Proc. Nail. Acad. Sci. USAVol. 85, pp. 26-30, January 1988Biochemistry

Molecular cloning and amino acid sequence of human5-lipoxygenase

(cDNA expression library/antibody screening/mRNA hybridization/peptide analyses/calcium-binding domain)

TAKASHI MATSUMOTO*, COLIN D. FUNK, OLOF RADMARK, JAN-OLOV HOOG, HANS JORNVALL,AND BENGT SAMUELSSONDepartment of Physiological Chemistry, Karolinska Institutet, S-104 01 Stockholm, Sweden

Contributed by Bengt Samuelsson, September 9, 1987

ABSTRACT 5-Lipoxygenase (EC 1.13.11.34), a Ca2 - andATP-requiring enzyme, catalyzes the first two steps in thebiosynthesis of the peptidoleukotrienes and the chemotacticfactor leukotriene B4. A cDNA clone corresponding to 5-lipoxygenase was isolated from a human lung Xgtll expressionlibrary by immunoscreening with a polyclonal antibody. Ad-ditional clones from a human placenta Xgtll cDNA librarywere obtained by plaque hybridization with the 32P-labeledlung cDNA clone. Sequence data obtained from several over-lapping clones indicate that the composite cDNAs contain thecomplete coding region for the enzyme. From the deducedprimary structure, 5-lipoxygenase encodes a 673 amino acidprotein with a calculated molecular weight of 77,839. Directanalysis of the native protein and its proteolytic fragmentsconfirmed the deduced composition, the amino-terminal aminoacid sequence, and the structure of many internal segments.5-Lipoxygenase has no apparent sequence homology withleukotriene A4 hydrolase or Ca2+-binding proteins. RNA blotanalysis indicated substantial amounts of an mRNA speciesof g2700 nucleotides in leukocytes, lung, and placenta.

The leukotrienes constitute a group of arachidonic acid-derived metabolites with biological activities suggesting im-portant roles in inflammation and immediate hypersensitivity(1, 2). The enzyme 5-lipoxygenase (arachidonate:oxygen5-oxidoreductase, EC 1.13.11.34) catalyzes the formation of5-hydroperoxy-6,8,11,14-icosatetraenoic acid (5-HPETE)from arachidonic acid, as well as the subsequent conversionof5-HPETE to 5,6-oxido-7,9,11,14-icosatetraenoic acid (leu-kotriene A4) (3-6). This dual role for the 5-lipoxygenase wasfirst demonstrated with an enzyme of plant origin (7). The5-lipoxygenase is also involved in the formation of lipoxins,a group of biologically active compounds derived fromarachidonic acid (8, 9).The 5-lipoxygenase has been isolated from human and

porcine leukocytes, murine mast cells, and rat basophilicleukemia cells (4, 6, 10, 11). The enzyme is dependent onCa2' and ATP. The human leukocyte enzyme displays evengreater complexity by the requirement for three cellularcomponents for maximal activity. One of these factors wasshown to be present in the 100,000 x g pellet from leukocytehomogenates. The others were found during purification ofthe 5-lipoxygenase from the 100,000 x g supernatant (3, 12,13). Little is known about the mechanism of action of the5-lipoxygenase stimulatory factors.

In this study we describe the isolation ofcDNA clones forhuman lung and placenta 5-lipoxygenase and deduce thecomplete amino acid sequence of the enzyme.t The molec-ular cloning and amino acid sequence of one of the next

enzymes in the arachidonic acid cascade, the leukotriene A4hydrolase, were described recently (14, 15).

MATERIALS AND METHODSMaterials. Human lung and placenta cDNA libraries in the

expression vector Xgtll were obtained from Clontech (PaloAlto, CA). Restriction endonucleases, other nucleic acid-modifying enzymes, and M13 sequencing kits were obtainedfrom Pharmacia and Amersham; radioactive nucleotides andnick-translation kits were from Amersham; Cyclone subclon-ing system was from International Biotechnologies (NewHaven, CT).

Antibody Preparation. 5-Lipoxygenase from human leuko-cytes was purified to near homogeneity as described (10) andelectrophoresed in NaDodSO4/polyacrylamide gels. The re-gion at -80 kDa containing 5-lipoxygenase was cut out,minced, and mixed with Freund's complete adjuvant, andsubsequently used to immunize rabbits. The IgG fraction wasfurther purified by protein A-Sepharose CL-4B chromatog-raphy and then was absorbed with Escherichia coli strainY1090 lysate to remove antibodies that recognize E. coliantigens. The specificity of the antibody was tested byimmunoblot analysis of 100,000 x g leukocyte sonicatesupernatant resolved in a NaDodSO4/10% polyacrylamidegel. Optimal antibody dilutions were determined by dot blotanalysis with purified 5-lipoxygenase.Antibody Screening of cDNA Library. The lung library was

screened basically according to the method of Huynh et al.(16). Plates with 104 phages adsorbed to E. coli Y1090 wereincubated at 42°C for 3.5 hr. The plates were then overlaidwith isopropyl ,3-D-thiogalactopyranoside-soaked nitrocellu-lose filters, incubated overnight at 37°C, and treated asdescribed (14). Putative positive clones were carried throughtwo or three further rounds of screening at reduced densityuntil all phages produced positive signals.

Hybridization Screening of cDNA Library. The 397-base-pair (bp) insert of clone XluS1, isolated by antibody screen-ing, was 32P-labeled by nick-translation to 107 dpm/,ug andused to screen a human placenta Xgtll library in order toobtain longer inserts. Phages were grown for 6-15 hr at 37°C,after which duplicate nitrocellulose filters were overlaid for1 min each. The DNA bound to these filters was subsequentlyprehybridized in a solution containing 50% (vol/vol) form-amide, 5 x Denhardt's solution (lx is 0.02% Ficoll/0.02%polyvinylpyrrolidone/0.02% bovine serum albumin), 5 xSSPE (lx is 0.15 M NaCI/10 mM sodium phosphate, pH7.4/1 mM EDTA), 0.1% NaDodSO4, and 100 ,ug ofdenaturedsalmon spermDNA per ml at 42°C overnight. Nick-translated

*Permanent address: Central Research Institute, Japan Tobacco,Inc., Midori-ku, Yokohama, Japan.

tThis sequence is being deposited in the EMBL/GenBank data base(Bolt, Beranek, and Newman Laboratories, Cambridge, MA, andEur. Mol. Biol. Lab., Heidelberg) (accession no. J03571).

26

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

June

24,

202

0 D

ownl

oade

d by

gue

st o

n Ju

ne 2

4, 2

020

Dow

nloa

ded

by g

uest

on

June

24,

202

0

Proc. Natl. Acad. Sci. USA 85 (1988) 27

probe was added and hybridization continued for 24 hr.Filters were washed according to standard procedures (17)and were autoradiographed.

Antibody Selection Assay. Phages were plated lytically at adensity of 4105 plaque-forming units per plate and weretreated with isopropyl /3-D-thiogalactopyranoside-soaked fil-ters as described (14). These filters were used for theselection of antibodies that reacted specifically with 5-lipoxygenase epitopes present in the various ,3-galactosidasefusion proteins. Filter-bound antibodies were then elutedwith 100 mM glycine/150 mM NaCl at pH 2.6 (18) and wereused in immunoblot analysis of purified 5-lipoxygenase.

Subcloning and Sequencing ofcDNAs. The EcoRI inserts ofpositive phage clones were purified (17) and sized by elec-trophoresis in 1.2% agarose gels. Inserts were either sub-cloned into EcoRI-cut pEMBL8 (19) and used to transform E.coli JM101 or multiplied directly in Xgtll by large-scaleplate-lysate preparations (17). DNA sequencing was carriedout by the dideoxy chain-termination method (20) aftercDNA inserts were subcloned into phage vectors M13mpl8and mpl9. A sequential series of overlapping clones wasproduced by digestion with the 3'-* 5' exonuclease activityof bacteriophage T4 DNA polymerase as described (21). Insome cases appropriate restriction fragments, purified byelectrophoresis in 4% polyacrylamide gels, were used forDNA sequence analysis.

Preparation ofRNA. Total RNA was extracted from humanperipheral leukocytes, placenta, and lung (obtained at time ofsurgery) by the guanidinium isothiocyanate method (22).Poly(A)+ RNA was obtained by two steps of oligo(dT)-cellulose chromatography.

Hybridization of cDNAs to RNA Blots. RNA was size-fractionated by electrophoresis in 1% agarose gels containing0.22 M formaldehyde (23) and then was transferred tonitrocellulose. Blots were prehybridized for 3-4 hr in asolution containing 4x SSC (lx is 0.15 M NaCl/0.015 Mtrisodium citrate, pH 7), 40o (vol/vol) formamide, 10%(wt/vol) dextran sulfate, 1x Denhardt's solution, and 15 mMTris/HCl (pH 7.5) at 430C. Nick-translated probes (==108dpm/,ug of DNA, 4105 cpm/ml) were added to the prehy-bridization solution and incubated for a further 15-20 hr.Hybridized blots were washed four times (20 min per wash)with 0.1x SSC containing 0.1% NaDodSO4 and were auto-

0-40C8 zn,fiDC co oII CL a. Y U u

1 11 I1100

0 an

radiographed for 6-15 hr at -70'C with two intensifyingscreens.

Peptide Sequence Analysis. Purified 5-lipoxygenase (400Ag) from human leukocytes was reduced with dithiothreitoland carboxymethylated with neutralized iodo[2-14C]aceticacid in 6 M guanidine hydrochloride/0.4 M Tris/2 mMEDTA, pH 8. 1, as described (14, 24). Reagents were removedby extensive dialysis against distilled water, and the carboxy-methylated protein was tested for sensitivity to acid cleavageof Asp-Pro bonds by treatment with 70% formic acid at roomtemperature for 3 days. NaDodSO4/polyacrylamide gel elec-trophoresis revealed that specific cleavage products werelargely absent. The acid was removed, and the protein wasdissolved in 9 M freshly deionized urea (100 ,.l). The clearsolution was diluted to 1 M urea and 0.1 M ammoniumbicarbonate (pH 8.0). Lysine-specific protease (50 ,ug) fromAchromobacter lyticus (Wako Chemicals, Neuss, F.R.G.)was added immediately, and proteolysis was allowed toproceed for 4 hr at 370C. The peptides generated wereseparated by reverse-phase HPLC on an Ultropac (LKB)TSK ODS-120T (5-gm particle size) column, utilizing agradient of acetonitrile (0-80%) in 0.1% trifluoroacetic acid,essentially as described (24, 25). All peptides purified wereanalyzed for amino acid sequence with an Applied Bio-systems (Foster City, CA) 470A gas-phase sequencer. Phen-ylthiohydantoin derivatives were identified by reverse-phaseHPLC (26) with a Hewlett-Packard 1090 system or an appliedBiosystems 120A on-line system.

RESULTS

Antibody Screening of a Lung Xgtll cDNA Library. In orderto clone the cDNA for 5-lipoxygenase, we prepared a specificantiserum against purified human leukocyte 5-lipoxygenasefor immunoscreening a Xgtll library. The specificity of thepurified IgG fraction was tested by immunoblot analysis of100,000 x g human leukocyte sonicate supernatant that hadbeen electrophoresed in a NaDodSO4/10%O polyacrylamidegel. A distinct single band was observed at -80 kDa (data notshown).A human lung Xgtll cDNA library was screened with the

IgG fraction. Fourteen positive phage clones were isolated

Un 0- n m

IIWs~~~~~~~~~~~~~~~~~~ ------

0

0 00

o~~~~P it 0 0

x.qW0-Q-o =I Co0. 0,e W

ALuSlApl 9AS

ApL6S

Apl 5BS4 -4-* * - * **

* O.- .-

- e- o*0 b o --- o IN 0

0 0.5 1.0 1.5 2.0 2.5 kbp

FIG. 1. Partial restriction map and sequencing strategy for cloned cDNAs encoding human 5-lipoxygenase. Direction and extent of sequencedeterminations are indicated by arrows. Overlapping clones produced by T4 DNA polymerase 3' -) 5' exonuclease digestion begin with solidcircles. Restriction fragments begin with open circles. The protein-coding region is shown by the open box. The cDNA insert of Xpl5BS containsa 51-bp repeat sequence that is present only once in the other inserts. This whole area is indicated by the stippled region of the box and thezig-zag arrows in the sequence determinations.

Biochemistry: Matsumoto et al.

Dow

nloa

ded

by g

uest

on

June

24,

202

0

28 Biochemistry: Matsumoto et al. Proc. Nati. Acad. Sci. USA 85 (1988)

and purified to homogeneity by three successive rounds of shown). Antibodies selected by the parent vector Xgt11screening. (lacking a cDNA insert) failed to recognize 5-lipoxygenaseAntibody Selection Assay and Clone Characterization. An- (data not shown).

tibodies recognizing 5-lipoxygenase epitopes on nitrocellu- The cDNA inserts from the 9 positive phages were isolatedlose-bound fusion protein's were prepared from the 14 posi- and found to range in size from 0.3 to 1.5 kbp. The clone withtive phage clones. Selected antibodies from 9 of the 14 clones the longest insert (XuIW01) was nick-translated and used as arecognized purified 5-lipoxygenase on immunoblots (data not probe to check the relatedness of the clones on nitrocellulose

-34 -1IGGG CCCGGCGCT CGCT GCT CC CGCGG CC CGCG CC

ATG CCC TCC TAC ACG GTC ACC GTG GCC ACT GGC AGC CAG TGG TTC GCC GGC ACT GAC GAC TAC ATC TAC CTC AGC CTC GTG GGC TCG GCG 90Met Pro Ser Tyr Thr Va1 Thr Va1 Ala Thr Gly ser Gin Trp Ph. Ala, Gly Thr Asp Asp Tyr Ile Tyr Lou Ser Lou Val Gly Ser Ala 29

GGC TGC AGC GAG AAG CAC CTG CTG GAC AAG CCC TTC TAC AAC GAC TTC GAG CGT GGC GCG GTG GAT TCA TAC GAC GTG ACT GTG GAC GAG 180Gly Cys Ser Glu Lys His Leu Lou Asp Lys Pro Phe Tyr Ain Asp Pho Glu Arg Gly Ala Val Asp Ser Tyr Asp Val Thr Val Asp Giu 59

GAA CTG GGC GAG ATC CAG CTG GTC AGA ATC GAG AAG CGC AAG TAC TGG CTG AAT GAC GAC TGG TAC CTG AAG TAC ATC ACG CTG AAG ACG 270Glu Lou Gly Glu Ilie Gin Lau Va1 Arg Ile Glu Lys Arg Lys Tyr Trp Lou Asn Asp Asp Trp Tyr Lou Lys Tyr Ii. Thr Lou Lys Thr 89

CCC CAC GGG GAC TAC ATC GAG TTC CCC TGC TAC CGC TGG ATC ACC GGC GAT GTC GAG GTT GTC CTG AGG GAT GGA CGC GCA AAG TTG GCC 360Pro His Gly Asp Tyr Ilie Glu Pho Pro Cys Tyr Arg Trp Il. Thr Gly Asp Va1 Glu Val Val Lou Arg Asp Gly Arg Ala Lys Lou Ala 119

CGA GAT GAC CAA ATT CAC ATT CTC AAG CAA CAC CGA CGT AAA GAA CTG GAA ACA CGG CAA AAA CAA TAT CGA TGG ATG GAG TGG AAC CCT 450Arg Asp Asp Gin 11. His Il. Lou Lys Gin His Arg Arg Lys Glu Lou Glu Thr Arg Gin Lys Gin Tyr Arg Trp Mot. Glu Trp Asn Pro 149

GGC TTC CCC TTG AGC ATC GAT GCC AAA TGC CAC AAG GAT TTA CCC CGT GAT ATC CAG TTT GAT AGT GAA AAA GGA GTG GAC TTT GTT CTG 540Gly Ph. Pro Lou Sor 11e Asp Ala Lys Cys His Lys Asp Lou Pro Arg Asp I1e Gin Pho Asp Sor Glu Iys Gly Val Asp Phe Val Lou 179

AAT TAC TCC AAA GCG ATG GAG AAC CTG TTC ATC AAC CGC TTC ATG CAC ATG TTC CAG TCT TCT TGG AAT GAC TTC GCC GAC TTT GAG AAA 630Asn Tyr Scr Lys Ala Hot Glu Asn Lou Pho I1e Asn Arg Pho Mot His Mot Ph. Gin Sor Sor Trp Asn Asp Pho Ala Asp Pho Glu Lys 209

ATC TTT GTC AAG ATC AGC AAC ACT ATT TCT GAG CGG GTC ATG AAT CAC TGG CAG GAA GAC CTG ATG TTT GGC TAC CAG TTC CTG AAT GGC 720Ile Pho Va1 Lys 1i. Sor Asn Thr Il. Ser Glu Arg Val Met AsnHis Trp Gin Gis Asp Lou Hot Ph. Gly Tyr Gin Phe Lou Ass Gly 239

TGC AAC CCT GTG TTG ATC CGG CGC TGC ACA GAG CTG CCC GAG AAG CTC CCG GTG ACC ACG GAG ATG GTA GAG TGC AGC CTG GAG CGG CAG 810aCSy Ass Pro Va1 Lou I1e Arg Arg Cys Thr Glu Lou Pro Giu Lys Lou Pro Val Thr Thr Glu Hot Val Glu Cys Sor Lou Glu Arg Gin 269

CTC AGC TTG GAG CAG GAG GTC CAG CAA GGG AAC ATT TTC ATC GTG GAC TTT GAG CTG CTG GAT GGC ATC GAT GCC AAC AAA ACA GAC CCC 900Lou Sor Lou Giu Gin Glu Va1 Gin Gin Gly Ass 110 Pho I1e Val Asp Pho Glu Lou Lou Asp Gly Ilie Asp Ala Ass Lys Thr Asp Prs 299

TGC ACA CTC CAG TTC CTG GCC GCT CCC ATC TGC TTG CTG TAT AAG AAC CTG GCC AAC AAG ATT GTC CCC ATT GCC ATC CAG CTC AAC CAA 990Cys Thr Lou Gin Ph. Lou Ala Ala Pro 110 Cys Lou Lou Tyr Lys Ass Lou Ala Ass Lys I1. Val Pro 110 Als I1e Gin Lou Ass Gin 329

ATC CCG GGA GAT GAG. AAC CCT ATT TTC CTC CCT TCG GAT GCA AAA TAC GAC TGG CTT TTG GCC AAA ATC TGG GTG CGT TCC AGTI GAC TTC 1060Ilie Pro Giy Asp Gis Ass Pro 110 Pho Lou Pro Sor Asp Ala Lys Tyr Asp Trp Lou Lou Ala Lys Ile Trp V.1 Arg Sor Sor Asp Pho 359

CAC GTC CAC CAG ACC ATC ACC CAC CTT CTG CGA ACA CAT CTG GTG TCT GAG GTT TTT GGC ATT GCA ATG TAC CGC CAG CTG CCT GCT GTG 1170His Val His Gin Thr 110 Thr His Lou Lou Arg Thr His Lou Va1 Sor Glu Va1 Phe Gly 110 Ala Hot Tyr Arg Gin Lou Pro Ala Va1 389

CAC CCC ATT TTC AAG CTG CTG GTG GCA CAC GTG AGA TTC ACC ATT GCA ATC AAC ACC AAG GCC CGT GAG CAG CTC ATC TGC GAG TGT GGC 1260Hi.-pro I1e Ph. Lys Lou Lou Va1 Ala His Val Arg Pho Thr 11. Ala I10 Ass Thr Lys Ala Arg Glu Gin Lou Ilie Cys Giu Cys Gly 419

CTC TTT GAC AAG GCC AAC GCC ACA GGG GGC GGT GGG CAC GTG CAG ATG GTG CAG AGG GCC ATG AAG GAC CTG ACC TAT GCC TCC CTG TGC 1350Lou Ph. Asp Lys Ala Ass Ala Thr Gly Gly Gly Giy His Va1 Gin Hot Val Gin Arg Ala Hot Lys Asp Lou Thr Tyr Ala Sor Lou Cy ! 449

TTT CCC GAG GCC ATC AAG GCC CGG GGC ATG GAG AGC AAA GAA GAC ATC CCC TAC TAC TTC TAC CGG GAC GAC GGG CTC CTG GTG TGG GAA 1440Pho Pro Giu Ala 110 Lys Ala Arg Gly Hot Glu Sor Lys Glu Asp 110 Pro Tyr Tyr Pho Tyr Arg Asp Asp Gly Lou Lou Val Trp Glu 479

GCC ATC AGG ACG TTC ACG GCC GAG GTG GTA GAC ATC TAC TAC GAG GGC GAC CAG GTG GTG GAG GAG GAC CCG GAG CTG CAG GAC TTC GTG 1530Ala 11e Arg Thr Pho Thr Ala Giu Va1 Va1 Asp 110 Tyr Tyr Giu Sly Asp Gin Val Val Glu Glu Asp Pro Giu Lou Gin Asp Pho Val 509

AAC GAT GTC TAC GTG TAC GGC ATG CGG GGC CGC AAG TCC TCA GGC TTC CCC AAG TCG GTC AAG AGC CGG GAG CAG CCT GTC GGA GTA CCT 1620Asn Asp Val Tyr Vai Tyr Gly Mot Arg Gly Arg Lys Sor Sor Gly Ph. Pro Lys Sor V.1 Lys Sor Arg Giu Gin Pro Vsi Sly Va1 Pro 539

GAC CGT GGT GAT CTT CAC CGC CTC CGC CCA GCA CGC CGC GGT CAA CTT CGG CCA GTA CGA CTG GTG CTC CTG GAT CCC CAA TGC GCC CCC 1710Asp Arg Gly Asp Lou His Arg Lou Arg Pro Ala Arg Arg Gly Gin Lou Arg Pro Val Arg Lou Val Leu Lou Asp Pro Gin Cys Ala Pro 569

AAC CAT GCG AGC CCC GCC ACC GAC TGC CAA GGG GTG GTG ACC ATT GAG CAG ATC GTG GAC ACG CTG CCC SAC CGC GGC CGC TCC TGC TGG 1800oAan His Ala Sor Pro Ala Thr Asp Cys Gin Sly Val Val Thr 11e Glu Gin 110 Val Asp Thr Lou Pro Asp Arg Giy Arg Ser Cys Trp 599

CAT CTG GGT GCA GTG TGG GCG CTG AGC CAG TTC CAG GAA AAC GAG CTG TTC CTG GGC ATG TAC CCA GAA GAG CAT TTT ATC GAG AAG CCT 1890His Lou Gly Ala Val Trp Ala Lou Ser Gin Phe Gin Glu Ass Glu Lou Pho Leu Sly Hot Tyr Pro Giu Glu His Phe Ilie Glu Lys Pro 629

GTG AAG GAA GCC ATG GCC CGA TTC CGC AAG AAC CTC GAG GCC ATT GTC AGC GTG ATT GCT GAG CGC AAC AAG AAG AAG CAG CTG CCA TAT 1980oVal Lys Glu Ala Hot Ala Arg Phe Arg Lys Asn Lou Giu Ala Ilie V.1 Ser Va1 Ilie Ala Glu Arg Ass Lyu Lys Lys Gin Lou Pro Tyr 659

TAC TAC TTG TCC CCA GAC CGG ATT CCG AAC AGT GTG GCC ATC TGA GCACACTGCCAGTCTCACTGTGGGAAGGCCAGCTGCCCCAGCCAGATGGACTCCAGCCT 2084Tyr Tyr Lou Sor Pro Asp Arg Ilie Pro Ass Sor Va1 Ala Ilie--673

GCCTGGCAGGTGTCTGGCCAGGCCTCTTGGCAGTCACATCTCT TCCTCCGAGGCCAGTACCTTTCCATTTATTCTTTGAT CTTCAGGGAACTGCATAGATTGATCAAAGTGTAAACACC 2203

AGTTCATTTAAAAAAAAAAAAAAAA 26

FIG. 2. Nucleotide sequence of 5-lipoxygenase cDNAs and the predicted amino acid sequence. Nucleotides are numbered beginning withthe first base of the ATG initiator codon. Nucleotides to the 5' side are designated by negative numbers. Amino acids are numbered from theamino-terminal proline residue of the mature protein. Solid underlining represents regions determined also by direct peptide analysis (brokenunderlines indicate amino acids incompletely identified in the peptide analyses but with analytical data compatible with the deduced amino acidsequence). The polyadenylylation signal is double-underlined. The overlined region bordered by asterisks is repeated in Xpl5BS and would beinserted between nucleotides 1228 and 1229.

Dow

nloa

ded

by g

uest

on

June

24,

202

0

Proc. Natl. Acad. Sci. USA 85 (1988) 29

blots after agarose gel electrophoresis. Eight of the 9 clonescross-hybridized with XluIOl, whereas one clone (XluSl) didnot. The inserts from both XluIOl and XluS1 were sequenced.XluS1 had a 397-bp insert and was found to contain a codingsequence for a segment that was known for 17 amino acidsfrom the peptide analyses of the lipoxygenase fragments (seeFigs. 1 and 2). This finding identifies XluS1 as part of the5-lipoxygenase cDNA.

Screening for Additional 5-Lipoxygenase Clones. The insertfrom XluS1 was nick-translated and used as a probe forfinding clones with longer inserts from a Xgtll humanplacenta cDNA library. Four strongly positive clones wereobtained after screening =8 x 105 cDNA clones. Theseclones were purified and the sizes of the EcoRI inserts weredetermined to be 1.3, 1.6, 2.2, and 2.6 kbp.

Nucleotide Sequence of cDNA and Deduced Amino AcidSequence for 5-Lipoxygenase. The insert of the clone contain-ing the 2.6-kbp insert (Xpl5BS) was sequenced. Xpl5BScontains a 2551-bp insert, excluding EcoRI linkers, with 2073bp from the initiator codon ATG to the stop codon TGA in acontinuous open reading frame. Within this insert there aretwo adjacent exact 51-bp repeating units (Fig. 2 legend). Thepresence of this repeat suggested the possibility of a cloningartifact (see Discussion). Therefore, two additional clones,Xpl9AS (1.6-kbp insert) and Xpl6S (2.2-kbp insert) weresequenced. Only one copy of the 51-bp unit was present ineach ofthese inserts (Fig. 1). All other sequenced nucleotideswere identical to the insert of Xpl5BS. Consequently, the true5-lipoxygenase is concluded also to lack the repeat, and theopen reading frame would encode a mature protein of 673amino acids with a calculated molecular weight of 77,839(Fig. 2). The 5' noncoding region is 34 bp long. The 3'noncoding region is 442 bp long and contains an AATAAApolyadenylylation signal 11 bases upstream from the poly(A)tail.

Direct Analysis of 5-Lipoxygenase. Preparations of purified5-lipoxygenase were investigated structurally. Total compo-sitions by acid hydrolysis showed reproducibility betweenpreparations. The values obtained are in agreement with

Table 1. Total composition of human 5-lipoxygenaseResidues per polypeptide

Amino acid analysis Predicted fromResidue mol % of purified protein cDNA sequence

Asx 10.1 66 72Thr 4.8 31 27Ser 5.5 36 31Glx 12.2 80 79Pro 5.0 33 35Gly 5.9 39 35Ala 7.0 46 40Val 6.9 45 50Met 2.0 13 14Ile 6.3 41 42Leu 10.1 66 63Tyr 4.3 28 28Phe 5.2 34 33Trp ND ND 13Lys 5.6 37 37His 2.3 15 18Arg 5.5 36 42Cys 1.8 12 14

The mol % values are from amino acid analysis of 6 M HCJhydrolysates (3 analyses of 2 different preparations; Trp not deter-mined, ND) without corrections for hydrolytic losses, slow release,or impurities. Residues per polypeptide chain were estimated direct-ly from amino acid analysis or determined indirectly from thededuced amino acid sequence shown in Fig. 2.

1 2 3 4 5 6

28S I~

18S --O--

TI

FIG. 3. Autoradiogram of RNA blot analysis. Human poly(A)+RNA from various tissues was electrophoresed in a 1% agarose gelcontaining 0.22 M formaldehyde, blotted onto nitrocellulose, andhybridized with the 32P-labeled insert of XluS1. Lanes: 1, placenta(2.5 ,ug); 2, leukocyte (1 pg); 3, leukocyte (2.5 Ag); 4, lung (1 ,ug); 5,lung (2.5 ,g); 6, leukocyte poly(A)- RNA (2.5 Ag). Positions of 28Sand 18S rRNAs are indicated at left.

those calculated from the sum of the amino acid sequencededuced (Table 1).Attempts at cleavage with CNBr showed that the size and

solubility ranges ofthe fragments obtained were unfavorable,and the main preparation studied [5 nmol (starting material)of 5-lipoxygenase] was therefore carboxymethylated andutilized for enzymatic cleavage with a lysine-specific prote-ase from A. lyticus. About 30 different fragments werepurified by reverse-phase HPLC in a one-step procedure.Sequence information was obtained for about one-third oftheprotein chain at internal segments (Fig. 2, underlined re-gions). At several positions, however, residue assignmentswere tentative because of variable yield of unstable aminoacids and because of the presence of peptide mixtures. Inaddition, the intact protein was directly analyzed withoutcleavage, yielding the amino acid sequence of the first 17residues, since the amino terminus was not blocked. All thestructures directly analyzed agree completely with thosededuced from the cDNA.RNA Blot Analysis. Poly(A)+ RNA obtained from human

lung, placenta, and peripheral leukocytes was subjected toblot analysis using the insert ofXluS1 as a hybridization probe(Fig. 3). Hybridization to a discrete mRNA of =2700 nucle-otides occurred in all three tissues. A faint band at =3200nucleotides was also present in the leukocyte sample. Thehybridization intensity was greatest for leukocyte poly(A)+RNA, followed by the preparations from placenta and lungtissue.

DISCUSSIONA clone carrying the complete coding region for 5-lipoxy-genase was isolated from a human placenta Xgtll cDNAlibrary. However, it was found to contain an internal repeatsegment that was not present in other overlapping clones.The repeat segment likely represents a cloning artifactintroduced during cDNA synthesis. The corresponding re-gion of the mRNA (nucleotides 1230-1362) has a sequencesuggesting extensive secondary structure, which may havecreated transcriptional problems during first-strand cDNAsynthesis. Consequently, the insert corresponding to 5-lipoxygenase is deemed likely not to have this repeat seg-ment. With this in mind, it follows that the cDNAs for5-lipoxygenase would encode a mature protein of 673 aminoacids (the initiator methionine is not present in the matureprotein: direct sequence analysis revealed the subsequentproline residue to constitute the amino terminus). The pre-dicted molecular weight of 77,839 agrees well with valuesobtained from NaDodSO4/polyacrylamide gel electrophore-sis. Furthermore, the deduced amino acid sequence of the

Biochemistry: Matsumoto et aL

Dow

nloa

ded

by g

uest

on

June

24,

202

0

30 Biochemistry: Matsumoto et al.

first 17 amino acids is identical to the sequence determined byEdman degradation of the purified protein and to the amino-terminal sequence of rat basophilic leukemia cell 5-lipoxy-genase (6). In addition, the deduced sequence agrees with thesequences of internal peptides generated by proteolyticcleavages of purified leukocyte 5-lipoxygenase (Fig. 2). Theamino acid composition of 5-lipoxygenase determined fromthe sequence is also in good agreement with the compositionobtained by chemical analysis of the purified enzyme (Table1).Another possible interpretation of the 51-bp repeat unit

within the insert of Xpl5BS would involve two forms ofmRNA for 5-lipoxygenase. The repeat does not alter the openreading frame. In this case a mature protein of 690 aminoacids with a calculated molecular weight of 79,758 would bethe result.The mRNA for human 5-lipoxygenase has a 442-bp 3'

noncoding region that is A+T-rich (73%), while the 34-bp 5'noncoding region is characteristically G+C-rich (91%). Co-don usage is heavily biased towards codons ending in C or Gas is the case for the majority of human mRNAs (27).The structure of 5-lipoxygenase has no long segments with

noticeably hydrophobic properties. A segment centeredaround residue 310 and, to some extent, one after position 643have several consecutive hydrophobic residues, but neithersegment reveals extreme properties. The protein is fairly richin tryptophan and other aromatic residues. This also appliesto the basic residues, which not infrequently occur in pairs orother small clusters.

5-Lipoxygenase, which requires Ca2+ and ATP for maxi-mal activity, shows no significant homologies (WORD-SEARCH program of the University of Wisconsin GeneticsComputer Group) with any of the proteins in the NationalBiomedical Research Foundation's protein data bankJ in-cluding leukotriene A4 hydrolase (14, 15). A search for thetypical "E-F hand" Ca2+-binding domain associated withCa2+-binding proteins (28) revealed no such sites in 5-lipoxygenase. From kinetic studies with guinea pig neutrophil5-lipoxygenase, it has been suggested that the free carboxylicmoiety of arachidonic acid may be involved in binding Ca2+at the active site (29), as was demonstrated previously forsoybean lipoxygenase type II (30). Recent studies (C. A.Rouzer and B.S., unpublished) indicate the possibility thatCa2+ may effect a translocation of the normally solubleenzyme to a membrane site, which may be related to theactivation of the enzyme.The presence of a consensus element (31) known to be

present in ATP-binding proteins like protein kinase C (32) andadenylate kinase (33) was not found. ATP does not stimulate5-lipoxygenase activity in the absence of Ca2+, but in thepresence of Ca2+ there is a marked enhancement of activity.The availability ofacDNA for 5-lipoxygenase will facilitate

further studies to elucidate its regulation and mechanism ofaction.

tProtein Identification Resource (1987) Protein Sequence Database(Natl. Biomed. Res. Found., Washington, DC), Release 12.

We thank Lena Eliasson, Carina Palmberg, Anne Peters, andGunilla Lundquist for excellent assistance. This study was supportedby fellowships from Japan Tobacco Inc. (to T.M.) and Fonds de laRecherche en Sante du Quebec (to C.D.F.) and by grants from theSwedish Medical Research Council (03X-217, 03X-7467, and 03X-3532), the Konung Gustav V 80-ars fond, the Magnus BergwallFoundation, and the Swedish Cancer Society (1806).

1. Samuelsson, B. (1983) Science 220, 568-575.2. Samuelsson, B., Dahldn, S.-E., Lindgren, J. A., Rouzer, C. A. &

Serhan, C. N. (1987) Science 237, 1171-1176.3. Rouzer, C. A., Matsumoto, T. & Samuelsson, B. (1986) Proc.

Natl. Acad. Sci. USA 83, 857-861.4. Shimizu, T., Izumi, T., Seyama, Y., Tadokoro, K., Radmark,

O. & Samuelsson, B. (1986) Proc. Natl. Acad. Sci. USA 83,4175-4179.

5. Ueda, N., Kaneko, S., Yoshimoto, T. & Yamamoto, S. (1986)J. Biol. Chem. 261, 7982-7988.

6. Hogaboom, G. K., Cook, M., Newton, J. F., Varrichio, A.,Shorr, R. G. L., Sarall, H. M. & Crooke, S. T. (1986) Mol.Pharmacol. 30, 510-519.

7. Shimizu, T., Ridmark, 0. & Samuelsson, B. (1984) Proc.Nati. Acad. Sci. USA 81, 689-693.

8. Serhan, C. N., Nicolaou, K. C., Webber, S. E., Veale, C. A.,Dahldn, S.-E., Puustinen, T. J. & Samuelsson, B. (1986) J.Biol. Chem. 261, 16340-16345.

9. Serhan, C. N., Nicolaou, K. C., Webber, S. E., Veale, C. A.,Haeggstrom, J., Puustinen, T. & Samuelsson, B. (1987) inAdvances in Prostaglandin, Thromboxane and LeukotrieneResearch, eds. Samuelsson, B., Paoletti, R. & Ramwell, P.(Raven, New York), Vol. 17A, pp. 90-93.

10. Rouzer, C. & Samuelsson, B. (1985) Proc. Natl. Acad. Sci.USA 82, 6040-6044.

11. Goetze, A. M., Fayer, L., Bouska, J., Bornemeier, D. &Carter, G. W. (1985) Prostaglandins 29, 689-701.

12. Rouzer, C., Shimizu, T. & Samuelsson, B. (1985) Proc. NatI.Acad. Sci. USA 82, 7505-7509.

13. Samuelsson, B., Rouzer, C. A. & Matsumoto, T. (1987) inAdvances in Prostaglandin, Thromboxane and LeukotrieneResearch, eds. Samuelsson, B., Paoletti, R. & Ramwell, P.(Raven, New York), Vol. 17A, pp. 1-11.

14. Funk, C. D., RAdmark, O., Fu, J. Y., Matsumoto, T., JMrn-vall, H., Shimizu, T. & Samuelsson, B. (1987) Proc. Natl.Acad. Sci. USA 84, 6677-6681.

15. Minami, M., Ohno, S., Kawasaki, H., Ridmark, O., Samuels-son, B., Jornvall, H., Shimizu, T., Seyama, Y. & Suzuki, K.(1987) J. Biol. Chem., in press.

16. Huynh, T. V., Young, R. A. & Davis, R. W. (1985) in DNACloning, ed. Glover, D. M. (IRL, Oxford), Vol. 1, pp. 49-78.

17. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) MolecularCloning: A Laboratory Manual (Cold Spring Harbor Labora-tory, Cold Spring Harbor, N.Y.).

18. Hall, R., Hyde, J. E., Goman, M., Simmons, D. L., Hope,I. A., Mackay, M., Sealfe, J., Merkli, B., Richle, R. &Stocker, J. (1984) Nature (London) 311, 379-382.

19. Dente, L., Cesareni, G. & Cortese, R. (1983) Nucleic AcidsRes. 11, 1645-1655.

20. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl.Acad. Sci. USA 74, 5463-5467.

21. Dale, R. M. K., McClure, B. A. & Houchins, J. P. (1985)Plasmid 13, 31-40.

22. Chirgwin, J. M., Przybyla, H. E., MacDonald, R. J. & Rutter,W. J. (1978) Biochemistry 18, 5294-5299.

23. Persson, H., Gray, H. E. & Godeau, F. (1985) Mol. Cell. Biol.5, 2903-2912.

24. Kaiser, R., Holmquist, B., Hempel, J., Vallee, B. L. &Jornvall, H. (1987) Biochemistry, in press.

25. Jeffery, J., Cederlund, E. & Jornvall, H. (1984) Eur. J.Biochem. 140, 7-16.

26. Zimmerman, C. L., Appella, E. & Pisano, J. J. (1977) Anal.Biochem. 77, 569-573.

27. Maruyama, T., Gojobori, T., Aota, S. & Ikemura, T. (1986)Nucleic Acids Res. 14, Suppl., rl51-r190.

28. Tufty, R. M. & Kretsinger, R. H. (1975) Science 187, 167-169.29. Aharony, D. & Stein, R. L. (1986) J. Biol. Chem. 261,

11512-11519.30. Zimmerman, G. L. & Snyder, H. E. (1974) J. Agric. Food

Chem. 22, 302-305.31. Bradley, M. K., Smith, T. F., Lathrop, R. H., Livingston,

D. M. & Webster, T. A. (1987) Proc. Natl. Acad. Sci. USA 84,4026-4030.

32. Parker, P. J., Coussens, L., Totty, N., Rhee, L., Young, S.,Chen, E., Stabel, S., Waterfield, M. D. & Ulrich, A. (1986)Science 233, 853-859.

33. Kamps, M. P., Taylor, S. S. & Sefton, B. M. (1984) Nature(London) 310, 589-592.

Proc. Natl. Acad. Sci. USA 85 (1988)

Dow

nloa

ded

by g

uest

on

June

24,

202

0

3406 Biochemistry: Corrections

Correction. In the article "Isolation and structural charac-terization of a cDNA clone encoding rat gastric intrinsicfactor," by B. K. Dieckgraefe, B. Seetharam, L. Banaszak,J. F. Leykam, and D. H. Alpers, which appeared in number1, January 1988, of Proc. Natl. Acad. Sci. USA (85, 46-50),the shading for the hydrophobic segments in Fig. 5 did not

1 5 p 10 15 p 20 25 1

l- F-l _' _ HIIFAMS T R AQ R S C SVFPMD QQ PW[ N.. - HQ L L M E N V T ES M D -- S P Z I R V L W. T A A Q LA FTTL L Y I GF-'_ F_ a Nx

61 65 70 75 80 90 95

IFAM Y L A K T YL M A MOiA L T N G Q L A L T I M A

SMDHV0xJL EB C A N K S SF G K G Y A S Z B V G V L L A G

3|:D

Proc. Natl. Acad. Sci. USA 85 (1988)

reproduce in the photoprocessing of the figure. The residuesthat should have been shaded include: for IFAM, residues25-26, 44-50, and 90-96; for SMDH, residues 16-20, 23-24,26-28, 30-31, 44-51, 70-73, and 90-95. The correct figureand its legend are shown below.

35 40 0 550

E SD L --PH IA-HNLA0----- TB G S V F G K Z P -LS L D V VF K Z Z T S Z A

-1

I

PB1 0 0

FIG. 5. Alignment of the nucleotide binding domain of cytoplasmic malate dehydrogenase (SMDH) with the first 80 amino acids (identifiedby the single-letter code) ofIF (IFAM) following the signal peptide. Identical conserved amino acids that are present in both proteins are indicatedby open boxes. Position of p-strands A-D and the a-helix labeled B in SMDH (27) and in IF [predicted by Chou and Fasman (20)] are shownbelow and above the sequence comparisons, respectively. Positions of hydrophobic segments for both proteins, calculated by the method ofKyte and Doolittle (21), are indicated by shading. Positions of the conserved residues discussed in the text are indicated by arrowheads.

Correction. In the article "Molecular cloning and amino acidsequence of 5-lipoxygenase" by Takashi Matsumoto, ColinD. Funk, Olof Radmark, Jan-Olov Hoog, Hans Jornvall, andBengt Samuelsson, which appeared in number 1, January1988, of Proc. Natl. Acad. Sci. USA (85, 26-30), the authorsrequest that the following corrections be noted. Recentnucleotide sequence and restriction site analyses have estab-lished that a cytosine residue was omitted at position 1744 ofthe 5-lipoxygenase cDNA sequence in Fig. 2 and that the

cytosine residue at position 1606 should be deleted. Theamended nucleotide sequence and the altered prediction oftranslation of 5-lipoxygenase are given below. Correspondingchanges in Table 1 should be noted. The calculated molecularweight for 5-lipoxygenase is therefore 77,856. Additionally, acytosine residue should be inserted between nucleotides 2094and 2095 in the 3' noncoding region. The corrections do nototherwise affect the conclusions of the paper.

Pvu II

CGG GAG CAG CTG TCG GAG TAC CTGArg Glu Gin Leu Ser Glu Tyr Leu

ACC GTG GIG ATC TTC ACC GCC TCC GCC CAG CAC GCC GCG GTC AAC TTC GGC CAG TAC GAC TGG TGC TCC TGG ATC CCC AAT GCG CCC CCAThr Val Val Ile Phe Thr Ala Ser Ala Gin His Ala Ala Val Asn Phe Gly Gln Tyr Asp Trp Cys Ser Trp lie Pro Asn Ala Pro Pro

ACC ATG CGA GCC CCG CCA CCG ACT GCC AAG GGC GTG CTG ACCThr Met Arg Ala Pro Pro Pro Thr Ala Lys Gly Val Val Thr

1620539

1110569