Oxidative damage of mitochondrial and nuclear DNA induced by ionizing radiation in human hepatoblastoma cells

PII S0360-3016(98)00185-0

● Biology Contribution

OXIDATIVE DAMAGE OF MITOCHONDRIAL AND NUCLEARDNA INDUCED BY IONIZING RADIATION IN

HUMAN HEPATOBLASTOMA CELLS

ALBERT MORALES, PH.D., MERCE MIRANDA, M.S., ALBERTO SANCHEZ-REYES, PH.D.,*ALBERTO BIETE, M.D.,* AND JOSE C. FERNANDEZ-CHECA, PH.D.

Instituto Investigaciones Biome´dicas, August Pi i Sun˜er (IDIBAPS), CSIC-UB, and Liver Unit, *Radiotherapy Service,Hospital Clinic i Provincial, Universidad de Barcelona, Barcelona 08036, Spain

Purpose: Since reactive oxygen species (ROS) act as mediators of radiation-induced cellular damage, the aim ofour studies was to determine the effects of ionizing radiation on the regulation of hepatocellular reducedglutathione (GSH), survival and integrity of nuclear and mitochondrial DNA (mtDNA) in human hepatoblastomacells (Hep G2) depleted of GSH prior to radiation.Methods and Materials: GSH, oxidized glutathione (GSSG), and generation of ROS were determined inirradiated (50–500 cGy) Hep G2 cells. Clonogenic survival, nuclear DNA fragmentation, and integrity of mtDNAwere assessed in cells depleted of GSH prior to radiation.Results: Radiation of Hep G2 cells (50–400 cGy) resulted in a dose-dependent generation of ROS, an effectaccompanied by a decrease of reduced GSH, ranging from a 15% decrease for 50 cGy to a 25% decrease for 400cGy and decreased GSH/GSSG from a ratio of 17 to a ratio of 7 for controls and from 16 to 6 for diethyl maleate(DEM)-treated cells. Depletion of GSH prior to radiation accentuated the increase of ROS by 40–50%. Thedepletion of GSH by radiation was apparent in different subcellular sites, being particularly significant inmitochondria. Furthermore, depletion of nuclear GSH to 50–60% of initial values prior to irradiation (400 cGy)resulted in DNA fragmentation and apoptosis. Consequently, the survival of Hep G2 to radiation was reducedfrom 25% of cells not depleted of GSH to 10% of GSH-depleted cells. Fitting the survival rate of cells as afunction of GSH using a theoretical model confirmed cellular GSH as a key factor in determining intrinsicsensitivity of Hep G2 cells to radiation. mtDNA displayed an increased susceptibility to the radiation-induced lossof integrity compared to nuclear DNA, an effect that was potentiated by GSH depletion in mitochondria (10–15%intact mtDNA in GSH-depleted cells vs. 25–30% of repleted cells).Conclusion: GSH plays a critical protective role in maintaining nuclear and mtDNA functional integrity,determining the intrinsic radiosensitivity of Hep G2. Although the DNA repair is a complex process that is notyet completely understood, the protective role of GSH probably does not seem to involve the repair of classicalDNA damage but may relate to modification of DNA damage dependent signaling. © 1998 Elsevier Science Inc.

Oxidative stress; GSH; Antioxidants; Radiobiology.

INTRODUCTION

Irradiation produces physical and chemical damage to tis-sues leading to cell death or neoplastic transformation.Ionizing radiation interacts with cells transferring energy tomolecular systems in discrete quanta. In the presence ofoxygen, ionizing radiation leads to formation of reactiveoxygen species (ROS), such as superoxide anion, hydrogenperoxide, hydroxyl radical, and singlet oxygen (1–4). Al-

though the hydroxyl radical is thought to be the mostimportant ROS with respect to DNA damage–mediatedclonogenic cell death, other ROS have been suggested toplay a role in radiation injury (1, 2), possibly by effects onother biochemical targets, such as membrane lipids (5, 6).The combination of direct ionization of DNA and reactionof hydroxyl radical with DNA leads to the production ofclustered DNA lesions, such as double-strand breaks (DSB).These clustered lesions and their repair are considered to be

Reprint requests to: J. C. Fernańdez-Checa, Liver Unit, HospitalClinic i Provincial, Villarroel, 170, E-08036 Barcelona, Spain.Acknowledgments—Supported by grants from National Institute ofAlcohol Abuse and Alcoholism (NIAAA) AA09526, DirecciońGeneral Polı´tica Cientı´fica y Tecnica (DIGICYT PB92-1110; PM95-0185), Fondo Investigaciones Sanitarias (FISS 94-0046/01),Plan Nacional I1D Grant 97-0089, and Europharma. Dr. Moralesis a Fellow from the FISS. We are grateful to Dr. Antoni Barri-entos for his assistance with PCR experiments.

Accepted for publication 29 April 1998.1 Abbreviations used in this paper: BSO, buthionine-L-sulfoxi-

mine; CMFDA, 5-chloromethylfluorescein diacetate; DCFDA, 29-79-dichlorofluorescin diacetate; DCF, dichlorofluorescein; DEM,diethyl maleate; DPA, diphenylamine; DSB, double-strand breaks;GSH, reduced glutathione; GSSG, oxidized glutathione; mtDNA,mitochondrial DNA.

Int. J. Radiation Oncology Biol. Phys., Vol. 42, No. 1, pp. 191–203, 1998Copyright © 1998 Elsevier Science Inc.Printed in the USA. All rights reserved

0360-3016/98 $19.001 .00

191

the principal determinants of cell killing by ionizing radia-tion (7).

Since ROS appear to be mediators of the cellular damageinduced by radiation, factors that regulate the fate of suchspecies may be of great importance in the protection of cellsagainst radiation-induced damage. In this regard, reducedglutathione (GSH), the main nonprotein thiol, fulfils a widevariety of important functions. In particular, GSH plays acritical role in protecting cells against a varied repertoire ofoxidative stress-related insults including radiation (8–11).GSH, as substrate for the GSH S-transferase, conjugateselectrophiles, which otherwise would react with nucleo-philic centers in essential cellular macromolecules, such asproteins, DNA, and RNA, compromising cell viability andfunction. GSH is also a substrate for the GSH peroxidase,playing a critical role in the elimination of hydrogen per-oxide, as well as others organic hydroperoxides, and toxicchemicals generated from the radiated membrane. In addi-tion, GSH by modulating the thiol disulfide status of pro-teins involved in the repair of DNA damage participates inthe maintenance of DNA integrity (7–10).

Unlike nuclear DNA, the mitochondrial genome is par-ticularly vulnerable to the damaging effects mediated byROS (12, 13). The mtDNA located in the matrix, near theinner mitochondrial membrane, is exposed to the constantgeneration of semiquinone radicals and ROS produced byaerobic respiration (8, 13). The mtDNA is a circular double-stranded DNA of 16.6 kb that is replicated within mitochon-dria (14, 15). The mitochondrial genome lacks protectivehistone-like proteins and is replicated by DNA polymerasegamma without proofreading; these features may contributeto the high susceptibility of this genome to oxidative-relateddamage. Besides the exposure of the mtDNA to oxidativespecies generated endogenously in the mitochondrial elec-tron transport chain, the DNA molecule is vulnerable toattack by mutagens, exogenously derived ROS and variousfree radicals (16, 18). Mitochondria have inherent defensivemechanisms to counterbalance the adverse effects exertedby ROS. Hence, although this organelle lacks catalase, it isequipped with other antioxidant systems, most importantlymanganese–superoxide dismutase (Mn-SOD) and the GSHredox cycle. The latter would metabolize peroxide speciesgenerated by the action of Mn-SOD. Although previousstudies have demonstrated that overexpression of this en-zyme affords the survival of tumor cells after exposure to awide variety of oxidative stress-generated stimuli includingionizing radiation (4), the role of GSH in maintaining themtDNA structural integrity upon exposure of cells to radi-ation has not been examined.

Previous studies have provided evidence showing thatmany of the damaging effects of radiation are due to thegeneration of a particular reactive species of ROS, such ashydroxyl radical, rather than to the overall levels of ROSinduced by radiation (17, 18). However, it is now increas-ingly recognized that in addition to the effects due to theaction of hydroxyl radical, other mediators, which arise at

specific sites of irradiated cells, such as the plasma mem-brane, may also contribute to the varied repertoire of effectsevoked by radiation, pointing to the existence of numerousmolecular targets which contribute to the radiation response(5, 6, 21).

The importance of GSH to the cellular radiation responsehas been suggested in previous reports using a wide varietyof tumor cells lines (22–24). Most of these studies indicatedthat the survival of radiated cells was not dependent on thelevels of GSH except under hypoxia (25), although sensiti-zation of some cells under aerobic conditions by GSHdepletion has been reported (24). Depletion of GSH leads tomoderate and variable radiosensitization of hypoxic cells,but greatly enhances the effectiveness of electron-affinichypoxic cell radiosensitizers (25). GSH depletion has beenreported to have no effect on the shoulder of the radiationsurvival curve, which is regarded to be indicative of DNArepair (26), while oxidation of GSH results in a decrease inthe shoulder of the radiation survival curve and in inhibitionof DNA repair (25). However, the effects of radiation on theregulation of hepatocellular GSH and the role of mitochon-drial GSH in maintenance of mtDNA in irradiated cellshave not been reported. Thus, the purpose of this study wasto examine the reciprocal regulation between cellular GSHand radiation in determining the survival of Hep G2 cellsand the role of GSH in the integrity of mitochondrial DNA(mtDNA).

EXPERIMENTAL PROCEDURES

Materials and cell culturesGSH, oxidized glutathione (GSSG), buthionine-L-sul-

foximine (BSO), diethyl maleate (DEM), and diphe-nylamine (DPA) were obtained from Sigma Chemical Co.(St. Louis, MO). 29-79-dichlorofluorescin diacetate(DCFDA), cis-parinaric acid, propidium iodide, 5-chlorom-ethylfluorescein diacetate (CMFDA), and Hoechst 33258were obtained from Molecular Probes (Eugene, OR). Sili-cone and mineral oil were from Aldrich Chemical Co.(Madrid, Spain). Human hepatoblastoma cell lines, Hep G2,were purchased from American Type Culture Collection(ATTC) and routinely cultured in Dulbecco’s modified Ea-gle’s medium (DMEM) containing 10% fetal bovine serum(FBS), penicillin (0.1 mg/ml), and streptomycin (0.1 mg/ml)in a humidified atmosphere of 5% CO2 /95% air, at 37°Cand were subcultured every 7 days, changing culture me-dium every 3–4 days. Rat hepatocytes were isolated bycollagenase perfusion and cultured in rat tail collagen asdescribed previously (27, 28).

Cell radiationPrimary cultured rat hepatocytes or subconfluent Hep G2

cells were pelleted and washed once with phosphate-buff-ered saline (PBS) and resuspended at 103 106 cells/ml. Toensure an homogeneous radiation dose on all samples, cellswere added to 1 cm polystyrene tube and filled with PBS.Cells were irradiated in a linear accelerator (KDS Siemens)

192 I. J. Radiation Oncology● Biology ● Physics Volume 42, Number 1, 1998

at room temperature using an electron beam of 18 MeV.Doses between 50 and 500 cGy were applied at a rate of 300cGy/min. Estimate errors on dose have been calculated to bebelow 1%. Immediately after radiation cells were culturedas indicated above. Hep G2 cells were maintained in culturefor 15 days. Cells were counted automatically with aCoulter Multisizer II and verified using an hemocytometer.Cell viability was determined by trypan blue exclusion(0.2%) and propidium iodide labeling. In order to controlfor nonspecific effects due to handling of cells, controlnonirradiated cells were handled exactly as irradiated cells.

Clonogenic assayCells suspensions of Hep G2 were irradiated and imme-

diately cells were plated in triplicate at 100 to 1000 cells per60-mm dish. After 10 days, the plates were fixed, stainedwith 50% methanol, 15% acetic acid, and 0.2% Coomassiebrilliant blue R and colonies containing.50 cells werescored.

Fractionation of cellsTo estimate the GSH content after radiation in cellular

compartments containing DNA, cells were fractionated toobtain mitochondria and nuclei. Hep G2 or rat hepatocyteswere incubated with digitonin to selectively disrupt theplasma membrane as previously described (29, 30). Theability of digitonin to permeabilize plasma membrane ofcells is due to the interaction of digitonin with the choles-terol of the bilayer, the content of which is lower in mito-chondrial membranes. Briefly, in 1.5-ml Eppendorf tubecontaining from the bottom: 0.1 ml 40% glycerol, 0.5 mlsilicone–mineral oil mixture (6:1), and 0.1 ml top layer of19.8 mM EDTA, 250 mM mannitol in 17.0 mM HEPES, pH7.4, 0.5 ml of the cell suspension was mixed with the toplayer and centrifuged at 13,0003 g at room temperature for3 min. Separation of cytosol and mitochondrial fraction wasachieved by including 0.24 mg/ml digitonin in the HEPESbuffer. Intact mitochondrial fraction was recovered in thebottom of the tube as their density is sufficient to go throughthe silicone–mineral oil layer. Nuclear fraction was pre-pared from hepatocytes by lysing cells with Nonidet P-40(0.25%) in 10 mM HEPES, pH 7.8 containing 10 mM KCl,2 mM MgCl2, 1 mM dithiothreitol (DTT), 0.1 mM EDTA,0.1 mM phenylmethylsulfonyl fluoride, and 0.05 mg/mlaprotinin. Cells were vigorously mixed and centrifuged at4°C at 13,0003 g (31). The integrity of isolated nuclei wasverified by examination on a hemocytometer with a phasecontrast microscope to ensure that cells had been lysed andnuclei appeared free of cytoplasmic material. Portions ofcytosol, mitochondria, and nuclei were processed immedi-ately for GSH determination.

Determination of GSHCells and subcellular fractions were treated with 10%

trichloroacetic acid (1:1, v/v) and centrifuged 13,0003 g

for 5 min. Supernatants (0.5 ml) were incubated with 100mlof iodoacetic acid (100 mM) and the pH adjusted to 8.5–9.0.To this mixture a volume of 0.5 ml of dinitrofluorobenzene(1.5% in ethanol) was added and incubated at 4°C over-night. Before analysis by high-performance liquid chroma-tography (HPLC), the mixture was centrifuged at 13,0003g for 2 min, and the supernatant injected into an amino-propiryl column (Waters Mildord, MA) (29, 32). This pro-cedure minimizes oxidation of GSH to GSSG, as verified bypreparation of GSH standards, which revealed that morethan 97% of GSH was in the reduced form. To monitor theextent of nonspecific loss of intracellular GSH due to dam-age induced by manipulations of culture dishes, cells wereincubated with14C-inulin (0.7mCi/ml), followed by wash-ing as described previously (27). Incorporation of countsinto cells reflects the contribution of trapping and nonspe-cific leakage of plasma membrane, although this approachdoes not entirely exclude the possibility of leakiness tosmaller molecules like GSH.

Alternatively, intracellular thiol content, including GSH,was analyzed by flow cytometry using the thiol probeCMFDA (33). Cells were labeled with CMFDA, 50mM at37°C for 10 min in the dark, followed by washing to removeexcess probe. Fluorescence was determined using a FAC-Star Flow cytometer (Becton Dickinson, San Jose, CA).Similar levels of GSH were obtained by flow cytometry orHPLC and the depleting effects of radiation on GSH weresimilarly observed when GSH levels were determined byflow cytometry.

Determination of diameter and cell volumeThe diameter of irradiated cells was determined with a

Coulter Multisizer-II following harvesting of cells withtrypsin-EDTA. Alternatively, cell volume of irradiated cellswas measured by incubation of cells with3H-2-deoxyglu-cose (2.1 Ci/mmol; 1mCi/ml for 30 min) as describedpreviously (27).

Measurement of ROSProduction of reactive oxygen species, mainly hydrogen

peroxide and other organic peroxides (34) was monitoredspectrofluorimetrically using DCFDA. Oxidation ofDCFDA by peroxides yields the fluorescent derivative di-chlorofluorescein (DCF). DCFDA, 2mM in ethanol wasadded to the cells immediately before radiation and fluores-cence of DCF determined at 529 nm/503 nm (emission/excitation) after 30 minutes as described previously (31).The final ethanol concentration was 0.1% and did not affectviability nor DCF fluorescence.

Modeling of cell survival to radiation as a function ofcell GSH

Cells were preincubated with DEM at various concentra-tions (0.05–0.8 mM) for 15 minutes to obtain different

193Oxidative DNA damage and radiation● A. MORALES et al.

degrees of cellular depletion of GSH. Survival of irradiatedcells was determined by clonogenic assay as describedabove and plotted as a function of the dose of radiationadministered. Experimental points were fitted according tothe repair saturation model described previously in detail(35) using the equation,

S5 exp @ 2 AD 1 ~ AB/C ~1-exp~ 2 CD!!#

whereS is the surviving cellular fraction,D the adminis-tered dose,A the probability per unit dose to produce lethaldamage,B the repair recovery capacity of cells, andC theprobability per unit dose that the repair is affected byradiation.

DNA fragmentationFragmentation of DNA in irradiated cells was assessed by

DPA (36). Cells were homogenized in lysis buffer (1:10w/v, 5 mM Tris-HCl, 20 mM EDTA, 0.5% Triton X-100,pH 8.0) and the lysates were centrifuged at 27,0003 g for20 minutes to separate fragmented DNA in the supernatantfrom intact chromatin in the pellet. Both fractions weretreated with perchloric acid to reach a 0.1 M concentration,heated at 90°C for 15 minutes and centrifuged at 1500g for10 minutes to remove protein. Supernatants were treatedwith DPA for 16 hours at 30°C and measured spectropho-tometrically at 600 nm. DNA fragmentation is expressed aspercentage of absorbance appearing in the soluble fraction

containing DNA fragments with respect to the chromatinfound in the pellet.

Alternatively, internucleosomal DNA degradation wasdetermined by DNA electrophoresis in agarose gels. Briefly,DNA from the 27,0003 g supernatants and pellets obtainedas described above was precipitated overnight at220°C in50% isopropanol and 0.5 M NaCl. The precipitates werepelleted by centrifugation at 13,0003 g for 10 min, air-dried and resuspended in 10 mM Tris, 1 mM EDTA, pH 7.4.Electrophoresis was performed in 0.75% agarose for 75 minat 90 V. DNA was visualized with ethidium bromide.

Polymerase chain reaction (PCR) of mitochondrial DNAIntegrity of mtDNA was estimated by PCR based on

previous reports (37, 38). Two different PCR were per-formed using specific mitochondrial primers. A 4.456 kbsegment was amplified using primers corresponding to theLeu site of the light chain and Ser of the heavy chain ofmtDNA, L-Leu, CCTTCCCCCGTAAATGATAT and H-ser, GCGTCT TGTAGACCTACTT, whereas a 150 b mi-tochondrial fragment was generated using primers corre-sponding to the L-Arg, GGCCTATGA GTGACTACAAAand H-Arg, CCT AGAAGTGAGAGTTGAA as depicted inFig. 1. Amplification reactions were carried out in 0.5-mlmicrocentrifuge tubes in a final volume of 50ml. Eachreaction consisted of 150 ng of DNA, and contained the twoappropriate primers (1mM each), the 4 deoxynucleotides(200mM each), 2.5 Units of Taq DNA polymerase (Boehr-inger Mannheim). Preliminary assays were performed torelate the amount of PCR products obtained with the num-

Fig. 1. Structure of mtDNA. Diagrammatic representation of cir-cular mtDNA indicating the transcription site of light (OL) andheavy chain (OH) and the position of rRNAs (12S and 16S) andsome mitochondrially encoded transcripts, ND5, cyt b, COX II,and COX III. Primers used in the PCR experiments are indicatedin the boxes as L-Leu and H-Ser for the 4,5 kb fragment and L-Argand H-Arg for the 150 b fragment.

Fig. 2. Generation of hydrogen peroxide by ionizing radiation. HepG2 cells were pretreated with DEM (0.4 mM) (striped bars) or withits vehicle DMSO (open bars) for 15 min and washed thoroughlyafterwards to remove excess DEM. Cells were then irradiated asdescribed in Methods at the dose indicated. Generation of hydro-gen peroxide was determined from DCFDA as fluorescence ofDCF as described in detail (31). Data are mean6 SD of 4–6separate experiments. *p , 0.05 vs. unirradiated cells.


ber of cycles to characterize the exponential phase of theassay. Amplification was accomplished following 23 cyclesof template denaturation at 94°C for 30 sec, primer-templateannealing at 56°C for 45 sec, and primer extension at 72°Cfor 90 sec. 10ml of PCR amplifications were run in a 1%agarose gel and ethidium bromide stained. Densitometeranalyses were performed with a densitometer Pre´fer-ence/DVS (Sebia).

Statistical analysesStatistical analyses for comparison of mean values for

multiple comparisons between mitochondrial preparationswere made by one-way ANOVA followed by Fisher’s test.

RESULTS

Oxidative stress induced by ionizing radiation inHep G2 cells

The generation of ROS produced as a consequence ofradiation of Hep G2 cells was assessed following the fluo-rescence of DCF. DCFDA is a nonfluorescent precursor ofDCF which is formed upon oxidation by peroxides (34).Figure 2 shows the acute effects of radiation of Hep G2 onhydrogen peroxide generation. As shown, the increase ofthese species was dependent on the dose of radiation ad-ministered (Fig. 2). Since hydrogen peroxide can be metab-olized by the GSH redox cycle, we examined the content of

both GSH and GSSG in irradiated Hep G2 cells. As seen,there was a gradual decline in the levels of GSH that wasmaximal at the highest radiation dose reaching a 15–25%depletion. Such depletion of GSH was paralleled by anincrease in the GSSG level (Fig. 3). Consequently, therelative predominance of intracellular GSH and GSSG re-flected as the ratio GSH/GSSG was decreased as the dose ofradiation increased, indicating that radiation resulted in ox-idative stress (Table 1). Although care was taken to mini-mize GSH oxidation during the derivatization procedurefollowing the harvesting of cells, nonspecific oxidation ofGSH during sample preparation could have contributed tothe observed increase in GSSG. The observed depletion ofcellular GSH by radiation was not due to nonspecific dam-age induced by the handling of cells during radiation, whichwas estimated by incorporation of inulin (less than 5% vs.permeabilized cells) and lack of labeling with propidiumiodide (not shown). Furthermore, the cell volume and meandiameter of irradiated cells was unchanged (0.96 0.3 mlcell water/106 cells, and 11.56 1.5 mm, respectively)compared to control cells, indicating that the depletion ofcell GSH by radiation was not due to changes in cellvolume. In order to determine if the depletion of cellularGSH by radiation was homogeneous and not due to theexistence of subpopulations of cells with different GSHlevels, cells were labeled with a fluorescence probe whichmonitors the levels of GSH followed by flow cytometric

Fig. 3. Regulation of GSH and GSSG in irradiated Hep G2 cells. Cells were first preincubated with DEM (filled bars)to deplete the initial levels of GSH and then irradiated as indicated. Immediately after radiation cells were deproteinizedand derivatized with dithionitrobenzene to determine reduced GSH (A) and GSSG (B) by HPLC as described. Data arethe mean6 SD of n 5 4–6 individual experiments. *p , 0.05 vs. control unirradiated cells.


analyses. As revealed (Fig. 4), the distribution of intracel-lular GSH in Hep G2 and its depletion by radiation reflect anevent representative of a homogeneous population of cells.

To assess the protective role of GSH in attenuating theoxidative signs derived from radiation, hepatocellular GSHlevels were depleted by preincubation of cells with DEMprior to the exposure to radiation. As shown, the levels ofhydrogen peroxide induced by radiation were greater incells that were deprived of 40–50% of initial GSH contentcompared to radiated control cells (Fig. 2). Furthermore,GSH depletion sensitized Hep G2 cells to the pro-oxidativeeffects induced by ionizing radiation, as hydrogen peroxideincreased significatively at a dose of 100 cGy compared toHep G2 controls not depleted of GSH. Thus, the changesdescribed above revealed the short- term oxidative effectsthat radiation induced in Hep G2 as these measurementswere performed within 1 hour postirradiation. However,these responses were transient since the increased levels ofhydrogen peroxide returned to control values by 2 hourspostirradiation. This outcome reflected a greater syntheticcapacity of irradiated Hep G2 to synthesize GSH as theGSH levels increased above those of unirradiated cells dueto the induction of the rate-limiting enzyme involved inGSH synthesis (39).

The generation of hydrogen peroxide by radiation isexpected not to be confined to a particular subcellular sitedue to the random generation of ROS induced by radiation.Therefore, we determined the capacity of ionizing radiationto deplete GSH in those subcellular compartments where itis found, mainly in cytosol and mitochondria (6, 40). Sincethere have been suggestions that GSH is also found in thenuclei (42), by an uncharacterized mechanism, GSH levelsin nuclei were also examined. Hep G2 cells were fraction-ated to obtain these subcellular fractions and the content ofGSH determined immediately after irradiation. Although itis possible that some of the GSH may be lost during thepreparation procedure, such a nonspecific loss would be

expected to be similar for control and irradiated cells. Asshown, radiation led to a depletion of GSH in these fractionsbeing more pronounced in mitochondria where the deple-tion of GSH reached 40% (Fig. 5).

Modulation by GSH of radiation-induced DNAfragmentation and apoptosis

To evaluate the oxidative consequences of radiation onnuclear DNA, we determined the extent of fragmentation ofDNA isolated from Hep G2 following radiation. The degreeof DNA fragmentation was estimated by measurement of

Table 1. Cellular ratio of GSH to GSSG of HepG2 cellsexposed to ionizing radiation

Radiation dose, cGy

0 100 200 400

ConditionControl 17.36 1.8 11.36 1.4* 8.86 1.2* 7.26 0.9*DEM 16.26 1.4 10.76 1.2* 7.76 0.9* 6.36 0.8*

Cells were pretreated with DEM (0.4 mM) for 15 min at 37 Cto deplete the initial levels of GSH. The levels of total GSH incontrol and DEM treated cells were 28.76 3.4 and 17.76 2.1nmol/106 cells, respectively. Afterwards, cells were washed withice cold PBS to remove excess DEM and irradiated as described inMethods. Following irradiation, cells were deproteinized andtreated with iodoacetic acid and DTNB to determine the molecularforms of GSH by HPLC as indicated in Methods. Data shows theGSH/GSSG in both control and DEM pretreated cells. Data are themean6 SD of 4 independent experiments. *p,0.05 vs. irradiatedcontrol cells not treated with DEM.

Fig. 4. Flow cytometry analyses of GSH levels in Hep G2. Cul-tured Hep G2 were labeled with CMFDA, 50mM for 10 min in thedark followed by flow cytometry analyses as described in Methodsto determine the cellular distribution of GSH (A). Cells wereirradiated (400 cGy) as described above and labeled with CMFDAto assess the depletion of cellular GSH following radiation (B).Data acquisition was made using a FACStar flow cytometer witha 5-watt argon ion laser tuned at 419 nm and 250 milliwatts.Fluorescence was measured through a 530-nm bandpass filter.


the absorbance of DPA (36). The appearance of fragmentedDNA remained undetectable in Hep G2 cells when irradi-ated at moderate doses. However, as radiation exposureincreased to 400 cGy, there was an increase in DNA deg-radation, reflecting the damage exerted by ROS (Fig. 6).The fragmentation of DNA at this radiation dose correlatedwith the increased generation of hydrogen peroxide.

To unravel the role of GSH in maintaining the intactnessof nuclear DNA, we estimated the extent of DNA fragmen-tation in cells pretreated with DEM. Incubation of cells withDEM resulted in depletion of nuclear GSH pool size to40–50% of control nuclear values (not shown). This deple-tion by itself did not affect cell viability nor DNA integrity.However, subsequent exposure to radiation resulted in in-creased susceptibility of genomic DNA to radiation (Fig. 6).Similar findings were observed by examining the pattern ofDNA mobility in electrophoresis revealing internucleoso-mal degradation in cells depleted of GSH (not shown).Additional demonstration of the functional role of GSH inmaintaining the integrity of nuclear DNA was provided byexamining the morphological appearance of cells labeledwith Hoechst 33258, revealing that depletion of GSH in-creased the segmentation and nucleoplasmic condensationof the chromatin induced by radiation (not shown).

Role of GSH in the survival of irradiated Hep G2 cellsTo examine the long-term effects of radiation and to

assess the protective role of GSH, we determined the sur-vival of irradiated Hep G2 cells after their initial GSH levelswere depleted. In this paradigm we incubated Hep G2 cellswith increasing doses of DEM to achieve depletion of GSHat different degrees. As seen in Fig. 7, the survival of HepG2 cells nondepleted of GSH was gradually lost as the doseof radiation increased. The magnitude of this relationshipwas accentuated in cells that were depleted of GSH by DEMpretreatment prior to the exposure of radiation.

The cellular capacity to repair damaged DNA may mod-ulate survival of cells exposed to radiation (19, 20, 42).Therefore, we examined the relationship of several param-eters involved in the survival of irradiated cells using therepair saturation model described previously (35). By fittingthe data points to the equation described in Methods, theprobability per unit of radiation to induce lethal damage byimpairing or diminishing the repair capacity of irradiatedcells pretreated with DEM (0.1–0.8 mM) (Table 2) can beestimated. Of these parameters, the probability to producelethal damage, parameter A, which represents intrinsic cel-lular radiosensitivity, increased significatively in cellstreated with increasing doses of DEM. When this parameterwas related to the intracellular levels of GSH, an inversecorrelation was obtained (Fig. 7B). The absence of changeof parameters B and C as a function of cellular GSHindicates lack of involvement of GSH in the cellular repair–recovery process, suggesting that GSH affords radioprotec-tion by acting as a ROS shield preventing oxidative damageto DNA.

Mitochondrial DNA integrity in irradiated Hep G2 cellsIn addition to the recognized effects of radiation on the

integrity of DNA and cell survival, radiation impairs mito-chondrial function. Previous studies have demonstrated al-tered mitochondrial function in cells exposed to radiation,such as loss of enzymatic activity, oxidative phosphoryla-

Fig. 5. Subcellular compartmentation of GSH in irradiated Hep G2cells. Cells were either irradiated at 400 cGy (striped bars) or leftunirradiated (open bars) and subsequently fractionated to isolatethe mitochondria and nuclei as described in Methods. These frac-tions were deproteinized and the level of reduced GSH determinedby HPLC. Data are the mean6 SD of 3–5 separate experiments.*p , 0.05 vs. nonradiated controls.

Fig. 6. DNA integrity of irradiated cells and modulation by GSH.Cells were irradiated at the dose indicated after preincubation withDEM (striped bars) or treated with DMSO as control (open bars).4 hours postradiation, DNA was extracted and reacted with DPAand absorbance determined as described in Methods. Results areexpressed as percentage of DNA fragmentation of control unirra-diated cells. Data are the mean6 SD of n 5 4 individual deter-minations. *p , 0.05 vs. control unirradiated cells.


tion, and onset of lipid peroxidation (43–45). However,these studies did not examine the effect of radiation on theintegrity of DNA in the organelle. To quantitate the mtDNAdamage induced by radiation, we used a quantitative PCRapproach. This assay is based on the fact that many DNAlesions can block the Taq polymerase, and thereby result ina relative decrease in amplification of the damaged DNAsegment. This technique offers greater advantages overother approaches, such as southern hybridizations, in thatthe requirement of large amounts of DNA and the use ofspecific restriction sites flanking the region to be studied areeliminated.

We performed preliminary assays to establish the condi-

tions necessary to accurately estimate the mtDNA integrity.The number of cycles used in the amplification is a criticalfactor to guarantee that the only limiting component for theamplification is the amount of template DNA. By assessingthe relation of the amplification product with the cyclenumber, the exponential phase of the PCR was found to bebetween 22 and 30 cycles. These conditions ensure thatother components of the reaction such as deoxyribonucleo-side triphosphates (dNTPs), primers, or Taq polymerasewere not limiting. Furthermore, in order not to limit thesensitivity of the assay to detect differences between thecontrol and radiated cells, it was necessary to amplify afragment of more than 1 kb as originally described (37).Using a set of two specific primers (L-leucine and H-serine)(Fig. 1), we amplified a fragment of 4,5 kb. Another set ofprimers (L-arginine and H-arginine), which amplify only afragment of 150 bases, was used as control. As expected, theamount of this PCR control fragment in irradiated cells wassimilar to unirradiated Hep G2 cells, reflecting lack ofdamage in this region of mtDNA by radiation (Fig. 8).Furthermore, the PCR assay indicated a comparable amountof the 150b fragment independent of the initial mitochon-drial GSH levels. However, the mtDNA of irradiated cellsunderwent a significant degree of damage since the PCRfragment of 4,5 kb was decreased to 25–30% of controlunirradiated cells. Interestingly, pretreatment of cells withDEM to deplete the mitochondrial GSH pool size to 70–80% of the initial value resulted in a further decrease in the4,5 kb fragment (Fig. 8). It is noteworthy that these changeswere detected within 30 min of exposure of cells to radia-tion, reflecting acute oxidative effects of radiation on the

Fig. 7. Survival of Hep G2 cells to radiation. Cells were treated with various doses of DEM (0.1 mM, open squares; 0.4mM, closed circles; 0.8 mM, open circles) for 15 min to achieve a wide range depletion of the GSH levels respect tocontrol cells that were just treated with DMSO (closed squares). After washing cells to remove excess DEM, cells wereirradiated at the dose indicated and cell survival determined by the clonogenic assay. Data of survival fraction wasplotted as a function of radiation and fitted by the equation described in Methods (panel A) (35). (B) The linearregression of parameter A as a function of the intracellular GSH concentration obtained by treatment of cells with DEMis shown. Data are the mean6 SD of 4–5 individual experiments.

Table 2. Parameters that regulate cell survival of irradiatedHep G2 cells

Parameter of cell survival

A B C

ConditionControl 0.447 1.0 1.320.1mM DEM 0.590 1.0 1.260.4mM DEM 0.788* 1.0 1.220.8mM DEM 1.056* 1.0 0.83

Parameters were calculated by fitting data reported in Figure 7(panel A) using the repair-saturation model described previously(35). The GSH levels for control cells were 26.76 2.7 nmol/106

cells. DEM treatment at 0.1, 0.4 and 0.8 mM resulted in GSHdepletion to 22.16 1.9, 16.86 1.3 and 7.36 0.9 nmol/106 cells,respectively. *p,0.05 vs. control, irradiated cells, non depleted ofGSH.


integrity of DNA, which persisted within the next 5–7 hourspostradiation.

DISCUSSION

One of the biological effects of ionizing radiation is thegeneration of ROS, some of which can mediate the cellularresponse to radiation. The diversity and extent of effectselicited by radiation may be determined not only by the typeof cellular components affected by the generation of ROS,but also by the action of self-defense antioxidant networks,which operate in the cell to neutralize the deleterious effectsof ROS. Particularly, it is well recognized that generation ofhydroxyl radical in the vicinity of DNA plays a critical rolein the lesions induced by radiation, which culminate in celldeath or mutagenesis (19, 20). However, due to the diversityof factors that modulate the cellular response to radiation, itis conceivable that factors other than the generation ofhydroxyl radical may be of significance in determining thefate of cells in response to radiation (5, 6, 21). Indeed,previous studies have examined the role of GSH in theaerobic radioresponse of several cell lines. The effects de-scribed in GSH-depleted cells prior to exposure to radiationvaried depending on the type of cell studied and the extentof GSH depletion achieved (22, 23, 43–49). Although insome instances, it has been shown that the depletion of GSHexerted a modest effect on the growth and aerobic radiationresponse (46), or even a lack of modulation of the radiore-sponse, other studies have provided evidence that GSHmodulate the response of cells to radiation (25, 26, 50).Thus, these data suggest that pharmacological manipula-

tions of GSH can modulate the extent of cellular response toradiation, consistent with the protective role of GSH againstoxidative stress-induced damage. However, the character-ization of oxidative stress induced by radiation as a functionof cellular GSH has remained largely uncharacterized inparenchymal cells. Hep G2 is a human hepatoblastomaderived cell line whose morphology, function, and metab-olism are similar to that of human liver parenchymal cells.Since the regulation and compartmentalization of hepaticGSH is well characterized (8, 40, 51, 52), our studies wereundertaken to determine the regulation of cellular GSH byionizing radiation and to assess the protective role of GSHin the maintenance of integrity of nuclear and mitochondrialDNA in Hep G2 cells.

Our approach comprised studies that evaluated the effectsthat radiation exerted on Hep G2 regarding the character-ization and extent of oxidative stress. Furthermore, theconsequences on nuclear and mitochondrial DNA integrityand cell survival of irradiated Hep G2 were also investi-gated. In this regard, our results revealed that radiation ofHep G2 resulted in oxidative stress, as reflected by the shiftin the redox status of intracellular GSH to GSSG ratio andgeneration of ROS. Whereas these changes were detected inseveral subcellular sites, they were more predominant inmitochondria, as indicated by the increased loss of mtDNAintegrity in irradiated cells.

GSH is synthesized exclusively in cytosol which containsmost of the cellular GSH. However, GSH is also found inseveral compartments, mainly mitochondria and nuclei (8,40, 41, 51). Alkylating agents such as DEM react with GSH,leading to its depletion. Different susceptibility of cytosol

Fig. 8. Mitochondrial DNA integrity of Hep G2 cells. Cells were irradiated after preincubation with 0.8 mM DEM for15 min (D) or its vehicle (C). This led to mitochondrial GSH depletion of 60–70% of control mitochondrial GSH values(5–6 nmol/mg protein). After irradiation at 400 cGy, DNA was extracted and specific fragments amplified by PCR usingthe primers designed according to the structure of mtDNA (Fig. 1) to achieve a 4,5 kb and 150 b fragment as shownin a representative agarose gel stained with ethidium bromide (A). Scanning densitometry analyses of these fragmentsas indicated as a percentage of undamaged control DNA from unirradiated cells are shown in panel B. M indicates thesize markers; 50, 100, and 200 lanes represents the amplification of PCR using these amounts of template DNA. Dataare mean6 SD of 4–5 individual experiments. *p , 0.05 vs. irradiated control cells.


and mitochondrial GSH towards its depletion by DEM hasbeen exploited to determine the functional significance ofGSH in either compartment (31, 47, 53). Our findings notonly demonstrated for the first time the capacity of radiationto deplete GSH in subcellular compartments of Hep G2cells; in addition we addressed the significance of preferen-tial depletion of nuclear and mitochondrial GSH in the samecell type using different doses of DEM to determine theintegrity of DNA as a reflection of the initial damage andcell survival indicative of long-term effect. In this paradigm,we assessed the oxidative damage of nuclear DNA inducedby radiation by measurement of DNA integrity. Althoughirradiation may lead to some initial DNA damage, whichwas not assessed in our studies, the extent of DNA integrityobserved following radiation would reflect the balance ofthe initial damage induced by radiation and its subsequentrepair. However, initial DNA damage could be involved ininitiating signaling events that lead to secondary damage,such as apoptosis. To evaluate the consequences of such anoutcome, the survival of Hep G2 cells was examined. As-sessment of DNA fragmentation revealed that exposure ofHep G2 cells to moderate doses of radiation does not resultin significant oxidative damage in nuclear DNA nor apo-ptotic demise of cells, indicating that Hep G2 are relativelyradioresistant. Our findings provide evidence that the limi-tation of GSH in nuclei prior to exposure of cells to 400 cGyresulted in greater DNA fragmentation detected after 4 hourpostradiation. The endpoint consequence of such an effectwas the greater radiation-induced cell death determined byclonogenic assay. Indeed, an inverse correlation of intracel-lular GSH levels with the probability of lethal damageinduced by radiation was observed, adding further evidencein favor of the critical functional role of GSH as a vital lineof defense in eliminating the radiation-induced ROS gener-ation and preventing both DNA damage and apoptosis. Inaddition, these findings are consistent with the lack ofparticipation of GSH in the repair of DNA directly orthrough regulation of specific gene products. Our work,however, did not address additional alternative mechanismsof GSH depletion in enhancing the killing of irradiated cellsdespite its ability to lower the level of ROS. For instance,recent studies in murine and human tumor cell lines haveshown a reduction of Ha-, Ki-, and N-ras expression afterGSH depletion by posttranscriptional mechanisms. Eleva-tion of ras oncogene expression in animal and human celllines has been demonstrated to confer resistance to ionizingradiation (48, 54).

Despite the increased generation of hydrogen peroxide byradiation observed in our studies, additional ROS may havebeen produced. Of particular interest is hydroxyl radical,one of the most reactive ROS known. Previous studies haveprovided evidence that hydroxyl radical mediates a signif-icant number of the damaging effects induced by radiation(19, 20). Although we did not assess the level of hydroxylradical in irradiated Hep G2 cells, our findings do notdiscard the participation of these potent species in the del-

eterious effects elicited by ionizing radiation in parenchy-mal cells depleted of GSH. Indeed, hydroxyl radical canarise not only as a consequence of interaction of radiationwith matter; hydrogen peroxide, by participating as a pre-cursor for these species in the Haber-Weiss or Fenton reac-tions, can be envisioned as a steady generator of hydroxylradical. Therefore, the role of GSH in limiting the availabil-ity of hydrogen peroxide would be critical in minimizing thegeneration of hydroxyl radical and its consequences, such asDSB and apoptosis. Regardless of the identification of thespecific ROS formed during radiation, their involvement ascausal effectors in apoptosis has been well established (55–57). Recent studies examining the apoptosis induced bytransforming growth factor beta (TGF-b) in hepatocyteshave provided evidence for the involvement of ROS ineliciting this form of cell demise. Consequently, the treat-ment of hepatocytes with antioxidants or radical scavengersdiminished the degree of cell death induced by TGF-b.Furthermore, the increase of ROS induced by reoxygenationof hypoxic hepatocytes has also been shown to lead toapoptosis. Furthermore, the apoptosis seen in irradiated HepG2 depleted of GSH may have also been caused by gener-ation of apoptotic stimuli other than ROS. In this regard,recent evidence has demonstrated that radiation triggers therelease of certain intermediates produced at the plasmamembrane of irradiated cells which, in turn, participate inthe chain of events leading to apoptosis (5, 6). Of particularrelevance to the current studies is the observation of Haimo-vitz-Friedmanet al. (5) that radiation induces the hydrolysisof sphingomyelin from plasma membrane releasing cer-amide. This lipid moiety has been shown to play a role inthe induction of apoptosis in a wide variety of cells (5, 58,59). GSH depletion may synergize with radiation resultingin cell death, conceivably by enhancing release of ceramide,as recent observations have shown that cellular GSH deple-tion stimulates the activity of neutral sphingomyelinase(60).

In addition to the consequences derived from the oxida-tive damage of nuclear DNA, we have also assessed theeffect of radiation on mtDNA from Hep G2 cells. Ourfindings have revealed a significant vulnerability of mtDNAto the oxidative damage induced by radiation even in theabsence of GSH depletion. These findings contrast withthose of nuclear DNA, confirming the greater susceptibilityof mtDNA to damage induced as has been described for avariety of pro-oxidants and aging (12, 13, 16–18, 61).Despite the features of mtDNA that contribute to its vul-nerability (see Introduction), the depletion of GSH prior toexposure to radiation accentuates the oxidative damage ofmtDNA, adding further support for the functional criticalrole that GSH plays in this subcellular compartment (8, 28,30, 31, 40, 52). The significance of the observed mtDNAdamage on mitochondrial functions remains to be deter-mined. The loss of mtDNA integrity observed in GSH-depleted cells was observed shortly after radiation and wastransitory lasting 5–7 hours following radiation. The mech-


anism for this transient damage of mtDNA in irradiatedcells is unknown. Nevertheless, the increase in oxidativedamage of mtDNA by radiation in GSH-depleted cellsreflects an increased vulnerability of this organelle to theoxidative stress induced by radiation, consistent with thedepletion of GSH and decreased GSH/GSSG observed inthis subcellular site (Fig. 5). In line with this, previousstudies have revealed impaired mitochondrial respirationand oxidative phosphorylation of irradiated cells (43–45).Indeed, the loss of mitochondrial function in irradiated cellsmay be the consequence of the direct action of ROS oninactivation of mitochondrial components, as has been re-ported in certain segments of the electron transport chaincomponents and ATPase complex (31, 62). Furthermore, asindicated above, ceramide generated distally at the plasmamembrane by radiation targets specific segments of themitochondrial electron transport chain, resulting in an ad-ditional means of generating ROS and consequently, oxida-tive stress (59, 63). Moreover, mitochondria depleted ofGSH may be more susceptible to the effects of hydrogenperoxide produced within the organelle, as its depletionwould leave mitochondrial components less protectedagainst the deleterious effects of hydrogen peroxide (59–63). However, a modest GSH depletion may be insufficientto leave mitochondria fully unprotected against ROS, sincethe predominant protective mechanism is catalyzed by en-zymatic reactions involving GSH peroxidase and GST.

Thus, the mechanisms whereby GSH depletion in mito-chondria modulates the radiation response remain to becharacterized. Hence, our findings indicate that mitochon-drial GSH, by playing a critical role in maintaining a func-tional competent organelle, and in the control of ROS,would be of significance in amplifying the cytotoxic effectsof radiation. In this regard, recent studies have demonstratedthat ROS, generated in specific segments of respiratorychain complexes, act as early major mediators in ceramide-induced apoptosis (59, 63). Our findings imply that GSH inmitochondria would be a critical protective factor not onlyin maintaining vital mitochondrial components, but also inthe control of cell survival of irradiated cells for its abilityto downregulate the levels of ROS triggered by radiation.

In summary, due to the diverse mechanisms by whichradiation affect cellular components and in view of themultiple cellular functions at which GSH acts, its depletionbelow a critical threshold value determines the susceptibil-ity of cells to the cytotoxic effects of radiation. In particular,our studies indicate that mitochondria become particularlysusceptible to the oxidative effects of radiation, reflectingthe existence of multiple ways for the generation of oxida-tive stress by radiation, some of which converge at thissubcellular site. GSH depletion in mitochondria stands as acritical preventive factor whose depletion may be of signif-icance in amplifying the cytotoxic effects of radiation.

REFERENCES

1. Hall, E. J.; Astor, M.; Bedford, J.; Borek, C.; Curtis, S. B.;Fry, M.; Geard, C.; Hei, T.; Mitchell, J.; Oleinick, N. Basicradiology Am. J. Clin. Oncol. 11:220–252; 1988.

2. Fridovich, I. The biology of oxygen radicals. Science 201:875–880; 1978.

3. Scott, M. D.; Meshnick, S. R;. Eaton, J. W. Superoxidedismutase amplifies organismal sensitivity to ionizing radia-tion. J. Biol. Chem. 264:2498–2501;1989.

4. Hirose, K.; Longo, D. L.; Oppenheim, J. J.; Matsushima, K.Overexpression of mitochondrial manganese superoxide dis-mutase promotes the survival of tumor cells exposed to inter-leukin-1, tumor necrosis factor, selected anticancer drugs, andionizing radiation. FASEB J. 7:361–368; 1993.

5. Haimovitz-Friedman, A.; Kan, C. C.; Ehleiter, D.; Persaud,R. S.; McLoughlin, M.; Fuks, Z.; Kolesnick, R. Ionizingradiation acts on cellular membranes to generate ceramide andinitiate apoptosis. J. Exp. Med. 180:525–535; 1994.

6. Ramakrishnan, N.; McClain, D.E.; Catravas, G.N. Membranesas sensitive targets in thymocyte apoptosis. Int. J. Radiat. Biol.63:693–701, 1993.

7. Clark, I. A.; Cowden, W. B.; Hunt, N. H.; Free radical-induced pathology. Med. Res. Rev. 5:297–332; 1985.

8. Fernańdez-Checa, J. C.; Yi, J. R.; Garcıá-Ruiz, C.; Yi, J. R.;Ookhtens, M.; Kaplowitz, N. GSH transporters: Molecularcharacterization and role in GSH homeostasis. Sem. Liver Dis.16:147–158; 1996.

9. Kaplowitz, N.; Aw, T. Y.; Ookhtens, M. The regulation ofhepatic glutathione Annu. Rev. Toxicol. Pharmacol. 25:715–744; 1985.

10. Meister, A.; Anderson, M. E. Glutathione. Annu. Rev. Bio-chem. 52:711–760; 1983.

11. Moore, W.; Anderson, M. E.; Meister, A.; Murata, K.;

Kimura, A. Increased capacity for glutathione synthesis en-hances resistance to radiation inEscherichia coli: A possiblemodel for mammalian cell protection. Proc. Natl. Acad. Sci.USA 86:1461–1464; 1989.

12. John, D. R. The other human genome: Mitochondrial DNAand disease. Nat. Med. 2:1065–1068; 1996.

13. Shigenaga, M. K.; Hagen, T. M.; Ames, B. N. Oxidativedamage and mitochondrial decay in ageing. Proc. Natl. Acad.Sci. USA, 91:10771–10778; 1994.

14. Clayton, D. A. Replication of animal mitochondrial DNA.Cell 28:693–705; 1982.

15. Clayton, D. A. Transcription of the mammalian mitochondrialgen. Annu. Rev. Biochem. 53:573–594; 1984.

16. Ames, B. Endogenous oxidative DNA damage, aging andcancer. Free Radic. Res. Commun. 7:121–128; 1989.

17. Richter, C. Reactive oxygen and DNA damage in mitochon-dria. Mutat. Res. 275:249–255; 1992.

18. Wallace, C. Mitochondrial genetics: A paradigm for aging anddegenerative diseases? Science 256:628–632; 1992.

19. Bump, E. A.; Brown, J. M. Role of GSH in the radiationresponse of mammalian cells in vitro and in vivo. Pharmacol.Ther. 47:117–136; 1990.

20. Ward, J. F. Radiation mutagenesis: The initial DNA lesionsresponsible. Radiat. Res. 142:362–368; 1995.

21. Maity, A.; Kao, G. D.; Muschel, R. J.; McKenna, W. G.Potential molecular targets for manipulating the radiation re-sponse. Int. J. Radiat. Oncol. Biol. Phys. 37:639–653; 1997.

22. Biaglow, J. E.; Varnes, M. E.; Clark, E. P.; Epp, E. P. The roleof thiols in cellular response to radiation and drugs. Radiat.Res. 95:437–455; 1983.

23. Clark, E. P.; Epp, E. P.; Morse-Gaudio, M.; Biaglow, J. E. Therole of glutathione in aerobic radioresponse. Sensitization and


recovery in the absence of intracellular glutathione. Radiat.Res. 108:238–250; 1986.

24. Miller, A. C.; Henderson, B. W. The influence of cellularglutathione content on cell survival following photodynamictreatment in vitro. Radiat. Res. 107:83–94; 1986.

25. Bump, E. A.; Yu N.Y.; Brown, J. M. Radiosensitization ofhypoxic tumor cells by depletion of intracellular GSH. Sci-ence 217:544–545; 1982.

26. Evans, J. W.; Taylor, Y. C.; Brown, J. M. The role of gluta-thione and DNA strand break repair in determining the shoul-der of the radiation survival curve. Br. J. Cancer. 49(Suppl.VI):49–53; 1984.

27. Garcıá-Ruiz, C.; Fernańdez-Checa, J. C.; Kaplowitz, N. Bidi-rectional mechanism of plasma membrane transport of re-duced glutathione in intact rat hepatocytes and membranevesicles. J. Biol. Chem. 267:22256–22264; 1992.

28. Garcıá-Ruiz, C.; Colell, A.; Marı´, M.; Morales, A.; Fernańdez-Checa, J. C. Feeding S-adenosyl-L-methionine attenuates bothethanol-induced depletion of mitochondrial glutathione andmitochondrial dysfunction in periportal and perivenous rathepatocytes. Hepatology 22:201–210; 1995.

29. Fernańdez-Checa, J. C.; Ookhtens, M.; Kaplowitz, N. Effectof chronic ethanol feeding on rat hepatocyte glutathione: Re-lationship of cytosolic glutathione to efflux and mitochondrialsequestration. J. Clin. Invest. 83:1247–1252; 1989.

30. Garcıá-Ruiz, C.; Morales, A.; Ballesta, A.; Rodes, J.; Kaplow-itz, N.; Fernandez-Checa, J. C. Effect of chronic ethanolfeeding on glutathione and functional integrity of mitochon-dria in periportal and perivenous rat hepatocytes. J. Clin.Invest. 94:193–201; 1994.

31. Garcıá-Ruiz, C.; Colell, A.; Morales, A.; Kaplowitz, N.; Fer-nandez-Checa, J. C. Role of oxidative stress generated fromthe mitochondrial electron transport chain and mitochondrialglutathione status in loss of mitochondrial function and acti-vation of transcription factor nuclear factor-kappa B: Studieswith isolated mitochondria and rat hepatocytes. Mol. Pharma-col. 48:825–834; 1995.

32. Fariss, M. W.; Reed, D. J. High-performance liquid chroma-tography of thiols and disulfides: Dinitrophenol derivatives.Methods Enzymol. 143:101–109; 1987.

33. Burghardt, R. C.; Barhoumi, R.; Lewis, E. H.; Bailey, H.;Pyle, K. A.; Clement, B. A.; Phillips, T. D. Patulin-inducedcellular toxicity: A vital fluorescence study. Toxicol. Appl.Pharmacol. 112:235–244, 1992.

34. Cathcart, R.; Schwiers, E.; Ames, B. N. Detection of picomolelevels of hydroperoxides using a fluorescent dichlorofluores-cein assay. Anal. Biochem. 134:111–116; 1983.

35. Sanchez-Reyes, A. A simple model of radiation action in cellsbased on a repair saturation mechanism. Radiat. Res. 130:139–147; 1992.

36. Sellins, K. S.; Cohen, J. J. Gene induction by gamma-irradi-ation leads to DNA fragmentation in lymphocytes. J. Immu-nol. 139:3199–3206; 1987.

37. Goram, H. L.; Valles-Ayoub, Y.; Braun, J. Fine mapping ofDNA damage and repair in specific genomic segments. NucleiAcid Res. 18:3823–3829, 1990.

38. Kalinowski, D. P.; Illenye, S.; Van Houten, B. Analysis ofDNA damage and repair in murine leukemia L1210 cells usinga quantitative polymerase chain reaction assay. Nuclei AcidRes. 20:3845–3494, 1992.

39. Morales, A.; Miranda, M.; Sańchez-Reyes, A.; Colell, A.;Biete, A.; Fernańdez-Checa, J. C. Transcriptional regulationof the heavy subunit chain ofg-glutamylcysteine synthetaseby ionizing radiation. FEBS Lett. 427:15–20, 1998.

40. Meredith, M; Reed, D. J. Depletion in vitro of mitochondrialGSH in rat hepatocytes and enhancement of lipid peroxidation

by adriamycin and BCNU. Biochem. Pharmacol. 32:1383–1388; 1988.

41. Bellomo, G.; Vairetti, M.; Stivala, L.; Mirabelli, F.; Richelmi,P.; Orrenius, S. Demonstration of nuclear compartmentaliza-tion of glutathione in hepatocytes. Proc. Natl. Acad. Sci. USA89:4412–4416; 1992.

42. Park, M. S. Expression of human RAD52 confers resistance toionizing radiation in mammalian cells. J. Biol. Chem. 270:15467–15470; 1995.

43. Erickson, G. A.; Koppenol, W. H. Effects of gamma-radiationon isolated liver mitochondria. Int. J. Radiat. Biol. 51:147–155, 1987.

44. Itoi, M. E.; de Rey, B. M.; Cabrini, R. L. Effect of bodyirradiation on rat liver mitochondria DNA and respiratoryfunctions. Histochem. J. 14:205–213; 1982.

45. Yukawa, O.; Miyahara, M.; Shiraishi, N.; Nakazawa, T. Ra-diation-induced damage to mitochondrial D-beta-hydroxybu-tyrate dehydrogenase and lipid peroxidation. Int. J. Radiat.Biol. 48:107–115; 1985.

46. Den Boer, P. J.; van Loon, A. A. W. M.; Mackenbach, P.; vander Schans, G. P.; Grootegoed, J. A. Effect of glutathionedepletion on the cytotoxicity of xenobiotics and induction ofsingle-strand DNA breaks by ionizing radiation in isolatedround spermatids. J. Reprod. Fert. 88:259–269, 1990.

47. Freeman, M. L.; Meredith M. J. Subcellular localization ofglutathione and thermal sensitivity. Radiat. Res. 115:461–471; 1988.

48. Miller, A. C.; Gafner, J.; Clark, E. P.; Samid, D. Posttran-scriptional down-regulation of ras oncogene expression byinhibitors of cellular glutathione. Mol. Cell. Biol. 13:4416–4422; 1993.

49. Dethlefsen, L. A.; Lehman, C. M.; Biaglow, J. E.; Peck, V. M.Toxic effects on acute glutathione depletion by buthioninesulfoximine and dimethylfumarate on murine mammary car-cinoma cells. Radiat. Res. 114:215–224; 1988.

50. Zheng, S.; Newton, G. L.; Ward, J. F.; Fahey, R. C. Aerobicradioprotection of pBR322 by thiols: Effects of thiol netcharge upon scavenging of hydroxyl radicals and repair ofDNA radicals. Radiat. Res. 130:183–193; 1995.

51. Fernańdez-Checa, J. C.; Lu, S.; Ookhtens, M.; DeLeve, L.;Kannan, R.; Runnegar, M.; Yoshida, H.; Hideki, H.; Garcıá-Ruiz, C.; Kulenhkamp, J.; Kaplowitz, N. Hepatic anion trans-port and bile secretion: Physiology and pathophysiology. In:Hepatic transport and bile secretion. Tavoloni, N.; Berk, P.eds. New York; Raven Press; 345–395; 1993.

52. Fernańdez-Checa, J. C.; Kaplowitz, N.; Garcıá-Ruiz, C.;Colell, A.; Miranda, M.; Marı´, M.; Ardite, E.; Morales, A.Importance and characteristics of glutathione transport in mi-tochondria: Defense against oxidative stress and defect in-duced by alcohol. Am. J. Physiol. 273:G1–G9; 1997.

53. Fernańdez-Checa, J. C.; Garcıá-Ruiz, C.; Ookhtens, M.;Kaplowitz, N. Impaired uptake of glutathione by hepatic mi-tochondria from chronic ethanol-fed rats. J. Clin. Invest. 87:397–405; 1991.

54. Sklar, M. D. The ras oncogene increases the intrinsic resis-tance of NIH 3T3 cells to ionizing radiation. Science 239:645–647; 1988.

55. Sanchez, A.; Alvarez, A. M.; Benito, M; Fabregat, I. Apopto-sis induced by transforming growth factor-beta in fetal hepa-tocyte primary cultures: Involvement of reactive oxygen in-termediates. J. Biol. Chem. 271:7416–7422; 1996.

56. Shimizu, S.; Eguchi, Y.; Kamiike, W.; Akao, Y.; Kosaka, H.;Hasegawa, J. I.; Matsuda, H.; Tsujimoto, Y. Involvement ofICE family proteases in apoptosis induced by reoxygenationof hypoxic hepatocytes. Am. J. Physiol. 271:G949–G958;1996.


57. Slater, A. F. G.; Nobel, S. I.; Orrenius, S. The role of intra-cellular oxidants in apoptosis. Biochim. Biophys. Acta 1271:59–62, 1995.

58. Kolesnick, R.; Fuks, Z. Ceramide: A signal for apoptosis ormitogenesis? J. Exp. Med. 181:1949–1952; 1995.

59. Garcıá-Ruiz, C; Colell, A.; Marı´, M.; Morales, A.; Fernańdez-Checa, J. C. Direct effect of ceramide on the mitochondrialelectron transport chain leads to generation of reactive oxygenspecies. Role of mitochondrial glutathione. J. Biol. Chem.272:11369–11377; 1997.

60. Liu, B.; Hannun, Y. A. Inhibition of the neutral magnesium-dependent sphingomyelinase by glutathione. J. Biol. Chem.272:16281–16287, 1997.

61. Yen, T. C.; King, K. L.; Lee, H. C.; Yeh, S. W.; Wei, Y. H.Age-dependent increase of mitochondrial DNA deletions to-gether with lipid peroxides and superoxide dismutase in hu-man liver mitochondria. Free Rad. Biol. Med. 16:207–214;1994.

62. Zhang, Y.; Marcillat, O.; Giulivi, C.; Ernster, L.; Davies, K. L.The oxidative inactivation of mitochondrial electron transportchain components and ATPase. J. Biol. Chem. 265:16330–16336; 1990.

63. Quillet-Mary, A.; Jaffrezou, J. P.; Mansat, V.; Bordier, C.;Naval, J.; Laurent, G. Implication of mitochondrial hydrogenperoxide generation in ceramide-induced apoptosis. J. Biol.Chem. 272:21288–21395; 1997.


Documents

Oxidative damage of mitochondrial and nuclear DNA induced by ionizing radiation in human hepatoblastoma cells