18
Nano-assembly Peng Yin Department of Systems Biology, Harvard Medical School Wyss Institute for Biologically Inspired Engineering, Harvard University March 7th, 2013 The Science of Digital Fabrication Workshop

Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

  • Upload
    others

  • View
    1

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

Nano-assembly

Peng Yin

Department of Systems Biology, Harvard Medical School

Wyss Institute for Biologically Inspired Engineering, Harvard University

March 7th, 2013

The Science of Digital Fabrication Workshop

Page 2: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

A B

D C

B

A

C D

Digital fabrication with DNA

Same color denotes complementary segments

Simple Robust Designable

N.C. Seeman, J. Theor. Biol., 1982

Page 3: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

DNA nano-structures

1D tubes

3-helix bundle

TX-tube

6-helix bundle

4x4 tube DX tube

single-strandDX-like tubes

(Liu, Park, Reif & LaBean 04)

(He, Chen, Liu,Ribbe & Mao 05)

(Park, Barish, Li, Reif,Finkelstein,Yan & LaBean 05)

(Rothemund, Ekani-Nkodo, Papadakis, Kumar,

Fygenson & Winfree 04)

…(Mathieu, Liao, Kopatsch,Wang, Mao & Seeman 05)

Chiral DX tube

(Mitchell, Harris, Malo, Bath &Turberfield 04)

(Yan, Park, Finkelstein,Reif & LaBean 03)

1D ribbons

(Schulman, Winfree, 06)

Zigzag ribbonNano-trackRhombus ribbon

(Mao, Sun & Seeman, 1999)

(Park, Yin, Liu, Reif LaBean & Yan 05)

TX ribbon

(Li, Park, Reif, LaBean, Yan 03)

3D

(Shih, Quispe & Joyce 04)

(Goodman, Schaap, Tardin, Erben, Berry, Schmidt & Turberfield 05)

TetrahedronOctahedron

Algorithmic latticeSierpinsky triangle Counting/copying

(Rothemund, Papadakis& Winfree 04)

(Barish, Rothemund & Winfree 05)

Barcode lattice

(Yan, LaBean, Feng & Reif 03)

triangle lattice

2D latticesDX lattice TX lattice 4x4 lattices

hexagonal lattice 3 point-star lattices symmetry lattice

Rhombus lattice

(Mao, Sun & Seeman 99)

(Winfree, Liu, Wenzler & Seeman 98)

(LaBean, Yan, Kopatsch, Liu, Winfree, Reif, & Seeman 00)

(Liu, Wang, Deng, Walulu & Mao 04) (He, Tian, Chen, Deng,

Ribbe & Mao 05)

(He, Chen, Liu,Ribbe & Mao 05)

HJ lattice

(Malo, Mitchell, Venien-Bryan, Harris,Wille,

Sherratt & Turberfield 05)

(Reishus, Shaw, Brun,Chelyapov & Adleman 05)

DDX lattice

(Chelyapov, Brun, Gopalkrishnan, Reishus, Shaw & Adleman 04)

(Yan, Park, Finkelstein,Reif & LaBean 03)

(Rothemund 05)

SAO lattice

(Rothemund 06)

Origami

(Rothemund 06)

Page 4: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

Rapid prototyping with

DNA bricks

Page 5: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

Y. Ke, L. Ong, W. Shih, P. Yin, Science, 338:1177-1183, 2012 Yin lab @ Harvard

Page 6: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

Building 3D structures with DNA bricks

Y. Ke, L. Ong, W. Shih, P. Yin, Science, 338:1177-1183, 2012 Yin lab @ Harvard

Page 7: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

Yin lab @ Harvard

Page 8: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

Scaling up

Page 9: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

Hierarchical assembly

Yan lab @ ASU

Zhao Zhao , Yan Liu *, and Hao Yan * Nano Lett., 2011

100 nm

Page 10: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

NanoAssembler: iterative, solid phase synthesis of geometry

Slide credit: Charles Fracchia Gershenfeld lab @ MIT

Page 11: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

Scaffolds for functional materials

Page 12: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

Fluorescent barcodes for multiplexed imaging

Lin, Jungmann, Leifer, Li, Levner, Church, Shih* & Yin*, Nature Chemistry 4:832 (2012)

Fluorophores

Church, Shih, Yin labs @ Harvard

Fluorophores

Page 13: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

SM Douglas, I Bachelet, GM Church (2012) Science. 335:831

DNA “nanorobot” for targeted delivery

Proteins

Church lab @ Harvard

Proteins

Page 14: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

Anton Kuzyk et al, Nature 483, 311, 2012

Chiral gold arrays for “Carving light”

Liedl lab @ LMU

Gold particles

Gold particles

Page 15: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

DNA to

inorganic

Page 16: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

3D nano-printing with DNA bricks

Scaffolds for functional materials Digital fab of inorganic nano-structures

Scaling up

Digital fabrication of functional nano-structures with DNA

Page 17: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

Digital fabrication by nature: Genome for a whale

Digital fabrication by us: Genome for a computer?

“Grow” a computer using DNA?

ATGGTGAGCAAGGGCGCCGAGCTGTTCACCGGCATCGTGCCCATCCTGATCGAGCTGAATGGCGATGTGAATGGCCACAAGTTCAGCGTGAGCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCTGTGCCCTGGCCCACCCTGGTGACCACCCTGAGCTACGGCGTGCAGTGCTTCTCACGCTACCCCGATCACATGAAGCAGCACGACTTCTTCAAGAGCGCCATGCCTGAGGGCTACATCCAGGAGCGCACCATCTTCTTCGAGGATGACGGCAACTACAAGTCGCGCGCCGAGGTGAAGTTCGAGGGCGATACCCTGGTGAATCGCATCGAGCTGACCGGCACCGATTTCAAGGAGGATGGCAACATCCTGGGCAATAAGATGGAGTACAACTACAACGCCCACAATGTGTACATCATGACCGACAAGGCCAAGAATGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGATGGCAGCGTGCAGCTGGCCGACCACTACCAGCAGAATACCCCCATCGGCGATGGCCCTGTGCTGCTGCCCGATAACCACTACCTGTCCACCCAGAGCGCCCTGTCCAAGGACCCCAACGAGAAGCGCGATCACATGATCTACTTCGGCTTCGTGACCGCCGCCGCCATCACCCACGGCATGGATGAGCTGTAC

Page 18: Peng Yin - Massachusetts Institute of Technologycba.mit.edu/events/13.03.scifab/Yin.pdfA B D C B A C D Digital fabrication with DNA Same color denotes complementary segments Simple

Acknowledgements

molecular-systems.net

Wyss Institute for Biologically Inspired Engineering

Office of Naval ResearchYoung Investigator Program Award

& Biomat. and Bionanotech. Program

National Institute of Health Director’s New Innovator Award

NIGMS

Defense Advanced Research Projects Agency

Young Faculty AwardLiving Foundries

National Science FoundationFaculty CAREER Award

CISE

Army Research OfficeBiochemistry

Molecular Systems Lab at Harvard