PCR Optimization:PCR Optimization: Challenges and Successes Challenges and Successes

May 8, 2009May 8, 2009DNA Facility Seminar SeriesDNA Facility Seminar Series

OutlineOutline

Components of the PCR reactionComponents of the PCR reaction

Cycling ConditionsCycling Conditions

Variations on basic PCRVariations on basic PCR

PCR: HistoryPCR: HistoryPCR Invention: 1987 Kary MullisPCR Invention: 1987 Kary Mullis

PCR is essentially DNA replication in a tube.PCR is essentially DNA replication in a tube.

Series of repetitive steps enabling amplificationSeries of repetitive steps enabling amplificationof target DNA from a complex mixture of DNAof target DNA from a complex mixture of DNA

Starting ThoughtsStarting Thoughts

Think about purpose of PCR and downstream Think about purpose of PCR and downstream applications for your PCR productapplications for your PCR product

Think about “Carry over effect”Think about “Carry over effect” Set up area keeping in mind PCR has the potential Set up area keeping in mind PCR has the potential sensitivity to amplify a single molecule sensitivity to amplify a single molecule

BasicsBasics TargetTarget

dNTP’sdNTP’s

BufferBuffer

PrimersPrimers

DNA Taq polymeraseDNA Taq polymerase

Denature- 92Denature- 9200C-95C-9500C C (94(9400C)C)

Anneal- 50Anneal- 5000C-72C-7200CCAim for 5Aim for 500C below C below calculated Tmcalculated Tm(52(5200C-58C-5800C generally best)C generally best)

Extension - 68Extension - 6800C-80C-8000CC(72(7200C)C)highest efficiency 70highest efficiency 7000C-80C-8000CC

TemplateTemplate

PlasmidPlasmid cDNA (RT-PCR)cDNA (RT-PCR) Genomic DNAGenomic DNA

Purified (P)Purified (P) Crude Lysate (C)Crude Lysate (C)

P C P C Plasmid Genomic

40ng 10ng 1ng

dNTPsdNTPs Mixture of dATP, dCTP, dGTP, dTTP or dUTPMixture of dATP, dCTP, dGTP, dTTP or dUTP

Purity- chemical or enzymatic synthesisPurity- chemical or enzymatic synthesisStability- concentration – Li or Na salt formStability- concentration – Li or Na salt form

dNTPsdNTPs

Purity can effect PCRPurity can effect PCR

BufferBufferAll 10x Buffers are not the sameAll 10x Buffers are not the same

SaltSalt 10-50 mM Tris pH 8.310-50 mM Tris pH 8.3

Monovalent cationMonovalent cation 100-150 mM KCl or NaCl100-150 mM KCl or NaCl

Divalent cationDivalent cation 1.5uM or > MgCl1.5uM or > MgCl2+2+

Mg2+, Mn2+Mg2+, Mn2+

Additives Additives Detergent, Glycerol, Detergent, Glycerol, GelatinGelatin

Buffer SystemsBuffer Systems Modifications:

MgpHIonic strength Additives

Ionic strength

Mg2+

Buffer AdditivesBuffer Additives

Q-solution-BetaineQ-solution-Betaine DMSODMSO BSA BSA GlycerolGlycerol GelatinGelatin PEG PEG GC-meltGC-melt FormamideFormamide Detergents Detergents Q D B G P Q/D F D

PrimersPrimers Pair complementary to opposite strandsPair complementary to opposite strands

5’5’3’ sense primer3’ sense primer 3’3’5’ anti-sense primer 5’ anti-sense primer

FeaturesFeatures18-26 nucleotides18-26 nucleotides Equal mix GC to AT Equal mix GC to AT basesbasesMatch Tm of primersMatch Tm of primers Tm Tm ooC= 2(A/T) + 4(G/C)C= 2(A/T) + 4(G/C) 3’ Stability 3’ Stability GG or GC clampsGG or GC clamps

Additional ConsiderationsAdditional Considerations Secondary structure- avoid hairpins, self-dimers, cross-Secondary structure- avoid hairpins, self-dimers, cross-

homologyhomology

Avoid di-nucleotide repeats that occur consecutively- Avoid di-nucleotide repeats that occur consecutively- ATATATATATATATAT

Avoid long runs of single bases- ACGGGGGGATAvoid long runs of single bases- ACGGGGGGAT

Avoid cross-homology- BLAST TestAvoid cross-homology- BLAST Test

Primer Variation ExamplePrimer Variation ExamplePCR 1st Round vary primer pairs Sets A-F

Forward primersPrimer 1: GAGGGCAGATTCGGGAATG Tm=600cPrimer 2: TCGGGAGAGGCCCTTCCC Tm=620cPrimer 3: CAGTTTCCCGGGTTCGGC Tm=600c

Reverse primersPrimer 1: AGCCTAATCAAGTCACTATCAAG Tm=620CPrimer 2: GCAAGTGAGAAAATGGGGAG Tm=600C

A= Primer 1F Primer 1RB= Primer 2F Primer 1RC= Primer 3F Primer 1RD= Primer 1F Primer 2RE= Primer 2F Primer 2RF= Primer 3F Primer 2R

DNA Taq PolymerasesDNA Taq PolymerasesConsiderations: Considerations: Aim of experimentAim of experiment Thermal stabilityThermal stability ProcessivityProcessivity Fidelity Fidelity

DNA Taq PolymerasesDNA Taq PolymerasesStandard polymeraseStandard polymerase works for most works for most

applicationsapplicationsStandard polymerase with loading dyeStandard polymerase with loading dye aids in higher through-putaids in higher through-putHot Start polymerase Hot Start polymerase inhibits non-specific inhibits non-specific

primer primer extensionextensionPolymerase blends or cocktailsPolymerase blends or cocktails combine polymerases for combine polymerases for

fidelity with speedfidelity with speed

Taq blend Standard Taq Hot Start Taq

FidelityPCR product sequence

PCR product T/A clonedIndividual isolates sequenced

PCR CyclingPCR Cycling

Modified PCR MethodsModified PCR Methods Hot Start PCRHot Start PCR

Manual Hot StartManual Hot StartPhysical BarrierPhysical BarrierModified Taq DNA polymeraseModified Taq DNA polymeraseOligo InhibitorsOligo InhibitorsModified dNTP’sModified dNTP’s

Semi-Nested or Nested PCRSemi-Nested or Nested PCR Touch down PCRTouch down PCR

Semi-Nested or Nested-PCRSemi-Nested or Nested-PCR

Specificity

-------------------------------------------

Sensitivity

Additional PCR MethodsAdditional PCR Methods Allele-specific PCRAllele-specific PCR Assembly PCR (PCA)Assembly PCR (PCA) Breakpoint PCRBreakpoint PCR Intersequence-specific PCR (ISSR)Intersequence-specific PCR (ISSR) Inverse-PCR (IPCR or RE-PCR)Inverse-PCR (IPCR or RE-PCR) Ligation Mediated PCR (LM-PCR)Ligation Mediated PCR (LM-PCR) Long distance PCRLong distance PCR Multiplex-PCRMultiplex-PCR Methylation Specific PCR Methylation Specific PCR Mini-primer PCRMini-primer PCR Quantitative PCR or Real-time PCRQuantitative PCR or Real-time PCR Reverse Transcriptase PCR (RT-PCRReverse Transcriptase PCR (RT-PCR))

RT-PCRRT-PCRQuality of RNA

Reverse Transcriptase-QColigo dTrandom hexamersgene specific primers

Multiplex-PCRMultiplex-PCR

Exon 7 and 8Exon 9Exon 3Exon 5Exon 1Exon 2Exon 6Exon 4

2 3 4 5 6 7 81 9

Increase throughputIncrease data with limited material

Long-PCRLong-PCRAnalyze large area in single reaction

Tool to analyze inserts and breakpoints

14kb

3kb

1.6kb 20kb

Breakpoint-PCRBreakpoint-PCR Isolate low frequency event Isolate low frequency event

Inverse-PCR and RE-Inverse PCRInverse-PCR and RE-Inverse PCR Isolate unknown flanking regionIsolate unknown flanking region

Digest with restriction enzymeDigest with restriction enzymeLigate with T4 DNA ligaseLigate with T4 DNA ligase

Real-Time PCR or Q-PCRReal-Time PCR or Q-PCR Increased SensitivityIncreased Sensitivity Increased SpecificityIncreased Specificity Increased ThroughputIncreased Throughput

QuestionsQuestions