves at almost the same time (midnight) and finished opening completely by 5:25 am (Figure

5A).

Interestingly, the transgene had the opposite effect on excised main veins. When the main

vein with leaves was excised and placed on a paper towel, the pairs of leaves from the

transgenic plants closed faster than those of the wild type (Figure 6). The younger leaves in the



11

upper part of each plant started closing immediately; leaves in the middle part completed

closing more than one hour later; and leaves in the lower part completed closing two hours

later. The older leaves in the middle and lower parts of the transgenic plants completed closing

more than 30 minutes earlier than those of the wild type. Thus, when the main vein was

excised, closing was faster in the leaves of the transgenic plants than in those of the wild-type

plants, whereas in vivo, closing was slower in the transgenic leaves.

Xyloglucan endotransglucosylase activity was detected in situ on the transverse sections

of the petiolule pulvinus attached to the main vein using either fluorescent whole xyloglucan

(50 kDa) or fluorescent xyloglucan heptasaccharide (XXXG) (Takeda et al., 2002). Whole

xyloglucan was incorporated into the parenchyma cells (motor cells) of the pulvinus in both

genotypes, although the transgenic plants incorporated less xyloglucan than the wild type

(Figure 7). The incorporation of whole xyloglucan into the vascular bundle of the main vein

was also greater in the wild type than in the transgenic plants, although it was incorporated

into the connection between the petiolule pulvinus and main vein at the same rate in both

genotypes.

In contrast, the incorporation of XXXG, either into the parenchyma cells of the pulvinus

or into the vascular bundle of the main vein, was not observed in either genotype. These results

show that the walls of the parenchyma cells (motor cells) can incorporate whole xyloglucan

but not XXXG. The level of incorporation was higher in the wild-type plants than in the

transgenic plants, probably because the walls of the transgenic plants contain less endogenous

xyloglucan molecules to act as donors. Another possible explanation is that the increased

cellulase in the transgenic plants cleaves the glucan chains to which xyloglucan binds, so that

the glucan chains are washed out, making it more difficult for xyloglucan molecules to attach

firmly to the wall.

DISCUSSION



12

We have succeeded in producing transgenic sengon plants for the first time. Seven

independent shoots regenerated from 400 co-cultivated explants were demonstrated to be

transgenic; this represents a transformation frequency of 1.75%. So far, we have not

succeeded in either multiple propagation of the transgenic shoots or clonal propagation by

cutting their stems. Nevertheless, shoots and roots were induced in MS medium both in the

presence and absence of 4 µM benzylaminopurine. The shoots always formed from the

callus-like tissues of explants from the cut hypocotyls, although the shoots and roots directly

formed from the explants of hypocotyls in the case of Acacia sinuate (Vengadesan, et al.,

2006). Now sengon can be genetically modified to exhibit desirable traits, such as easy

degradation of cellulose microfibrils, as well as pathogen and insect resistance, qualities

which are hard to achieve by traditional breeding. It would also be expected to increase the

transformation frequency, particularly the induction of roots from shoots. The increased

frequency of root induction should accelerate the biotechnological application of sengon as a

biomass resource. It should be noted that wild-type sengon is already one of the fastest

growing tree species in the world; the transgenic sengon developed in this study grows even

faster and may ultimately be the fastest growing tree in the world.

Transgenic sengon overexpressing poplar cellulase (PaPopCel1) increased the size of

leaves by increasing cell volume, as other authors have demonstrated in Arabidopsis leaves

(Park et al., 2003). This phenomenon has been attributed to an increase in the specific activity

of cellulase, similar to the increase observed in transgenic Arabidopsis and poplar (Park et al,

2003; Shani et al., 2004). Nevertheless, no bulk degradation of cellulose was confirmed,

because the amount of cellulose per dry weight was nearly the same in the transgenic and the

wild-type plants. Therefore, we believe that cellulase promotes increased growth in transgenic

sengon by trimming off disordered glucose chains from cellulose microfibrils, where some

xyloglucan would otherwise be solubilized. Residual xyloglucan can adhere tightly to

cellulose microfibrils, perhaps as a monolayer coating the surface, but the transgenic plants

contained less xyloglucan bound to cellulose microfibrils. This agrees with a previous finding



13

that a decrease in xyloglucan tethers accelerates cell elongation (Takeda et al., 2002).

We have found that leaf movements are somehow disturbed by the transgene expression.

The transgenic plants opened their leaf pairs at the same time as the wild-type plants

(midnight), but started closing their leaves 30 minutes later and completed closing them more

than one hour later (Figure 5). Nevertheless, transgenic sengon still retains a type of circadian

rhythm in the opening and closing movements of leaves, although sterilized sengon (in vitro

culture) did not show closing movements at night, even if the plant was placed in darkness.

The opening and closing movements of leaves occur in the leaf bases (petiolule pulvinus) and

are caused by the expansion and contraction of the motor cells. Motor cells occupy most of the

space in the pulvinus, surrounding the central ring of the vascular bundle. The expansion and

contraction of these cells is believed to result from changes in their turgor, which is regulated

in turn by the flow of K+ ions across the cells’ thin walls.

In the case of transgenic sengon that overexpresses poplar cellulase, an increase in wall

plasticity may cause changes in normal leaf movements, because the movements correspond

to the balance between turgor pressure and wall pressure. Therefore, the turgor pressure in

transgenic sengon motor cells might increase during the day and decrease at night, while the

wall pressure remains constant. In the case of pea hypocotyls, the wall pressure in growing

cells is decreased during elongation, while the turgor pressure remains constant. Since the

walls of the motor cells in the pulvinus incorporated whole xyloglucan but not XXXG, wall

tightening rather than loosening could be required for preventing the expansion of the cells at a

cut surface (Takeda et al., 2002).

In this case, the xyloglucan endotransglucosylase activity could occur between

high-molecular-size xyloglucans in the cell walls, where the enzyme has both enzyme-donor

enzyme-acceptor complexes. Ueda and Nakamura (2007) suggested that leaf movements are

controlled by the balance of the concentrations of chemical substances involving an aglycon or

a glucoside, which induce opening and closing, respectively. Nakanishi et al. (2005) showed

that in excised leaves of O. corymbosa, the opening movement was sensitive to blue light but



14

not to red light. It should be noted that cellulase tends to affect the down-regulation of leaf

movements, whereas chemical substances and light tend to affect the up-regulation of leaf

movements.

Darwin (1880) postulated that the nyctinastic movements of plants occurred in order to

hide the upper surface of the leaves at night, because the upper leaf epidermis was believed to

be a sense organ for adaptive responses. Bunning and Moser (1969), on the contrary,

suggested that adaptive leaf movements occurred to protect the plant’s photoperiodic rhythm

against radiation from moonlight rather than against radiation from the leaf surfaces into the

sky. This cannot be considered a satisfactory explanation in the case of sengon, however,

because pairs of sengon leaves start to open at night. It should be noted that light does not

induce the opening movements during normal growth.

It is possible that the transgenic sengon plants have slightly higher photosynthetic

capability than the wild-type plants, since the leaf pairs of the transgenic plants close more

slowly than those of the wild-type plants. The sun always sets in Indonesia by 18:40, while the

transgenic plants keep their leaf pairs open for about an hour after the normal sunset time. We

are performing detailed analyses of the plant’s leaf movements to determine their

photosynthetic efficiency.

MATERIALS AND METHODS

Transgenic constructs

The PaPopCel1 cDNA fragment was excised from pBluescript SK by digestion with BamHI

and KpnI (Nakamura et al., 1995). The GUS-coding sequence of pBE2113 was removed from

the fragment by digestion with BamHI and SacI, and the cDNA fragment was inserted into the

pBE vector between the cauliflower mosaic virus 35S promoter and the Agrobacterium

tumefaciens NOS transcription terminator. The chimeric construct was introduced into the

disarmed A. tumefaciens strain LBA4404.



15

Plant transformation

Agrobacterium carrying plasmid-harboring poplar cellulase cDNA (PaPopCel1) and

selectable marker NPTII genes were cultured in YES medium (0.1% yeast extract, 0.5%

polypeptone, 0.5% sucrose, 0.0246% MgSO4) containing 50 µg ml-1 kanamycin. The bacterial

suspension was pelleted and resuspended with sterilized water. Seeds were germinated for two

weeks to produce hypocotyls elongating 1 to 2 cm in length.

Pieces of sengon stems (2 to 4 mm in length) excised from their hypocotyls were dipped

in diluted Agrobacterium solution (OD600 = 0.1) for 5 to 10 min and put on sterile filter paper,

then co-cultivated for 1 day on half-strength hormone-free Murashige-Skoog (MS) medium.

Next, the pieces of stems were placed on MS agar medium containing 600 µg ml-1 kanamycin

for 2 weeks, after which they were washed with a water solution containing 400 µg ml-1

Claforan. The stems were cultured several times by transplantation on MS agar media

containing 600 µg ml-1 kanamycin and 4 µM benzylaminopurine for 2 to 4 months, under 14 h

day (4,000 lux)/10 h night cycles, after which they were placed on a medium containing 300

µg ml-1 kanamycin for 2 weeks. Shoots 5 mm in length were excised from the medium and

cultured again on a medium containing 300 µg ml-1 kanamycin in the absence of plant

hormone. Roots were then formed in the medium for 2 to 4 weeks, and the plantlets were

further cultured for growth in the medium for 2 months. Plantlets approximately 10 to 15 cm

long were planted in soil.

RNA isolation and reverse transcription-PCR analysis

Total RNA was isolated from the main vein with petiolule pulvinus (Ohmiya et al., 2000). The

first-strand cDNA was synthesized using 5 µg of total RNA at 42 oC for 1 h using oligo(dT) (n

= 20) and SuperScript II reverse transcriptase (Gibco BRL, Rockville, MD, USA). PCR was

performed with final volumes of 20 µl containing 0.5 unit of cDNA polymerase mix (Clontech,

Palo Alto, CA, USA), 0.2 mM dNTPs, 3.5 mM Mg(OAc)2 and 0.4 µM gene-specific primers.

The forward primer was CACCACGCAATGTGTACAAAGTAACCATC (nucleotide



16

position 512-540) and the reverse primer was

GGGTGTATATTGGGCCTGGAAACTAGAAGTT (nucleotide position 993-1,023) with

the first-strand cDNA. The PCR reaction was initially denatured at 94 oC for 5 min and in the

subsequent cycles at 94 oC for 30 sec. Annealing and elongation cycles were both performed

for 3 min at 68 oC. PCR products were size-separated by electrophoresis in a 0.9 % agarose gel

and blotted onto nylon membranes (Hybond-N+ from Amersham-Pharmacia Biotech, Uppsala,

Sweden).

Membranes were hybridized in 5 x SSC, with 1.0 % blocking reagent, 0.1%

lauroylsarcosine and 0.02 % SDS at 42 oC to digoxigenin-dUTP-labeled probes. Probes were

labeled using a DIG-DNA labeling kit (Roche Diagnostics, Tokyo, Japan), which were

synthesized from PopCel1 cDNA by gene-specific primers.

Following hybridization, the membranes were washed in 2 x SSC for 5 min at room

temperature and then two times in 0.1 x SSC with 0.1 % SDS at 68 oC, for 15 min each time.

The washed membranes were developed using a DIG-DNA Detection kit (Roche Diagnostic)

for chemiluminescent detection.

Western blot analysis

After the leaves were removed, the main vein with petiolule pulvinus in the middle part of the

petiole was homogenized in 20 mM sodium phosphate buffer (pH 6.2) in a mortar and the wall

residue was washed three times. The wall-bound proteins were extracted from the wall residue

with a buffer containing 1 M NaCl. The proteins were then subjected to electrophoresis with

10% SDS-PAGE, electrotransferred to Hybond-C Extra (Amersham), and probed with an

antibody against the PopCel sequence, followed by a second antibody using a Toyobo-ABC

high-HRP Immunostaining Kit (Toyobo, Osaka, Japan). Seven lines of transgenic plants were

assayed.

Cellulase activity assay



17

Each enzyme preparation was obtained from the wall residue of the main vein with petiolule

pulvinus in the middle part of the petiole with a buffer containing 1 M NaCl, and its activity

was assayed viscometrically at 35 oC for 2 h, using 0.1 ml of the enzyme preparation plus 0.9

ml of 10 mM sodium phosphate buffer (pH 6.2) containing 0.65% (W/V)

carboxymethylcellulose in Cannon semimicroviscometers (Cannon Instrument Co., State

College, PA, USA). One unit of activity is defined as the amount of enzyme required to cause

0.1% loss in viscosity in 2 h under such conditions (Ohmiya et al., 1995). Protein was

determined using the Coomassie Plus Protein Assay Reagent (Pierce, Rockford, IL, USA),

according to the method described by Bradford (1976).

Determination of cello-oligosaccharides

After the leaves were removed, the main vein with petiolule pulvinus in the middle part of the

petiole was homogenized in 20 mM sodium phosphate buffer (pH 6.2) in a mortar. The soluble

extract was boiled for 5 min and left at room temperature for 24 h to equilibrate the anomer

configuration between α- and β-types. After centrifugation, the amount of

cello-oligosaccharides was determined by cellobiose dehydrogenase purified from conidia

spores of Phanerochaete chrysosporium (Tominaga et al., 1999). The reaction mixture

contained 90 mU (10 µl) of cellobiose dehydrogenase, 50 µM Cyt c (10 µl), and sample

solution (70 µl) in 100 mM sodium acetate buffer, with a pH of 4.2. After incubation for 5 min

at room temperature, the absorbance at 550 nm was determined. A linear standard curve was

obtained with a standard cellobiose solution, and an absorbance of 0.5 % corresponded to

approximately 270 ng per 100 µl of reaction mixture for cellobiose.

Fractionation and measurement of wall components

The main vein and petiolule pulvinus in the middle part of the petiole were separated after the

leaves had been removed. Each sample was ground in liquid nitrogen and freeze-dried before

its dry weight was determined. The sample was successively extracted 6 times with 10 mM



18

sodium phosphate buffer (pH 7.0) and 3 times with 24% KOH containing 0.1% NaBH4 at less

than 45 oC for 3 h in an ultrasonic bath. The insoluble wall residue (the cellulose fraction) was

washed with water and solubilized with ice-cold 72% sulfuric acid. Total sugar in each

fraction was determined by the phenol/sulphuric acid method (Dubois, 1956). The xyloglucan

level was determined by the iodine/sodium sulfate method (Kooiman, 1961).

Growth measurement

The growth response of the transgenic plants was monitored after they were transplanted in

soil and habituated for 3 weeks under non-sterile conditions. Each stem (around 15 cm) was

marked at a height of 5 cm, which was used as a reference point for measuring the height,

diameter, and number of internodes every third day. The length of the stem was determined

from the top to the reference point. Dry weight was determined after freeze-drying the

samples.

The timing of the leaf movement was determined by observing the movements every day

for 20 days during both the rainy (January) and dry (May) seasons. The closing movements of

the leaves with the base of their main vein excised occurred between 10:00 am and 11:00 am

during both the rainy (January) and dry (May) seasons. The veins with leaves attached were

placed on paper towels immediately after excision.

Four transgenic lines, trg1, trg2, trg3 and trg4, were used to observe the opening and

closing movements of leaves. These plants had 9 or 10 petioles each, all of which were more

than 10 cm long. The lower part of the petiole was defined as the 2nd petiole from the bottom;

the middle part as 5th or 6th petiole from the bottom; and the upper part as the 9th or 10th (or

newest) petiole. All the pairs of leaves attached to the main vein in the petiole were observed

to determine the opening and closing movements.

Fluorescent xyloglucans



19

Fluorescent xyloglucan (Takeda et al., 2002) was prepared by dissolving 10 mg of CNBr and

20 mg of pea xyloglucan (50 kDa) in 1 ml of water and adjusting the pH to 11.0 by adding

NaOH. The activated polysaccharide was incubated with 4 mg fluoresceinamine overnight at

room temperature. The fluorescein-labeled xyloglucan was purified by gel filtration on a

Sephadex G-50 column (Amersham-Pharmacia Biotech, Uppsala, Sweden). Calculations

showed that 1 µmol of fluorescein incorporated into 110 µmol of sugar residues,

corresponding to a substitution rate of 3.7 mol fluorescein per mole of xyloglucan. To prepare

fluorescent XXXG (Fry, 1997), 40 mg of XXXG was aminated with 2 ml of 0.4 M sodium

cyanotrihydroborate in 2.0 M ammonium chloride at 100 °C for 120 min. The aminated

oligosaccharide was purified by gel filtration on Bio-Gel P-2 and incubated with 50 mg

fluorescein isothiocyanate (FITC) in sodium carbonate bicarbonate buffer (pH 9.0) for 2 h at

room temperature. The oligosaccharide-FITC conjugate was purified by gel filtration on

Bio-Gel P-2.

In situ xyloglucan endotransglucosylase activity

The transverse sections (200 µm) of the main vein including petiolule pulvinus with

fluorescent derivatives were incubated for 15 min in 300 µl of 2 mM MES/KOH buffer (pH

6.2) containing 0.2 mM fluorescent whole xyloglucan or 9 mM fluorescent XXXG while

being shaken in darkness at 23 °C. The sections that were incubated with whole xyloglucan

were washed three times in 0.01 M NaOH for 30 min. Those incubated with XXXG were

washed with 5% formic acid in 90% ethanol for 5 min followed by 5% formic acid for 5 min

(Takeda et al., 2002). The sections were washed twice with water and examined using a Zeiss

Axioscope microscope equipped with epifluorescence illumination (Oberkochen, Germany).

ACKNOWLEDGEMENTS

We thank Takahide Tsuchiya and Nobuyuki Kanzawa (Department of Chemistry, Sophia

University) for valuable discussions during the final preparation of the paper.



20

LITERATURE CITED

Binkley D, Senock R, Bird S, Cole TG (2003) Twenty years of stand development in pure

and mixed stands of Eucalyptus saligna and nitrogen-fixing Facaltaria moluccana. Forest

Ecol Manage 182: 93-102

Bon MC, Bonal D, Goh DK, Monteuuis O (1998) Influence of different macronutrient

solutions and growth regulators on micropropagation of juvenile Acacia mangium and

Paraserianthes falcataria explants. Plant Cell Tissue Organ Culture 53: 171-177

Bradford MN (1976) A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Ana Biochem 72:

248-254

Bunning E, Moser I (1969) Interference of moonlight with the photoperiodic measurement of

time by plants, and their adaptive reaction. Proc Natl Acad Sci USA 62: 1018-1022

Darwin C (1880) The Power of movement in Plants, John Murray, London

Dubois M, Gilles KA, Hamilton JK, Rebers PA, Smith F (1956) Colorimetric method for

determination of sugars and related substances. Anal Chem 28: 350-356

Fry SC (1997) Novel ‘dot-blot’ assays for glycosyltransferases and glycosylhydrolases:

optimization for xyloglucan endotransglycosylase (XET) activity. Plant J 11: 1141-1150

Harpster MH, Dawson DM, Nevins DJ, Dunsmuir P, Brummell DA (2002) Constitutive

overexpression of ripening-related pepper endo-1,4-beta glucanase in transgenic tomato

fruit does not increase xyloglucan depolymerization of fruit softening. Plant Mol Biol 50:

357-69

Hayashi T (1989) Xyloglucans in the primary cell wall. Ann Rev Plant Physiol Plant Mol Biol

40: 139-168

Hayashi T, Yoshida K, Park YW, Konishi T, Baba K (2005) Cellulose metabolism in

plants. Inter Rev Cytol 247: 1-34



21

Kooiman P (1961) The constitution of Tamarindus-amyloid in plant seeds. Recl Trav Chim

Pays-Bas 80: 849-865

Kurinobu S, Prehatin D, Mohanmad N, Matsune K, Chigira O (2007) A provisional

growth model with a size-density relationship for a plantation of Paraserianthes falcataria

derived from measurements taken over 2 years in Pare, Indonesia. J Forest Res 12: 230-236

Merkel RC, Pond KR, Burns JC, Fisher DS (2000) Rate and extent of dry matter

digestibility in sacco of both oven- and freeze-dried Paraserianthes falcataria, Calliandra

calothyrsus, and Gliricidia sepium. Trop Agriculture 77: 1-5

Nakamura S, Hayashi T (1993) Purification and properties of extracellular

endo-1,4-β-glucanase from suspension-cultured poplar cells. Plant Cell Physiol 34:

1009-1013

Nakamura S, Mori H, Sakai F, Hayashi T (1995) Cloning and sequencing of cDNA for

poplar endo-1,4-β-glucanase. Plant Cell Physiol 36: 1229-1235

Nakanishi F, Nakazawa M, Katayama N (2005) Opening and closing of Oxalis leaves in

response to light stimuli. J Biol Education 39: 87-91

Nicol F, His I, Jauneau A, Vernhettes S, Canut H, Hofte H. (1998) A plasma

membrane-bound putative endo-1,4-β-glucanase is required for normal wall assembly and

cell elongation in Arabidopsis. EMBO J 17: 5563-5576

Ohmiya Y, Nakamura S, Sakai F, Hayashi T (1995) Purification and properties of

wall-bound endo-1,4-β-glucanase from suspension-cultured poplar cells, Plant Cell Physiol

36: 607-614

Ohmiya Y, Samejima M, Amano Y, Kanda T, Sakai F, Hayashi T (2000) Evidence that

endo-1,4-ß-glucanase act on cellulose in suspension-cultured poplar cells. Plant J 24:

147-158

Ohmiya Y, Nakai T, Park YW, Aoyama T, Oka A, Sakai F, Hayashi T (2003) The role of

PopCel1 and PopCel2 in poplar leaf growth and cellulose biosynthesis, Plant J 33:

1087-1097



22

Otsamo R (1998) Effect of nurse tree species on early growth of Anisoptera marginata Korth.

(Dipterocarpaceae) on an Imperata cylindrica (L.) Beauv. grassland site in south

Kalimantan, Indonesia. Forest Ecol Manage 105: 303-311

Park YW, Tominaga R, Sugiyama J, Furuta Y, Tanimoto E, Samejima M, Sakai F,

Hayashi T (2003) Enhancement of growth by expression of poplar cellulase in Arabidopsis

thaliana. Plant J 33: 1099-106

Ragaukas AJ, Williams CK, Davison BH, Britovsek G, Cairney J, Eckert CA, Frederick

Jr WJ, Hallett JP, Leak DJ, Liotta CL, Mielenz JR, Murphy R, Templer R,

Tschaplinski T (2006) The path forward for biofuels and biomaterials. Science 311:

484-489

Shani Z, Dekel M, Tsabary G, Goren R, Shoseyov O (2004) Growth enhancement of

transgenic poplar plants by overexpression of Arabidopsis thaliana endo-1,4-β-glucanase

(cel1). Molecular Breed 14: 321-330

Shively GE, Zelek CA, Midmore DJ, Nissen TM (2004) Carbon sequestration in a tropical

landscape: an economic model to measure its incremental cost. Agroforest Systems 60:

189-197

Siregar UJ, Rachmi A, Massijaya MY, Ishibashi N, Ando K (2007) Economic analysis of

sengon (Paraserianthes falcataria) community forest plantation, a fast growing species in

East Java, Indonesia. Forest Policy Economics 9: 822-829

Takeda T, Furuta Y, Awano T, Mizuno K, Mitsuishi Y, Hayashi T (2002) Suppression and

acceleration of cell elongation by integration of xyloglucans in pea stem segments. Proc Natl

Acad Sci USA 99: 9055-9060

Tominaga R, Samejima M, Sakai F, Hayashi T (1999) Occurrence of

cello-oligosaccharides in the apoplast of auxin-treated pea stems. Plant Physiol. 199:

249-254

Ueda M, Nakamura Y (2007) Chemical basis of plant leaf movement. Plant Cell Physiol 48:

900-907



23

Vengadesan G, Amutha S, Muruganantham M, Anand RP, Ganapathi A (2006)

Transgenic Acacia sinuata from Agrobacterium tumefaciens-mediated transformation of

hypocotyls. Plant Cell Rep 25: 1174-1180

Table I. Xyloglucan and cellulose content in cell walls

Xyloglucan was determined from 24%KOH-soluble fractions.

——————————————————————————— Petiolule pulvinus Main vein



24

Plant —————————— —————————— Xyloglucan Cellulose Xyloglucan Cellulose ———————————————————————————

µg mg-1 dry weight

wt 41.1 ± 2.2 370 ± 32 16.0 ± 2.2 454 ± 23

trg1 9.1 ± 1.4 371 ± 18 8.1 ± 0.9 460 ± 55

trg2 8.3 ± 1.3 372 ± 20 9.1 ± 1.2 455 ± 32

trg3 8.8 ± 1.8 378 ± 21 8.2 ± 0.8 461 ± 31

trg4 10.4 ± 1.5 377 ± 28 8.7 ± 1.6 451 ± 43

trg5 11.6 ± 1.8 374 ± 32 8.9 ± 0.9 452 ± 53

trg6 10.1 ± 2.1 385 ± 38 7.9 ± 1.3 460 ± 47

trg7 12.0 ± 2.8 366 ± 24 8.2 ± 1.4 458 ± 44 ——————————————————————————— Three separate main veins for each plant were used for the determination.

SE values were calculated from three samples per line.



25

FIGURE LEGENDS

Figure 1. Regenerating shoots and roots in the transgenic and wild-type plants.

(A) Regenerating shoots of the transgenic plants. Arrows indicate adventitious buds (bar = 3

mm). (B) Growth of regenerated transgenic shoots. The shoots had pinnate leaflets during

elongation (bar = 2.0 cm). (C) Regenerating transgenic roots. The plantlets producing roots

had pinnate leaves (bar = 1 cm). (D) Regenerated plantlets of the wild-type plants (bar = 1 cm).

Figure 2. Analysis of PaPopCel1 expression in the main vein with petiolule pulvinus.

(A) RT-PCR Southern blot analysis of PaPopCel1 mRNA. The relative amounts of mRNAs

by reverse transcription-PCR analysis at 15 cycles are shown. (B) Western blot analysis of cell

wall proteins. Five µg of protein was used for each. (C) Level of cellulase activity.

(D) Level of cello-oligosaccharides. Three separate main veins for each plant were used for

the determination.

Figure 3. Effect of PaPopCel1 transgenes on stem growth.

(A) Increase in stem length. (B) Increase in stem diameter. Closed circle, trg1; open circle,

trg2; closed square, trg3; open square, trg4; open triangle, wild-type.

Figure 4. Wild-type and transgenic (trg1) plants.

The wild-type and transgenic plants are shown on the left and right, respectively, at 390 days

after adventitious shoot formation. (A) Whole plants (bar = 10 cm). (B) Leaves (bar = 1.5 cm).



26

Figure 5. Leaf movements of upper, middle, and lower parts of petioles in the wild-type and

the transgenic plants. (A) Opening: all the leaves are open (left, bar = 4 cm). (B) Closing:

closing leaves are distinguishable as yellow and white leaves (left, bar = 4 cm). The lower part

of the petiole was defined as the 2nd petiole from the bottom; the middle part as 5th or 6th

petiole from the bottom; and the upper part as the 9th or 10th (or newest) petiole. All the leaves

in the petiole were observed to determine the opening and closing times of leaf pairs from start

to finish. SE values were calculated from four lines of trg1, trg2, trg3, and trg4.

Figure 6. Closing movements of leaves whose main vein was excised.

Leaves in the vein at the upper, middle, and lower parts of petioles are shown from left to right.

SE values were calculated from four lines of trg1, trg2, trg3, and trg4. Bar = 2 cm.

Figure 7. In situ xyloglucan endotransglucosylase activity incorporating green-fluorescent

whole xyloglucan for 15 min on the transverse section (200 µm) of the petiolule pulvinus

attached to the main vein of trg1. The tissues of the pulvinus and vein are shown in the upper

and lower areas, respectively, in the images of the wild-type (A) and transgenic plant (B). The

arrow indicates the incorporated whole xyloglucan in the parenchyma motor cells. The red

color is due to the autofluorescence of chloroplasts. Bar = 0.5 mm.

















Documents

Overexpression of poplar cellulase accelerates growth and disturbs