15
Persea Americana and Persea Pseudocarolinensis By Jacky Luo Vincent Lum Jackie Xie

Persea Americana and Persea Pseudocarolinensis

  • Upload
    dyllis

  • View
    52

  • Download
    1

Embed Size (px)

DESCRIPTION

Persea Americana and Persea Pseudocarolinensis. By Jacky Luo Vincent Lum Jackie Xie. Persea Americana Location. Avocados will grow in shade and between buildings, but are productive only in full sun. The roots are highly competitive and will choke out nearby plants. Facts. - PowerPoint PPT Presentation

Citation preview

Page 1: Persea Americana and  Persea Pseudocarolinensis

Persea Americana and Persea Pseudocarolinensis

ByJacky Luo

Vincent LumJackie Xie

Page 2: Persea Americana and  Persea Pseudocarolinensis

Persea Americana Location

Avocados will grow in shade and between buildings, but are productive only in full sun. The roots are highly competitive and will choke out nearby plants.

Page 3: Persea Americana and  Persea Pseudocarolinensis

FactsAvocado leaves are alternate, glossy, elliptic

and dark green with paler veins. They normally remain on the tree for 2 to 3 years.

Due to recalcitrant nature of the seeds, they have a short viable life, can not be dried well

and can not withstand low temperatures.

Page 4: Persea Americana and  Persea Pseudocarolinensis

• This is a fruit cluster of three avocado in a persea americana tree.

Page 5: Persea Americana and  Persea Pseudocarolinensis

Persea Pseudocarolinensis Location

Fossil Location In private Property in Clarkia, Idaho

Clarkia Fossil Bowl Racetrack, Clarkia, Idaho

Page 6: Persea Americana and  Persea Pseudocarolinensis

Pseudocarolinensis

Photo of the Persea Pseudocarolinensis extracted in Clarkia, Idaho fossil site

Page 7: Persea Americana and  Persea Pseudocarolinensis

Svante PääboHe said that fossil older than one hundred thousand years to fifty

thousand years old won’t be able to have its DNA extracted because over time outside radiation and water would destroy

the DNA.

Page 8: Persea Americana and  Persea Pseudocarolinensis

The other groupA group of scientist wrote for the American Journal of Botany in

2004 saying that it was possible to extract DNA from the miocene period.

Page 9: Persea Americana and  Persea Pseudocarolinensis

RBCL GENE

Persea Americana 1 aaaggaacta aagcaagtgt tggattcaaa gctggtgtta aagattacaa attgacttat

61 tatactcctg actatgaaac caaaagtact gatattttgg cagcatttcg agtaactcct

121 caacccggag ttccacctga ggaagcaggg gctgcggtag ctgccgaatc ttctactggt

181 acatggacaa ctgtgtggac cgatggactt accagccttg atcgttacaa aggacgatgc

241 taccacatcg agcccgttgc tggggaggaa agtcaattta ttgcctatgt agcttaccct

301 ttagaccttt ttgaagaagg ttctgttacg aacatgttta cttctattgt gggtaatgta

361 tttgggttca aagctctacg agctctacgt ctggaggatc tgcgaattcc tcctgcttat

421 tccaaaactt tccaaggccc gccccatggc atccaagttg agagagataa attgaacaag

481 tatggtcgtc ccctattggg atgtactatt aaaccaaaat tggggttatc cgccaagaac

541 tacggtagag cggtttatga atgtctccgt ggtggacttg attttaccaa ggatgatgag

601 aacgtgaact cccaaccatt tatgcgttgg agagaccgtt tcttattttg tgccgaagca

661 atttataaat cgcaggccga aacaggtgaa atcaaaggac attacttgaa tgctactgca

721 ggtaaac

Persea PseudoCarolinensis 1 aaaggacatt acttgaatgc tactgcaggt acatgcgaag aaatgatcaa aagggccgta

61 tttgccagag aattgggagt tcctatcgta atgcatgact atttaacggg gggattcact

121 gcaaatacta gcttggctca ttattgccgg gacaacggcc tacttcttca catccatcgc

181 gcaatgcatg cagttattga tagacagaag aatcatggta tgcactttcg cgtactggct

241 aaagcgttac gtatgtctgg tggagatcat attcacgctg gtaccgtagt aggtaaacta

301 gaaggggaac gggacatcac tttgggtttt gttgatttac tacgtgatga ttttattgaa

361 aaagaccgaa gtcgcggtat ttatttcact caagattggg tctctatgcc aggtgttctg

421 cccgtggctt cagggggtat tcacgtttgg catatgcctg ccctgaccga gatctttggg

481 gatgattccg tactacagtt cggtggagga actttaggac acccttgggg aaacgcacct

541 cgtgcagtag ctaatcgggt ggctttagaa gcgtgtgtac aagctcgtaa tgagggacgt

601 gatcttgctc gtgaaggtaa tgaaattatc cgtgaagctt ccaaatggag ccctgagcta

661 gctgcggctt gtgagatatg gaaggagatc aaattcgaa

Page 10: Persea Americana and  Persea Pseudocarolinensis

Primers

Persea Americana LEFT PRIMER tgcgaattcctcctgcttat

RIGHT PRIMER atcaagtccaccacggagac

LEFT PRIMER tgcgaattcctcctgcttat

RIGHT PRIMER agtccaccacggagacattc

LEFT PRIMER aggatctgcgaattcctcct

RIGHT PRIMER ccgtagttcttggcggataa

LEFT PRIMER gacaactgtgtggaccgatg

RIGHT PRIMER gaattcgcagatcctccaga

Persea PseudoCarolinensis LEFT PRIMER gaccgaagtcgcggtattta

RIGHT PRIMER gcaagatcacgtccctcatt

LEFT PRIMER ctgcaggtacatgcgaagaa

RIGHT PRIMER gtacgcgaaagtgcatacca

LEFT PRIMER tctttggggatgattccgta

RIGHT PRIMER ctagctcagggctccatttg

LEFT PRIMER tgccagagaattgggagttc

RIGHT PRIMER ccagtacgcgaaagtgcata

Page 11: Persea Americana and  Persea Pseudocarolinensis

DNA Extraction Of Persea Americana

Steps

1. grind up leaf until it becomes a pasty like substance to break down cell walls

2. add some edwards buffer to destroy cell membrane

3. vortex and centrifuge it a few times to get all the junk not needed to the bottom and to get a supernatant

Page 12: Persea Americana and  Persea Pseudocarolinensis

Steps continued 4. Pour out the supernatant which

contains DNA and other stuff not needed into another test tube

5. Add isopropanol to the supernatant to separate the DNA from rest of the solution

6. Vortex and centrifuge to get the DNA to the bottom

7. let it dry out for a few minutes then take the supernatant and leave the DNA on the bottom behind

Page 13: Persea Americana and  Persea Pseudocarolinensis

Making Agarose Gel1. Mix 0.6%-2% agarose powder into a buffer

like TE buffer. The amount of powder used varies based on what you are testing.

2. Put the mixture into a microwave for less than 1 minute to get the powder melted into with the buffer.

3. Let the gel cool down until it isn't that hot.

4. Pour the liquid into a gel tray without stopping until the gel isn't to thin or to thick.

5. Let the gel solidify and store it in a refrigerator to keep it from shriveling up.

Page 14: Persea Americana and  Persea Pseudocarolinensis

Running The Gel

Page 15: Persea Americana and  Persea Pseudocarolinensis

REFERENCES

http://www.454genomics.net/downloads/news-events/geneticanalysisfromancientdna.pdf

http://www.dnalc.org/view/15152-Isolating-ancient-DNA-Svante-Paabo.html

http://www.avocadosource.com/CAS_Yearbooks/CAS_52_1968/CAS_1968_PG_029-034.pdf

http://www.amjbot.org/cgi/reprint/91/4/615.pdfhttp://www.ncbi.nlm.nih.gov/http://frodo.wi.mit.edu/primer3/http://www.mines.uidaho.edu/~tertiary/http://www.molecularstation.com/molecular-biology-techniques/gel-

electrophoresis/http://www.crfg.org/pubs/ff/avocado.htmlhttp://www.hort.purdue.edu/newcrop/morton/avocado_ars.html