Upload
dyllis
View
52
Download
1
Tags:
Embed Size (px)
DESCRIPTION
Persea Americana and Persea Pseudocarolinensis. By Jacky Luo Vincent Lum Jackie Xie. Persea Americana Location. Avocados will grow in shade and between buildings, but are productive only in full sun. The roots are highly competitive and will choke out nearby plants. Facts. - PowerPoint PPT Presentation
Citation preview
Persea Americana and Persea Pseudocarolinensis
ByJacky Luo
Vincent LumJackie Xie
Persea Americana Location
Avocados will grow in shade and between buildings, but are productive only in full sun. The roots are highly competitive and will choke out nearby plants.
FactsAvocado leaves are alternate, glossy, elliptic
and dark green with paler veins. They normally remain on the tree for 2 to 3 years.
Due to recalcitrant nature of the seeds, they have a short viable life, can not be dried well
and can not withstand low temperatures.
• This is a fruit cluster of three avocado in a persea americana tree.
Persea Pseudocarolinensis Location
Fossil Location In private Property in Clarkia, Idaho
Clarkia Fossil Bowl Racetrack, Clarkia, Idaho
Pseudocarolinensis
Photo of the Persea Pseudocarolinensis extracted in Clarkia, Idaho fossil site
Svante PääboHe said that fossil older than one hundred thousand years to fifty
thousand years old won’t be able to have its DNA extracted because over time outside radiation and water would destroy
the DNA.
The other groupA group of scientist wrote for the American Journal of Botany in
2004 saying that it was possible to extract DNA from the miocene period.
RBCL GENE
Persea Americana 1 aaaggaacta aagcaagtgt tggattcaaa gctggtgtta aagattacaa attgacttat
61 tatactcctg actatgaaac caaaagtact gatattttgg cagcatttcg agtaactcct
121 caacccggag ttccacctga ggaagcaggg gctgcggtag ctgccgaatc ttctactggt
181 acatggacaa ctgtgtggac cgatggactt accagccttg atcgttacaa aggacgatgc
241 taccacatcg agcccgttgc tggggaggaa agtcaattta ttgcctatgt agcttaccct
301 ttagaccttt ttgaagaagg ttctgttacg aacatgttta cttctattgt gggtaatgta
361 tttgggttca aagctctacg agctctacgt ctggaggatc tgcgaattcc tcctgcttat
421 tccaaaactt tccaaggccc gccccatggc atccaagttg agagagataa attgaacaag
481 tatggtcgtc ccctattggg atgtactatt aaaccaaaat tggggttatc cgccaagaac
541 tacggtagag cggtttatga atgtctccgt ggtggacttg attttaccaa ggatgatgag
601 aacgtgaact cccaaccatt tatgcgttgg agagaccgtt tcttattttg tgccgaagca
661 atttataaat cgcaggccga aacaggtgaa atcaaaggac attacttgaa tgctactgca
721 ggtaaac
Persea PseudoCarolinensis 1 aaaggacatt acttgaatgc tactgcaggt acatgcgaag aaatgatcaa aagggccgta
61 tttgccagag aattgggagt tcctatcgta atgcatgact atttaacggg gggattcact
121 gcaaatacta gcttggctca ttattgccgg gacaacggcc tacttcttca catccatcgc
181 gcaatgcatg cagttattga tagacagaag aatcatggta tgcactttcg cgtactggct
241 aaagcgttac gtatgtctgg tggagatcat attcacgctg gtaccgtagt aggtaaacta
301 gaaggggaac gggacatcac tttgggtttt gttgatttac tacgtgatga ttttattgaa
361 aaagaccgaa gtcgcggtat ttatttcact caagattggg tctctatgcc aggtgttctg
421 cccgtggctt cagggggtat tcacgtttgg catatgcctg ccctgaccga gatctttggg
481 gatgattccg tactacagtt cggtggagga actttaggac acccttgggg aaacgcacct
541 cgtgcagtag ctaatcgggt ggctttagaa gcgtgtgtac aagctcgtaa tgagggacgt
601 gatcttgctc gtgaaggtaa tgaaattatc cgtgaagctt ccaaatggag ccctgagcta
661 gctgcggctt gtgagatatg gaaggagatc aaattcgaa
Primers
Persea Americana LEFT PRIMER tgcgaattcctcctgcttat
RIGHT PRIMER atcaagtccaccacggagac
LEFT PRIMER tgcgaattcctcctgcttat
RIGHT PRIMER agtccaccacggagacattc
LEFT PRIMER aggatctgcgaattcctcct
RIGHT PRIMER ccgtagttcttggcggataa
LEFT PRIMER gacaactgtgtggaccgatg
RIGHT PRIMER gaattcgcagatcctccaga
Persea PseudoCarolinensis LEFT PRIMER gaccgaagtcgcggtattta
RIGHT PRIMER gcaagatcacgtccctcatt
LEFT PRIMER ctgcaggtacatgcgaagaa
RIGHT PRIMER gtacgcgaaagtgcatacca
LEFT PRIMER tctttggggatgattccgta
RIGHT PRIMER ctagctcagggctccatttg
LEFT PRIMER tgccagagaattgggagttc
RIGHT PRIMER ccagtacgcgaaagtgcata
DNA Extraction Of Persea Americana
Steps
1. grind up leaf until it becomes a pasty like substance to break down cell walls
2. add some edwards buffer to destroy cell membrane
3. vortex and centrifuge it a few times to get all the junk not needed to the bottom and to get a supernatant
Steps continued 4. Pour out the supernatant which
contains DNA and other stuff not needed into another test tube
5. Add isopropanol to the supernatant to separate the DNA from rest of the solution
6. Vortex and centrifuge to get the DNA to the bottom
7. let it dry out for a few minutes then take the supernatant and leave the DNA on the bottom behind
Making Agarose Gel1. Mix 0.6%-2% agarose powder into a buffer
like TE buffer. The amount of powder used varies based on what you are testing.
2. Put the mixture into a microwave for less than 1 minute to get the powder melted into with the buffer.
3. Let the gel cool down until it isn't that hot.
4. Pour the liquid into a gel tray without stopping until the gel isn't to thin or to thick.
5. Let the gel solidify and store it in a refrigerator to keep it from shriveling up.
Running The Gel
REFERENCES
http://www.454genomics.net/downloads/news-events/geneticanalysisfromancientdna.pdf
http://www.dnalc.org/view/15152-Isolating-ancient-DNA-Svante-Paabo.html
http://www.avocadosource.com/CAS_Yearbooks/CAS_52_1968/CAS_1968_PG_029-034.pdf
http://www.amjbot.org/cgi/reprint/91/4/615.pdfhttp://www.ncbi.nlm.nih.gov/http://frodo.wi.mit.edu/primer3/http://www.mines.uidaho.edu/~tertiary/http://www.molecularstation.com/molecular-biology-techniques/gel-
electrophoresis/http://www.crfg.org/pubs/ff/avocado.htmlhttp://www.hort.purdue.edu/newcrop/morton/avocado_ars.html