91
Pharmacogenetics Pharmacogenetics Hype or Hope? Hype or Hope?

Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

  • View
    215

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

Pharmacogenetics Pharmacogenetics

Hype or Hope?Hype or Hope?

Page 2: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

2CDD Course June 8, 2006

Lecture OverviewLecture Overview

• Drug Discovery Path– What are the problems?– What are the causes?

• What is genetic variance?– What is the driving force and how does it lead to disease?– How do we measure it?

• Genetic variance in Drug response: pharmacogenetics– How do we measure it?– Are there any examples?– How do we apply it?– Is it feasible? Technically and economically?

• Outlook for the future

Page 3: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

3CDD Course June 8, 2006

First: what is the definition of First: what is the definition of Pharmacogenetics?Pharmacogenetics?

• Pharmacogenetics:

– The genetics of drug response– The patient’s point of view, what a patient does with the drug

• Pharmacogenomics:

– The study of drug-induced gene expression– The drug’s point of view, what a drug does to the patient

Page 4: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

Drug Discovery PathDrug Discovery Path

Page 5: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

5CDD Course June 8, 2006

Intermezzo: Intermezzo: The Drug Discovery Pathway The Drug Discovery Pathway

and its problemsand its problems

TargetDiscovery

Lead Discovery

Lead Optimization

ExploratoryDevelopment

FullDevelopment Market

00 22 44 7766 1212 141499No. of years:No. of years:

1 NCE:1 NCE: 14 years14 years

USD 800 millionUSD 800 million

No. of projects:No. of projects:5757 1414 88 4.54.5 22 113636 2222

90% attrition

No. of compounds:No. of compounds:300.000300.000 1515 4-54-5 2-32-3 1-21-2 11

Data based on several leading pharmaData based on several leading pharma{Brown, 2003, Drug Disc. Today 8, 23}{Brown, 2003, Drug Disc. Today 8, 23}

Phase I, IIa Phase III, IV

Page 6: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

6CDD Course June 8, 2006

First human dose to First patient

dose

First patient dose to First pivotal

dose

First pivotal dose to First

submission

First submission to First launch

Su

cces

s r

a te

Year of entry into phaseCurrent success rate

1994

-96

1995

-97

1996

-98

1997

-99

1998

-00

1999

-01

1994

-96

1995

-97

1996

-98

1997

-99

1998

-00

1999

-01

1994

-96

1995

-97

1996

-98

1997

-99

1998

-00

1999

-01

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

1994

-96

1995

-97

1996

-98

1997

-99

1998

-00

1999

-01

Trends in success rates by Trends in success rates by phasephase

CMR success rates CMR success rates methodologymethodology

Page 7: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

7CDD Course June 8, 2006

Reasons for attritionReasons for attritionAttrition as a result of Drug safety and efficacy mainly caused

by:

• Unexpected differences with animal models used in pre-clinical research– Animal disease models poorly match (especially in immunological

diseases and CNS) – Animal toxicology and metabolism can differ significantly from

humans• Unexpected variance in the human population with regard

to drug metabolism and efficacy.– Varying degrees of genetic predisposition– Currently difficult to anticipate on (lack of information on

cause/effect to steer prediction)

Page 8: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

What is genetic variance?What is genetic variance?

Page 9: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

9CDD Course June 8, 2006

Genetic variationGenetic variation

Egg production (6 weeks)

Meat production (6 weeks)

On average, one human to another differs ~0.1% On average, one human to another differs ~0.1% (=~3.2 10(=~3.2 106 6 nucleotides)nucleotides)

Page 10: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

10CDD Course June 8, 2006

D.simulans & D.yakubaD.simulans & D.yakuba

20%

36,000,000 differences

600,000 aa differences

Page 11: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

11CDD Course June 8, 2006

1%

34,000,000 nucleotide differences290,000 amino acid differences

Page 12: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

12CDD Course June 8, 2006

0.1%

3,400,000 nucleotide differences12,800 amino acid differences

Page 13: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

13CDD Course June 8, 2006

Variance, some definitionsVariance, some definitions• Gene unit of hereditary information that occupies a fixed

position (locus) on a chromosome. Genes achieve their effects by directing the synthesis of proteins.

• Allele An appearance of a gene on either of the 2 chromosomes, or: one member of a pair or series of genes that occupy a specific position on a specific chromosome.

• Haplotype A combination of polymorphisms or genes or other genetic landmarks on one chromosome of anindividual

• Genotype The total genetic makeup of an individual

Page 14: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

14CDD Course June 8, 2006

Definition of a Definition of a PolymorphismPolymorphism

• polymorphism= the inheritance of genes in different forms termed alleles

• alleles have different DNA sequences

• polymorphic locus: the frequency of the most common allele is less than 99%.– 1 allele in 100 alleles– 100 alleles =50 people– 1 person in 50 (2%) is heterozygous

Page 15: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

15CDD Course June 8, 2006

Types of Polymorphisms,Types of Polymorphisms,Sequence variationSequence variation

• Single Nucleotide Polymorphism (SNP): GAATTTAAG

GAATTCAAG• Simple Sequence Length

Polymorphism (SSLP): NCACACACAN • Also known as CA-repeat NCACACACACACACAN• NCACACACACACAN

• Insertion/Deletion: GAAATTCCAAGGAAA[ ]CCAAG

Page 16: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

16CDD Course June 8, 2006

Genome structural Genome structural variationvariation

Feuk et al. Nature Reviews Genetics 7, 85–97 (2006)

In addition, variation in active genes is now found to be much higher than originally anticipated

Page 17: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

17CDD Course June 8, 2006

Other types of variationOther types of variation

• DNA methylation sites

• Epigenetic control

• ?

Page 18: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

18CDD Course June 8, 2006

What’s the difference What’s the difference between a SNP and a between a SNP and a

mutation?mutation?• None!

• We generally say a mutation is disease (phenotype) related

• SNPs and mutations are just a sign of variance, constant mutation rate with evolutionary consequences

Page 19: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

19CDD Course June 8, 2006

Constant mutation rate Constant mutation rate

• Negative selection

• Neutral

• Positive selection

Page 20: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

20CDD Course June 8, 2006 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display.

Sickle cellallele in Africa

1–5%5–10%10–20%

P. Falciparummalaria in Africa

Malaria

Normal red blood cellsSickled red blood cells

Heterozygote Advantage: Sickle Heterozygote Advantage: Sickle cell trait confers resistance to cell trait confers resistance to

MalariaMalaria

Page 21: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

21CDD Course June 8, 2006

Another exampleAnother example

• Lactose intolerance

• Study in the Finish population

• Demonstrated that actually this is the wild type, whereas lactose tolerance is caused by a recent mutation

Page 22: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

22CDD Course June 8, 2006

Co-Co-evolutionevolution

North-Central Europe

PCA using cattle diversity1st component derived from the allele frequencies of cattle genes

PCA using cattle diversity1st component derived from the allele frequencies of the human lactose persistence genes

Page 23: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

23CDD Course June 8, 2006

Mendelian vs. complex diseasesMendelian vs. complex diseasesoror

Monogenic vs. Polygenic Monogenic vs. Polygenic inheritanceinheritance

Page 24: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

24CDD Course June 8, 2006

Genetic variance Genetic variance measurementsmeasurements

• These days most commonly performed by measuring the Single Nucleotide Polymorphisms (SNPs)

Page 25: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

25CDD Course June 8, 2006

SNPsSNPs

Paternal allele: CCCGCCTTCTTGGCTTTACA

Maternal allele: CCCGCCTTCTCGGCTTTACA

Paternal allele : CCCGCCTTCTTGGCTTTACA

Maternal allele : CCCGCCTTCTTGGCTTTACA

Page 26: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

26CDD Course June 8, 2006

Distribution of SNPs for 1630 Distribution of SNPs for 1630 Genes (Genaissance HapFocus Genes (Genaissance HapFocus

DB)DB)

4.15.7 5.8 4.5 6.1

0

1

2

3

4

5

6

7

8

9

10

Coding 5' UTR 5' Upstream Intron 3' UTR

SN

Ps

per

kb

of

DN

A

Page 27: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

27CDD Course June 8, 2006

Gene SNPs01

01

01

01

01 ~15 SNPs per gene

215 combinations

Genaissance principle in a Genaissance principle in a nutshellnutshell

HAP™ Markers: gene HAP™ Markers: gene haplotypeshaplotypes

ChromosomeLocus of Gene

Exons

Promoters

SNPs

PairedHaplotypes

0 1 0 0 1

1 0 1 1 0

~18 haplotypes per gene

Page 28: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

28CDD Course June 8, 2006

Mendelian inheritance vs Mendelian inheritance vs non-Mendelian inheritancenon-Mendelian inheritance

Example: autosomal dominant inheritance Example: Asthma in the Icelandic population

Page 29: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

29CDD Course June 8, 2006

Different methods to Different methods to measure variance and measure variance and

inheritanceinheritance• Family based

– Traditional linkage analysis– Allele sharing: IBS/IBD

• Population based– Case-Control study– Transmission disequilibrium test (TDT)– Sibling control

Page 30: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

30CDD Course June 8, 2006

LD vs Risk RatiosLD vs Risk RatiosLinkage describes the phenomenon whereby allele at neighboring loci are close to one another on the same chromosome, they will be transmitted together more frequently than chance. LOD score : Z(q) = log10 [L(q) / L(1/2)]

Two basic hypotheses are tested:

H0: free recombination, q = 1/2

H1: linkage, q < 1/2

where q is the recombination fractionand L is a likelihood function

lod score > 3: evidence of linkagelod score > 3: evidence of linkage

2 < lod score < 3: suggestive evidence of linkage2 < lod score < 3: suggestive evidence of linkage

-2 < lod score < 2: uninformative of linkage -2 < lod score < 2: uninformative of linkage

lod score < -2: exclusion of linkagelod score < -2: exclusion of linkage

Recurrence Risk Ratio (λ)Recurrence Risk Ratio (λ)

Frequency in relatives of affected personFrequency in relatives of affected person

λλr r = -------------------------------------------------------= -------------------------------------------------------

Population frequencyPopulation frequency

r denotes the degree of relationshipr denotes the degree of relationship

Disease λ s

Cystic fibrosis 500 Type I diabetes 15 schizophrenia 8.6 Type II diabetes 3.5

Page 31: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

Genetic Variance in Drug Genetic Variance in Drug ResponseResponse

Page 32: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

32CDD Course June 8, 2006

“…“…more than 90% of more than 90% of drugs only work in 30-50% drugs only work in 30-50%

of people.” of people.”

Allen D. Roses GlaxoSmithKlineAllen D. Roses GlaxoSmithKline

Page 33: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

33CDD Course June 8, 2006

Where do drugs interact with Where do drugs interact with proteins?proteins?

Goldstein et al. Nature Rev. Gen. 4, 937 (2003)

Page 34: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

34CDD Course June 8, 2006

Pharmacogenetic Basis for Pharmacogenetic Basis for

Differences in Medicine Differences in Medicine ResponseResponse

• Patients may have altered drug efficacy or greater risk of drug-related adverse events stemming from polymorphisms in:– genes encoding the drug target– genes encoding drug metabolizing enzymes– genes related to drug clearance mechanisms– genes causally linked to the disease and hence

causally related to drug efficacy – genes causally linked to mechanisms

underlying adverse events

Page 35: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

35CDD Course June 8, 2006

2000In the US the cost of problems linked to drug

use in the ambulatory setting exceeded $US177 billion in the year 2000

Rodriguez-Monguio R et al 2003 Pharmacoeconomics 21(9):623-50

2000In the US the cost of problems linked to drug

use in the ambulatory setting exceeded $US177 billion in the year 2000

Rodriguez-Monguio R et al 2003 Pharmacoeconomics 21(9):623-50

197328% of hospitalized patients had adverse drug reactions

Miller Am J Hosp Pharm 30:584-592

197328% of hospitalized patients had adverse drug reactions

Miller Am J Hosp Pharm 30:584-592

197917% of hospitalized children had adverse drug-attributed events

Mitchell AA et al Am J Epid

110: 196-204

197917% of hospitalized children had adverse drug-attributed events

Mitchell AA et al Am J Epid

110: 196-204 1994

2,216,000 serious adverse drug reactions in hospitalized patients

Lazarou et al 1998; 279: 1200-1205

19942,216,000 serious adverse drug reactions in hospitalized patients

Lazarou et al 1998; 279: 1200-1205 1995

Drug-related morbidity & mortality estimated at $76.6 billion

Johnson & Bootman Arch Intern Med 1995; 155: 1949-56

Adverse Drug Reactions Adverse Drug Reactions Incidence and CostIncidence and Cost

Page 36: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

36CDD Course June 8, 2006

Cytochrome P450 Cytochrome P450 enzymesenzymes

Four phenotypes identified:– Poor metabolizer: lack the functional

enzyme (7%)– Intermediary metabolizers: heterozygous

for one deficient allele or carry two alleles that cause reduced activity

– Extensive metabolizers: two normal alleles– Ultra rapid metabolizers: multiple gene

copies (5,5%)

Page 37: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

37CDD Course June 8, 2006

Meyer, Nature Reviews Genetics 2004

Page 38: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

38CDD Course June 8, 2006

The consequences of outlier cytochrome The consequences of outlier cytochrome P450 CYP2D6-dependent drug P450 CYP2D6-dependent drug

metabolism. metabolism.

Page 39: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

39CDD Course June 8, 2006

Other examples of Other examples of metabolizing enzymesmetabolizing enzymes

Page 40: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

40CDD Course June 8, 2006

These associations were compiled from the literature by using the keywords „pharmacogenetics“ OR pharmacogenomcis“, „association study“ AND „drug response“, „polymorphism“ AND „drug response“.

Goldstein et al. Nature Rev. Gen. 4, 937 (2003)

Page 41: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

Any examples?Any examples?

Page 42: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

42CDD Course June 8, 2006

Some Products where PGx Some Products where PGx makes a differencemakes a difference

Page 43: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

43CDD Course June 8, 2006

Biotech examplesBiotech examples

• Anti cancer drug Herceptin (MoAb)ERBB2 is a 185-kda (mw) tyrosine kinase receptor that might be

overexpressed in 25–30% of human breast cancers.

overexpression of erbb2 is associated with enhanced tumour aggressiveness and a high risk of relapse and death effective treatment was shown in patient over expressing ERBB2

• Anti TNF (Infliximab)SNP in the promotor seems to be associated with reduced

response with Infliximab (more TNF compensates for anti-TNF

Page 44: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

44CDD Course June 8, 2006

2 Adrenergic Receptor2 Adrenergic Receptor

• G Protein-coupled receptor expressed throughout the body• Receptor for catecholamines (epinephrine and norepinephrine)• Drug target in the treatment of heart failure and asthma• Also thought to play a role in obesity and possibly diabetes

Page 45: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

45CDD Course June 8, 2006

Function of ADRB2 VariantsFunction of ADRB2 Variants

• Ile164, Gly16 and the Gly16/Gln27 combination are associated with depressed exercise performance in heart failure (Wagoner et al., 2000)• Gly16 associated with nocturnal asthma (OR 3.8)• Gly16 associated with increased agonist-promoted downregulation of ADRB2• Glu27 markedly associated with obesity (OR 10), Glu27 homozygotes had 50% larger fat cells

Page 46: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

46CDD Course June 8, 2006

ADRB2 HaplotypesADRB2 Haplotypes

13 SNPs found in 12 haplotypes out of 8,192 possible haplotypesDivergence between ethnic groups

Page 47: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

47CDD Course June 8, 2006

Phylogeny of ADRB2 HaplotypesPhylogeny of ADRB2 Haplotypes

• Based only on the multi-ethnic panel• Some haplotypes related to others by recombination

Page 48: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

48CDD Course June 8, 2006

Functional Analysis of ADRB2 Haplotype PairsFunctional Analysis of ADRB2 Haplotype Pairs

• Mean responses by haplotype pair varied by >2-fold• Response significantly related to haplotype pair• Response not related to individual SNPs• Note that the 2/4 haplotype pair has a B2AR agonist response halfway between that of the 2/2 pair and the 4/4 pair

FEV = Forced Expiration Volume

Page 49: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

49CDD Course June 8, 2006

Expression Analysis of ADRB2 HaplotypesExpression Analysis of ADRB2 Haplotypes

Page 50: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

How do we apply it?How do we apply it?

Page 51: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

51CDD Course June 8, 2006

Genetic Marker = Genetic Marker = BiomarkerBiomarker

• A genetic marker is a predictive biomarker

• The predictive power of a genetic marker is determined by the strength of the underlying genetics in a disease and drug response

• The value lies in focused therapies and focused clinical development

Page 52: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

52CDD Course June 8, 2006

Mendelian Mendelian (Monogenic) (Monogenic)

Disorders/Drug Disorders/Drug response response

Compared With Compared With

Complex Complex (Polygenic)(Polygenic)

Disorders/Drug Disorders/Drug responseresponsePeltonen and McKusick. Science. 2001;291:1224-1229.

Page 53: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

53CDD Course June 8, 2006

GenotypingGenotyping

1.Candidate gene(s)• Develop SNP genotypes and haplotypes for each

implicated gene(s)• Genes selected based on

– Biological paradigms– Knowledge of disease pathogenesis– Genomic data mining

2.Total genome analysis• Screen patients (and controls) in attempt to identify

a genomic region containing the drug response gene(s)

– Use positional cloning to isolate and characterize the underlying gene

Page 54: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

54CDD Course June 8, 2006

DiseaseResponder

ControlNon-responder

Allele 1 Allele 2

Marker A is associated with Phenotype

Marker A:

Allele 1 =

Allele 2 =

Human Genetic Association Human Genetic Association Study DesignStudy Design

Page 55: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

55CDD Course June 8, 2006

Disease PopulationN=500

Matched Control PopulationN=500

122~3,000,000 common SNPs across genome

• Representing every gene

P v

alu

e

1 22

Informatics to ID gene(s) mapped to associated SNP

Regions of association

Chromosomal Location

Whole Genome Whole Genome AssociationsAssociations

Page 56: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

56

Blocks vs BinsBlocks vs Bins

Page 57: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

57

Block Tags vs Bin TagsBlock Tags vs Bin Tags

• 6 Bin Tags• 4 Haplotype Tags

Page 58: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

58

Gene X ExampleGene X Example

Source SNPs Bins Bins missedHapMap 40 23^ 5Perlegen 40 15' 13Journals 9 8 20

Total 66* 28*

^ - 19 haplotype tags for these 23 bins.‘ - Equals 16 HapMap bins.* - Includes 1 AA SNP (MAF = 0.05) from Genaissance not seen in the other three sources.

NB – There are approximately 300 SNPs across the gene genomic interval in dbSNP and the PG Genetics Database.

Page 59: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

59

Selection ConsiderationsSelection Considerations

Sources Effect on protein Extent of LD (D’ vs r2)

True measure of gene size Number and length of bins/blocks

Tag bins or tag haplotypes SNP coverage in gaps between bins/blocks Power

Number of SNPs Allele Frequency

Page 60: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

60

Power CalculationPower Calculation

Page 61: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

61

Selection ConsiderationsSelection Considerations

Sources Effect on protein Extent of LD (D’ vs r2)

True measure of gene size Number and length of bins/blocks

Tag bins or tag haplotypes SNP coverage in gaps between bins/blocks Power

Number of SNPs Allele Frequency

Page 62: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

62

X gene structure 02012006X gene structure 02012006

CA

CHB/JPT

rs1799914J/C 10%

+198

rs486779826%

J/C 46%+2203

rs68640%

J/C 15%+1402

rs1251822213%

J/C 24%+2934

rs70374832%

J/C 38%+4067

BOTH

rs216863114%

-5900

rs68599703%

-9891

rs6878159J/C 26%

-6299

rs2674023%

-13001

rs247102038%

J/C 17%-18794

rs26740546%

-14450

rs1355077J/C 39%-20211

rs1496133J/C 44%-23178

rs2644645J/C 35%-26084

rs686272128%

-25710

rs17065069J/C 15%-25300

Page 63: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

63

CA

JPT/CHB

BOTH

Y gene structure 02072006Y gene structure 02072006

rs34607633%

J/C 35%-8042

rs180904913%

J/C 32%+2161

rs259496638%

+24552

rs34607018%

+3151

rs346078 33% +27116

rs101811130%

J/C 31%-1202

rs12629094J/C 7%-45787

rs762575624%

J/C 27%-51007

rs34759435%

J/C 32%-51196

rs124884104%

-54972

rs187495922%

J/C 36%-53464

rs34759640%

J/C 41%-41217

rs1191505016%

J/C 30%-35491

rs6773737J/C 27%-35402

rs4660646J/C 14%

-9553

rs2606731J/C 27%

-9109

rs347606J/C 20%-36418

rs4684787 29% +279141

rs9876898 18% +267237

rs17534941 4% +127798

rs7621218 J/C 36% +141289

rs7623889 4% +176663rs9818393 J/C 14% +208944

rs7623147 3% +219309

rs11128552 16% J/C 38% +239231rs2442793 5% +246971

rs2443706 16% +249781rs2447607 38% +251303

rs3856794 20% +261381

rs2344826 11% +261903

rs2594992 J/C 35% +60273

rs3816380 15% +81249rs1375204 6% +86992

rs12630869 J/C 6% +89530

rs9310379 37% +133419

rs4684776 J/C 43% +142499

rs9848833 J/C 8% +145801rs11707842 22% +172140rs9816564 J/C 37% +174573

rs13081468 5% +28029

rs2606757 J/C 38% +57439rs17034276 J/C 8% +58075

Page 64: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

64

CYP2D6 gene structure 02092006CYP2D6 gene structure 02092006

CA

CHB/JPT

rs962001810%

+77761

rs1058172N/S%+3266

rs3915951N/S%+3158

rs11568728N/S%+1848

rs1058164SYN%+1662

BOTH

rs482207510%

+176388

rs600256148%

+179744rs5751188

6%J/C 44%+180908

rs600256033%

+182062

rs962353133%

+7250rs5758589

45%J/C 35%+8412

rs106275331%

J/C 6%+146137

rs2743467J/C 26%+24430

rs2070903J/C 20%+21998

rs4467371J/C 42%+16878

rs112603J/C 30%-149135rs9611766

20%J/C 32%-149689

rs599613520%

-102508

rs121658468%

-110348

rs80506J/C 34%-150190

rs13487148%

-113766rs5758686

24%J/C 24%-116427

rs13487347%

J/C 39%-118616

rs575123219%

-25354

rs93063568%

-28140rs738257

24%-30348

rs17002868J/C 22%-45516

rs21426956%

-42298

rs48221008%

-143836

rs13488324%

J/C 38%-132537

rs81426734%

-57303

rs4822079J/C 14%+144336

rs1333095%

+140342

rs133330J/C 18%+129492

rs13333724%

J/C 13%+122253

Page 65: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

Is it feasible? Are there risks?Is it feasible? Are there risks?How can we calculate the benefits?How can we calculate the benefits?

Page 66: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

66CDD Course June 8, 2006

Genetic Pedigree of World Genetic Pedigree of World PopulationsPopulations

Adapted from Cavalli-Sforza and Feldman. Nat Genet. 2003

Page 67: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

67CDD Course June 8, 2006

Haplotype block Haplotype block differences among differences among

populationspopulations

Page 68: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

68CDD Course June 8, 2006

SNPs in different SNPs in different populationspopulations

Page 69: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

69CDD Course June 8, 2006

Effect of sampling in Effect of sampling in association studiesassociation studies

Page 70: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

70CDD Course June 8, 2006

Genotyping children with Genotyping children with ALLALL

From : Veenstra et al., AAPS Pharmsci 2000;

Page 71: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

71CDD Course June 8, 2006

A simple Health A simple Health Economics ModelEconomics Model

BCG report, 2001

Page 72: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

72CDD Course June 8, 2006

What is the prevalence of What is the prevalence of the the

genetic variant?genetic variant?• Genetic testing is essentially a screening strategy• Thus, the frequency of the variant allele in the

population being tested will be a critical factor • Example:

– prevalence of a genotype is 0.5%, – 200 patients must be tested to identify 1 patient with a

variant allele, on average

• Sensitivity enhanced by methods used in CEA– e.g., calculating an incremental cost effectiveness ratio

From : Veenstra et al., AAPS Pharmsci 2000;

Page 73: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

73CDD Course June 8, 2006

Hypothetical AnalysisHypothetical Analysis

• Varied the following parameters:– cost of the test ($5 to $250)– mortality due to severe myleosuppression (5% to 25%)– prevalence of patients with a TPMT (thiopurine s-

methyltransferase ) deficient genotype (0.3%, 0.5%, and 1.0%)

• These 3 parameters are representative of 3 of the dimensions that affect the cost-effectiveness of genetic testing: – economic (cost of test)– genetic (genotype prevalence)– clinical (mortality of myleosuppression)

From : Veenstra et al., AAPS Pharmsci 2000;

Page 74: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

74CDD Course June 8, 2006

Genotype prevalence Genotype prevalence 0.3%0.3%

25% 21% 17% 13% 9%5%

$5

$80

$150

$225

$0

$50,000

$100,000

$150,000

Incremental cost-effectiveness ratio

($/QALY)

Attributable mortality of severe myleosuppresion

Cost of test

Deficient genotype prevalence 0.3%

100000-150000

50000-100000

0-50000

QALY, equivalent to 1 year of perfect health

From : Veenstra et al., AAPS Pharmsci 2000;

Page 75: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

75CDD Course June 8, 2006

Genotype prevalence Genotype prevalence 1.0%1.0%

25% 21% 17% 13% 9%5%

$5

$80

$150

$225

$0

$50,000

$100,000

$150,000

Incremental cost-effectiveness ratio

($/QALY)

Attributable mortality of severe myleosuppression

Cost of test

Deficient genotype prevalence 1.0%

100000-150000

50000-100000

0-50000

From : Veenstra et al., AAPS Pharmsci 2000;

Page 76: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

76CDD Course June 8, 2006

Ethical issues to consider:Ethical issues to consider:AnonymizationAnonymization

Copy,Copy,

RELABEL,RELABEL,

Remove SID 123 and Remove SID 123 and personal identifiers personal identifiers

((eg eg DOB)DOB)

AnonymizedAnonymizedGenomicGenomicAnalysisAnalysis

Anonymized Samples

Anonymized Data

123

Sample

123

Clinical dataSecure Data in

PharmacogenomicsDatabase

XYZ

XYZ

new tube,new tube,

remove SID 123,remove SID 123,

RELABELRELABEL

DELETE LINK

LINK

123~XYZ … …… …… …X

Subject 123 at Study Site

XYZ

Secure Sample Storage

New Random ID (XYZ) Generated in Secure File

LINK

123~XYZ … …… …… …

Page 77: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

77CDD Course June 8, 2006

Predicting Treatment Predicting Treatment response and outcomeresponse and outcome

• Each individual has a unique genetic make-up

• During the course of live our environment shapes our disease risk and drug response

• Pharmacogenetics aims at:– Predicting the treatment efficacy for improved

therapy– Avoiding potential health risks due to side effects– Speed up drug discovery by patient stratification

Page 78: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

78CDD Course June 8, 2006

What areas will benefit most What areas will benefit most from Pharmacogenetics?from Pharmacogenetics?

• Therapeutic areas where treatment response prediction is a question of life and death, e.g. cancer and psychiatric diseases

• Therapeutic areas where little is know about the disease mechanisms and mechanism of action of a drug, e.g. psychiatric disorders

Page 79: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

79CDD Course June 8, 2006

Pharmacogenetics and Pharmacogenetics and CNSCNS

• There’s a need for better classification of psychiatric disorders

• Modern life science approaches deliver endophenotypes:– Genetics/genomics– Proteomics– Imaging– Etc.

Page 80: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

80CDD Course June 8, 2006

AlleleGene Genotype PhenotypeEndophenotpye

EndophenotypesEndophenotypes

Page 81: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

81CDD Course June 8, 2006

Pharmacogenetics and Pharmacogenetics and imagingimaging

The BDNF Val66Met polymorphismThe BDNF Val66Met polymorphismFigure 1. Statistical maps of t-transformed hippocampal volume differences derived by optimized voxel-based morphometry in met relative to val/val-BDNF carriers thresholded at p = 0.05 (corrected) in coronal, sagittal, and axial views, showing bilateral significant hippocampal volume reduction in met-BDNF carriers

Pezawas, L. et al. J. Neurosci. 2004;24:10099-10102

Page 82: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

82CDD Course June 8, 2006Copyright ©2004 Society for Neuroscience

Pezawas, L. et al. J. Neurosci. 2004;24:10099-10102

Figure 2. Mean differences ({+/-}SEM) in hippocampal volume reduction in met-BDNF carriers relative to val/val-BDNF subjects within regions of statistical significance (p = 0.05) as shown in Figure 1

The BDNF Val66Met polymorphismThe BDNF Val66Met polymorphism

Page 83: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

83CDD Course June 8, 2006Copyright ©2004 Society for Neuroscience

Pezawas, L. et al. J. Neurosci. 2004;24:10099-10102

Figure 3. Statistical gray matter maps of the entire brain showing volume reductions of met-BDNF carriers in comparison to val/val-BDNF have been transformed from MNI space in Talairach space and converted to z-scores

The BDNF Val66Met polymorphismThe BDNF Val66Met polymorphism

Page 84: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

Outlook for the futureOutlook for the future

Hype or Hope ?Hype or Hope ?

Page 85: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

85CDD Course June 8, 2006

PGx efforts in the worldPGx efforts in the world

Page 86: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

86CDD Course June 8, 2006

PGx alliances and PGx alliances and numbersnumbers

Page 87: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

Commercial collaborations Commercial collaborations based on pharmacogeneticsbased on pharmacogenetics

Page 88: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

88CDD Course June 8, 2006

Clinical data integration and Clinical data integration and personalized medicinepersonalized medicine

Source: IBM

Page 89: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

89CDD Course June 8, 2006

Integration of discplinesIntegration of discplines

Source: IBM

Page 90: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

90CDD Course June 8, 2006

What do we still need?What do we still need?

• Better disease classification based on endophenotypes

• Better (low level) data integration• Better analysis methods (taking gene-

gene interactions into account• Better statistical methods• Better trained computational scientists

in the field of Molecular Medicine

Page 91: Pharmacogenetics Hype or Hope?. CDD Course June 8, 2006 2 Lecture Overview Drug Discovery Path –What are the problems? –What are the causes? What is genetic

91CDD Course June 8, 2006

Thank you for listeningThank you for listening