Upload
others
View
7
Download
0
Embed Size (px)
Citation preview
PhD Thesis
Epithelial barrier integrity and function in paediatric asthma
Kevin Looi B.Sc. (Hons)
This thesis is presented for the Degree of Doctor of Philosophy at the University of
Western Australia, School of Paediatrics and Child Health
2015
Looi 2015
i
Declaration
DECLARATION FOR THESES CONTAINING PUBLISHED WORK AND/OR
WORK PREPARED FOR PUBLICATION
This thesis contains published work and/or work prepared for publication, some of
which has been co-authored. The bibliographical details of the work and where it
appears in the thesis are outlined below.
Signed___
Kevin Looi
Date 27 March 2015
Looi 2015
ii
1. Looi, K., Sutanto, E.N., Banerjee, B., Garratt, L.W., Ling, K-M., Foo, C.J.,
Stick, S.M. & Kicic, A. (2011). Bronchial brushings for investigating airway
inflammation and remodelling. Respirology 16: 725–737.
This manuscript constitutes aspects of the Literature Review of this thesis. K Looi
(80%) was involved in manuscript preparation, literature collation, writing and editing.
EN Sutanto, B Banerjee, LW Garratt, KM Ling, CJ Foo assisted in manuscript
preparation, literature collation and editing. SM Stick and A Kicic were involved in the
initial manuscript concept and design, drafting and editing of the manuscript.
Signed Date 27 March 2015
Sunalene Devadason (Co-ordinating Supervisor)
Signed__ Date 27 March 2015
Anthony Kicic (Senior Author)
Looi 2015
iii
2. Looi, K., Buckley, A.G., Rigby, P., Garratt, L.W., Iosifidis, T., Knight, D.A.,
Bosco, A., Troy, N.M., Ling, K-M., Martinovich, K.M., Kicic-Starcevich, E.,
Shaw, N.C., Sutanto, E.N., Kicic, A. & Stick, S.M. (2015). Human rhinovirus
infection of airway epithelium triggers tight junction protein disassembly
resulting in increased transepithelial permeability. (In preparation)
This manuscript constitutes Chapter 4 of this thesis. K Looi (80%) was involved in the
initial manuscript concept and experimental design, sample collection, performing
experimental assays, data analysis and manuscript writing. AG Buckley and P Rigby
provided technical expertise in confocal microscopy and image data analysis. LW
Garratt, T Iosifidis, K-M Ling, KM Martinovich, E Kicic-Starcevich, NC Shaw and EN
Sutanto assisted in manuscript preparation and editing. NM Troy and A Bosco provided
technical expertise in Ingenuity Pathway Analysis. DA Knight assisted in data
interpretation and critical revision of the manuscript. SM Stick and A Kicic were
involved in manuscript concept and design, data interpretation, drafting and critical
revision of the manuscript.
Signed_ Date 27 March 2015
Sunalene Devadason (Co-ordinating Supervisor)
Signed_ Date 27 March 2015
Anthony Kicic (Senior Author)
Looi 2015
iv
3. Looi, K., Buckley, A.G., Rigby, P., Garratt, L.W., Iosifidis, T., Knight, D.A.,
Zosky, G.R., Larcombe, A.N., Lannigan, F.J., Ling, K-M., Martinovich, K.M.,
Kicic-Starcevich, E., Shaw, N.C., Sutanto, E.N., Kicic, A. & Stick, S.M. (2015).
Effects of human rhinovirus on epithelial barrier integrity and function in
childhood asthma. (In preparation)
This manuscript constitutes Chapter 5, 6 and 7 of this thesis. K Looi (80%) was
involved in the initial manuscript concept and design, sample collection, performing
experimental assays, data analysis and manuscript writing. AG Buckley and P Rigby
provided technical expertise in confocal microscopy and image data analysis. LW
Garratt, T Iosifidis, GR Zosky, AN Larcombe, K-M Ling, KM Martinovich, NC Shaw
and EN Sutanto assisted in manuscript preparation and editing. E Kicic-Starcevich was
involved in co-ordinating patient recruitment. FJ Lannigan was the Otolaryngologist
involved in patient sample collection. DA Knight assisted in data interpretation and
manuscript preparation. SM Stick, GR Zosky, AN Larcombe and A Kicic initiated the
study. SM Stick and A Kicic were involved in manuscript concept, data interpretation,
drafting and critical revision of the manuscript.
Signed_ Date 27 March 2015
Sunalene Devadason (Co-ordinating Supervisor)
Signed Date 27 March 2015
Stephen M. Stick (Senior Author)
Looi 2015
v
4. Garratt, L.W., Sutanto, E.N., Ling, K-M., Looi, K., Iosifidis, T., Martinovich,
K.M., Shaw, N.C., Kicic-Starcevich, E., Knight, D.A., Ranganathan, S., Stick,
S.M. & Kicic, A. on behalf of AREST CF (2015) MMP activation by free NE
contributes to bronchiectasis progression in early CF. European Respirology
Journal (In Press)
This publication is not directly related to the content of this thesis or its chapters. K
Looi provided feedback and assisted in critical revision of the manuscript.
Signed_ Date 27 March 2015
Sunalene Devadason (Co-ordinating Supervisor)
Signed__ Date 27 March 2015
Anthony Kicic (Senior Author)
Looi 2015
vi
5. Garratt, L.W., Sutanto, E.N., Ling, K-M., Looi, K., Iosifidis, T., Martinovich,
K.M., Shaw, N.C., Buckley, A.G., Kicic-Starcevich, E., Lannigan, F.J., Knight,
D.A., Stick, S.M. & Kicic, A. on behalf of AREST CF (2015) Alpha 1-
antitrypsin mitigates the inhibition of primary airway epithelial cell repair by
elastase (Under Review)
This publication is not directly related to the content of this thesis or its chapters. K
Looi was involved in sample collection and processing for the study and critical
revision of the manuscript.
Signed Date 27 March 2015
Sunalene Devadason (Co-ordinating Supervisor)
Signed Date 27 March 2015
Anthony Kicic (Senior Author)
Looi 2015
vii
6. Garratt, L.W., Sutanto, E.N., Foo, C.J., Ling, K-M., Looi, K., Kicic-Starcevich,
E., Iosifidis, T., Martinovich, K.M., Lannigan, F.J., Stick, S.M. & Kicic, A. on
behalf of AREST CF (2014) Determinants of culture success in an airway
epithelium sampling program of young children with cystic fibrosis.
Experimental Lung Research. Early Online 1-13.
This publication is not directly related to the content of this thesis or its chapters. K
Looi provided feedback and assisted in critical revision of the manuscript.
Signed Date 27 March 2015
Sunalene Devadason (Co-ordinating Supervisor)
Signed Date 27 March 2015
Anthony Kicic (Senior Author)
Signed___
Kevin Looi
Date 27 March 2015
Looi 2015
viii
Abstract
The airway epithelium is the primary contact point with the inhaled air and provides a
physical barrier defence against injurious stimuli. This barrier is achieved and
maintained through a myriad of junctional complexes, however, of key interest, are the
tight junctional complex proteins. Tight junctions (TJ) are located at the terminal end of
the epithelial cell layer and serve to maintain structural integrity as well as regulate
transepithelial permeability. Although studies have demonstrated TJ abnormalities in
adults with asthma, few studies have addressed whether these abnormalities are intrinsic
to asthma, are consequences of chronic inflammation, or due to atopy rather than
asthma. In addition, it is unknown whether these abnormalities can be detected early in
the disease progression and are correlated with disease severity.
Evidence has also demonstrated a close association between respiratory viral infections,
in particular, human rhinoviruses (HRVs) and resulting asthma exacerbations. Although
it has been previously shown that there is disassembly of specific TJ proteins, in
particular, zonula occludens-1 (ZO-1) following HRV infection, there still remains a
paucity of data on the susceptibility of the asthmatic epithelium to TJ disassembly
following HRV infection, especially within a paediatric population. This presents
significant rationale for the re-evaluation of the concept of epithelial barrier dysfunction
in asthma as well as the effects of HRV infection on barrier integrity. Therefore, this
study was conducted to study epithelial barrier function in non-asthmatic and asthmatic
individuals to test the following hypotheses. Firstly, the epithelial barrier function is
defective in children with asthma. Secondly, a defective barrier function in asthma is
independent of atopy. Thirdly, epithelial integrity and barrier function is further
compromised by HRVs in asthmatic airways compared to non-asthmatics.
In order to address these hypotheses, this project initially adapted, designed and
optimised two methodologies for the in vitro assessment of barrier integrity. A novel,
quantitative immunofluorescence assay termed In-Cell™ Western (ICW) was used to
Looi 2015
ix
quantify multiple membrane TJ proteins simultaneously from small sample sizes. Here,
different parameters including concentration of primary antibodies, length of primary
antibodies incubation and concentration of secondary antibodies were all optimised
using modified human AECs namely NuLi-1, which was subsequently corroborated in
primary AECs (pAECs). Results obtained indicated a 1:200 dilution of primary
antibodies and an incubation temperature and time of 4°C overnight, followed by
secondary antibody detection at a 1:800 dilution was the most appropriate for assessing
membrane TJ protein expression in pAECs. In addition, a transepithelial permeability
assay was also established. Here, fluorescently labelled dextran molecules of two
different molecular weights (4 and 20 kDa) were used and experiments performed to
ascertain the effects of varying sampling durations (4 and 6 hours) on absorbance
measurements and calculated permeability coefficients. Data generated reports the
successful establishment of this assay and demonstrated that absorbance values
continually increased over time and reached a maximum value at 6 h. Furthermore, the
additional sampling time period provided a more accurate measure of calculated
permeability coefficients than a shorter sampling period.
In addition, it was also essential to establish a direct correlation between HRV infection,
altered TJ expression and transepithelial permeability. This was performed using
modified healthy AECs, namely NuLi-1. However, prior to elucidating the potential
pathways and regulatory effects HRV has on epithelial TJ proteins, it was first
necessary to assess the susceptibility of NuLi-1 cells to the virus. Cells were initially
infected with HRV-1B at 50% Tissue Culture Infectivity Dose (TCID50) 2.5, 10 and 20
x 104 TCID50/ml for 24 h and cell viability, apoptosis and viral replication all
subsequently assessed. Membrane TJ protein disassembly and the resulting permeability
was assessed using previously optimised ICW and transepithelial permeability assay.
Finally, focused arrays on human TJs were performed to identify potential pathways
and regulatory effects of HRV infection on epithelial TJ proteins. Results confirmed a
typical loss of viability (p<0.05), induction of apoptosis following infection at a titre of
20x104 TCID50/ml HRV-1B for 24 h (p<0.05) and the presence of high viral RNA copy
number following HRV-1B infection for 24h (p<0.05). Focused qPCR array data
Looi 2015
x
demonstrated a down-regulation of 58 key genes with an up-regulation of 26 key genes
encoding for epithelial barrier junction proteins following infection with HRV-1B,
providing additional insights and better understanding of the molecular mechanisms
behind TJ-mediated cell biology. Membrane TJ disassembly in response to HRV-1B
infection was observed following infection at a titre of 20x104 TCID50/ml HRV-1B for
24 h. Although this was non-significant, when assessed functionally, a significant
increase in transepithelial permeability was observed (p<0.05).
To address the first hypothesis that epithelial barrier function is defective in children
with asthma, pAECs derived from non-asthmatic and asthmatic children were assessed
for the gene and protein expression of the TJs, claudin-1, occludin and ZO-1, via RT-
PCR and immunocytochemistry. Data demonstrated a significant increase in claudin-1
and occludin gene expression within the asthmatic cohorts. In contrast, ex vivo protein
expression for all three TJ was observed to be markedly decreased within the asthmatic
cohorts. Furthermore, assessment of TJ protein expression in vitro further corroborated
this decrease with significant reduction in membrane expression of all three TJ proteins
within the asthmatic cohorts. (p<0.05). Using submerged monolayer cultures, basal
transepithelial permeability was observed to be higher within the asthmatic cohorts
compared to the non-asthmatics. Collectively, these findings demonstrate that paediatric
asthmatic epithelium, despite higher TJ gene expression, has lower protein expression
and subsequently, an increase in basal transepithelial permeability compared to their
non-asthmatic counterpart. The discordance between increased TJ gene expression and
decreased TJ protein expression suggests post-transcriptional regulation or a
compensatory effect by other junctional proteins.
In order to test the second hypothesis that defective barrier function in asthma is
independent of atopy, pAECs were sub-categorised according to confirmed allergen
sensitisation, resulting in the following phenotypes; healthy non-atopic (HNA), healthy
atopic (HA), non-atopic asthmatic (NAA) and atopic asthmatic (AA) cohorts. Ex vivo
TJ gene and protein expression were assessed using RT-PCR and
immunocytochemistry. In vitro assessment of TJ protein expression and barrier integrity
Looi 2015
xi
was achieved via ICW and transepithelial permeability assays. Significant differences in
ex vivo claudin-1 and occludin TJ gene expression was observed between the HNA and
HA cohorts (p<0.05). Marked differences in ex vivo TJ protein expression was also
similarly observed between the HNA and HA cohorts. Moreover, in vitro analysis
demonstrated significantly lower membrane TJ protein expression within the HA
cohorts when compared to HNA (p<0.05). However, the lower protein expression did
not translate into a significant increase in transepithelial permeability within the HA
cohorts. Due to the limited availability of paediatric derived pAECNAA samples, no
statistical analysis could be performed on this cohort.
To test the third hypothesis that barrier function and epithelial integrity is further
compromised by HRV in asthmatic compared to non-asthmatic airways, asthmatic and
non-asthmatic paediatric derived pAECs were infected with viral titres of 2.5x104
TCID50/ml and 20x104 TCID50/ml of HRV-1B for 24 and 48 h. Membrane TJ protein
expression and barrier function was assessed using the ICW and transepithelial
permeability assay respectively. Data demonstrated significant disassembly of
membrane claudin-1, occludin and ZO-1 proteins in non-asthmatic cohort following
infection with viral titres of 20x104 TCID50/ml (p<0.05) of HRV-1B for 24 h was
observed, while, significant disassembly of all 3 TJ proteins was similarly observed in
the asthmatic cohort (p<0.05). Interestingly, a restoration towards non-infected levels
was observed for all TJ membrane proteins in non-asthmatic cohort following 48 h
infection while sustained disassembly occurred in the asthmatic cohort. When barrier
integrity was assessed functionally, a significant increase in transepithelial permeability
was only observed in the non-asthmatic cohorts (p<0.05) while increased transepithelial
permeability was maintained within the asthmatic cohorts post infection. Collectively,
these findings indicate that maintenance of increased permeability within the asthmatic
cohorts could be attributed to the low basal membrane TJ protein expression and that
HRV infection did not increase transepithelial permeability significantly in an already
permeable state. When assessing the effects of atopy on TJ protein expression in
response to HRV infection, a significant decrease (p<0.05) in all 3 TJ protein
expression was observed in pAECHNA, pAECHA and pAECAA after infection with viral
Looi 2015
xii
titres of 2.5 and 20x104 TCID50/ml of HRV-1B for 24 h. Interestingly, restoration of all
3 TJ protein expression towards non-infected levels was only observed in pAECHNA
while sustained decreased expression was observed in pAECHA, pAECNAA and pAECAA
cohorts. Despite this significant decrease in membrane TJ protein expression in all
cohorts, no significant differences in transepithelial permeability was observed between
submerged monolayer cultures of pAECHNA, pAECHA, pAECNAA and pAECAA.
Findings were then recapitulated in a physiologically more representative culture model
of the airway, using paediatric derived non-asthmatic and asthmatic pAECs. Cells were
cultured on inserts and once confluent, were grown at air-liquid interface (ALI) and
allowed to terminally differentiate. Transepithelial electrical resistance (TEER)
measurements and transepithelial permeability assays were performed to assess barrier
integrity and function respectively. Cells were then infected with viral titres of 10x104
TCID50/ml of HRV-1B for 24 h at 33°C, TEER and permeability to different sized inert
molecules subsequently re-assessed. The results showed lower basal membrane TJ
protein expression within the asthmatic epithelium compared to non-asthmatic
counterpart. Elevated basal transepithelial permeability, concomitant with reduced RT
values, strongly suggests that asthmatic epithelial cells have an intrinsically altered TJ
expression, hence leading to impairment of barrier functionality. Collectively, these
observations demonstrate potential relationship between atopy and asthma in altering
barrier integrity as well as the effects of HRV infection on epithelial integrity and
functionality in paediatric derived non-asthmatic and asthmatic pAEC ALI cultures.
In conclusion, this project has demonstrated an association between TJ disassembly and
the subsequent increase in transepithelial permeability. The data have also demonstrated
significantly lower membrane TJ protein and significantly higher permeability towards
small sized molecules in the asthmatic cohorts, which supports the notion that intrinsic
differences in basal TJ protein expression exist between non-asthmatic and asthmatic
epithelium. This may partly explain the increased susceptibility to aeroallergen
sensitisation and pathogenic challenges in children with asthma. Interestingly, this
project also demonstrated significant differences between non-atopic and atopic
Looi 2015
xiii
phenotypes within the non-asthmatic cohort. This suggests that the presence of atopy
might contribute to an increased predisposition towards membrane TJ protein
disassembly. However, the precise role of atopy, whether causative or co-contributing to
TJ disassembly, warrants further detailed analysis. Following HRV infection,
significant disassembly of all three membrane TJ protein within the non-asthmatic
cohort which is concomitant with elevated permeability may explain the increased
vulnerability of the non-asthmatic epithelium to successive aeroallergen sensitisation or
pathogenic challenges. However, despite significant disassembly of membrane occludin
within the asthmatic cohort following infection, maintenance of elevated permeability
was observed, suggesting that this intrinsically higher level of permeability could
facilitate trafficking of aeroallergens or pathogens into the sub-epithelial space,
resulting in an endless cycle of aeroallergen sensitisation, pathogenic challenges and
asthma exacerbations.
Looi 2015
xiv
Contents
Abstract ......................................................................................................................... viii
List of Figures .............................................................................................................. xxii
List of Tables ............................................................................................................. xxvii
List of Abbreviations ............................................................................................... xxviii
Publications arising from this project .................................................................... xxxiii
Presentations arising from this project .................................................................. xxxiv
International Conference Paper .............................................................................. xxxiv
National Conference Paper ..................................................................................... xxxv
Local Conference Paper ........................................................................................ xxxvii
Awards ...................................................................................................................... xxxix
Australian Postgraduate Award (APA) .................................................................. xxxix
Princess Margaret Hospital Foundation PhD Top-Up Scholarship ....................... xxxix
New Investigator Awards ....................................................................................... xxxix
Best Poster Prize .................................................................................................... xxxix
Travel Awards .............................................................................................................. xl
Acknowledgements ........................................................................................................ xli
CHAPTER 1: Literature Review ................................................................................... 1
1. Asthma ................................................................................................................... 1
1.2 Recent advances in the pathophysiology of asthma ........................................... 6
1.3 Respiratory epithelium ....................................................................................... 8
1.3.1 Form and function of the epithelium ........................................................... 8
1.3.2 Airway responses in the asthmatic epithelium .......................................... 14
Looi 2015
xv
1.3.3 Intrinsic abnormalities of the asthmatic epithelium .................................. 17
1.4 Respiratory viruses and asthma ........................................................................ 20
1.4.1 Influenza virus ........................................................................................... 21
1.4.2 Respiratory syncytial virus (RSV) ............................................................ 23
1.4.3 Human rhinovirus ..................................................................................... 25
1.5 Assessing airway integrity ................................................................................ 29
1.5.1 Animal models .......................................................................................... 29
1.5.2 Cell culture models ................................................................................... 31
1.6 Summary .......................................................................................................... 34
1.7 Hypotheses and research aims .......................................................................... 36
CHAPTER 2: General Materials and Methods ......................................................... 37
2.1 General Materials ............................................................................................. 37
2.2 Antibodies ............................................................................................................. 40
2.2.1 Primary antibodies .................................................................................... 40
2.2.2 Secondary antibodies ................................................................................ 40
2.3 General Equipment................................................................................................ 41
2.3.1 Autoclave .................................................................................................. 41
2.3.2 Balances .................................................................................................... 41
2.3.3 Bronchoscope ............................................................................................ 41
2.3.4 Bronchial brush ......................................................................................... 41
2.3.5 Centrifuges ................................................................................................ 41
2.3.6 Glassware .................................................................................................. 42
2.3.7 Heating devices ......................................................................................... 42
2.3.8 Incubators .................................................................................................. 42
2.3.9 Infrared scanner ......................................................................................... 42
Looi 2015
xvi
2.3.10 Laminar flow cabinets ............................................................................... 42
2.3.11 Microscope ................................................................................................ 43
2.3.12 pH meter .................................................................................................... 43
2.3.13 Pipettes ...................................................................................................... 43
2.3.14 Plate readers .............................................................................................. 43
2.3.15 Real Time Quantitative PCR (RT-qPCR) ................................................. 44
2.3.16 Semi-dry Western Blot Transfer ............................................................... 44
2.3.17 Spectrophotometer .................................................................................... 44
2.3.18 Stirrer, shakers and rockers ....................................................................... 44
2.3.19 Tissue culture and general plastic ware .................................................... 44
2.3.20 Water bath ................................................................................................. 45
2.4 General Buffers and Solutions.......................................................................... 45
2.4.1 General purpose ........................................................................................ 45
2.4.2 Cell culture ................................................................................................ 48
2.4.3 Assays and associated solutions ................................................................ 53
2.5 General Methodology ....................................................................................... 56
2.5.1 Cell line types ............................................................................................ 56
2.5.2 Immortalised cell line culture, sub-culture and cryopreservation ............. 59
2.5.3 Ethics approval .......................................................................................... 60
2.5.4 Primary paediatric airway epithelial cells ................................................. 60
2.5.5 Plasma and buffy coat isolation ................................................................ 63
2.5.6 Cytospin preparation ................................................................................. 63
2.5.7 Human Rhinovirus .................................................................................... 63
2.5.8 Immunocytochemistry............................................................................... 65
2.5.9 Immunohistochemistry .............................................................................. 66
Looi 2015
xvii
2.5.10 In-Cell™ Western ...................................................................................... 67
2.5.11 Transepithelial permeability...................................................................... 67
2.5.12 Transepithelial electrical resistance (TEER) ............................................. 68
2.5.13 Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) and Real
Time quantitative Polymerase Chain Reaction (RT-qPCR) ................................... 69
2.5.14 Total cellular protein extraction ................................................................ 69
2.5.15 Total cellular protein quantification .......................................................... 70
2.5.16 Western Blot.............................................................................................. 70
2.5.17 Statistical analysis ..................................................................................... 71
CHAPTER 3: Optimisation of In Cell™ Western and Transepithelial permeability
assays .............................................................................................................................. 72
3.1 Introduction ...................................................................................................... 72
3.2 In Cell™ Western assay .................................................................................... 75
3.2.1 Materials .................................................................................................... 75
3.2.2 Methods ..................................................................................................... 76
3.2.3 Results / Discussion .................................................................................. 77
3.2.4 Conclusion ................................................................................................ 82
3.3 Transepithelial permeability assay ................................................................... 83
3.3.1 Materials .................................................................................................... 83
3.3.2 Methods ..................................................................................................... 84
3.3.3 Results / Discussion .................................................................................. 85
3.3.4 Conclusion ................................................................................................ 87
CHAPTER 4: Effect of human rhinovirus infection on tight junction disassembly
and the subsequent changes to barrier function ........................................................ 88
4.1 Introduction ...................................................................................................... 88
4.2 Materials and Methods ..................................................................................... 89
Looi 2015
xviii
4.2.1 Cell culture ................................................................................................ 89
4.2.2 Human rhinovirus and titrations................................................................ 89
4.2.3 Human tight junction Polymerase Chain Reaction (PCR) arrays ............. 89
4.2.4 Infection of cell cultures............................................................................ 90
4.2.5 In Cell™ Western assay ............................................................................. 90
4.2.6 MTS cell viability assay ............................................................................ 90
4.2.7 Quantification of Human Rhinovirus viral copy number ......................... 91
4.2.8 Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) ............ 91
4.2.9 Single-stranded DNA (ssDNA) apoptosis assay ....................................... 91
4.2.10 Transepithelial permeability assay ............................................................ 92
4.2.11 Statistical analysis ..................................................................................... 93
4.3 Results .............................................................................................................. 93
4.3.1 Effect of human rhinoviral infection on NuLi-1 cell viability .................. 93
4.3.2 Apoptotic response and viral replication following infection with HRV-1B
94
4.3.3 Effect of HRV-1B infection on mRNA expression of tight junction
complexes ................................................................................................................ 95
4.3.4 Effect of human rhinovirus infection on membrane tight junction
disassembly ............................................................................................................. 95
4.3.5 Effect of human rhinovirus infection on transepithelial permeability ...... 96
4.4 Discussion ........................................................................................................ 97
4.5 Conclusion ........................................................................................................ 99
CHAPTER 5: Epithelial barrier integrity and function in paediatric asthma ..... 101
5.1 Introduction .................................................................................................... 101
5.2 Materials and Methods ................................................................................... 103
5.2.1 Patient Demographics ............................................................................. 103
Looi 2015
xix
5.2.2 Cell culture .............................................................................................. 103
5.2.3 In Cell™ Western ..................................................................................... 103
5.2.4 Immunocytochemistry............................................................................. 103
5.2.5 Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) .......... 104
5.2.6 Transepithelial permeability assay .......................................................... 104
5.2.7 Statistical analysis ................................................................................... 104
5.3 Results ............................................................................................................ 104
5.3.1 Basal tight junction gene expression ....................................................... 104
5.3.2 Basal tight junction protein expression ................................................... 106
5.3.3 In vitro tight junction protein expression ................................................ 108
5.3.4 In vitro transepithelial permeability ........................................................ 110
5.4 Discussion ...................................................................................................... 112
5.5 Conclusion ...................................................................................................... 117
CHAPTER 6: Effects of human rhinovirus on epithelial barrier integrity and
function in vitro and its role in paediatric asthma ................................................... 118
6.1 Introduction .................................................................................................... 118
6.2 Materials and Methods ................................................................................... 119
6.2.1 Patient Demographics ............................................................................. 119
6.2.2 Cell culture .............................................................................................. 120
6.2.3 Human rhinovirus and titrations.............................................................. 120
6.2.4 Infection of cell cultures.......................................................................... 120
6.2.5 In Cell™ Western ..................................................................................... 120
6.2.6 Transepithelial permeability assay .......................................................... 121
6.2.7 Statistical analysis ................................................................................... 121
6.3 Results ............................................................................................................ 121
Looi 2015
xx
6.3.1 Effect of human rhinovirus infection on membrane tight junction protein
expression after 24 and 48 h.................................................................................. 121
6.3.2 Effect of human rhinovirus infection on in vitro transepithelial
permeability........................................................................................................... 134
6.4 Discussion ...................................................................................................... 136
6.5 Conclusion ...................................................................................................... 141
CHAPTER 7: Effects of human rhinovirus on epithelial barrier integrity and
function in well-differentiated air-liquid interface cultures ................................... 142
7.1 Introduction .................................................................................................... 142
7.2 Materials and Methods ................................................................................... 143
7.2.1 Patient Demographics ............................................................................. 143
7.2.2 Cell culture .............................................................................................. 144
7.2.3 Establishment of air-liquid interface (ALI) cultures ............................... 144
7.2.4 Immunohistochemistry for visualisation of ciliated and goblet cells...... 144
7.2.5 Immunofluorescence and confocal microscopy ...................................... 145
7.2.6 Stereological analysis and quantification of tight junction expression ... 145
7.2.7 Human rhinovirus and titrations.............................................................. 146
7.2.8 Infection of cell cultures.......................................................................... 146
7.2.9 Transepithelial electrical resistance measurement .................................. 146
7.2.10 Transepithelial permeability assay .......................................................... 147
7.2.11 Statistical analysis ................................................................................... 147
7.3 Results ............................................................................................................ 147
7.3.1 Establishment of air-liquid interface cultures ......................................... 147
7.3.2 Physical properties of pAEC derived ALI cell cultures of non-asthmatic
and asthmatic cohorts ............................................................................................ 148
Looi 2015
xxi
7.3.3 Effect of human rhinovirus infection on membrane tight junction protein
expression in pAEC derived well differentiated air-liquid interface (ALI) cultures
149
7.3.4 Effect of human rhinovirus infection on transepithelial electrical resistance
(TEER) and permeability in pAEC derived well differentiated air-liquid interface
(ALI) cultures ........................................................................................................ 152
7.4 Discussion ...................................................................................................... 155
7.5 Conclusion ...................................................................................................... 159
Chapter 8: General Discussion .................................................................................. 160
References .................................................................................................................... 169
Appendix A .................................................................................................................. 190
Appendix B .................................................................................................................. 192
Appendix C .................................................................................................................. 194
Appendix D .................................................................................................................. 196
Appendix E .................................................................................................................. 197
Appendix F ................................................................................................................... 198
Appendix G .................................................................................................................. 199
Appendix H .................................................................................................................. 200
Looi 2015
xxii
List of Figures
Chapter 1: Literature Review
Fig 1.1: Schematic diagram of the factors contributing to the heterogeneity and
complexity in asthma pathogenesis and diagnosis.
Fig 1.2: Schematic of major cell types lining the respiratory airways.
Fig 1.3: Illustration of the complexity between protein-protein interactions at the tight
junction complex.
Fig 1.4: Schematic of air-liquid interface culture process.
Chapter 3: Optimisation of In-Cell™ Western and Transepithelial permeability
assay
Fig 3.1: Effect of primary antibody concentration on NuLi-1 TJ signal intensity.
Fig 3.2: Effect of primary antibody concentration on paediatric derived pAECHNA
TJ signal intensity.
Fig 3.3: Effect of incubation temperature of primary antibody at 25°C on NuLi-1 TJ
signal intensity.
Fig 3.4: Effect of incubation temperature of primary antibody at 4°C on NuLi-1 TJ
signal intensity.
Looi 2015
xxiii
Fig 3.5: Effect of incubation temperature of primary antibody at 25°C on paediatric
derived pAECHNA TJ signal intensity.
Fig 3.6: Effect of incubation temperature of primary antibody at 4°C on paediatric
derived pAECHNA TJ signal intensity.
Fig 3.7: Effect of secondary antibody concentration on NuLi-1 TJ signal intensity.
Fig 3.8: Effect of secondary antibody concentration on paediatric derived pAECHNA
TJ signal intensity.
Fig 3.9: Methodology of In-Cell™ Western (ICW) assay
Fig 3.10: Effect of sampling time on FITC-dextran molecules across cell
monolayers.
Fig 3.11: Methodology of Transepithelial permeability assay
Chapter 4: Effect of human rhinovirus infection on tight junction disassembly and
the subsequent changes to barrier function
Fig 4.1: Effect of HRV-1B on cellular viability in NuLi-1 over time.
Fig 4.2: Effect of HRV-1B on apoptosis and viral replication in NuLi-1.
Fig 4.3: Effect of HRV-1B on mRNA expression of TJ in NuLi-1.
Fig 4.4: Effect of HRV-1B infection on membrane TJ protein expression in NuLi-1.
Fig 4.5: Effect of HRV-1B infection on transepithelial permeability in NuLi-1.
Looi 2015
xxiv
Chapter 5: Epithelial barrier integrity and function in paediatric asthma
Fig 5.1: Ex vivo mRNA expression of TJs from pAECs of non-asthmatic and asthmatic
cohorts.
Fig 5.2: Ex vivo mRNA expression of TJs in pAECs of non-asthmatic and asthmatic
cohorts with each cohort further categorised based on atopy.
Fig 5.3: Ex vivo membrane protein expression of TJs from pAECs of non-asthmatic and
asthmatic cohorts.
Fig 5.4: Ex vivo membrane protein expression of TJs of pAECs from non-asthmatic and
asthmatic cohorts with each cohort further categorised based on atopy.
Fig 5.5: Basal membrane TJ protein expression in pAECs from non-asthmatic and
asthmatic cohorts.
Fig 5.6: Basal membrane TJ protein expression in pAECs from non-asthmatic and
asthmatic cohorts with each cohort further categorised based on atopy.
Fig 5.7: Basal transepithelial permeability in pAECs from non-asthmatic and asthmatic
cohorts and with each cohort further categorised based on atopy.
Chapter 6: Effects of human rhinovirus on epithelial barrier integrity and function
in vitro and its role in paediatric asthma
Fig 6.1: Membrane TJ protein expression over time in pAECs from non-asthmatic and
asthmatic cohorts following viral infection.
Looi 2015
xxv
Fig 6.2: Membrane TJ protein expression over time in pAECs from non-asthmatic and
asthmatic cohorts following viral infection with each cohort further categorised based
on atopy.
Fig 6.3: Transepithelial permeability in pAECs from non-asthmatic and asthmatic
cohorts following viral infection.
Fig 6.4: Transepithelial permeability in pAECs from non-asthmatic and asthmatic
cohorts following viral infection with each cohort further categorised based on atopy.
Chapter 7: Effects of human rhinovirus on epithelial barrier integrity and function
in well-differentiated air-liquid interface cultures
Fig 7.1: Generation of ALI cultures from pAECs of non-asthmatic and asthmatic
cohorts.
Fig 7.2: Generation of ALI cultures from pAECs of non-asthmatic and asthmatic
cohorts with each cohort further categorised based on atopy.
Fig 7.3: Membrane TJ protein expression in ALI cultures generated from pAECs of
non-asthmatic cohorts following viral infection.
Fig 7.4: Membrane TJ protein expression in ALI cultures generated from pAECs of
asthmatic cohorts following viral infection.
Fig 7.5: Expression of membrane TJ protein in ALI cultures from pAECs of non-
asthmatic and asthmatic cohorts following viral infection.
Fig 7.6: Membrane TJ protein expression in ALI cultures generated from pAECHNA
cohorts following viral infection.
Looi 2015
xxvi
Fig 7.7: Membrane TJ protein expression in ALI cultures generated from pAECHA
cohorts following viral infection.
Fig 7.8: Membrane TJ protein expression in ALI cultures generated from pAECAA
cohorts following viral infection.
Fig 7.9: Expression of membrane TJ protein in ALI cultures from pAECs of non-
asthmatic and asthmatic cohorts with each cohort further categorised based on atopy.
Fig 7.10: Transepithelial electrical resistance (RT) and permeability in ALI cultures
from pAECs of non-asthmatic and asthmatic cohorts.
Fig 7.11: Transepithelial electrical resistance (RT) and permeability in ALI cultures
from pAECs of non-asthmatic and asthmatic cohorts with each cohort further
categorised based on atopy.
Looi 2015
xxvii
List of Tables
Chapter 1: Literature Review
Table 1: Asthma susceptibility genes with the associated functions and pathway.
Chapter 2: General Materials and Methods
Table 2: Radioallergosorbent test (RAST) to a panel of common allergens for
determination of atopy.
Chapter 5: Epithelial barrier integrity and function in paediatric asthma
Table 5.1: Demographic of patient cohort categorised according to atopy.
Chapter 6: Effects of human rhinovirus on epithelial barrier integrity and function
in vitro and its role in paediatric asthma
Table 6.1: Demographic of patient cohort categorised according to atopy.
Chapter 7: Effects of human rhinovirus on epithelial barrier integrity and function
in well-differentiated air-liquid interface cultures
Table 7.1: Demographic of patient cohort categorised according to atopy.
Looi 2015
xxviii
List of Abbreviations
°C degrees Celsius
AA atopic asthmatic
AEC airway epithelial cell
AHR airway hyper-responsiveness
AJ adherens junction
ALI air liquid interface
ASL airway surface liquid
ASM airway smooth muscle
ATCC American type culture collection
ATS American Thoracic Society
AU Arbitrary Units
BAL bronchoalveolar lavage
BCA bicinchoninic acid
BEBM bronchial epithelial basal medium
BPE bovine pituitary extract
BSA bovine serum albumin
CaCl2 calcium chloride
CEB cell protein extraction buffer
CF cystic fibrosis
cDNA complementary deoxyribonucleotide acid
CLDN claudin
cm2 squared centimetre
CO2 carbon dioxide
DAPI 4′,6-diamidino-2-phenylindole
DC dendritic cell
ddH2O double deionised water
DMEM dulbecco’s modified eagle medium
DMSO dimethyl sulfoxide
Looi 2015
xxix
DNA deoxyribonucleotide acid
dNTP deoxyribonucleotide triphosphates
ECACC European collection of cell cultures
ECM extracellular matrix
EDTA ethylenediamine tetraacetic acid
EGF epidermal growth factor
EMEM earl’s modified essential medium
FCS foetal calf serum
FEV1 forced expiratory volume in 1 second
FITC fluorescein isothiocynate
g grams
g gravitational force
GWAS genome wide association studies
h hour
HA healthy atopic
HBSS hank’s balanced salt solution
HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
HCl hydrochloric acid
HNA healthy non-atopic
HRV human rhinovirus
ICC immunocytochemistry
ICW In Cell™ Western
Ig immunoglobulin
IHC immunohistochemistry
I.I integrated intensity
IL interlukin
iNOS inducible nitric oxide synthase
IQR interquartile range
ISAAC International Study of Asthma and Allergies in Childhood
JAMs junctional adhesion molecules
KCl potassium chloride
Looi 2015
xxx
kDa kilodaltons
KH2PO4 potassium dihydrogen orthophosphate
l litre
LDS lithium dodecyl sulphate
M molar
MEM minimum essential media
MES-SDS 2-(N-morpholino)ethanesulfonic acid sodium dodecyl sulphate
mg milligram
MgCl2 magnesium chloride
MHC major histocompatibility complex
min minutes
ml millilitres
mM millimolar
MOI multiplicity of infection
mRNA messenger ribonucleic acid
MW molecular weight
NAA non-atopic asthmatic
NaCl sodium chloride
Na2CO3 sodium carbonate
Na2HPO4 sodium phosphate dibasic
NaF sodium fluoride
NaHCO3 sodium bicarbonate
NaH2PO4 sodium dihydrogen orthophosphate
NaOH sodium hydroxide
Na3VO4 sodium orthovanadate
NBF neutral buffered formalin
ng nanogram
nm nanometre
OCLN occludin
pAEC paediatric-derived primary airway epithelial cells
Looi 2015
xxxi
pAECAA atopic asthmatic paediatric-derived primary airway epithelial
cells
pAECHA healthy atopic paediatric-derived primary airway epithelial cells
pAECHNA healthy non-atopic paediatric-derived primary airway epithelial
cells
pAECNAA non-atopic asthmatic paediatric-derived primary airway epithelial
cells
PAGE polyacrylamide gel electrophoresis
Papp Apparent permeability coefficient
PBS phosphate buffered saline
PCR polymerase chain reaction
pH -log [H+]
PPIA peptidylprolyl isomerase A
PVDF polyvinylidene fluoride
qPCR quantitative polymerase chain reaction
RANTES regulated upon activation, normal T-cell expressed and secreted
RAST radioallergosorbent test
RLT ribonucleic acid lysis buffer
RNA ribonucleic acid
rpm revolutions per minute
RPMI Roswell Park Memorial Institute
RSV respiratory syncytial virus
RT room temperature
RT-PCR reverse transcriptase-polymerase chain reaction
RT-qPCR real time quantitative polymerase chain reaction
SD standard deviation
SDS sodium dodecyl sulfate
SE standard error
SEM standard error of mean
TBS tris buffered saline
TCID50 50% tissue culture infective dose
Looi 2015
xxxii
TEER transepithelial electrical resistance
TH T helper cell
TJ tight junction
UV ultraviolet
v/v volume per volume
w/v weight per volume
ZO-1 zonula occludens-1
µg microgram
µl microlitre
µM micromolar
% percent
Ω ohms
Looi 2015
xxxiii
Publications arising from this project
1. Looi K., Sutanto E.N., Banerjee B., Garratt L.W., Ling K-M., Foo C.J., Stick
S.M. & Kicic A. (2011). Bronchial brushings for investigating airway
inflammation and remodelling. Respirology 16: 725–737.
2. Looi K., Buckley A.G., Rigby P., Garratt L.W., Iosifidis T., Knight, D.A.,
Bosco A., Troy N.M., Ling K-M., Martinovich K.M., Kicic-Starcevich E., Shaw
N.C., Sutanto E.N., Kicic A. & Stick S. M. (2015). Human rhinovirus infection
of airway epithelium triggers tight junction protein disassembly resulting in
increased transepithelial permeability. (In preparation)
3. Looi K., Buckley A.G., Rigby P., Garratt L.W., Iosifidis T., Knight D.A., Zosky
G.R., Larcombe A.N., Lannigan F.J., Ling K-M., Martinovich K.M., Kicic-
Starcevich E., Shaw N.C., Sutanto E.N., Kicic A. & Stick S. M. (2015). Effects
of human rhinovirus on epithelial barrier integrity and function in childhood
asthma. (In preparation)
Looi 2015
xxxiv
Presentations arising from this project
International Conference Paper
Oral Presentation
Looi K., Larcombe A.N., Zosky G.R, Rigby P., Knight D.A., Stick S.M., Kicic
A. (2013). Human rhinovirus infection of asthmatic airway epithelial cells
causes tight junction disassembly resulting in increased permeability.
Respirology 18(4): 16
Full oral presentation at the 18th Congress of the Asian Pacific Society of Respirology
(APSR), Yokohama, Japan (2013).
Poster Presentation
1. Looi K., Buckley A.G., Rigby P., Garratt L.W., Iosifidis T., Lannigan F.J.,
Knight D.A., Zosky G.R., Larcombe A.N., Ling K-M., Martinovich K.M.,
Kicic-Starcevich E., Shaw N.C., Sutanto E.N., Kicic A. & Stick S.M. (2015).
Intrinsic differences of epithelial tight junction in asthmatic airway epithelium
and barrier compromisation following human rhinoviral insult.
Poster presentation at the American Thoracic Society (ATS) annual scientific meeting,
Denver, USA (2015).
Looi 2015
xxxv
2. Looi K., Ling K-M., Sutanto E.N., Larcombe A.N., Foong R., Knight D.A.,
Rigby P., Stick S.M., Kicic A. (2011). Barrier integrity compromisation as an
intrinsically abnormal process in asthmatic epithelium independent of atopy. Am
J Respir Crit Care Med 183: A2062
Poster presentation at the American Thoracic Society (ATS) annual scientific meeting,
Denver, USA (2011).
National Conference Paper
Oral Presentation
Looi K., Garratt L.W., Iosifidis T., Lannigan F.J., Ling K-M., Martinovich
K.M., Kicic-Starcevich E., Sutanto E.N., Kicic A. & Stick S.M. (2014). Tight
junction disassembly following human rhinovirus infection results in airway
epithelial permeability changes. Respirology 19 (S2): 56
Oral presentation at Thoracic Society of Australia and New Zealand (TSANZ) Annual
Scientific Meeting, Adelaide, Australia (2014).
Looi 2015
xxxvi
Poster Presentation
1. Looi K., Buckley, A.G., Rigby P, Garratt L.W., Iosifidis T, Lannigan F.J.,
Knight D.A., Zosky G.R., Larcombe A.N., Ling K-M, Martinovich K.M., Kicic-
Starcevich E, Shaw N.C., Sutanto E.N., Stick S.M. & Kicic A (2015)
Disassembly of epithelial tight junctions in well-differentiated air-liquid
interface (ALI) cultures following human rhinovirus infection results in airway
epithelial permeability changes.
Poster presentation at Thoracic Society of Australia and New Zealand (TSANZ)
Annual Scientific Meeting, Gold Coast, Australia (2015).
2. Looi K., Larcombe A.N., Zosky G.R., Rigby P, Knight D.A., Stick S.M. &
Kicic A (2013) Human rhinovirus infection initiates airway epithelial tight
junction disassembly resulting in barrier function disruption. Respirology 18
(S2): 49
Poster presentation at Thoracic Society of Australia and New Zealand (TSANZ)
Annual Scientific Meeting, Darwin, Australia (2013).
3. Looi K., Ling K-M, Sutanto E.N., Larcombe A.N., Foong R. Rigby P, Stick
S.M. & Kicic A (2011) Airway epithelium barrier integrity compromisation
following rhinoviral insult. Respirology 16 (S1): 47
Poster presentation at Thoracic Society of Australia and New Zealand (TSANZ)
Annual Scientific Meeting, Perth, Australia (2011).
Looi 2015
xxxvii
Local Conference Paper
Oral Presentation
1. Looi K., Larcombe A.N., Zosky G.R., Rigby P, Knight D.A., Stick S.M. &
Kicic A (2013) Disassembly of asthmatic airway epithelial cells tight junctions
following rhinoviral insult results in increased permeability.
Oral presentation at the Child and Adolescent Health Service Research and Advances
Seminar, Princess Margaret Hospital, Perth, WA (2013)
2. Looi K., Buckley A.G., Rigby P, Knight D.A., Zosky G.R., Larcombe A.N.,
Stick S.M. & Kicic A (2013) Change in airway epithelial permeability following
human rhinovirus infection is associated with disassembly of tight junctions in
well-differentiated air-liquid interface (ALI) cultures.
Oral presentation at the Respiratory Medicine Annual Scientific Meeting, Perth, WA
(2013) New Investigator Finalist.
Poster Presentation
1 Looi K.,, Garratt L.W., Iosifidis T, Lannigan F.J., Ling K-M, Martinovich K.M.,
Kicic-Starcevich E, Sutanto E.N., Stick S.M. & Kicic A (2013) Tight junction
expression in healthy and asthmatic airway epithelium: Are they intrinsically
different?
Poster presentation at Thoracic Society of Australia and New Zealand (TSANZ) WA
Branch Annual Scientific Meeting, Perth, Australia (2013)
Looi 2015
xxxviii
2 Looi K., Stick S.M. & Kicic A (2012) Evaluating changes on epithelial tight
junction expression in response to rhinoviral insult to determine potential
regulatory mechanisms.
Poster presentation at Thoracic Society of Australia and New Zealand (TSANZ) WA
Branch Annual Scientific Meeting, Perth, Australia (2012)
3 Looi K., Stick S.M. & Kicic A (2012) Assessing the effects of rhinoviral
infection on epithelial tight junction expression to elucidate potential regulatory
mechanisms.
Poster presentation at the Child and Adolescent Health Service Research and Advances
Seminar, Princess Margaret Hospital, Perth, WA (2012)
4 Looi K., Ling K-M, Sutanto E.N., Larcombe A.N., Foong R. Rigby P, Stick
S.M. & Kicic A (2010) Changes in the airway epithelium barrier integrity in
response to viral insult.
Poster presentation at Thoracic Society of Australia and New Zealand (TSANZ) WA
Branch Annual Scientific Meeting, Perth, Australia (2010)
5 Looi K., Ling K-M, Sutanto E.N., Larcombe A.N., Foong R. Rigby P, Stick
S.M. & Kicic A (2010) The effect of rhinoviral insult on airway epithelium
barrier integrity.
Poster presentation at the Child and Adolescent Health Service Research and Advances
Seminar, Princess Margaret Hospital, Perth, WA (2010)
Looi 2015
xxxix
Awards
Australian Postgraduate Award (APA)
A three year scholarship was awarded during the PhD candidature by the University of
Western Australia, Perth, Western Australia, Australia (2010)
Princess Margaret Hospital Foundation PhD Top-Up Scholarship
A three year top-up scholarship was awarded during the PhD candidature by the
Princess Margaret Hospital Foundation, Perth, Western Australia (2010)
New Investigator Awards
Recipient of the Distinguished Young Scientist Award inclusive of conference
registration, accommodation and travel reimbursement from the European Respiratory
Society at Yokohama, Japan (2013)
Finalist for the Young Investigator Award at the Respiratory Medicine Annual
Scientific Meeting, Perth, Western Australia (2013)
Best Poster Prize
A conference travel award of $500 for best poster at the annual Child and Adolescent
Health Services Research and Advances Seminar, Perth, WA (2010)
Looi 2015
xl
Travel Awards
Winner of the Lung Institute of Western Australia (LIWA) Young Scientist Award of
$1750 conference travel reimbursement for attendance at the American Thoracic
Society Annual Scientific Meeting at Denver, Colorado, USA (2011)
Conference travel awards of $500 from the Thoracic Society of Australia and New
Zealand (TSANZ) to attend the annual scientific conference in Darwin, Adelaide and
Gold Coast (2013, 2014, 2015)
Looi 2015
xli
Acknowledgements
I would like to thank all the study patients and their families who have supported and
participated in this study. I would also like to thank all the funding bodies who have
provided financial support over the years. I would like to acknowledge the contribution
of all the doctors and recruitment officers at the Department of Respiratory Medicine at
Princess Margaret Hospital and St John of God Hospital Subiaco, who assisted in
patient recruitment and sample collection, in particular, Dr Desmond Cox, Dr Srinivas
Poreddy, Dr Francis Lannigan and Ms Cindy Bailey. I would especially like to thank Dr
Elizabeth Kicic-Starcevich for her dedication in recruiting and co-ordinating the
collection of samples, without whom, this study would not have been possible. I would
also like to thank all past and present members of the Epithelial Research Group for
their assistance in the laboratory, particularly, Ms Kak-Ming Ling, for her patience in
teaching and guidance.
For their aspiring guidance, I would like to thank my supervisors, Professor Stephen
Stick and Associate Professor Sunalene Devadason for their constant support, feedback,
constructive criticisms and their truthful and illuminating views on the various issues
related to this project. I am especially thankful to my supervisor, Associate Professor
Anthony Kicic, for his continuous support, guidance and patience on a daily basis. You
have been a tremendous mentor for me, encouraging my research and allowing me to
grow as a research scientist.
A special thanks to my family. Words alone cannot adequately express how grateful I
am to my parents and parents-in-laws for all the sacrifices that you’ve made on my
behalf. I would also like to thank my friends who supported me and encouraged me to
strive towards my goal. At the very end, I would like to express my special appreciation
to Erika, my beloved wife and mother of our two beautiful children, Evelyn and Kenzo,
who endured many a sleepless nights with and was always my pillar of strength in those
moments when all seemed impossible.
Looi 2015
xlii
In loving memory of my late Grandfather,
Looi Kim Thean
3rd July 2007
When the journey ahead seems arduous,
And all light has faded and failed,
Your words of “Never stop learning”,
Kept me persevering,
And so, against all odds, I have prevailed.
Thank you for being such an inspiration to me.
Looi 2015
1
CHAPTER 1: Literature Review
1. Asthma
Asthma is among the most common chronic condition worldwide, affecting both
children and adults. The report by Masoli and colleagues (2004) estimated that 300
million people worldwide has a history of asthma and that this number would increase
to 400 million by 2025 as cities becoming increasingly urbanised (Masoli et al. 2004).
Asthma is the most common chronic illness in childhood and adolescence (GINA
2011), imparting physical, mental as well as an impaired quality of life burden to the
patients and their care-givers. Studies have shown that the quality of life experienced by
the asthmatic individual is closely associated with the severity of symptoms
(Warschburger et al. 2003; Merikallio et al. 2005) and it has been reported that
presentation of severe asthmatic symptoms has been closely linked to anxiety or
depression disorders (Richardson et al. 2006). In addition to an impaired quality of life
in patients, asthmatic episodes can also result in the increased need for treatment,
hospitalisation and emergency department services. Care-givers for asthma patients can
also experience a loss of personal time, absenteeism from work resulting in lost
productivity as well as the need to cope with the mental and physical demands.
Collectively, these requirements can then place further strain on the overall healthcare
system and social costs (Kenny et al. 2005; Simonella et al. 2006; Watson et al. 2007;
Ivanova et al. 2012). The total cost of asthma for the 2008-09 fiscal year in Australia
was $655 million, which represented 0.9% of the total health expenditure of that year
(AIHW 2011). Despite comprehensive analyses of the prevalence and burden of asthma,
attempts at advancing the understanding of the pathophysiology of asthma remain
elusive.
Historically, the earliest concept of asthma was derived from detailed clinical
observations that eventually contributed to the development of the bronchoconstrictor
paradigm. The Belgian physician, Jean van Helmont, who suffered from asthma,
Looi 2015
2
suggested one of the first pathophysiologic mechanisms of asthma in 1662, stating that:
“the lungs are contracted or otherwise drawn together” (Keeney 1964; Sakula 1988). In
1698, the English physician, Sir John Floyer, who developed asthma following a
respiratory infection, provided detailed accounts of asthma signs and symptoms,
treatment, prevention and prognosis. He also described a hereditary component of
asthma as well as other contributing factors to asthma exacerbations such as air
pollution, infection, cold air, exercise, psychological stress and tobacco smoke. These
observations aided in the clear distinction of asthma from other respiratory disorders.
By early 1900s, Brodie and Dixon proposed that the physiologic process of bronchial
narrowing due to constriction of the airway smooth muscle (ASM) resulted in asthma.
Subsequent observations from studies performed on individuals with asthma further
documented an exaggerated bronchoconstrictor response to various agents (Boushey et
al. 1980), which led to a general consensus that airway hyper-reactivity played a central
role in the pathogenesis of asthma. However, as airway hyper-reactivity could not be
consistently associated with ASM behaviour between healthy individuals and
individuals with asthma, it was postulated that non-muscle factors may contribute to the
development of airway hyper-reactivity in asthma as well as other chronic inflammatory
airway diseases (Solway and Fredberg 1997). Furthermore, the development of airway
hyper-reactivity in acute or chronic bronchitis has resulted in the postulation of a
common pathogenic mechanism between airway inflammatory diseases and asthma
(Bleecker 2004; Postma and Boezen 2004). Recent findings have documented
differences in ASM cells of animal models and individuals with asthma (Stephens et al.
2003; Roth et al. 2004). This accumulated evidence suggests the possibility of intrinsic
differences within the smooth muscles of individuals with asthma potentially
contributing to an increased level of bronchoconstriction. Although the importance of
ASM cells in asthma has long been recognised, the precise nature of its involvement in
the pathogenesis of airway hyper-reactivity remains unclear. Studies performed within
the past decade have challenged the well-established concept that ASM cells were
primarily an effector, while airway inflammation has been generally considered to be
the causal pathophysiological mechanism underlying airway hyper-reactivity and
ultimately, asthma pathogenesis. However, several studies have indicated that airway
Looi 2015
3
hyper-reactivity and airway inflammation can occur independently following specific
interventions at the inflammatory mediator level (Johnson et al. 2004; Kariyawasam et
al. 2007; Fattouh et al. 2008) .
Another suggestion was that an abnormal nervous system resulted in bronchial
constriction (Simonsson et al. 1967), thereby extending the bronchoconstriction
paradigm. In the past century, respiratory neurobiologists have shown that the lungs are
innervated with sympathetic, parasympathetic as well as non-adrenergic non-cholinergic
(NANC) nervous systems. Although recent studies have shown the influence of the
NANC nervous systems on airway behaviour, the primary role of NANC nervous
systems continues to be largely undefined and remains of interest to researchers
particularly in relation to cough associated with airway inflammation.
A dominant concept arose from observations of the many similarities between asthma
and allergic conditions (Stolkind 1933; Persson 1985) such as the high incidence of
allergen skin test reactivity and tissue eosinophilia (Powell and Hartley 1911; Cooke
and Vander Veer 1916). However, further examination indicated that certain individuals
with asthma have an allergic diathesis while some others do not. An early study of over
600 individuals with asthma categorised individuals as having “intrinsic” or “extrinsic”
asthma, largely dependent on the nature of the primary attributed factor (Rackemann
1921). Intrinsic asthma was thought to be precipitated by a factor within the individual
and was often associated with either respiratory bacterial or viral infection, a reflex of
upper airway irritation or stress and anxiety. Alternatively, extrinsic asthma was
observed to occur within hypersensitive individuals and asthma exacerbations were
induced by exposure to external allergens (Rackemann 1921). The commonly
associated link between allergy and asthma has been the major focus for asthma
research for at least 4 decades. Although much has been learned about the nature of the
association, very few new and effective therapeutic strategies have resulted. However,
the importance of airway inflammation has emerged as an almost ubiquitous factor in
asthma regardless of apparent phenotype.
Looi 2015
4
The presence of airway inflammation in individuals with asthma was evident in a series
of autopsies performed on individuals who died from status asthmaticus in 1922.
Evidence from these autopsies described the clinical presentation and classic
histopathological features of asthma which includes bronchial glands and muscle
hypertrophy, basement membrane thickening, injury to the AEC layer, mucous cell
metaplasia and accumulation of inflammatory cells such as eosinophils, neutrophils,
lymphocytes and macrophages into the sub-epithelial and epithelial layer (Huber and
Koessler 1922). However, it was also noted by Huber and Koessler that not all
individuals exhibited the classical eosinophilic infiltration of the airways typical of
allergic asthma, thus postulating the existence of other non-allergic subtypes of asthma.
Nonetheless, the inflammatory concept of asthma pathogenesis emerged as the most
widely regarded model of asthma pathogenesis in the early 1980s in which a pioneer
study quantified the severity of experimental airway inflammation and suggested that
non-allergic inflammation directed by AECs could also be responsible for airway hyper-
reactivity (Holtzman et al. 1983). Advancement of tissue sampling methods has enabled
studies to be performed utilising samples obtained via fibre-optic bronchoscopy for the
confirmation of previously obtained findings from autopsies demonstrating the presence
of mucosal inflammation within individuals with asthma (Djukanović et al. 1990;
Bousquet et al. 2000). Furthermore, other studies have shown a correlation between the
level of disease severity and the extent of inflammation and that an increase in
inflammatory cell infiltration was closely associated with the state of the disease
activity (De Monchy et al. 1985; Metzger et al. 1987; Laitinen et al. 1991; Vignola et
al. 1998).
An approach which links the “allergic” asthma phenotype with airway inflammation
stems from the observations of adaptive immune responses in murine models, in which
the inflammatory patterns are characterised by the development of distinct subsets of
CD4+ T cells designated as T-helper type-1 (TH1) or type-2 (TH2) (Mosmann et al.
1986). Although the distinction is not as clear in humans, similar differentiation of cells
in humans have been described and counter-regulation between TH1 and TH2 cells have
been shown to occur (Fiorentino et al. 1989; de Waal Malefyt et al. 1993; Manetti et al.
1993; Trinchieri 1994; Wenner et al. 1996) while the interplay of TH1 and TH2 with
Looi 2015
5
other cells have been shown to regulate the release of mediators responsible for the
inflammatory responses (Wills-Karp 1999). Moreover, considerable evidence obtained
from individuals with asthma, which demonstrated a TH2 inflammatory profile, led to
the belief that TH2 cells contribute towards asthma pathogenesis (Robinson et al. 1992).
However, observations have also shown that the onset and progression of asthma is not
entirely attributed to the allergic pathway and that other pathways exists that could also
result in the development of asthma (Johnston et al. 2007; Kim et al. 2008; Pichavant et
al. 2008). This subgroup of asthma is classically termed non-TH2 mediated asthma and
unlike TH2 mediated asthma, very little is known about this subpopulation of asthma,
the phenotypes underlying it as well as the molecular aspects which regulate it.
Observations such as those that demonstrated eosinophilic and neutrophilic asthma
phenotypes (Hastie et al. 2010; Bourgeois et al. 2011) and data that have challenged
whether the T cell paradigm can be extrapolated to humans from murine models argue
that the current perception is likely to be more complex than a simple dichotomy of
innate or adaptive immune developmental processes and responses.
As history has demonstrated, countless models and concepts have been proposed to
explain the pathophysiological abnormalities of asthma and also to explain the
complexity of asthma as a disease. However, a unifying explanation for asthma and its
heterogeneity remains elusive. One acceptable description is of a heterogeneous disease
with multiple phenotypes and endotypes, involving a plethora of susceptibility genes
(Table 1) in combination with multiple environmental stimuli and associated with
inflammation that can either be TH2-driven or non-TH2 mediated (Figure 1.1).
Therefore, given such a complex description, it is not surprising that the many models
and concepts have also become increasingly complex in their attempt to describe asthma
pathogenesis. Despite the considerable progress that has been achieved, the inability to
define a cause of asthma highlights the need to investigate alternative concepts that
might contribute to a better comprehension of disease pathogenesis.
Table 1: Asthma susceptibility genes with the associated functions and pathway
Susceptibility gene Associated function / pathway References
GSTM1 Environmental and oxidative stress — detoxification
Hatsushika, K. et al.(2007)
FLG Epithelial barrier integrity Palmer, C.N. et al (2006)
IL10 Immuno-regulation Guglielmi, L. et al (2007)
CTLA4 T-cell-response inhibition and immune-regulation Jones, G. et al.(2006)
IL13 TH2 effector functions Maier, L.M. et al (2006)
IL4 TH2 differentiation and IgE induction Imboden, M. et al. (2006)
CD14 Innate immunity — microbial recognition
Bernstein, D.I. et al. (2006)
SPINK5 Epithelial serine protease inhibitor Hubiche, T. et al. (2007)
ADRB2 Bronchial smooth-muscle relaxation Leung, T.F. et al.(2007)
HAVCR1 T-cell-response regulation — HAV receptor
Page, N.S. et al (2006)
LTA Inflammation Mak, J.C. et al. (2007)
TNF Inflammation Munthe-Kaas, M.C. et al. (2007)
GPRA Regulation of cell growth and neural mechanisms
Booth, M. et al. (2006)
NAT2 Detoxification of drugs and carcinogens Batra, J. et al. (2006)
FCERIB High-affinity Fc receptor for IgE Kim, Y.K. et al. (2007)
CC16 Epithelium-derived anti-inflammatory protein
Yang, K.D. et al. (2007)
IL18 Induction of IFNγ and TNF Imboden, M. et al.(2006)
STAT6 IL-4 and IL-13 signalling Yabiku, K. et al. (2007)
NOS1 Nitric oxide synthesis — cell–cell communication
Martinez, B. et al. (2007)
IL4R α-chain of the IL-4 and IL-13 receptors Yabiku, K. et al. (2007)
CCL11 Epithelium-derived eosinophil chemoattractant
Raby, B.A. et al.(2006)
ACE Monocyte, T-cell and eosinophil chemoattractant
Tanaka, K. et al. (2006)
TBXA2R Inactivation of inflammatory mediators Ku, M.S et al. (2006)
TGFB1 Smooth-muscle contraction, inflammation
Kim, S.H. et al. (2007)
ADAM33 Immuno-regulation, cell proliferation Van Eerdewegh, P. et al. (2002)
Figure 1.1: Schematic diagram of the factors contributing to the heterogeneity and complexity in asthma pathogenesis and diagnosis.
The genetic susceptibility and environmental interactions which contribute to asthma as well as the key clinical features of severity such as symptoms,
exacerbations and lung function, inflammatory characteristics and their categorisation into associated phenotypes and division into endotypes are
illustrated. However, the phenotypes as well as the resulting endotypes and the interactions between them have yet to be fully understood.
Early onset ASTHMA
Symptoms
Exacerbations
Lung function
TH2 mediated Non T
H2 mediated
Phenotype A
Phenotype B
Phenotype C
Phenotype D
Endotype 1
Endotype 2
Endotype 3
Endotype 4
Endotype 5
Late onset
Genetic
Susceptibility Environment
Looi 2015
6
1.2 Recent advances in the pathophysiology of asthma
The lack of a clear understanding of the pathobiology of asthma has resulted in
relatively few new therapies over the past 4 decades. Beyond the simple ‘allergic’ and
‘inflammatory’ paradigms, the recognition that individuals with similar adaptive
immune profiles might or might not develop asthma has led to investigations of whether
intrinsic abnormalities within the respiratory airways exist. Evidence from genome wide
association studies (GWAS), such as those performed by Koppelman and colleagues,
reported a link between airway hyper-responsiveness, a fundamental feature of asthma
and the gene encoding protocadherin-1 (PCDH-1), an adhesion molecule on the airway
epithelium. In addition, various genes that are expressed on the respiratory epithelium
have also been shown to be associated with asthma (Moffatt et al. 2007; Koppelman et
al. 2009; Willis-Owen et al. 2009). As a majority of these genes observed in these
GWAS studies associated with asthma are expressed within the airway epithelium
(Moffatt et al. 2010; Zhang et al. 2012), these observations support the notion that
asthma occurs as a result of aberrant gene expression within the airway epithelium and
that epithelial cells play a pivotal role in the allergic response. Moreover, biopsy studies
in children with asthma have also demonstrated an impaired epithelium early in the
disease pathogenesis (Barbato et al. 2006; Turato et al. 2008) as well as the crucial role
in the development of immune responses within the lungs (Hammad and Lambrecht
2008). These findings further strengthen the idea that asthma occurs as a result of an
aberrant airway epithelium, rendering the epithelium vulnerable to various insults.
The potential roles of the airway epithelium in asthma have been well-documented and
characterised in numerous studies (Bucchieri et al. 2000; Holgate et al. 2000; Chakir et
al. 2001). There has been evidence to suggest that asthma is primarily a disorder of the
airway epithelium and that altered function of the epithelial barrier properties are
closely associated with the developmental onset and subsequent clinical manifestations
of asthma, rather than an allergic pathway. Moreover, an impaired epithelial barrier
function would result in the airway being susceptible to early life bacterial or viral
infections. This, in turn, acts as a stimulus to prime immature immune cells to mount an
Looi 2015
7
inflammatory response and sensitisation towards various allergens, as suggested in a
study by Medzhitov and Janeway, where the innate immune system provided the
additional signals required by the adaptive immune system to mount an appropriate
response towards pathogens rather than self or harmless environmental antigens
(Medzhitov and Janeway 2000).
Prolonged epithelial susceptibility towards various environmental insults such as
allergen, pollutant exposure and viruses, coupled with a dysregulated repair response
would lead to a chronic asthma setting involving the persistence of airway inflammation
after the removal of the insult leading to subsequent airway wall remodelling. Increased
deposition of extracellular matrix on the basement membrane and a continued physical
distortion of the epithelium due to repeated bronchoconstriction would ultimately lead
to further remodelling. An exaggerated process of airway remodelling may eventually
result in partially reversible airflow obstruction and an accelerated decline in lung
function, aspects often seen in fatal asthma (James et al. 1989; Carroll et al. 1993).
Collectively, these studies provide considerable data to support a fundamental role of
the respiratory epithelium in the onset and development of asthma. The epithelium
could be central in the disease initiation and propagation as the airway surface is the
primary contact for inhaled allergens within the lungs. Moreover, an airway epithelium
with impaired barrier function would result in increased susceptibility and passage of
airborne allergens into the sub-epithelial components of the respiratory airways such as
basement membrane, fibroblasts and endothelium, which, in turns, exacerbates the
disease state. This provides the rationale for further examination into the role of the
respiratory epithelium in the development of asthma.
Looi 2015
8
1.3 Respiratory epithelium
1.3.1 Form and function of the epithelium
The human airway epithelium is a dynamic environment composed of at least eight
morphologically different epithelial cells types which can be classified into three broad
categories based on structural, biochemical and functional properties: basal, ciliated and
secretory (Spina 1998). Basal cells are commonly observed within the conducting
airways and past studies have shown a direct correlation with the number of basal cells
to decreasing airway size (Evans and Plopper 1988; Evans et al. 1990). Moreover, the
thickness of the conducting epithelium is also directly related to the percentage of
columnar cell attachment to the basement membrane via the basal cells (Evans and
Plopper 1988). Basal cells are the only cell type within the airway epithelium to be
directly attached to the basement membrane. This is achieved by the presence of hemi-
desmosomes that expresses the α6β4 integrin necessary for the firm attachment onto the
basement membrane (Evans et al. 1989). The basal cell, akin to the epidermal cell, is
postulated to be the precursor and / or progenitor cell which differentiates into either
mucous or ciliated cells (Boers et al. 1998).
The most common of the cell types present within the conducting epithelium are the
columnar ciliated epithelial cells, found on the topmost layer of the airway epithelium.
These cells account for greater than 50% of all epithelial cells and often originate from
either basal or secretory cells (Ayers and Jeffery 1988). Normally, columnar ciliated
cells would possess around 300 cilia on each cell, thus indicating their primary role in
the unidirectional transport of secreted mucous from the lung to the throat. Secretory
cells include both goblet cells as well as Clara cells. Goblet cells or otherwise known as
mucous cells, are identified by their electron-lucent acidic-mucin granules which are
secreted into the airways to entrap foreign inhaled pathogens or environmental particles
(Jeffery 1983; Jeffery 1991). It has been suggested that an average human trachea
consists of approximately 6800 goblet cells per mm2 of surface epithelium but in
Looi 2015
9
chronic airway inflammatory diseases such as asthma or bronchitis, mucous cell
hyperplasia or metaplasia occurs, leading to excess mucous production, a pathological
finding consistent with these diseases (Lumsden et al. 1984). Goblet cells are capable of
self-renewal and may also differentiate into ciliated columnar epithelial cells following
either a mechanical or a pathogen insult (Evans and Plopper 1988).
In humans, Clara cells are located within both the bronchial as well as the bronchiolar
airways and contain electron-dense granules. Clara cells have been shown to secrete
bronchiolar surfactants and specific anti-proteases such as the secretory leukocyte
protease inhibitor in order to regulate bronchiolar epithelial integrity and immunity as
well as to prevent excessive tissue damage caused by the secretion of harmful
proteinases from neutrophils during inflammation (De Water et al. 1986; Sallenave et
al. 1994). Furthermore, Clara cells are also capable of producing oxidases that
metabolises xenobiotic compounds such as aromatic hydrocarbons found in cigarette
smoke. Evidence has also suggested that Clara cells may in fact harbour stem cell
potentials and could act as progenitor cells for either mucous or ciliated cells (Hong et
al. 2001). These cells come together to form a pseudostratified layer that lines the
conducting airways beginning at the large airway epithelium and terminating at the
alveolar epithelium (Figure 1.2). These cells perform numerous important roles such as
regulating lung fluids, removal of inhaled particles, activating the different
inflammatory cells in response to injury and the secretion of various mediators to
regulate airway smooth muscles. Moreover, cells within the airway epithelium are
constantly renewed (Crystal et al. 2008) as it is also the primary interface between
noxious external environment stimuli and the lung milieu. Hence, any damage sustained
by the epithelium has the potential to not only cause inflammation, but also contribute
to the pathogenesis of major lung diseases such as asthma and chronic obstructive
pulmonary disorder (COPD). Although traditionally regarded to be an inert barrier
against the external environment, the airway epithelium, in recent years, has been
proven to play a central role in the control and modulation of various airway function
(Holgate 1998; Holgate et al. 2000; Knight 2001). Nevertheless, the most crucial role of
the airway epithelium is still protecting the lungs and airways against external stimuli.
This is often achieved through the interaction of different protective mechanisms,
Figure 1.2: Schematic of major cell types lining the respiratory airways. Within the bronchi, the predominant cell types are basal (B), ciliated
columnar (C) and goblet (G) cells. In the bronchioles, the cell types remain relatively similar except with more Clara cell (CL) type. As the bronchioles
merge with the alveolar epithelium, Type 1 (T1) and Type 2 (T2) cells become the major cell types. The endothelium (EN) provides a division between
the epithelium (EP) and the blood stream (BS). Neutrophils (N) are shown to migrate through the blood stream to the lumen through the endothelium,
endothelial basement membrane (BM) and interstitial tissue (IN) containing both type I fibroblast (F), which are parallel to the epithelium and type II
myofibroblast that are perpendicular to the epithelium and lastly, through the epithelium via a series of ligand-receptor interactions.
Bronchi Bronchioles Alveoli
EP
IN
EN
BS
EN
B
BM
BM
F
G C
CL T 2
T 1
R N
Adapted from Tam et al, Therapeutic Advances in Respiratory Disease, 2011
Looi 2015
10
however, a physical barrier provided by various junctional complexes and supported by
an efficient and highly effective mucociliary clearance remains the most pivotal defence
against external injurious stimuli.
1.3.1.1 Mucociliary clearance
One of the critical functions of the airway epithelium is the wave-like clearance of
inhaled particles. Mucous producing goblet cells together with surfactant secreting
Clara cells and ciliated columnar epithelial cells, work in collaboration in the trapping
and removal of inhaled foreign particles from the airway lumen (Kilburn 1968). Surface
epithelial goblet cells secrete the predominant form of mucin in the human airway,
MUC5AC while MUC5B is mainly secreted by the mucous cells of the submucosal
glands (Hovenberg 1996; Wickström 1998). Regulation of mucin production can be
attributed to various factors ranging from inflammatory mediators such as
lipopolysaccharides (LPS) (Smirnova et al. 2003), growth factors such as epidermal
growth factor (EGF) or transforming growth factor – α (TGF-α) (Takeyama et al. 1999)
to environmental insults such as cigarette smoke (Shao et al. 2004). Producing the right
amount of mucin, coupled with the viscoelasticity of the mucous is critical in the
maintenance of efficient mucociliary clearance. The viscoelastic mucous layer, which
floats on the periciliary layer tethered to the apical cell surface by different mucins and
glycolipids (Sheehan et al. 2008), acts as a fluid reservoir that removes or donates liquid
to maintain homeostatic airway surface liquid (ASL) level that approximates the total
height of the cilia (Tarran et al. 2001; Leopold et al. 2009). In normal airways, the
cystic fibrosis transmembrane conductance regulator (CFTR), together with epithelial
sodium channel (ENaC) allows for the combination of chloride secretion and sodium
reabsorption to favour a healthy ion composition and ASL depth (Zeitlin 2008). This
enables proper ciliary function for an effective mucociliary clearance. However, a
dysregulation between the chloride secretion and sodium reabsorption often observed in
chronic airway diseases such as cystic fibrosis could result in a decrease of the ASL
depth, leading to mucosal glands hypertrophy and subsequently, excessive production
of mucous resulting in airflow obstruction and increased bacterial colonisation within
the respiratory airways (Zeitlin 2008). Deficient mucociliary clearance could also be a
Looi 2015
11
direct result of ciliary dysfunction. Individuals with ciliary dysfunction usually have
normal amounts of mucous production but suffer from a compromised mucociliary
clearance due to a defective ciliary beat pattern (Bush et al. 1998; Noone et al. 2004).
Despite compromised mucociliary clearance occurring in different respiratory diseases,
the airway epithelium, through the various junctional protein complexes, persevere to
provide a highly regulated and impermeable barrier in the defence of the lungs and
airways.
1.3.1.2 Junctional protein barrier
The airway epithelium, being the primary interface between the lung milieu and the
external environment, forms a complex barrier to provide the first line of physical
defence against airborne pathogens. The AECs, which adhere tightly to one another to
form an epithelial sheet lining the entire mucosal surface in contact with inhaled air,
play pivotal roles in providing a physical barrier in defending the lungs and airways.
They are cemented to each other through the formation of adhesive cell – cell contact
junctions that include tight junctions (TJs), adherens junctions (AJs), gap junctions and
desmosomes. These junctional proteins come together to form the epithelial junctional
complex (Farquhar and Palade 1963) that completely surround the cell. These junctions
play a crucial role in the formation and maintenance of epithelial barrier by mediating a
tight seal between adjacent epithelial cells (Farquhar and Palade 1963). This results in a
continuous junctional belt that interconnects with neighbouring cells which then acts as
a barrier or fence to selectively regulate the passage of ions, solutes and cells through
the paracellular space (Roche et al. 1993). Although their ultrastructure from freeze-
fracture electron microscopy suggests that these junctional complexes form stable
structures, studies have indicated that they are highly dynamic complexes capable of
various functions even in fully polarised epithelia (Nelson 2003; Irie et al. 2004;
Gumbiner 2005). These junctional complexes can be broadly defined into three
categories which consist of structural proteins needed for the initiation of the junctions,
peripheral plaque proteins associated with the actin cytoskeleton and the signalling or
polarity proteins necessary for polarisation of the epithelium. Among the myriad of
junctional complexes, TJs, which are located at the most apical point of the epithelial
Looi 2015
12
cell and are closest to the airway lumen, serve to demarcate the boundary between the
apical surface and the basolateral domains of the cell. The common model of a TJ
structure is of a stable multi-protein complex composed of integral and peripheral
membrane proteins (Tsukita et al. 2001; Aijaz et al. 2006). The major types of integral
proteins are grouped according to the number of transmembrane domains they contain,
four pass transmembrane proteins including claudins, occludin and tricellulin while
single pass transmembrane proteins include junctional adhesion molecules (JAMs) as
well as the Coxsackie and adenovirus-associated receptor (CAR) (Balda and Matter
2008).
The claudin family, which consists of at least 24 members, have been shown to be
incorporated into TJ strands when observed in cultured epithelial cells (Furuse et al.
1998). Despite studies showing their role in maintaining epithelial integrity (Tsukita and
Furuse 2002), their role in controlling transepithelial permeability remains unclear
because the functional characteristics of the majority of claudins are still unknown at
present. The identification of claudins by Furuse and colleagues advanced the
understanding of TJ structure (Furuse et al. 1998; Furuse et al. 1998). Associations of
the other integral membrane proteins with claudin further complicate the TJ structure.
Occludin, the earliest transmembrane protein to be identified, has also been implicated
in regulating the permeability properties of the TJ seal, in particular, with the regulation
of size-selective paracellular diffusion (Furuse et al. 1993; Balda et al. 1996; McCarthy
et al. 1996; Balda et al. 2000). Although TJs without occludin are relatively uncommon,
the physiological function of occludin in the TJ complex remains relatively unclear. In
epithelial tissues lacking occludin, TJ strands as well as barrier function were observed
to be present, however, in mice that were deficient in occludin expression, different
phenotypes ranging from growth retardation, deposition of minerals within the brain to
sterility seems to suggests barrier impairment to a degree (Saitou et al. 2000).
Interestingly, in studies performed using Madin-Darby canine kidney (MDCK) cells
with knocked down occludin expression, it appeared that the role of occludin within the
TJ complex remains elusive, independent of the traditional TJ barrier function that is
crucial in the communication of apoptosis to adjacent cells (Yu et al. 2005). Tricellulin,
also a tetrapass transmembrane protein, was recently identified as having structural
Looi 2015
13
similarity to occludin (Ikenouchi et al. 2005). However, in contrast to occludin and the
claudin family, tricellulin is only enriched at the tricellular TJs, where it acts to
reinforce the barrier function of the epithelium. A study by Ikenouchi et al using RNA
interference to suppress tricellulin expression resulted in barrier impairment of TJs,
which indicates the important role tricellulin has in junctional formation (Ikenouchi et
al. 2005). Underlying this membrane domain is the cytoplasmic plaque consisting of a
network of densely packed peripheral adaptor proteins which connects the integral
membrane proteins to the underlying actin cytoskeleton as well as various signalling
proteins. Within TJs, the cytoplasmic plaque functions to regulate adhesion, paracellular
permeability and the transmission of signals from cellular junctions to the interior to
control various cellular processes such as migration and gene expression. An important
and probably the most studied plaque component is the peripheral adaptor protein tight
junction protein-1 (TJP-1) or otherwise identified as zonula occludens-1 (ZO-1). Zonula
occludens-1 has a typical functional property and domain structure of scaffolding
proteins that contains multiple sites of protein-protein interaction, including 3 PDZ and
a single SH3 domain through which they bind to a number of cytoskeletal, signalling
and membrane proteins (Guillemot 2008; Fanning and Anderson 2009). Tight junction
components are also capable of engaging in interactions with proteins of other
junctional complexes and this is thought to be crucial for the proper organisation of the
integral membrane structures as well as the regulation of junction assembly, function
and signalling to the cell interior (Matter and Balda 2003; Köhler and Zahraoui 2005;
Fanning and Anderson 2009) (Figure 1.3). Located directly below the TJs are the
adherens junctions, which perform various functions including the initiation and
stabilisation of cell-cell adhesion, regulation of the actin cytoskeleton, intracellular
signalling as well as transcriptional regulation. Among the many single pass
transmembrane proteins, the most notable is E-cadherin, which belongs to the classical
cadherin family of calcium-dependent adhesion proteins. Classical cadherins have 5
characteristics extracellular cadherin domains that form trans-cadherin interactions
between adjacent cells to initiate cell-cell adhesion and formation of adherens junctions.
The cytoplasmic domain of E-cadherin binds to proteins that are responsible for the
regulation of E-cadherin endocytosis, recycling and degradation, intracellular signalling,
gene transcription and control of the actin cytoskeleton. Desmosomes, located around
Figure 1.3: Illustration of the complexity between protein-protein interactions at
the tight junction complex. Interactions between proteins such as claudins, occludins
and ZO are essential for the structural integrity of the tight junction while other
interactions between ZO and ZONAB regulate signalling pathways which originate
from the tight junction. Interactions involving cingulin potentially regulate the
transcriptional up-regulation of claudins and occludin, leading to eventual tight junction
assembly. Similarly, interactions between Par3 or Par6 and aPKC can also lead to tight
junction assembly. aPKC, atypical protein kinase C; CDK4, cell division kinase 4;
MUPP1, multi-PDZ domain protein 1; PALS1, protein associated with Lin seven 1; Par,
partitioning defective; PATJ, PALS1-associated tight junction protein; RalA, Ras-like
GTPase; Tiam1, T-lymphoma invasion and metastasis; ZO, zonula occludens; ZONAB,
ZO-1-associated nucleic acid–binding protein.
CDK4 RalA
ZO-2
ZO-1
ZO-3
Cingulin
PATJ
PALS1
ZONAB
Cdc42
MUPP1
Rac
aPKC
Par6 Par3
Tiam1
Actin cytoskeleton
Occludin
Claudins
Transmembrane proteins Peripheral proteins G-protein / regulator Kinase / Phosphatase Other signalling protein
Adapted from Shin et al, Annual Review of Cell & Developmental Biology, 2006
Looi 2015
14
the midsection of the cell, are intercellular junctions that provide robust adhesive bonds
between epithelial cells to give mechanical strength to the epithelium. Gap junctions,
which can be found at the basolateral side of the epithelial cells, are specialised cell –
cell channels that permits the diffusion of small metabolic solutes, ions and other
molecules between adjacent cells (Mese et al. 2007).
The physical barrier and fence function of the epithelium have allowed for the
association of epithelial junctional complexes as robust, rigid structures that
determinedly prevent unwanted molecular traffic and although their primary function of
providing a physical barrier remains unchanged, studies over the years have suggested
that these junctional complexes could be more dynamic in their barrier roles and
responses than previously thought (Madara 1990; Rosenblatt 2001; Matter and Balda
2003; Pilot 2005; Wang and Cheng 2007; Shen et al. 2008). Moreover, several
published reports have suggested that the composition of the junctional associated
protein complexes is flexible and is dependent on diverse factors ranging from the state
of junctional assembly to the proliferation state of the cells (Aijaz et al. 2006; Ebnet
2008). Hence, a model of TJ complexes based on a flexible network of junctional
protein strands would fit the concept of a dynamic epithelium, thereby explaining the
size selective paracellular diffusion process allowing the movement of solutes through
controlled regulation of the TJ proteins between adjacent cells. This evidence in
conjunction with the concept of a dynamic and flexible junctional complex may
suggests the importance of the airway epithelium in the regulation and modulation of
airway responses to external stimuli.
1.3.2 Airway responses in the asthmatic epithelium
Airway inflammation is increasingly gaining recognition as a key component of asthma
and represents a complex interaction of inflammatory cells and airway cells and has
been postulated that a multitude of immune cells comprising predominantly of
eosinophils, neutrophils, lymphocytes, monocytes, mast cells and basophils, with
eosinophilic infiltration being the most commonly observed (Kay 2001), are capable of
orchestrating airway inflammation. However, although there is much evidence to
Looi 2015
15
support the notion that airway inflammation drives the remodelling process within the
airway walls, there are accumulating data to support the argument that an intrinsic
abnormality of airway architecture or function might initiate or perpetuate airway
inflammation.
Airway inflammation in asthma is often restricted to the conducting airways, however,
as the disease becomes more chronic, the inflammatory infiltration extends to involve
the trachea, larynx, small airways and occasionally, the alveoli (Kraft et al. 1996).
Progression of the inflammatory process to the smaller airways only occurs as the
severity of the disease increases and becomes chronic in nature but otherwise, remains
largely restricted to the larger airways (Kraft et al. 1999). Inflammation of the
submucosa dominates in the large airway whereas in small airways, the inflammatory
response seems to be predominantly external of the airway smooth muscle (Haley et al.
1998). The exact location of airway inflammation remains controversial, however, it has
been suggested that all airway cells are capable of active participation in the
pathogenesis of airway inflammation in asthma (Springall et al. 1991; Corrigan and Kay
1992; Vignola et al. 1993; Sousa et al. 1997). Inflammatory cells, in conjunction with
mesenchymal cells, create a complex cellular network that directly regulates the
inflammatory and reparative changes within the airway (Brewster et al. 1990). These
changes are often observed in the majority of individuals with differing severity levels
of asthma and can eventuate in the progression towards airway remodelling to cause
permanent tissue alterations in both large and small airways.
Asthma is an inflammatory disease often associated with changes in the usual structure
of the airway walls. These architectural changes are collectively termed airway
remodelling. Airway remodelling in asthma usually involves changes within the airway
epithelium, with characteristic shedding of columnar epithelial cells coupled with
abnormal changes in the goblet cell, eventually resulting in mucus plugging. The most
prominent remodelling changes can usually be seen beneath this augmented epithelium,
ranging from smooth muscle hyperplasia, increased angiogenesis and innervation to the
thickening of the sub-basement membrane layer involving deposition of interstitial
collagen. Together, these changes affect the airway structure as well as its mechanical
Looi 2015
16
and functional properties and have been thought to be a major contributor to the
pathophysiology of the episodic airway dysfunction described as airway hyper-
responsiveness (AHR). Airway remodelling is a primary and consistent component of
paediatric asthma with various studies describing increased deposition of collagen and
the thickening of the lamina reticularis, angiogenesis and increased smooth muscle
(Roche et al. 1989; Aikawa et al. 1992; Kuwano et al. 1993; Li and Wilson 1997).
Although there exists a paucity of evidence of reticular basement membrane thickening
in wheezing infants, airway walls have been reported to be abnormal by several studies
in infants who subsequently develop asthma. Despite the conventional paradigm that
airway remodelling is a consequence of a chronic inflammation, recent evidence has
suggested that these remodelling processes could occur as a result of an initial stimulus
and there are cogent evidence that indicates airway remodelling occurs in early
childhood (Fedorov et al. 2005; Barbato et al. 2006). Although certain components of
airway remodelling are reversible through therapeutic interventions or spontaneously,
the more prominent abnormalities observed within the epithelium, smooth muscle,
vasculature and extracellular matrix are most likely to be sustained and refractory to
pharmacologic interventions. An elevation in airway smooth muscle (ASM) mass
caused either by hypertrophy, hyperplasia or increased deposition of extracellular
matrix is a crucial component of a remodelled wall in asthmatic airways. Despite a lack
of understanding in the precise mechanisms behind this increased mass, it has been
postulated that increased proliferation rates could potentially contribute to the
development of ASM thickening (Hirst et al. 2004).
Various models have been used to characterise airway remodelling in asthma ranging
from post-mortem examination of lung tissues to murine models. Observations of lung
tissues taken from autopsies have demonstrated profound occurrences and changes in
airway architecture in those that have died from asthma when compared to those with
asthma but died from other causes and those without asthma (Bousquet et al. 2000).
Biopsy specimens obtained from living individuals with asthma, when compared to
healthy controls, have demonstrated typical histopathological changes associated with
asthma such as reversibility of some changes with therapeutic intervention, changes in
non-inflammatory airway wall structure and alterations within the distribution of
Looi 2015
17
inflammatory cells (Van Den Toorn et al. 2001). Although these studies provide an
insight into the process of airway remodelling, they are often limited due to their highly
invasive nature to obtain a relatively small quantity of viable target tissue. Despite the
incidence of substantial epithelial damage in asthma remaining controversial, there is no
doubt that the asthmatic epithelium is intrinsically abnormal both in vivo and in vitro
(Bousquet et al. 2000; Kicic et al. 2006).
1.3.3 Intrinsic abnormalities of the asthmatic epithelium
As the initial interface between the environment and the sub-mucosa, the airway
epithelium represents the primary point of defence for the lung from the various
constituents of the environment ranging from pollutant to viruses. Injury on the airway
epithelium results in a sequence of inflammatory and cell signalling events that would
lead to either regeneration or repair. These two processes differ in that regeneration
returns the epithelium to its normal structural and functional capacity while repair
results in increased stability of the epithelium but does not confer similar structural and
functional capacity before epithelial damage. In order to comprehend the complex role
of the epithelium in asthma, studies utilising mucosal biopsies and primary cultures of
AECs obtained from donors with asthma have provided insights as well as to
demonstrate that the airway epithelium is inherently abnormal.
A seminal study by Kicic and colleagues reported that AECs obtained from children
with asthma demonstrated both biochemical and functional differences when compared
to healthy cohorts (Kicic et al. 2006). Results from their study indicate no difference in
the release of the pro-inflammatory cytokines interlukin-1β (IL-1β), interlukin-8 (IL-8)
and sICAM-1 in the different donor cohorts. These findings are in contrast to those
previously reported, which showed increased levels of ICAM-1 (Vignola et al. 1993;
Manolitsas et al. 1994), IL-1 (Borish et al. 1992; Sousa 1996) and IL-8 (Marini and
Marini 1992) production by the bronchial epithelium in donors with asthma. Kicic et al
also reported an increased in prostaglandin E2 and IL-6, which correlates with other
studies indicating the epithelial cells were not of a pro-inflammatory phenotype.
Moreover, Kicic et al demonstrated that the asthmatic epithelial cells had a greater
Looi 2015
18
proliferative capacity with greatly elevated levels of proliferating cell nuclear antigen
(PCNA) mRNA which corroborated with their reported increase in epidermal growth
factor (EGF) release despite a lack of epidermal growth factor receptor expression being
reported.
Kicic et al also showed in their study that the release of transforming growth factor β1
(TGF-β1) was markedly diminished, suggesting abnormal differentiation might occur,
which could relate to the lower expression of cytokeratin-19 expression in the asthmatic
cells. Furthermore, Gras and colleagues, in their study to investigate the feasibility of
utilising air-liquid interface (ALI) cultures of bronchial epithelium derived from
endobronchial biopsies of individuals with differing severity of asthma, demonstrated
that both inflammatory and morphological imbalances initially observed in biopsy
samples obtained from patients with mild to severe asthma continued to exist within the
reconstituted epithelial ALI cultures throughout the entire differentiation process.
Moreover, results from the study performed by Gras et al also indicated that the
epithelium of individuals with severe asthma produced significantly elevated levels of
mucin and interlukin-8 (IL-8) but diminished levels of lipoxin A4, an anti-inflammatory
factor when compared to those with mild asthma or healthy controls. Observations from
the study conducted by Gras et al indicated not only the feasibility and relevance of ex
vivo ALI cultures of bronchial epithelium obtained from endobronchial biopsies, but
also demonstrating that inherent phenotypic differences exists within the asthmatic
epithelium (Gras et al. 2012).
In another study, Stevens et al, in their study, reported that bronchial epithelial cells
obtained from donors with asthma require a significantly longer time to achieve repair
upon wounding in contrast with cells obtained from healthy donors. They also reported
that mRNA expression of the plasminogen activator inhibitor-1 (PAI-1) was greatly up-
regulated within the asthmatic cells compared to healthy ones and that protein
expression was also similarly increased. These data, taken in conjunction with a reduced
rate of proliferation in both asthmatic and healthy cells following gene silencing and
mechanical wounding demonstrate that bronchial epithelial cells obtained from donors
with asthma are inherently dysfunctional in the capability to repair wounds despite
Looi 2015
19
elevated PAI-1 levels, which have been shown to play pivotal roles in both proliferation
and repair of healthy cells (Stevens et al. 2008). Findings from a recent study by Kicic
et al showed the diminished ability of bronchial epithelial cells obtained from donors
with asthma to secrete the extracellular matrix (ECM) component of fibronectin (FN),
providing further evidence that the asthmatic epithelium have an impaired repair ability
(Kicic 2010).
Freishtat and colleagues, similarly showed that following mechanical wounding, the
rate of regeneration in the asthmatic epithelia was less efficient compared to healthy
epithelia. Moreover, the asthmatic epithelia secreted more TGF-β1, IL-1β, 10, 13 and
had markedly less mitotic cells that were more dyssynchronously distributed along the
cell cycle in contrast to healthy epithelia (Freishtat et al. 2010). These results further
support the previous findings demonstrating an impaired repair process is inherent to
bronchial epithelial cells obtained from donors with asthma and further supports the
concept that the asthmatic epithelium is intrinsically different from a healthy
epithelium. Furthermore, these results also demonstrated that commercial cell lines and
adult AECs may not always be appropriate when attempting to comprehend paediatric
airway diseases.
Although there have been significant advances over the past few decades in our
knowledge regarding the human airway epithelium, little is still known about whether
the abnormality in epithelial barrier is representative of a gene-environment interaction,
with a genetic diathesis to asthma or atopy eventually resulting in a change in epithelial
cell response during early life to potential environmental stimuli such as respiratory
viruses. In addition, respiratory viruses have been shown to be the most common trigger
for asthma exacerbations in both adults and children (Nicholson et al. 1993; Johnston et
al. 1995). However, a paucity of data on the interaction between the known intrinsic
abnormalities of the epithelium with respiratory viruses provides the rationale to further
investigate the barrier role, in particular, the tight junctional complexes of the
epithelium as a potential influence in asthma exacerbations following early life
respiratory viral infections.
Looi 2015
20
1.4 Respiratory viruses and asthma
Although airway infection during infancy and early childhood was initially perceived to
confer protection against the development of atopic asthma (Ball et al. 2000), a growing
body of evidence has resulted in a progressive shift in this concept which suggests that
respiratory viral infections as well as the resulting innate immune response can be
attributed to or associated with most acute asthma exacerbations, up to 80-85% in
children and around 60% in adults (Gama et al. 1989; Pattemore et al. 1992; Nicholson
et al. 1993; Johnston et al. 1995; Papadopoulos et al. 2003; Tan et al. 2003; Dahl et al.
2004; Sly et al. 2006). Rhinovirus (RV), coronavirus, influenza virus, adenovirus,
parainfluenza virus and respiratory syncytial virus (RSV) have been shown to be the
most common viruses to trigger wheezing within infants and cause the exacerbation of
asthma symptoms in older children and adults, however, many other factors such as age,
gender and race could determine the susceptibility towards different viral infections.
Viral infections of the respiratory tract are among the most common debilitating illness
worldwide and have been reported as a major trigger of asthma exacerbation in both
adults and in children (Lambert and Stern 1972; Minor et al. 1974; Johnston et al. 1995;
Busse et al. 2010). Early on in life, many children have wheezing episodes that are
closely related to respiratory infections, however, in most cases, wheezing episodes
associated with respiratory tract infection will diminish with age. Exceptions occur
where early life wheeze episodes can indicate the onset of asthma in certain groups of
susceptible individuals. The advancement and development of highly specific and
sensitive diagnostic methods have led to improved detection of respiratory tract viruses,
thus allowing a clear insight into the relationship between viral infections and asthma
exacerbations. Viral respiratory tract infection can have a profound effect in individuals
with established asthma and recent use of molecular diagnostic techniques such as
reverse transcription polymerase chain reaction (RT-PCR) to either supplement or
replace conventional virology techniques have reported an increase in detection of the
common viruses among adults and children (Nicholson et al. 1993; Johnston et al.
1995; Wark et al. 2002). Moreover, separate studies performed have now shown
respiratory viral infections to be associated with 80 – 85% of acute asthma
Looi 2015
21
exacerbations in children (Johnston et al. 1995) and 45% in adults (Nicholson et al.
1993). Although it has been recognised for many years that respiratory viruses can
trigger asthma exacerbations, accumulating evidence from recent studies have not only
highlighted the importance of respiratory viruses but also demonstrated that the cause of
most cases of virus induced asthma is linked to respiratory viruses such as respiratory
syncytial viruses (RSV), influenza A virus (IAV) and human rhinoviruses (HRV)
(Bizzintino et al. 2011; Fujitsuka et al. 2011; Hasegawa et al. 2011).
1.4.1 Influenza virus
Influenza viruses, classified as a RNA virus of the family orthomyxoviridae, are a major
determinant of morbidity and mortality in many worldwide epidemics or pandemics.
Influenza viruses can be classified into three immunologic types, designated A, B and
C. Each of the immunologic types of influenza viruses has one species, namely
Influenza A, B and C virus respectively. All three species are capable of infecting
humans, however, of importance is the influenza A species due to its continual
occurrence of antigenic mutation, making influenza A virus (IAV) the most virulent
human pathogen among the three influenza types capable of causing severe and often
devastating disease outbreaks. All three influenza types are similar in structure and
composition, usually observed to be spherical, between 80 – 120 nm in diameter and are
made up of a viral envelope containing two main types of glycoproteins,
haemagglutinin (HA) and neuraminidase (NA) wrapped around a central core. The
central core contains the viral genome, which is comprised of 7 – 8 pieces of single
stranded, often segmented negative sense RNA, encoding for various proteins needed
for the viral replication process.
Influenza virus infection is extremely common and is often associated with substantial
morbidity and mortality worldwide, and especially in individuals with existing asthma,
as observed by Jain et al, in their study during the 2009 H1N1 influenza A virus
pandemic (Jain et al. 2009). However, the exact mechanism in which influenza viruses
contributes to asthma exacerbations remains unclear. It has been proposed that the
AECs may play a role in the exacerbation of asthma as AECs are often the primary sites
Looi 2015
22
for most viral infections, including influenza virus infections. As demonstrated in
several studies, infection of the AEC would ultimately lead to the activation of various
signalling cascades which then initiates expression of a range of cytokines and
chemokines (Buchweitz et al. 2007; Jewell et al. 2010; Tate et al. 2011). The eventual
destruction of the AEC following infection, in conjunction with a pro-inflammatory
immune response are the major contributing factors to the influx of inflammatory cells
and AHR often associated with asthma exacerbations. A study by Park et al showed that
individuals with asthma have increased levels of IL-13, a key cytokine involved in the
formation of goblet cells leading to increased mucin production, as well as a pro-fibrotic
repair of the airway epithelium and diminished production of IFN-γ. In addition, various
studies performed which utilised AECs of healthy and individuals with asthma have
revealed that AECs obtained from individuals with asthma demonstrated augmented
expression of genes involved with airway inflammation, airway epithelial repair process
and remodelling, all of which could contribute towards viral-induced exacerbations of
asthma (Kicic et al. 2006; Stevens et al. 2008; Kicic 2010).
Airway hyper-reactivity and airway inflammation are widely thought to be orchestrated
by allergen specific TH2 cells in conjunction with basophils and eosinophils, which are
commonly present in the lungs of the majority of individuals with asthma, especially
those with allergic asthma. However, non-TH2 factors such as IFN-γ and neutrophils can
also be frequently observed within the lungs of individuals with severe or
corticosteroid-resistant asthma. It has been commonly accepted that these non-TH2
cytokines often antagonise TH2-mediated allergic diseases. In two separate studies by
Doyle et al and Román et al, they were able to demonstrate that following respiratory
infection with influenza virus eventually led to an increased production of local IFN-γ
concentrations by CD4+ and CD8+ T cells (Doyle et al. 1999; Román et al. 2002).
Furthermore, Dahl et al were able to show that infection with IAV would initiate an
intense IFN-γ response within the lungs which then leads to the development of robust,
TH1-polarising dendritic cells (DCs). The study then advanced to utilise a TH2-
dependent mouse model of allergen-induced lung inflammation to demonstrate the
ability of these robust DCs in strengthening subsequent immunity by reinforcing both
TH1 and TH2 immunoglobulins and cytokines production (Dahl et al. 2004). Moreover,
Looi 2015
23
in a recent study performed by Chang and colleagues to define the various inflammatory
cell types and processes involved in viral-induced asthma, they established and
subsequently infected an experimental murine model with IAV of subtype H3N1
(Chang et al. 2011). Their results showed that IAV infection effectively induced airway
inflammation and airway hyper-reactivity, independent of TH2-mediated or adaptive
immunity. This was achieved through the production of IL-33 in alveolar macrophages
and its corresponding receptor, ST2 in conjunction with the innate lymphoid cell
population termed “natural helper cells” (Chang et al. 2011).
Although the actual characteristics of these natural helper cells are still being delineated,
their contribution towards the development of airway hyper-reactivity and their
activation by IAV subtype H3N1 via an IL-33 dependent, fully innate pathway
demonstrates the multiple pathways influenza virus could potentially lead to the
development and exacerbation of airway inflammation. However, despite the
progression in our understanding on how viral-induced airway inflammation is
generated and the likelihood a majority of these pathways coexisting and synergistically
causing airway hyper-reactivity, inflammation and ultimately asthma, the precise
underlying mechanism remains to be established.
1.4.2 Respiratory syncytial virus (RSV)
Respiratory syncytial virus (RSV), classified as a paramyxovirus, is a ubiquitous
pathogen in all human population and is closely related to the parainfluenza virus,
measles and mumps (Cane 2001). The genome of the virus consists of a single stranded
RNA containing only 10 genes which encodes for 11 proteins, 9 of which are structural
proteins and surface glycoproteins and the remaining 2 directly involved in the
replication process upon viral entry into the host cell (Cane 2001; Hall 2001). Two
different strains of RSV, A and B, have been identified, with both being infectious but
one strain being dominant during an epidemic in a particular region. Respiratory
syncytial virus epidemics changes with the onset of different seasons, generally
occurring with either the start of autumn or winter. Due to the universal presence of
RSV within the community, virtually all children would have had an infection by the
Looi 2015
24
age of 2. Infections in infants less than two months of life are less common, however,
infections rates climb rapidly, reaching a peak during the third and fourth months of life
(Glezen et al. 1986). Repeated infections are common in all age groups and previous
infections do not confer immunity or resistance against subsequent infections even in
sequential years. No particular age group is exempt from the risk of RSV infection,
however, certain risk factors such as pre-termed neonates, individuals with cystic
fibrosis, immune-suppressed patients, low socio-economic status, crowded living
conditions, exposure to indoor air pollution and a family history of asthma or atopy
have all been implicated in a more severe disease outcome.
Respiratory syncytial virus commonly causes upper respiratory tract infections (URTI),
which are characterised by rhinitis, cough and occasionally, fever. These indicators of
URTI usually precede those of the lower respiratory tract which can be characterised by
dyspnoea and difficulty in feeding. It has been postulated that infection of the airway
epithelia by RSV initiates an inflammatory response characteristic of bronchiolitis
through the release of initial inflammatory mediators such as tumour necrosis factor-α
(TNF-α), IL-8 and eotaxin (McNamara et al. 2004; McNamara et al. 2005). Although
studies have been performed to elucidate the specific contribution of the AECs using
murine models or immortalised cell lines, none have been able to accurately reflect the
actual infection process occurring in vivo. Nonetheless, a recent study by Fonceca and
colleagues utilised AECs obtained from children with RSV infection to examine and
compare the viral replication processes and AEC responses between primary airway
epithelial and immortalised cell line cultures. They reported that viral replication
cytotoxicity as well as inflammatory mediator production was higher in primary airway
epithelial cultures compared to the immortalised cell line culture. Moreover, they also
observed that IL-8 response within the primary airway epithelial cultures were similar in
magnitude to the clinical samples obtained from the lungs of children with current RSV
bronchiolitis (Fonceca et al. 2012). Hence, their results indicate the suitability of using
primary airway epithelial cultures due to the similarities with in vivo observations.
Another study by McNamara and colleagues also utilised similar methods to investigate
the role and interaction of the airway epithelium with RSV infections. Results from
Looi 2015
25
their study showed an elevated expression of both B cell activating factor of the TNF
family (BAFF) mRNA and protein were observed in the bronchoalveolar lavage (BAL)
as well as bronchial brushings from RSV infected infants. Furthermore, BAFF mRNA
and protein expression were also seen following in vitro infection of both the primary
airway epithelium culture as well as an immortalised cell line culture. Their data
showed that BAFF is a consistent feature of airway infection and seeks to postulate a
possible role for the airway epithelium in supporting the protective immune responses
within the lung (McNamara et al. 2013).
Accumulating evidence over the years have presented a strong association between
recurrent RSV infections that require hospitalisations during early life and the
progression to asthma in later years (Noble et al. 1997; Sigurs et al. 2000; Sigurs et al.
2005; Wu et al. 2008; Sly et al. 2010). In addition, separate independent prospective
studies have documented that approximately 50% of children who experienced severe
RSV related bronchiolitis were eventually diagnosed with asthma (Pullan 1982;
Bacharier et al. 2012). Krishnamoorthy and colleagues, in their study, utilised a murine
model to investigate whether early life infection with RSV would lead to the
impairment of the regulatory T cell function and eventually lead to an increase in
susceptibility to allergic asthma. They observed that following sensitisation to
ovalbumin (OVA), repeated infection of the infant mice successfully induced allergic
airway disease characterised by airway inflammation, AHR and higher allergen-specific
IgE compared to uninfected sensitised mice. Their findings established the capability of
a viral pathogen to target an immune-regulatory mechanism during early life to initiate
an effect on the development of asthma in later life (Krishnamoorthy et al. 2012).
1.4.3 Human rhinovirus
Human rhinoviruses (HRV), members of the Picornaviridae family are commonly
classified into two distinct groups based on their receptor utilisation. Generally, HRV
are classified into HRV-A which consists of 74 serotypes and HRV-B, containing 25
serotypes. Of the 74 serotypes of HRV-A, 11 serotypes attain entry into the cells via the
low density lipoprotein (LDL) receptor family. The remaining HRV-A serotypes and all
Looi 2015
26
serotypes of HRV-B utilise the intercellular adhesion molecule-1 (ICAM-1) for
infection. Data from recent studies performed worldwide (McErlean et al. 2008; Jin et
al. 2009; Miller et al. 2009) have identified additional serotypes of HRV and based on
the analysis of their entire genome sequences, these new HRV strains has been
classified as a unique group now designated as HRV-C (Palmenberg et al. 2009).
Although the receptor molecule for HRV-C has only been recently identified, it had
already been suggested that this group of HRV was capable of causing symptomatic
responses following infection (Gern 2010).
Human rhinoviruses are single stranded RNA viruses often implicated as a trigger for
acute respiratory tract illness and upper respiratory tract infection as well as their
resulting complications including chronic bronchitis (Lambert and Stern 1972; Stanway
1994), sinusitis (Turner et al. 1992; Gwaltney et al. 1994) and bronchial asthma
(Lambert and Stern 1972; Minor et al. 1976; Stanway 1994; Gwaltney 1995; Johnston
et al. 1995). The use of molecular diagnostic techniques such as RT-PCR has identified
HRV as the most commonly found respiratory tract virus during asthma exacerbations
and are detected 65% of the time (Nicholson et al. 1993; Johnston et al. 1995; Wark et
al. 2002; Grissell et al. 2005). Moreover, in an epidemiologic study performed by
Khetsuriani and colleagues, the only virus types significantly associated with asthma
exacerbation in children between the age of 2 and 17 were rhinoviruses (Khetsuriani et
al. 2007). As in vivo studies of HRV infection can be ethically challenging at times,
studies have utilised AECs obtained from either healthy or donors with asthma to
establish cell cultures for investigating the effects of HRV infection. Wark and
colleagues, in their study, examined viral replication and the innate responses to HRV
infection in AECs from donors with asthma. They reported that viral RNA expression,
together with the release of viral particles into the supernatant, were greater in the
asthmatic cultures than in healthy controls. They also postulated that an impaired viral
induced interferon-beta (IFN-β) expression could be linked to an enhanced viral
replication within asthmatic cultures (Wark et al. 2005). In a separate study, Contoli and
colleagues also showed that a lack of interferon-lambda (IFN-λ) expression by HRV
infection highly correlated with the severity of HRV induced asthma exacerbations as
well as viral load in experimentally infected human volunteers (Contoli et al. 2006).
Looi 2015
27
Collectively, these observations of diminished responses by impaired innate immune
cells could thus be associated with increased susceptibility to HRV infection, leading to
increased viral replication, ultimately modulating airway inflammation through the
recruitment of various immune cells to cause an increase in the release of inflammatory
mediators, resulting in further asthma exacerbation.
As the airway epithelium is the initial contact point with the inhaled air, HRV infection
predominantly occurs within the airway epithelium of the upper respiratory tract and
occasionally, the lower respiratory tract. The lack of a suitable animal model of HRV
infection has led to studies utilising in vitro primary AECs from healthy and donors
with asthma to understand the mechanisms of airway inflammation and asthma
exacerbation following experimental HRV infection. These studies have examined the
production of pro-inflammatory substances, chemical mediators and adhesion molecules
in different cells of the lungs (Wark et al. 2005; Bochkov et al. 2010; Cakebread et al.
2011).
Major and minor serotypes of HRV are capable of infecting primary AEC cultures by
binding to the ICAM-1 or LDL receptor respectively. Production of pro-inflammatory
mediators such as IL-1α, IL-1β, IL-6, 8, 11, TNF-α, RANTES, GM-CSF would occur
following HRV infection. Although a study by Wegner et al have shown that the up-
regulation of the ICAM-1 receptor following chronic antigen challenge increases the
cell susceptibility towards HRV infection (Wegner et al. 1990), a study by Wark et al to
characterise the variability in the response of primary AECs to infection with different
HRV strains showed contrasting data (Wark et al. 2009). They reported that the minor
group HRV appeared to cause a more aggressive infection with intense release of
inflammatory mediators leading to a strengthened antiviral IFN-β response associated
with increased cell apoptosis and consequently, reduced viral replication (Wark et al.
2009). They also reported that primary AEC cultures from donors with asthma were less
capable of responding to a HRV infection possibly due to the impaired IFN-β response.
Their data suggests the existence of considerable diversity in the response to different
HRV strains, most notably between the major and minor groups (Wark et al. 2009).
Looi 2015
28
Viral infections have also been demonstrated to affect the barrier function of AECs. Yeo
and Jang examined the effects of HRV infection on nasal epithelial barrier function and
observed that post HRV infection, mRNA expression of TJ and adherens junction
proteins were reduced when compared to mRNA expression of the control group.
Protein expression was similarly observed to be reduced in the HRV infected cells
compared to non-infected control cells (Yeo and Jang 2010). They indicate that HRV
infection has the propensity to decrease expression of junctional protein complexes to
exert potentially detrimental effects on the nasal epithelial barrier function. However,
their study utilised cells obtained from the nasal passages and thus, might not accurately
reflect the bronchial airway setting following HRV infection. A study by Sajjan et al
demonstrated the capability of HRV infection in the disruption of barrier function of
polarised AECs obtained from tracheal trimmings of donor lungs during transplantation
(Sajjan et al. 2008). They reported a loss of the zonula occludens-1 (ZO-1) TJ protein
complexes following HRV infection and an increased in the paracellular permeability of
fluorescein isothiocynate-inulin (FITC-inulin), suggesting the ability of HRV to disrupt
epithelial barrier function in vitro. Although evident that HRV infection has the
proclivity to disrupt epithelial barrier function, there exists, fundamental gaps in our
understanding on the effects of HRV infection on the barrier function of an epithelium
that is already inherently dysregulated.
Of all observations on the aetiology of asthma exacerbations in children, HRV were by
far the most numerically important virus type, accounting for approximately 65% of all
infections detected. Hence, HRV infections can be considered as a major cause of
asthma exacerbation and therefore, the most appropriate virus type to utilise with which
to investigate the interaction with AECs and elucidate the pathogenesis of acute asthma
exacerbations. Although studies performed have suggested a close causal association
between respiratory viruses and asthma exacerbation (Johnston et al. 1995; Johnston et
al. 1996; Freymuth et al. 1999; Rakes et al. 1999; Chauhan et al. 2003) there are still
considerable gaps in our knowledge on the subsequent effects of viral infection, in
particular, HRV infection on the barrier integrity of the paediatric asthmatic epithelium
due mainly to the lack of suitable donor samples and to a lesser extent, a suitable
method of sampling from the respiratory airways.
Looi 2015
29
1.5 Assessing airway integrity
The interactions between viral infection, immunity, inflammation and remodelling has
been central to a plethora of asthma research over the years, however, attempts at
understanding the events occurring in the asthmatic epithelium, particularly in children,
have been severely hampered by the difficulty in obtaining relevant target organ tissue.
The use of animal models as a surrogate to comprehend the multifaceted aetiologies of
asthma has often been the topic of considerable debate (Pabst 2003; Corry and Irvin
2006; Shapiro 2006; Krug 2008; Shapiro 2008). Despite the controversy often
surrounding the use of animal models, they have proven to be an invaluable
experimental tool for the in-depth comprehension of disease mechanisms at a cellular
and molecular level which is otherwise, not possible in humans due to obvious ethical
reasons. Although currently constrained, ethically derived human samples through
either indirect or direct sampling of the airways for the establishment of cell cultures are
continuously gaining momentum. Sampling from the airways has major advantages as
well as its limitations. Hence, there is no optimal sampling or assessment process and
the choice to utilise one methodology over the other depends entirely upon the aims of
the study. Whatever the methodology employed, it is essential that the process is safe,
reliable, easily reproduced and with a high degree of sensitivity in the detection of
minor changes.
1.5.1 Animal models
Animal models of respiratory diseases are probably the most extensively used and
characterised in terms of the inflammatory and remodelling processes (Bartlett et al.
2008; Fattouh et al. 2008; Gueders et al. 2009). Models of acute and chronic diseases
have been widely used in investigating the molecular and cellular mechanisms
underlying the pathogenesis of various respiratory diseases such as asthma, cystic
fibrosis and chronic obstructive pulmonary disorder (COPD). Animal models are often
categorised into “small animal models”, comprising of rodents or rabbits and “large
animal models” which include cats, dogs, sheep and horses. Advantages of using small
Looi 2015
30
animal models include ease of handling, widespread availability and ability to remove
many of the immunological complexities of airway diseases through genetic
manipulations (Kips et al. 2003). Several studies have shown the feasibility of using
small animals such as murine models for the evaluation of allergic airway inflammation
(Malm-Erjefalt et al. 2001; Zhou et al. 2005; Bartlett et al. 2008) and airway hyper-
responsiveness (Hamelmann et al. 1997; Kline et al. 1998; Burchell 2009; Zosky 2009)
in asthma. Assessment of airway inflammation and hyper-responsiveness involves the
initial challenge of mice (previously sensitised to ovalbumin (OVA)) with OVA and
subsequently exposing them to either viral or allergen challenge. Airway hyper-
responsiveness can be assessed post viral or allergen challenge by using a low-
frequency forced oscillation technique to measure the partitioned components
representing the airways and lung parenchyma which involves the measurement of the
respiratory system input impedance (Zrs) in mice that have been anaesthetised,
tracheostomised, and ventilated (Zosky et al. 2004). Bronchoalveolar lavage (BAL) can
be collected following viral or allergen challenge for inflammatory cells or cytokines
quantification and antibody counts while blood leukocytes collected can be stimulated
with known mediators to observe for leukocyte responses such as degree of granulation
and granule morphology using transmission electron microscopy (TEM) (Malm-Erjefalt
et al. 2001). Mice lungs, bone marrow or nasal septum are also collected for
histopathological and immunohistochemical analysis of airway inflammation which
includes quantification of tissue or bone marrow leukocytes, TEM analysis of
intracellular distribution of eosinophil peroxidise activity as well as evaluating
ultrastructural features of eosinophil degranulation activity (Malm-Erjefalt et al. 2001;
Bartlett et al. 2008). Although the use of these murine models provide significant
insights into the synergistic interaction between viral infection and the immunological
response and are useful in the investigation of asthma pathogenesis and viral
exacerbations of asthma, their use in accessing the airway integrity currently remains
limited.
Large animal models such as sheep often provide important insights into structural,
anatomical and physiological changes which are relevant to the human airways such as
assessing changes in lung morphology and function, bronchial responsiveness and
Looi 2015
31
airway inflammation (Hein and Griebel 2003; Koumoundouros et al. 2006; Kirschvink
2008; Krug 2008). For example, allergic airway responses in sheep, either acquired
naturally or through experimental inoculation with live Ascaris suum (Abraham et al.
1983), have been used for sustained investigations of lung function decline following
repeated exposure to the allergen (Koumoundouros et al. 2006). In addition,
bronchoscopic and bronchoalveolar lavage examination in post allergen challenged
large animals have demonstrated an increase of inflammatory cells such as neutrophils,
eosinophils and macrophages in the airways (Bosse 1987; Abraham et al. 1988).
Despite the ability to conduct long-term studies allowing for concurrent intra-subject
evaluation of functional, immunological and morphological changes, large animal
models are often extremely costly and have few, or limited immunological and
molecular probes for characterising allergic airway responses (Zosky and Sly 2007).
Currently, there is no large or small animal model that completely recapitulates the
anatomical characteristics of the human asthma disease, hence, the study design and
ultimate parameter outcomes will dictate the suitability of the animal model to be
utilised. Given the current ethical and biological constraints that limit human
investigation, the use of animal models to critically comprehend the mechanisms
underlying the onset of asthma will continue to be an invaluable tool bridging the gap
between the outcomes of in vitro cellular results and the extrapolation into the human
disease setting.
1.5.2 Cell culture models
In vitro models utilising immortalised cell lines or human derived primary AEC are
often the preferred method in understanding the complex and varied functions of the
asthmatic airway epithelium. Although lung or bronchial epithelial cell lines such as
A549, BEAS-2B and 16HBE14o- are readily available as they proliferate and divide
continuously, they seldom exhibit characteristics commonly observed in the in vivo
setting. Human derived primary AECs are often obtained through various indirect or
direct sampling methods and despite their limited proliferative capacity, they retain
certain characteristics of the original in vivo setting as well as the ability to differentiate.
Looi 2015
32
Hence, the use of human derived primary AECs to establish cultures would be a more
accurate reflection of the traits exhibited by epithelial cells in vivo. It is beyond the
scope of this review to comprehensively discuss each sampling methodology
individually and refer the reader to either eloquent reviews or key original articles
where relevant.
Indirect sampling involves the measurements of airway inflammation through sputum
(Pin 1992; Brightling et al. 2000), peripheral blood (Dahl 1993) or urine (Green et al.
2004). Direct sampling includes lungs unsuitable for transplants or cadaver sources
(Hackett 2008; Hackett et al. 2009), biopsies (De Jong et al. 1993), bronchoscopy and
its associated methods such as guided or non-bronchoscopy guided cytology bronchial
brushings. Primary AECs obtained from these direct sampling methods are routinely
cultured in submerged monolayers or at air-liquid interface (ALI) if a more
physiologically similar model is required (Bayram 1998; Devalia et al. 1999; Bucchieri
2002; Lordan et al. 2002; Doherty et al. 2003). These culture models have the
advantage of flexibility, ability to alter experimental conditions and increased
opportunities for investigating cellular mechanisms, application of therapeutic
intervention and epithelial barrier integrity assessment when compared to animal
models. In addition, they also allow for the study of epithelial cell function without
interference from other cell types or tissues such as macrophages, fibroblasts and
immune cells.
Primary AECs grown at air-liquid interface cultures (Figure 1.4) utilise a specialised
defined medium to derive a differentiated phenotype. These cultures often exhibit a
pseudostratified, polarised phenotype expressing ciliated and goblet cells, together with
mucous production (Jiang et al. 2001; Chan et al. 2010). Development of high
transepithelial electrical resistance (TEER) in fully differentiated cultures provides an
indirect measurement of the formation of junctional adhesions among cells and is often
used as an indicator of epithelial layer disruption (Pedemonte 1995). Human derived
primary AEC cultures have been utilised in numerous studies to investigate the
differences between healthy and asthmatic donors. Cultured epithelial cells obtained
from asthmatic donors have displayed augmented gene expression associated with
Figure 1.4: Schematic of air-liquid interface culture process. Cells are initially seeded into culture flasks (A) and upon confluence, expansion of
submerged culture is performed where cells are seeded onto the apical surface of a semi-permeable membrane of a cell culture insert and exposed to
culture medium on both apical and basolateral side (B). Once confluence is attained in the Expansion phase, the cells are ‘air-lifted’ where the medium
is only supplied to the basolateral chamber while the apical surface of the culture insert is exposed to air (C). This culture method mimics the
conditions found within the human airway and initiates differentiation towards a muco-ciliary phenotype. Differentiated cultures which exhibit a
pseudostratified epithelium are obtained following 21- 28 days incubation at air-liquid interface and can be maintained for extended lengths of time of
up to 6 months.
Pre-expansion Expansion
(Submerged) Differentiation
Submerged cultures Air-Liquid Interface (ALI) cultures
Paediatric pAECs in culture flasks
Expansion into culture inserts
‘Air-lift’ into air-liquid interface phase
A B C
Looi 2015
33
inflammation, repair and remodelling and have been shown to have an increased
proliferative capacity but a diminished rate of repair of a mechanical wound when
compared to cells obtained from a healthy donor (Kicic et al. 2006; Stevens et al. 2008;
Kicic 2010). Asthmatic epithelial cells, when cultured at air-liquid interface, have
shown to exhibit a less differentiated phenotype expressing more basal cells with
diminished junctional complexes formation (Hackett et al. 2011; Xiao et al. 2011).
Recent published reports have shown conflicting data between normal and asthmatic
cells. In their study, Hackett and colleagues (Hackett et al. 2011) reported no significant
differences in the TEER between normal and asthmatic cultures, however, in another
study, Xiao and co-workers have shown that asthmatic cultures had a lower TEER as
well as loss of TJs (Xiao et al. 2011). These differences may be due to the age of the
donors (young adults or children in the Hackett study versus adults in the Xiao study)
and / other source from which the epithelial cells were obtained (post mortem lungs
versus bronchial brushings). Although having differing observations, these studies have
served to highlight the importance and versatility of utilising culture AECs in the
investigation of respiratory epithelial barrier integrity.
Despite these discrepancies, the current literature suggests that primary AECs from
asthma donors, when cultured either monolayer or ALI, present with an intrinsically
different phenotype from healthy donors (Kicic et al. 2006; Stevens et al. 2008; White
et al. 2008; Kicic 2010; Hackett et al. 2011; Xiao et al. 2011). This further supports the
use of human derived primary AEC cultures in asthma research. However, despite the
accumulating data demonstrating that human derived primary AEC cultures can provide
a unique insight into the asthmatic epithelium, a vast majority of studies have
predominantly utilised cells obtained from adult donors Although crucial in allowing
the characterisation of the asthmatic phenotype, data generated from these studies are
less supportive when attempting to dissect and comprehend the underlying mechanistic
changes occurring within the paediatric asthmatic epithelium. At present, no study has
been attempted to investigate epithelial barrier integrity in paediatric asthma,
furthermore, there remains a paucity of data on paediatric airway epithelial barrier
integrity following viral exacerbations and the sustained effects on epithelial function.
Looi 2015
34
1.6 Summary
Asthma is among the most common, incurable, chronic conditions worldwide, affecting
both children and young adults and is estimated to affect 300 million people worldwide.
Often refractory to treatment in many and severe in a large number of the population,
asthma has traditionally been linked to an atopy, TH2-type T-lymphocyte cell driven
process which contributes to increasing chronicity of the inflammatory response. In
addition, there has been considerable emphasis on the role of the immune system in
asthma and as atopic asthma has generally been recognised as the most common asthma
phenotype, the most widely accepted concept is one of inflammation associated with
atopy. Consequently, majority of the research directed at comprehending asthma has
focussed on the development of atopy and the association with various clinical markers
of asthma such as airway hyper-responsiveness and inflammation. However, a succinct
review of the literature have reported that the TH2 inflammation paradigm have yet to
fully account for the pathobiology of asthma, thus suggesting the possibility of other
cellular and molecular mechanisms contributing towards asthma heterogeneity.
A recent shift in research focus has emphasised how the respiratory epithelium could
contribute to asthma heterogeneity. Over the decades, data obtained have seen a change
in the understanding of the role of the respiratory epithelium, from being a static
physical barrier against foreign invading particles, to one that is dynamic, versatile and
constantly reacting to the ever changing cascades of insults from the external
environment. Although evidence has shown that an abnormal epithelium is commonly
observed in asthma, relatively few studies have addressed whether these observed
abnormalities are actually intrinsic to asthma or a consequence of airway inflammation.
Current evidence has demonstrated that the asthmatic epithelium has intrinsic properties
such as vulnerability to injury, the ability to initiate and modulate inflammatory
responses, aberrant repair as well as an increased susceptibility to environmental
pathogens, which could contribute to the pathophysiology of asthma. Regulation of the
paracellular passage in the airway epithelium is achieved via TJ complex formation and
Looi 2015
35
through the limited studies performed, evidence have demonstrated compromised
integrity, disordered assembly as well as diminished expression of TJ complexes within
the adult asthmatic epithelium. However, there remains a paucity of comprehensive
assessments of epithelial TJ expression and barrier function within the paediatric
asthmatic epithelium.
In addition, respiratory viral infections, and in particular, human rhinovirus (HRV)
infection, which accounts for the majority of acute asthma exacerbations, have also been
shown to be associated with the disruption of specific airway epithelial TJ in healthy,
adult airway epithelium, resulting in increased permeability to environmental irritants,
antigens and pathogens. Although a seminal study have shown the translocation of
bacteria across the epithelial layer at points of TJ disassembly following HRV infection,
it remains unknown whether the epithelium in asthma is more susceptible to TJ
disassembly following HRV infection, thereby facilitating sensitisation from inhaled
haptens, allergens or pathogens. Collectively, the review of the literature has identified
significant gaps in the evidence regarding the expression of epithelial TJ and barrier
function within the paediatric airway epithelium in the presence or absence of atopy and
/ or asthma and most importantly, the impact of HRV infection on epithelial TJ
expression and barrier function. This provides the justification and rationale for the
following hypotheses.
Looi 2015
36
1.7 Hypotheses and research aims
To address the gaps within the evidence, this project seeks to examine the hypotheses
that, (1) epithelial barrier function is defective in children with asthma and (2) that this
defective barrier function in asthma is independent of atopy. Moreover, this project also
investigates the hypothesis that (3) the barrier function and epithelial integrity is
compromised to a greater extent by HRV in the asthmatic airway compared to healthy
airway. Therefore, the specific aims of the experiments described in this thesis were to:
1. Compare barrier characteristics of epithelium from healthy non-atopic (HNA),
healthy atopic (HA), non-atopic asthmatic (NAA) and atopic asthmatic (AA)
paediatric subjects.
2. Determine the effects of HRV infection on barrier characteristics of epithelium
from healthy non-atopic (HNA), healthy atopic (HA) non-atopic asthmatic
(NAA) and atopic asthmatic (AA) paediatric subjects.
Looi 2015
37
CHAPTER 2: General Materials and Methods
2.1 General Materials
All general reagents and chemicals utilised in the investigation are listed with their
supplier below. Specific materials are listed in their relevant chapters.
Material name, Supplier, Supplier’s origin (City/Town; State/County, Country).
0.22 µM filter, PALL, East Hills, NY, USA
25G & 27G needles, TERUMO, Macquaire Park, NSW, Australia
2 β-Mercaptoethanol, SIGMA, St. Louis, MO, USA
2 mM deoxyribonucleotide triphosphates (dNTPs), APPLIED BIOSYSTEMS, Foster
City, CA, USA
4′,6-diamidino-2-phenylindole (DAPI), SIGMA, St. Louis, MO, USA
4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), SIGMA, St. Louis, MO,
USA
10X RT-buffer, APPLIED BIOSYSTEMS, Foster City, CA, USA
Bovine pituitary extract (BPE), SIGMA, St. Louis, MO, USA
Bovine serum albumin (BSA), SIGMA, St. Louis, MO, USA
Bronchial epithelium basal medium (BEBM), LONZA™, Basel, Switzerland
Calcium chloride (CaCl2), SIGMA, St. Louis, MO, USA
Citric acid, SIGMA, St. Louis, MO, USA
Collagen S (Type 1), BD Biosciences, Franklin Lakes, NJ, USA
Dimethyl sulfoxide (DMSO), SIGMA, St. Louis, MO, USA
DRAQ5™ stain, BIOSTATUS, Shepshed, Leicestershire, UK
Dulbecco’s Modified Eagle Medium-High Glucose (DMEM-HG), INVITROGEN,
Melbourne, VIC, Australia
Eagle’s Minimum Essential Medium (EMEM), INVITROGEN, Melbourne, VIC,
Australia
Looi 2015
38
Epidermal growth factor (EGF), SIGMA, St. Louis, MO, USA
Epinephrine, SIGMA, St. Louis, MO, USA
Ethanol, LOMB Scientific, Taren Point, NSW, Australia
Ethylene diamine tetraacetic acid (EDTA), SIGMA, St. Louis, MO, USA
Ethylene glycol tetraacetic acid (EGTA), SIGMA, St. Louis, MO, USA
Fibronectin, SIGMA, St. Louis, MO, USA
Fluorescence mounting media, DAKO, Glostrup, Denmark
Fluorescein isothiocyanate-dextran 4 (FITC-dextran 4), SIGMA, St. Louis, MO, USA
Fluorescein isothiocyanate-dextran 20 (FITC-dextran 20), SIGMA, St. Louis, MO, USA
Foetal calf serum (FCS), SIGMA, St. Louis, MO, USA
Formalin (40% aqueous solution of formaldehyde), SIGMA, St. Louis, MO, USA
Fungizone, INVITROGEN, Melbourne, VIC, Australia
Gentamicin, INVITROGEN, Melbourne, VIC, Australia
Glucose powder, SIGMA, St. Louis, MO, USA
Glycerol, SIGMA, St. Louis, MO, USA
Glycine, SIGMA, St. Louis, MO, USA
Heparin sodium, MAYNE PHARMA, Mulgrave, VIC, Australia
Hydrochloric Acid (HCl) (32%), UNIVAR, Ingleburn, NSW, Australia
Hydrocortisone, SIGMA, St. Louis, MO, USA
Insulin, SIGMA, St. Louis, MO, USA
Inulin-FITC, SIGMA, St. Louis, MO, USA
Isopropyl alcohol, SIGMA, St. Louis, MO, USA
L-glutamine, INVITROGEN, Melbourne, VIC, Australia
Magnesium chloride (MgCl2), SIGMA, St. Louis, MO, USA
Magnesium sulphate (MgSO4), SIGMA, St. Louis, MO, USA
Methanol, ANALYTICAL SCIENCES, Patumwan, Bangkok, Thailand
Minimal Essential Medium (MEM), INVITROGEN, Melbourne, VIC, Australia
MEM Non-essential amino acids, GIBCO, Melbourne, VIC, Australia
Multiscribe, APPLIED BIOSYSTEMS, Foster City, CA, USA
Nalgene 1°C Mr Frosty freezing container, WESSINGTON CRYOGENICS, Houghton-
le-Spring, Tyne & Wear, UK
Nystatin, INVITROGEN, Melbourne, VIC, Australia
Looi 2015
39
Odyssey Blocking Buffer, LI-COR Biosciences, Lincoln, NE, USA
Penicillin Streptomycin (Pen Strep), INVITROGEN, Melbourne, VIC, Australia
Potassium chloride (KCl), SIGMA, St. Louis, MO, USA
Potassium dihydrogen phosphate (KH2PO4), BDH Lab. Supplies, Poole, Dorset, UK
Protease inhibitor cocktail, SIGMA, St. Louis, MO, USA
Proteinase K, SIGMA, St. Louis, MO, USA
Random Hexamers, APPLIED BIOSYSTEMS, Foster City, CA, USA
Recombinant human epidermal growth factor (EGF), SIGMA, St. Louis, MO, USA
RNase-free DNase, QIAGEN, Hilden, Germany
RNase inhibitor, APPLIED BIOSYSTEMS, Foster City, CA, USA
RPMI-1640 media, INVITROGEN, Melbourne, VIC, Australia
Sapphire 700™ stain, LI-COR Biosciences, Lincoln, NE, USA
Sodium bicarbonate (NaHCO3), SIGMA, St. Louis, MO, USA
Sodium chloride (NaCl), SIGMA, St. Louis, MO, USA
Sodium deoxycholate, SIGMA, St. Louis, MO, USA
Sodium dihydrogen phosphate (NaH2PO4), SCHARLAU CHEMIE S.A, Barcelona,
Spain
Sodium dodecyl sulphate (SDS), SIGMA, St. Louis, MO, USA
Sodium fluoride (NaF), SIGMA, St. Louis, MO, USA
Sodium hydroxide (NaOH), SIGMA, St. Louis, MO, USA
Sodium phosphate dibasic (Na2HPO4), SIGMA, St. Louis, MO, USA
Sodium pyrophosphate, SIGMA, St. Louis, MO, USA
Sodium pyruvate, SIGMA, St. Louis, MO, USA
Sodium orthovanadate (Na3VO4), SIGMA, St. Louis, MO, USA
Sudan-Black B, SIGMA, St. Louis, MO, USA
SYBR® Green PCR Master Mix, APPLIED BIOSYSTEMS, Foster City, CA, USA
Syringe (1 ml / 5 ml / 10 ml), TERUMO, Macquaire Park, NSW, Australia
Trans-retinoic acid, SIGMA, St. Louis, MO, USA
Transferrin powder, SIGMA, St. Louis, MO, USA
Tri-iodothyronine, SIGMA, St. Louis, MO, USA
Triton-X 100, SIGMA, St. Louis, MO, USA
Trizma base, SIGMA, St. Louis, MO, USA
Looi 2015
40
Trypan-Blue, SIGMA, St. Louis, MO, USA
Trypsin, SIGMA, St. Louis, MO, USA
Trypsin/Ethylenediaminetetraacetic acid (EDTA), SIGMA, St. Louis, MO, USA
Trypsin Neutralising Solution, LONZA, Basel, Switzerland
Tween-20, ICN BIOMEDICALS, Irvine, CA, USA
Ultroser-G, PALL BIOSEPRA, Cergy-Saint Christophe, France
2.2 Antibodies
2.2.1 Primary antibodies
Rabbit Anti-human Claudin (1:200), Life Technologies, VIC, Australia
Rabbit Anti-human Occludin (1:200), Life Technologies, VIC, Australia
Polyclonal Rabbit Anti-human Zonula occluden-1 (1:200), Life Technologies, VIC,
Australia
2.2.2 Secondary antibodies
Goat Anti-Rabbit IgG FITC Conjugate (1:100), SIGMA, St. Louis, MO, USA
Goat Anti-Mouse IgG FITC Conjugate (1:100), SIGMA, St. Louis, MO, USA
Goat Anti-Mouse IRDye® 800CW (1:800), LI-COR Biosciences, Lincoln, NE, USA
Goat Anti-Rabbit IRDye® 800CW (1:800), LI-COR Biosciences, Lincoln, NE, USA
Looi 2015
41
2.3 General Equipment
2.3.1 Autoclave
Sterilisation using an Atherton autoclave (Thornbury, VIC, Australia) of equipment was
performed at 121°C for 45 min and solutions at 121°C for 40 min when required.
2.3.2 Balances
All analytical and biochemical reagents were weighed out using an Ohaus Explorer®
Balance (Derrimut, VIC, Australia).
2.3.3 Bronchoscope
Bronchoscopy guided bronchial sampling was carried out using a Pentax® FI-10RBS
portable bronchoscope.
2.3.4 Bronchial brush
All bronchial brushings were collected using Olympus® BC-25105 brushes of 10mm
length and 2mm outer diameter (Macquarie Park, NSW, Australia).
2.3.5 Centrifuges
Centrifugation was performed using either an Eppendorf 5810R refrigerated Swing
Bucket Rotor or a 5415D mini-centrifuge (Hamburg, Germany). Cytospin
centrifugation was performed using a Hettich centrifuge from Andreas Hettich GmbH
and Company KG (Tuttlingen, Baden-Württemberg, Germany).
Looi 2015
42
2.3.6 Glassware
General glassware was procured from Schott (Frenchs Forest, NSW, Australia) and
Corning (Mount Martha, VIC, Australia). All glassware was washed in detergent
overnight, rinsed three times in tap water and once in deionised water. All equipment
used for culture purposes was sterilised in an autoclave.
2.3.7 Heating devices
Heating of samples or reagents to temperatures between 37°C and 100°C was
performed using a RATEK heating block (Boronia, VIC, Australia).
2.3.8 Incubators
All established mycoplasma-free cell cultures were maintained in a Panasonic CO2
incubator (Murarrie, QLD, Australia) in an atmosphere of 5% CO2 / 95% air. All
mycoplasma-free cell line cultures were maintained in a separate, identical incubator
with the same atmospheric conditions.
2.3.9 Infrared scanner
Detection of signal on microplates from In-Cell Western™ assays was achieved using a
LI-COR Odyssey infrared scanner (Lincoln, NE, USA). Scans were performed at 700
nm and 800 nm wavelengths as required. Quantification and data analysis was
performed using the associated Odyssey v.3.0 software.
2.3.10 Laminar flow cabinets
All cell culture was performed in a National Association of Testing Authorities (NATA)
Certified Laminar Flow Cabinet from AES Environment (Balcatta, WA, Australia).
Looi 2015
43
2.3.11 Microscope
A Leica Microsystems GmbH inverted microscope (Wetzlar, Hesse, Germany) and
Nikon® Eclipse Ti inverted microscope (Coherent Scientific, Hilton, Australia) with an
attached camera was used to observe cellular morphology and cell viability. A mercury
lamp attachment on the Nikon® Eclipse Ti inverted microscope was used to observe
fluorescently stained antibody conjugates on slides.
2.3.12 pH meter
A 3310 pH meter from Jenway (Gransmore Green Felsted Dunmow, Essex, England)
was used for all pH measurements. Calibration solutions were obtained from Scharlau
(Barcelona, Catalonia, Spain).
2.3.13 Pipettes
All volumes between 1 and 25 ml were measured using a Powerpette from Jencons
(Leighton Buzzard, Bedfordshire, England) and S1 Pipet Fillers from Thermoscientific
(Wilmington, DE, USA). Gilson micropipettes (Middleton, WI, USA) were used to
measure all volumes less than 1 ml. Finnpipette® multi-channels from Thermo
Labsystems (Helsinki, South Finland, Finland) were also used for work involving 96-
well microplates.
2.3.14 Plate readers
All spectrophotometric measurements between 400 nm and 600 nm were performed
using a Thermoscientific Multiskan FC microplate photometer (Wilmington, DE, USA).
Fluorescence measurements with excitation and emission wavelengths were performed
using a PerkinElmer Enspire® multilabel plate reader (Melbourne, VIC, Australia).
Looi 2015
44
2.3.15 Real Time Quantitative PCR (RT-qPCR)
Real time quantitative PCR (RT-qPCR) was performed on an Applied Biosystems ABI
Prism® 7300 (Foster City, CA, USA). Data analysis was performed using the software
program Sequence Detection System 1.9. A PTC-100 Thermal cycler from MJ Research
was used for reverse transcription of RNA to cDNA (Boston, MA, USA).
2.3.16 Semi-dry Western Blot Transfer
The Invitrogen iBlot® Transfer System (Melbourne, VIC, Australia) was used to
perform all semi-dry transfer of proteins from eletrophoresed gels during Western blots.
Pre-made “TOP Stack” consisting of copper cathode and “BOTTOM Stack” consisting
of copper anode and PVDF membrane purchased from Invitrogen® was used to perform
the transfer as per the manufacturer’s recommendations.
2.3.17 Spectrophotometer
A Thermoscientific NanoDrop 2000C spectrophotometer was used to assess the quality
and quantity of extracted ribonucleic acid samples (Wilmington, DE, USA).
2.3.18 Stirrer, shakers and rockers
For the agitation and mixing of solutions, a stirrer (Industrial Equipment and Control
PTY LTD, Melbourne, VIC, Australia), Ratek shaker (Boronia, VIC, Australia) IKA
vortex (Petaling Jaya, Malaysia) or Stuart® rocker (Barloworld Scientific Laboratory
Group, Rochester, NY, USA) were used.
2.3.19 Tissue culture and general plastic ware
All disposable plastic culture equipment was obtained from Sarstedt (Adelaide, SA,
Australia) or BD Biosciences (San Jose, CA, USA).
Looi 2015
45
2.3.20 Water bath
When specified, certain samples or reagents were thawed or warmed using a
Thermoline water bath (Smithfield, NSW, Australia).
2.4 General Buffers and Solutions
Where appropriate, solutions were sterilised either by autoclaving for 20 minutes at
120°C at 15 pounds per square inch or passed through a 0.22 µM filter.
2.4.1 General purpose
2.4.1.1 Double deionised water (ddH2O)
Double deionised water was prepared by passing distilled water through a Milli-Q water
purification system (Millipore, North Ryde, NSW, Australia).
2.4.1.2 Ethanol (95% v/v)
To make 1000 ml of 95% (v/v final) of ethanol, 950 ml of absolute ethanol was added
to 50 ml of ddH2O. The solution was stored at room temperature (RT) until required.
2.4.1.3 Ethanol (80% v/v)
To make 1000 ml of 80% (v/v final) of ethanol, 800 ml of absolute ethanol was added
to 200 ml of ddH2O. The solution was stored at RT until required.
2.4.1.4 Ethanol (70% v/v)
To make 1000 ml of 70% (v/v final) of ethanol, 700 ml of absolute ethanol was added
to 300 ml of ddH2O. The solution was stored at RT until required.
Looi 2015
46
2.4.1.5 Hank’s Balanced Salt Solution (HBSS)
To make 1000 ml of HBSS, 0.185 g of CaCl2, 0.097 g of MgSO4, 0.4 g of KCl, 0.06 g of
KH2PO4, 8 g of NaCl, 0.047 g of Na2HPO4 and 1 g of glucose was dissolved in 900 ml
of ddH2O. Solution pH was adjusted to 7.4 and the volume was made up to 1000 ml by
adding ddH2O. The buffer was autoclaved (Refer to 2.3.1) and stored at RT until use.
2.4.1.6 (HEPES) Buffered Saline Solution
A 10X stock of 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) was
prepared by dissolving 47.6 g of HEPES, 70.7 g of NaCl, 2 g of KCl, 1.7 g of glucose
and 10.2 g of Na2HPO4 in 800 ml of ddH2O. The solution pH was adjusted to 7.4 and
the volume was made up to 1000 ml by adding ddH2O. The buffer was autoclaved as
required and stored at RT until use. The stock solution was diluted 1 part to 9 parts
ddH2O before use.
2.4.1.7 Hydrochloric acid (HCl; 10mM)
To make a 10 mM HCl solution, 10 µl of 32% HCl was diluted in 9.99 ml of ddH2O to
a final volume of 10 ml and stored at RT.
2.4.1.8 Hydrochloric acid (HCl; 4mM)
To make a 4 mM HCl solution, 17 µl of 32% HCl was diluted in 50 ml of ddH2O and
stored at RT.
2.4.1.9 Neutral Buffered Formalin (NBF)
To make 1000 ml of NBF, 900 ml of ddH2O and 100 ml of formalin were combined
with 4 g of NaH2PO4 and 6.5 g of Na2HPO4. The solution was stored at 4°C until
required.
Looi 2015
47
2.4.1.10 Phosphate Buffered Saline (PBS)
A 10X solution of PBS was initially prepared by dissolving 80 g of NaCl, 2 g of KCl,
14.4 g of Na2HPO4 and 2.4 g of KH2PO4 into 1000 ml of ddH2O. The solution was then
diluted 1 part into 9 parts ddH2O for use. The PBS solution was autoclaved (Refer to
2.3.1) to ensure solution sterility for cell culture purposes.
2.4.1.11 Sodium dodecyl sulphate (SDS) solution (20% w/v)
To make 100 ml of 20% (w/v) SDS solution, 20 g of SDS was dissolved in 100 ml of
ddH2O using a magnetic stirrer and stored at RT.
2.4.1.12 Sodium fluoride solution (NaF, 1M)
To make 10 ml of 1 M NaF solution, 0.42 g of NaF was dissolved in 10 ml of ddH2O
and stored at RT until required.
2.4.1.13 Sodium orthovanadate solution (200 mM)
To make 50 ml of 200 mM sodium orthovanadate solution, 1.85 g of sodium
orthovanadate was dissolved in 50 ml of ddH2O using a magnetic stirrer and stored at
RT.
2.4.1.14 Sodium deoxycholate (10% w/v)
To make 100 ml of 10% (w/v) sodium deoxycholate, 10 g of sodium deoxycholate was
dissolved in 100 ml of ddH2O using a magnetic stirrer and stored at RT.
2.4.1.15 Tris Buffered Saline (TBS)
A 10X solution of TBS was prepared by dissolving 80 g of NaCl, 2 g of KCl and 30 g
of Trizma Base into 1000 ml of ddH2O and the pH adjusted to 7.4. The solution was
then diluted 1 part into 9 parts ddH2O for use and stored at RT.
Looi 2015
48
2.4.1.16 Tris-Hydrochloric acid (HCl; 0.5 M)
To make 100 ml of 0.5 M Tris-HCl solution, 6 g of Trizma-Base was dissolved and
made up to a final volume of 100 ml of ddH2O. The pH was adjusted to 6.8 and stored
at 4°C until required.
2.4.1.17 Triton X-100 (10% v/v)
To make 100 ml of 10% (v/v final) Triton X-100 permeabilisation solution, 10 ml of
Triton-X stock solution was added to 90 ml of 1X PBS (refer to 2.4.1.10). The
permeabilising solution was kept at RT and away from direct sunlight until required.
2.4.1.18 Tween-20 (20% v/v)
To make 100 ml of 20% (v/v final) Tween-20 wash solution, 20 ml of Tween-20 stock
solution was added to 80 ml of 1X PBS (refer to 2.4.1.10). The wash solution was
subsequently kept at RT and away from direct sunlight until required.
2.4.1.19 Carnoy’s Fixative Solution
To make 100 ml of Carnoy’s fixative solution, 60 ml of 100% ethanol was added to 30
ml of chloroform and 10 ml of glacial acetic acid. The fixative solution was
subsequently kept at RT and away from direct sunlight until required.
2.4.2 Cell culture
2.4.2.1 Media additives
2.4.2.1.1 Bovine pituitary extract (BPE)
A 100mg/ml stock of BPE was made by dissolving 10 g of BPE powder into 100 ml of
1X HEPES buffered saline solution (refer to 2.4.1.5). The solution was centrifuged at
10000g for 30 min, the supernatant collected, re-centrifuged and filter-sterilised before
being stored at -20°C.
Looi 2015
49
2.4.2.1.2 Bovine serum albumin (BSA) stock solution (1 mg/ml)
A 1 mg/ml stock solution of BSA was prepared by dissolving 100 mg of BSA powder
into 100 ml of 1X PBS (refer to 2.4.1.10). The solution was filter-sterilised before being
stored at -20°C.
2.4.2.1.3 Epidermal growth factor (EGF) (25 µg/ml)
A 25 µg/ml stock of EGF was made by dissolving 500 µg of EGF powder into 2 ml of
BSA (refer to 2.4.2.1.2) and 18 ml of 1X HEPES buffered saline solution (refer to
2.4.1.5). The solution was then filtered-sterilised before being stored at -20°C.
2.4.2.1.4 Epinephrine (1 mg/ml)
A 1 mg/ml stock of epinephrine was made by dissolving 50 mg of epinephrine powder
into a final volume of 50 ml of 10 mM HCl solution (refer to 2.4.1.7). The solution was
then filter-sterilised before being stored at -20°C.
2.4.2.1.5 Hydrocortisone (3.6 mg/ml)
To make 3.6 mg/ml stock of hydrocortisone, 72 mg of hydrocortisone powder was
dissolved into a final volume of 20 ml of 95% (v/v) ethanol (refer to 2.4.1.2). The
solution was then filtered-sterilised before being stored at -20°C.
2.4.2.1.6 Insulin (2 mg/ml)
To make a 2 mg/ml stock of insulin, 100 mg of insulin powder was dissolved into 50 ml
of 4 mM HCl (refer to 2.4.1.8). The solution was then filter-sterilised before being
stored at -20°C.
2.4.2.1.7 Trans-retinoic acid (1 µg/ml)
A 1 µg/ml stock of trans-retinoic acid was made by dissolving 50 mg of trans-retinoic
acid powder into 5 ml of dimethyl sulfoxide (DMSO). The solution was then filter-
sterilised before being stored at -20°C.
Looi 2015
50
2.4.2.1.8 Transferrin (5 mg/ml)
A 5 mg/ml stock of transferrin was made by dissolving 100 mg of transferrin powder
and 2 ml of BSA (refer to 2.4.2.1.2) into 18 ml of 1X HEPES buffered saline solution
(refer to 2.4.1.5). The solution was then filter-sterilised before being stored at -20°C.
2.4.2.1.9 3, 3’5-Triiodo-L-thyronine sodium salt stock (6.5 µg/ml)
A 6.5 µg/ml stock solution of 3, 3’5-Triiodo-L-thyronine sodium salt stock was made
by dissolving 100 mg of 3, 3’5-Triiodo-L-thyronine sodium salt powder into 1.54 ml of
DMSO. The solution was then filter-sterilised before being stored at -20°C. The
solution was diluted 1 part to 99 parts 1X HEPES buffered saline solution (refer to
2.4.1.5) before use.
2.4.2.1.10 Ultroser-G
To reconstitute the Ultroser-G serum supplement, 20 ml of sterile ddH2O was added to
the powder and dissolved with periodic agitation for 10 min at RT under sterile
conditions. The solution was then aliquoted into 4 ml vials and stored at 4°C until
required.
2.4.2.2 Cell culture media
2.4.2.2.1 16HBE14o- cell line culture medium
The 16HBE14o- cell lines were maintained in Minimum Essential Media (MEM)
containing Earle’s Salts, FCS (10% v/v final), L-Glutamine (1% v/v final) and
penicillin/streptomycin (1% v/v final). The components were added to a final volume of
500 ml of MEM under sterile conditions and the final solution stored at 4°C until
required.
Looi 2015
51
2.4.2.2.2 A549 cell line culture medium
A549 cell lines were maintained in RPMI-1640 containing FCS (10% v/v final),
gentamicin (1% v/v final) and penicillin/streptomycin (1% v/v final). The components
were added to a final volume of 500 ml of RPMI-1640 under sterile conditions and the
final solution stored at 4°C until required.
2.4.2.2.3 Caco-2 cell line culture medium
Caco-2 cell lines were maintained in Dulbecco’s Modified Eagle Medium-High
Glucose (DMEM-HG) containing FCS (10% v/v final), MEM non-essential amino acids
(1% v/v final) and penicillin/streptomycin (1% v/v final). The components were added
to a final volume of 500 ml of DMEM-HG under sterile conditions and the final
solution stored at 4°C until required.
2.4.2.2.4 HeLa Ohio cell line culture medium
HeLa Ohio cell lines were maintained in Eagle’s Minimum Essential Medium (EMEM)
containing FCS (10% v/v final), L-glutamine (1% v/v final), non-essential amino acids
(1% v/v final), penicillin/streptomycin (0.5% v/v final), sodium pyruvate (0.2% v/v
final). The components were added to a final volume of 500 ml of EMEM under sterile
conditions and the final solution stored at 4°C until required.
2.4.2.2.5 MRC-5 cell line culture medium
MRC-5 cell lines were maintained in Eagle’s Minimum Essential Medium (EMEM)
containing FCS (5% v/v final), L-glutamine (1% v/v final), non-essential amino acids
(1% v/v final), penicillin/streptomycin (0.5% v/v final), sodium pyruvate (0.2% v/v
final). The components were added to a final volume of 500 ml of EMEM under sterile
conditions and the final solution stored at 4°C until required.
2.4.2.2.6 NuLi-1 and primary airway epithelial cell culture growth medium
NuLi-1 modified human AECs and primary AECs were maintained in a Bronchial
Epithelial Basal Media (BEBM) containing the following additives; BPE (0.05 m/ml)
Looi 2015
52
(refer to 2.4.2.1.1), EGF (0.005 µg/ml) (refer to 2.4.2.1.3), epinephrine (0.5 µg/ml)
(refer to 2.4.2.1.4), hydrocortisone (0.5 µg/ml) (refer to 2.4.2.1.5), insulin (5 µg/ml)
(refer to 2.4.2.1.6), trans-retinoic acid (0.1 ng/ml) (refer to 2.4.2.1.7), transferrin (0.01
mg/ml) (refer to 2.4.2.1.8), 3,3’5-Triiodo-L-thyronine sodium salt stock (6.5 ng/ml)
(refer to 2.4.2.1.9), gentamicin (0.05 mg/ml), penicillin/streptomycin (20 U/ml),
fungizone (0.125 µg/ml), and Ultroser-G (2% v/v final) (refer to 2.4.2.1.10). The
components were added to a final volume of 500 ml of BEBM under sterile conditions
and the final solution stored at 4°C until required.
2.4.2.3 General purpose cell culture solutions
2.4.2.3.1 Fibronectin coating buffer
To make cell culture coating buffer, 1 mg of fibronectin was diluted in 10 ml of BEBM
at 37°C for 60 min to completely dissolve the powder. To this, 1 ml of collagen S and
10 ml of BSA stock (refer to 2.4.2.1.2) were added to a final volume of 100 ml of
BEBM under sterile conditions. The solution was filter-sterilised before use and stored
at 4°C away from light until required.
2.4.2.3.2 Cryopreservation medium
To make 1 ml of cryopreservation medium, 5% (v/v final) of DMSO and 25% (v/v
final) of FCS were added to culture media in which the cells were grown (refer to
2.4.2.2.1 – 2.4.2.2.5). NuLi-1 cryopreservation medium was made up of 10% (v/v final)
of DMSO, 30% (v/v final) of FCS added to culture media in which the cells were grown
(refer to 2.4.2.2.6). This solution was only used for the freezing down and storage of
immortalised cell lines and modified primary AECs as primary AECs cannot be
successfully frozen on a routine basis.
Looi 2015
53
2.4.2.3.3 Cell protein extraction buffer (CEB)
To make 100 ml of CEB, 1 ml of 0.5 M Tris-HCl (pH 6.8, refer to 2.4.1.16), 0.59 g of
NaCl, 0.037 g of EDTA, 0.892 g of sodium pyrophosphate, 0.038 g of EGTA, 100 µl of
1 M NaF solution (refer to 2.4.1.12) and 1 ml of 200 mM sodium orthovanate solution
(refer to 2.4.1.13) was dissolved in 70 ml of ddH2O. Solution pH was adjusted to 7.4 by
the addition of HCl drop-wise. Once pH was adjusted, 1 ml of Triton X-100, 10 ml of
glycerol, 500 µl of 20% SDS solution (refer to 2.4.1.11) and 5 ml of 10% sodium
deoxycholate solution (refer to 2.4.1.14) was added and dissolved. Final volume of the
solution was made up to 100 ml with the addition of more ddH2O and then aliquoted
and stored at -20°C until required.
2.4.3 Assays and associated solutions
2.4.3.1 In-cell Western™ solutions
2.4.3.1.1 Fixative solution
To make 50 ml of fixing solution, 5 ml of formalin was added to 45 ml of 1X PBS
(refer to 2.4.1.10). This solution was made up fresh and kept at RT prior to use.
2.4.3.1.2 Triton X-100 permeabilisation solution
To make 500 ml of 0.1% (v/v final) Triton X-100 permeabilisation solution, 5 ml of an
initially prepared 10% (v/v final) Triton X-100 solution was added to 495 ml of 1X PBS
(refer to 2.4.1.10). The permeabilising solution was subsequently kept at RT and away
from direct sunlight until required.
Looi 2015
54
2.4.3.1.3 Tween-20 washing solution
To make 1000 ml of the 0.1% (v/v final) Tween-20 wash solution, 5 ml of an initially
prepared 20% (v/v final) Tween-20 solution was added to 995 ml of 1X PBS (refer to
2.4.1.10). The wash solution was subsequently kept at RT and away from direct
sunlight.
2.4.3.2 Immunocytochemistry / histochemistry solution
2.4.3.2.1 Citrate buffer
To make 1000 ml of citrate buffer, 2.1 g of citric acid and 1 g of sodium hydroxide was
dissolved in 900 ml of ddH2O and the pH adjusted to 6.0. The solution was made up to
1000 ml with ddH2O and stored at RT until required for antigen retrieval in tissue
samples during immunohistochemistry.
2.4.3.2.2 Proteinase K
Lyophilised proteinase K was reconstituted by the addition of ddH2O to a final
concentration of 10 mg/ml, aliquoted and stored at -20°C. The stock solution was
further diluted in 1X PBS (refer to 2.4.1.10) to a final concentration of 36 µg/ml before
being added to slides for antigen retrieval during immunocytochemistry.
2.4.3.2.3 Sudan Black B solution
To make 100 ml of 0.5% (w/v final) Sudan Black B, 0.5 g of Sudan Black B powder
was dissolved in 100 ml of 70% ethanol (refer to 2.4.1.4). The resulting solution was
stored at RT until use.
Looi 2015
55
2.4.3.3 Transepithelial permeability solutions
2.4.3.3.1 Fluorescein isothiocyanate-dextran (FITC-dextran)
To make 10 ml of FITC-dextran (2 mg/ml), 20 mg of FITC-dextran of either 4kDA or
20kDa molecular weight was added to HEPES-HBSS (refer to 2.4.3.3.2) in a dark room
and allowed to dissolve. The solution was then aliquoted and stored at -20°C until
required.
2.4.3.3.2 HEPES buffered Hank’s Balanced Salt Solution (HEPES-HBSS)
To make 1000 ml of HEPES-HBSS, 0.35 g of NaHCO3 and 5.96 g of 4-(2-
hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) was dissolved in 990 ml of
HBSS (refer to 2.4.1.5). Solution pH was adjusted to 7.4 and the volume was made up
to 1000 ml by adding HBSS. The buffer was autoclaved as required (refer to 2.3.1) and
stored at 4°C until required.
2.4.3.4 Western Blot buffers
2.4.3.4.1 2-(N-morpholino)ethanesulfonic acid Sodium Dodecyl Sulphate (MES
SDS) Running buffer
2-(N-morpholino)ethanesulfonic acid (MES) SDS running buffer (Life Technologies
Novex BOLT®, Melbourne, Australia) was used with all Western blot pre-cast gels
electrophoresed using the BOLT® system. 1X MES SDS running buffer was prepared
by diluting 20X BOLT® MES SDS running buffer 20-fold with the addition of ddH2O
(refer to 2.4.1.1) prior to start of Western Blot.
Looi 2015
56
2.4.3.4.2 Transfer Buffer
Transfer buffer for wet transfer in Western Blots was prepared and stored as a 10X
stock solution. Stock solution was prepared by dissolving 150 g of glycine and 30 g of
Trizma Base in 1 L of ddH2O (refer to 2.4.1.1) and stored at 4°C until required.
Working solution of 1X transfer buffer was prepared by adding 200 ml of 100%
methanol to 100 ml of 10X transfer buffer followed by 700 ml of ddH2O to make up 1
L. The 1X transfer buffer was stored at 4°C initially and transferred to -20°C freezer for
30 min prior to use.
2.5 General Methodology
2.5.1 Cell line types
All experiments conducted in this study were performed utilising primary paediatric
AECs. Due to the limited availability of the primary cells, initial optimisation
experiments were performed on immortalised cell lines or modified primary AECs and
subsequently confirmed on primary paediatric AECs. Cellular material from cell line
cultures were also used for calibration, standardisation and experimental control
purposes as described in the relevant sections.
2.5.1.1 16HBE14o- cell line
An immortalised human bronchial epithelial cell line (16HBE14o-) was obtained from
Dr Dieter Gruenert (University of California, San Francisco, USA). This cell line was
originally established from normal bronchial epithelium and transformed using a Simian
Virus 40 (SV40) large T-antigen (Cozens et al. 1994). The cell line was maintained in a
defined growth medium (refer to 2.4.2.2.1) at 37°C in an atmosphere of 5% CO2 / 95%
air. 16HBE140- RNA was also used as a calibrator for gene expression measurement by
RT-qPCR. This cell line was tested fortnightly to ensure cultures remained cleared of
mycoplasma contamination.
Looi 2015
57
2.5.1.2 A549 cell line
The adenocarcinoma human alveolar basal epithelial cell line A549 was obtained from
The Lung Institute of Western Australia at Sir Charles Gardener Hospital (Perth, WA,
Australia). A549 cells were first isolated and cultured from an explanted cancerous
tumour tissue of a 58-year old Caucasian male and shown to exhibit squamous epithelial
cell like characteristics (Giard et al. 1973). The cell line was maintained in a defined
growth medium (refer to 2.4.2.2.2) and cultured at 37°C in an atmosphere of 5% CO2 /
95% air. A549 RNA was also used as a calibrator for gene expression measurement by
RT-qPCR. This cell line was tested fortnightly to ensure cultures remained cleared of
mycoplasma contamination.
2.5.1.3 Caco-2 cell line
The human epithelial colorectal adenocarcinoma cell line was obtained from American
Type Culture Collection (ATCC) (Manassas, VA, USA). Caco-2 cells were first
isolated and cultured from a colon carcinoma and were capable of being induced to
differentiate and polarised under specific culture conditions (Fogh and Trempe 1975).
The cell line was maintained in a defined growth medium (refer to 2.4.2.2.3) and
cultured at 37°C in an atmosphere of 5% CO2 / 95% air. Caco-2 cells have been widely
used as a model to predict permeability of solutes across the physical barrier due to the
ability to become polarised and were thus used for optimisation of experimental
protocols instead of primary paediatric AECs. This cell line was tested fortnightly to
ensure cultures remained cleared of mycoplasma contamination.
2.5.1.4 HeLa Ohio cell line
The human epithelial cervix carcinoma cell line was obtained from the European
Collection of Cell Cultures (ECACC) (Porton Down, Salisbury, UK). Hela Ohio cells
were first isolated and cultured from a cervix carcinoma and have been shown to be the
most commonly utilised immortalised cell line in various scientific research. The cell
Looi 2015
58
line was maintained in a defined growth medium (refer to 2.4.2.2.4) and cultured at
37°C in an atmosphere of 5% CO2 / 95% air. HeLa Ohio cells were used for the
propagation of human rhinovirus-1B (HRV-1B). This cell line was tested fortnightly to
ensure cultures remained cleared of mycoplasma contamination.
2.5.1.5 MRC-5 cell line
The human foetal lung fibroblast cell line was obtained from American Type Culture
Collection (ATCC) (Manassas, VA, USA). MRC-5 cells were first derived from a
normal lung tissue of a 14-week old male foetus. These fibroblast cells have been
shown to be capable of 42-46 population doublings before the onset of senescence. The
cell line was maintained in a defined growth medium (refer to 2.4.2.2.5) and cultured at
37°C in an atmosphere of 5% CO2 / 95% air. MRC-5 cells were used for the titration of
crude HRV-1B. This cell line was tested fortnightly to ensure cultures remained cleared
of mycoplasma contamination.
2.5.1.6 NuLi-1 cell line
The human airway epithelial (HAE) cell, NuLi-1 was obtained from American Type
Culture Collection (ATCC) (Manassas, VA, USA). NuLi-1 cells were first derived from
a normal lung of an adult patient via dual retroviral infection with HPV-16E6/E7-LXN
(Zabner et al. 2003). Consequently, NuLi-1 cells do not undergo growth arrest when in
cell culture due to exogenous expression of the telomerase and HPV-16 E6/E7 genes
and are capable of forming polarised differentiated epithelia which exhibits
transepithelial electrical resistance as well as maintenance of ion channel physiology.
This modified primary HAE cell was maintained in defined growth medium (refer to
2.4.2.2.6) and cultured at 37°C in an atmosphere of 5% CO2 / 95% air. This modified
primary AEC was tested fortnightly to ensure cultures remained cleared of mycoplasma
contamination.
Looi 2015
59
2.5.2 Immortalised cell line culture, sub-culture and cryopreservation
Frozen stocks of immortalised cell lines were stored at -180°C in cryopreservation
medium (refer to 2.4.2.3.2). When required, cells were revived by initial thawing at
37°C, diluted in 10 ml of appropriate pre-warmed defined culture medium followed by
centrifugation at 500 g for 7 min at 4°C. Following centrifugation, supernatant was
aspirated to remove residual DMSO and the cell pellet then re-suspended using the
appropriate pre-warmed defined culture medium. Ten microliters of cell suspension was
removed and the cells counted using a haemocytometer while viability was also
assessed via trypan blue staining. The cells were then seeded into a non-coated 25 cm2
culture vessel in 5 ml of appropriate pre-warmed culture media containing additives
(refer to 2.4.2.2.1 to 2.4.2.2.5). The culture vessels were subsequently maintained in an
incubator at 37°C at an atmosphere of 5% CO2 / 95% air. In culture expansion, cells
were initially washed with HBSS (refer to 2.4.1.5) and were detached from the culture
vessels by incubating with 0.25% Trypsin (w/v) / 0.05% (w/v) EDTA solution for 4 min
at 37°C. The culture vessel was then washed with the appropriate culture media and the
resulting cell suspension collected and centrifuged at 500 g for 7 min at 4°C. The
supernatant was then aspirated and the cell pellet re-suspended in the appropriate culture
medium. A total cell count and viability stain was also performed. Cells were then
plated into new culture flasks and incubated at 37°C in an atmosphere of 5% CO2 / 95%
air in the appropriate culture medium (refer to 2.4.2.2.1 to 2.4.2.2.5).
For future use of cell lines, stocks of each cell line were frozen down and subsequently
stored in liquid nitrogen tanks. Briefly, cells were detached from flasks as described
above and re-suspended in the appropriate culture medium (refer to 2.4.2.2.1 to
2.4.2.2.5). The resulting pellet obtained was re-suspended in 1 ml of cryopreservation
medium (refer to 2.4.2.3.2) and frozen in a Mr Frosty cryopreservation vessel at -80°C
for 24 h. This provides the critical -1°C / minute cooling rate required for successful cell
cryopreservation and recovery. The frozen cells were transferred to a liquid nitrogen
storage facility for long-term storage.
Looi 2015
60
2.5.3 Ethics approval
This study was approved by both the Princess Margaret Hospital for Children’s Human
Ethics Committee and the St John of God Hospital Health Care Ethics Committee for
the recruitment of AECs from children attending theatre for non-respiratory related
elective surgery at the respective hospitals (Refer to Appendix A - C).
2.5.4 Primary paediatric airway epithelial cells
Four cohorts of paediatric airway epithelial cells (pAEC) were used in this study: pAEC
from healthy non-atopic (HNA) and atopic (HA) children with no history of asthma,
pAEC from non-atopic asthmatic (NAA) and atopic asthmatic (AA) children with mild
asthma, who did not receive any corticosteroid therapy at least 1 month prior sampling.
Samples were collected from 133 subjects who were undergoing elective surgery for
non-respiratory conditions. Asthma was defined as clinician diagnosed asthma with a
documented wheeze in the past 12 months and confirmed with positive responses to
related questions on both the International Study of Asthma and Allergies in Childhood
(ISAAC) and American Thoracic Society (ATS) questionnaires (Ferris 1978; Asher et
al. 1995). Atopy was defined by a positive radioallergosorbent (RAST) test to a panel of
common allergens (Table 2), elevated plasma IgE levels and a history of hay fever and /
or eczema.
2.5.4.1 Primary airway epithelial cell isolation
Primary AECs were collected via either trans-laryngeal, non-bronchoscopic brushings
through an endotracheal tube or a bronchoscope-guided brushing of the tracheal
mucosa. Both the non-bronchoscopic brushing and the bronchoscope-guided techniques
were established in the laboratory in which this study was performed (Lane 2005; Kicic
et al. 2006; McNamara et al. 2008). For the non-bronchoscopic brushing technique,
once each patient was anaesthetised using sevofluorane and propofol, and intubated in
theatre, an unsheathed soft nylon bronchial cytology brush was advanced through the
endotracheal tube until the tip encountered airway wall resistance usually above the
Table 2: Radioallergosorbent test (RAST) to a panel of common allergens for determination of atopy
Mixed Allergen Test Elements
EX1 (Epidermal and Animal Protein Mix 1) Cat epithelia (Felis silvestris catus)
Horse dander (Equus caballus)
Cow dander (Bos Taurus)
Dog dander (Canis lupus familiaris)
GX2 (Grass Pollen Mix 2) Couch (Cynodon dactylon)
Rye (Lolium perenne)
Timothy (Phleum pretense)
Meadow (Poa pratensis)
Johnson (Sorghum halepense)
Bahia (Paspalum notatum)
MX1 (Mould Mix 1) Penicillium notatum
Cladosporium herbarum
Aspergillus fumigatus
Alternaria alternate
HX2 (House Dust Mite Mix 2) Dermatophagoides pteronyssinus
FX5E (Food Mix 5E) Egg white
Cow’s milk
Looi 2015
61
carina. Sampling occurred using a rotational movement of the brush rather than a
probing movement. Completion of sampling would see the cytology brush being
withdrawn from the endotracheal tube, the brush tip inserted and detached into cold
sterile collection media (RPMI-1640) containing 20% (v/v final) heat-inactivated FCS.
The brushing process was repeated with a second cytology brush tip which was then
detached into the same collection media.
In the bronchoscope-guided brushing technique, the unsheathed cytology brush was
passed down the instrument port of a portable intubation bronchoscope and kept
concealed within the bronchoscope tip. The patient’s vocal cords were sprayed with
lidocaine, after which the patient was hand ventilated with a bag and mask for
approximately 2 min prior intubation. The portable bronchoscope was then passed down
through a laryngeal mask airway (LMA), directed and positioned at a suitable site for
brushing beyond the lower edge of the vocal cords. Once positioned below the vocal
cords, the cytology brush was then advanced till resistance was encountered typically
above the carina region, similar to the blind brushing technique described above.
Rotational movement was performed to sample the cells and subsequently the cytology
brush tip was retracted to just beyond the tip of the bronchoscope. Both the
bronchoscope and the concealed cytology brush were then withdrawn together. The
cytology brush would then be pushed out from the bronchoscope and the brush tip
detached into sterile collection media. This procedure was repeated once more with a
second brush tip being detached into the same collection tube.
From both techniques, the collection tube, together with the brush tips were then
immediately processed by vortexing for 15 sec to dislodge the cells off the brush tips as
well as breaking up larger cell clumps. The brush tips were then removed into another
collection tube and the process repeated. Following this, the two collection media were
pooled, centrifuged at 500 g for 7 min at 4°C to pellet the cells and subsequently
resuspended in BEBM supplemented with growth additives (refer to 2.4.2.2.6). Cell
viability and yield was determined using a haemocytometer with trypan blue exclusion.
The cell suspension was then incubated on a petri dish pre-coated with a 1:500 dilution
of CD-68 antibody for 20 minutes at 37°C in an atmosphere of 5% CO2 / 95% air to
Looi 2015
62
remove macrophages. Following that, the cell suspension was first passed through a 25-
gauge needle followed by a 27-gauge needle for the separation of cell clumps. A
fraction of the cell suspension was seeded into a culture vessel (growth area 25 cm2)
pre-coated with fibronectin coating buffer (refer to 2.4.2.3.1) and maintained in a
Panasonic CO2 incubator in an atmosphere of 5% CO2 / 95% air and at 37°C. The
remaining cell suspension was centrifuged, the supernatant aspirated and the cell pellet
dissolved in 350 µl of QIAzol lysis reagent (QIAGEN, Hilden, Germany) for
subsequent RNA extraction.
2.5.4.2 Primary airway epithelial cell sub-culture
Established primary AEC cultures were expanded over 2 passages for downstream
experimentation. In culture expansion, cells were detached from the culture vessels by
initially washing them in HBSS (refer to 2.4.1.5) and incubating with 0.25% (w/v final)
Trypsin / 0.05% (w/v final) Ethylenediaminetetraacetic acid (EDTA) solution for 4 min
at 37°C. Trypsin neutralising solution (TNS) was added to halt the action of the
Trypsin-EDTA. The resulting cell suspension was centrifuged at 500 g for 7 min at 4°C
, upon which the supernatant was aspirated and the cell pellet resuspended in BEBM
supplemented with growth additives (refer to 2.4.2.2.6). The cell suspension was seeded
onto new culture vessels (growth area 25 cm2) similarly pre-coated with fibronectin
coating buffer and incubated at 37°C in an atmosphere of 5% CO2 / 95% air as
previously described (Kicic et al. 2006; Stevens et al. 2008; Kicic 2010; Sutanto et al.
2011)
2.5.4.3 Primary airway epithelial cell culture supernatant collection
Prior to the passage or harvesting of an established primary AEC culture, the culture
media in which the cells were grown was collected and stored at -80°C for subsequent
protein analysis.
Looi 2015
63
2.5.5 Plasma and buffy coat isolation
In addition to AEC collection, 5 ml of whole blood was collected from each cohort
participant, placed into a heparin sodium collection tube, mixed and transported to the
laboratory. The whole blood was centrifuged for 10 min at 2000 g at 18°C. Plasma and
the buffy coat layer were collected into 1.5 ml micro-centrifuge tubes respectively and
stored at -80°C until required.
2.5.6 Cytospin preparation
Cell cytospins were prepared by adding 60 – 70 µl of cell suspension containing at least
50 000 cells to each slide encased in a cytospin block and centrifuged for 20 min at
1500 rpm. The resulting slides were allowed to air dry for 24 h after which they were
fixed with 4% (v/v final) neutral buffered formalin (refer to 2.4.1.9) for 10 min at room
temperature. Slides were washed three times in a bath of 1X PBS (refer to 2.4.1.10) for
10 min to remove excess NBF and allowed to air dry. Slides were then stored at -20°C
until required.
2.5.7 Human Rhinovirus
Human rhinovirus (HRV) minor serotype 1B (HRV-1B) stocks was kindly provided by
Professor Peter Wark (John Hunter Hospital, Newcastle, New South Wales, Australia).
Human rhinovirus-1B stocks obtained were generated and titrated from infected cultures
of HeLa Ohio cells as previously described (Papi and Johnston 1999). Initially
determined viral titres of 1.06 x 108 tissue culture infective dose 50% (TCID50) / ml for
HRV-1B was reconfirmed via titration in MRC-5 cells by Dr Gerry Harnett (Pathwest,
Perth, Western Australia, Australia)
Looi 2015
64
2.5.7.1 Viral propagation of human rhinovirus-1B (HRV-1B)
Viral stocks of crude HRV-1B were generated by infecting monolayer cultures of Ohio
HeLa cells until cytopathic effects were fully developed. Cells and the supernatants
were harvested, cells were disrupted by repeated freezing at -80°C and thawing and the
resultant cell debris centrifuged at 2016 g for 10 min at 4°C. The resulting supernatant
was aspirated and the cell pellet was resuspended in 1X PBS (refer to 2.4.1.10) and
stored at -80°C until required.
2.5.7.2 Titration of human rhinovirus-1B (HRV-1B)
Human rhinovirus titration was performed on the frozen aliquots by exposing confluent
monolayers of MRC-5 cells in 48-well plates to serial 10-fold dilutions of crude viral
stock. Plates were cultured for 7 days in the required growth medium (refer to 2.4.2.2.5)
and incubated at 35°C in an atmosphere of 5% CO2 / 95% air. Cytopathic effect was
assessed by visual assessment over 7 days and TCID50 / ml values were determined as
previously described (Johnston and Tyrrell 1995).
2.5.7.3 Ultra-violet (UV) light inactivation of human rhinoviral activity
To confirm that the human rhinovirus (HRV) mediated response observed were a result
of active virus, the HRV-1B serotype was UV inactivated. One millilitre of HRV-1B
crude stock virus was transferred to a petri dish with lid removed and placed 10 cm
from a UV light source in a lamina flow hood. The empty vial was also similarly placed
with lid removed to allow for maximal penetration of the UV light. The UV-inactivated
virus was exposed to UV light for at least 120 min and subsequently stored at -80°C in
multiple aliquots until required.
Looi 2015
65
2.5.7.4 Cytotoxicity assays
To determine the effects of UV-inactivated human rhinovirus-1B (HRV-1B) on primary
airway epithelial cell (pAEC) viability, cells were seeded in 96-well plates and grown to
85% confluence in BEBM containing growth additives (refer to 2.4.2.2.6). Ultra-violet
light inactivated HRV-1B was then added to the wells at a titre ranging from 2.5 – 80
TCID50 / ml and exposed for 24, 48 and 72 hours. Following exposure, supernatant were
collected and bio-banked for subsequent cytokine assessment. The CellTitre 96® Aqueous
Non-Radioactive Cell Proliferation Assay was adapted to assess the number of
metabolically active cells post viral infection and was performed as previously
described (Kicic et al. 2006; Stevens et al. 2008).
2.5.8 Immunocytochemistry
Fixed slides of epithelial cells were brought to room temperature and re-hydrated with
1X PBS (refer to 2.4.1.10) for 5 min. To improve the intensity of staining, antigen
retrieval was performed using either citrate buffer or proteinase K. For citrate buffer
antigen retrieval, slides were immersed in 0.01 M citrate buffer (refer to 2.4.3.2.1) and
heated in a microwave oven for 15 min. Slides were then removed and allowed to cool
and washed in 1X PBS (3 x 15 min / wash). For proteinase K retrieval, slides were
incubated with 36 µg/ml proteinase K solution (refer to 2.4.3.2.2) at 37°C for 30 min
and subsequently washed in 1X PBS (3 x 15 min / wash). Cells were then quenched to
minimise auto-fluorescence by incubating the slides in 0.5% (w/v final) Sudan B Black
solution (refer to 2.4.3.2.3) for 20 min at RT. After washing with 1X PBS (3 x 15 min /
wash), cells were blocked for 2 h at RT in blocking buffer (5% (w/v final) BSA, 10%
(v/v final) FBS, 0.1% (v/v final) Triton X-100 and 1% (w/v final) saponin in 1X PBS) if
cytoplasmic or nuclear proteins were to be detected. If cell surface proteins were to be
detected, the slides were incubated for 2 h at RT in saponin free blocking buffer (5%
(w/v final) BSA, 10% (v/v final) FBS, 0.1% (v/v final) Triton X-100 in 1X PBS). The
appropriate primary antibodies were diluted in the blocking buffer solution at the
desired concentration and added to the slides which were then incubated overnight at
4°C. The following day, the slides were washed in 1X TBS (refer to 2.4.1.15) with 0.1%
Looi 2015
66
(w/v) saponin (3 x 15 min / wash) for the detection of cytoplasmic markers. If cell
surface markers were to be detected, 1X TBS without saponin was used as the wash
buffer. Fluorescent secondary antibodies were prepared in blocking buffer to the
necessary concentration and added to the slides which were further incubated in the
dark, overnight at 4°C. The following day, slides were washed in 1X TBS with saponin.
Once all primary and secondary antibodies had been used to stain the cells, the nucleus
of the cells was stained with 4′, 6-diamidino-2-phenylindole (DAPI). Slides were
incubated with DAPI (1:50 000) in 1X PBS for 10 min and then washed in 1X TBS (3 x
15 min / wash). Fluorescent mounting media was used to minimise fading and slides
were visualised using a fluorescence microscope.
2.5.9 Immunohistochemistry
Paraffin embedded, formalin fixed sections were initially deparaffinised, rehydrated and
subjected to antigen retrieval by incubating sections with proteinase K for 15 minutes at
37°C. Slides were then cooled to room temperature (RT) for 10 minutes followed by 3
washes in 1X TBS (refer to 2.4.1.15) containing 0.1% (v/v) saponin. Sections were
then blocked in 5% (w/v) BSA, 10% FBS (v/v), 0.1% (v/v) TritonX-100 and 0.1% (v/v)
saponin in 1 X TBS for 1 hour at RT. After a second series of washes, sections were
incubated with the appropriate primary antibodies diluted in the blocking buffer solution
at the desired concentration and added to the slides which were then incubated
overnight at 4°C. The following day, sections were washed in 1X TBS (refer to
2.4.1.15) with 0.1% (w/v) saponin (3 x 15 min / wash) for the detection of cytoplasmic
markers. Fluorescent secondary antibodies were prepared in blocking buffer in the
necessary concentration and added to the slides which were further incubated overnight
at 4°C. The following day, slides were washed in 1X TBS with saponin. Once all
primary and secondary antibodies had been used to stain the cells, the nucleus of the
cells was stained with 4′, 6-diamidino-2-phenylindole (DAPI). Slides were incubated
with DAPI (1:50 000) in 1X PBS for 10 min and then washed in 1X TBS (3 x 15 min /
wash). Fluorescent mounting media was used to minimise fading and slides were
visualised using a fluorescence microscope.
Looi 2015
67
2.5.10 In-Cell™ Western
Primary and subsequently passaged pAECs were plated onto 96-well microplates pre-
coated with fibronectin (10 mM) at a high seeding density of 1.2 x 105 cells/cm2 and
incubated at 37°C in an atmosphere of 5% CO2 / 95% air in BEBM containing growth
supplements as described previously (refer to 2.4.2.2.6). Upon observation of confluent
cell monolayers, growth media was aspirated and cells were immediately fixed using
150 µl of 3.7% formalin (refer to 2.4.3.1.1) for 20 min at RT. The cells were then
washed with 1X PBS containing 0.1% Triton X-100 (refer to 2.4.3.1.2) (5 x 5 min /
wash) with gentle shaking if cytoplasmic or nuclear proteins were to be detected. If cell
surface proteins were to be detected, the cells were incubated for 90 min at RT using
150 µl of LI-COR Odyssey Blocking Buffer. Cells were then incubated overnight at
4°C with primary antibodies dissolved in LI-COR Odyssey Blocking Buffer at a 1:200
dilution. The following day, cells were washed with 1X PBS containing 0.1% (v/v)
Tween-20 (refer to 2.4.3.1.3) (5 x 5 min / wash) with gentle shaking and incubated with
respective IRDye® secondary antibodies, diluted in a solution of LI-COR Odyssey
Blocking Buffer (1:800) with DRAQ5 (1:10000), Sapphire700 (1:1000) and 0.2% (v/v)
Tween-20 for 60 min at RT with gentle shaking in a dark room. Cells were then washed
in 1X PBS containing 0.1% (v/v final) Tween-20 (refer to 2.4.3.1.3) (5 x 5 min / wash).
Specific antibody staining for protein expression was then immediately visualised using
an infrared imaging system at both 680 and 800 nm channels. Protein expression was
quantified using the LI-COR Odyssey v.3.0 software. The integrated intensity (I.I) of
each well at 800 nm was then normalised to the I.I of the cell densities at 680 nm in the
corresponding well.
2.5.11 Transepithelial permeability
Primary airway epithelial cells (pAECs) were seeded onto fibronectin-coated culture
inserts (Corning Incorporated Life Sciences, MA, USA) at a high seeding density of 1.2
x 105 cells/cm2 and incubated at 37°C in an atmosphere of 5% CO2 / 95% air in BEBM
containing growth supplements as described previously (refer to 2.4.2.2.6). Upon
observation of confluent cell monolayers, growth media within the apical and
Looi 2015
68
basolateral compartments was replaced with HEPES buffered Hank’s balanced salt
solution (HEPES-HBSS) (refer to 2.4.3.3.2). Two hundred microliters of FITC-dextran
of molecular weight 4kDa or 20kDa (2 mg/ml) (refer to 2.4.3.3.1) was added to the
apical chamber and 50 µl of apical solution was immediately sampled. Five hundred
microliters of HEPES-HBSS from the basolateral compartment was sampled at hourly
intervals over a period of 6 h. The volume of the basolateral compartment was
maintained by addition of 500 µl fresh buffered HBSS-HEPES. All experiments were
performed at 37°C and on a calibrated orbital shaker at 300 rpm to minimise the
unstirred buffer layer. Fluorescence of FITC-dextran was detected using a PerkinElmer
Enspire® multilabel plate reader at an excitation wavelength of 492 nm and emission
wavelength of 520 nm. The apparent permeability of the epithelial monolayer to FITC-
dextran from the apical to basolateral compartment (Papp) was then calculated following
the general equation: Papp = (dQ/dt) x (1/AC0) where dQ/dt is the steady –state flux, A is
the surface area of the membrane and C0 is the initial concentration in the donor
compartment as previously described (Stutts et al. 1981).
2.5.12 Transepithelial electrical resistance (TEER)
Upon attaining a confluent monolayer of primary AECs in the culture inserts, TEER
measurements were performed across the epithelial cell monolayer to ensure the
formation and integrity of TJs between cells. This was achieved using an epithelial
voltohmeter (Millicell-ERS voltmeter, Millipore) with silver chloride ‘chopstick’
electrodes. Triplicate measurements per well were made at 37 ± 2°C prior the start of
any transport experiments and the mean resistance calculated. The resistance obtained
from a cell-free culture insert was subtracted from the resistance measured across each
cell monolayer and corrected for the surface area of the culture insert to yield the TEER
of the epithelial cells with values expressed in Ω/cm2.
Looi 2015
69
2.5.13 Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) and Real Time
quantitative Polymerase Chain Reaction (RT-qPCR)
Primers for the genes of interest (CLDN1, OCLN, ZO1) and the house keeping gene
(PPIA) were obtained from GeneWorks (Adelaide, SA, Australia) (Appendix D). Gene
expression was analysed by two-step RT-qPCR reactions. Total cellular RNA was
extracted from cell pellets stored in either QIAzol lysis reagent or RLT buffer with 1%
(v/v) 2 β-mercaptoethanol with RNeasy mini columns (QIAGEN, Hilden, Germany)
after a DNA digest was performed with RNase-Free DNase to remove unwanted DNA.
The isolated RNA was assessed for quality and quantity by measuring
spectrophotometric absorbance at 260 and 280 nm using a NanoDrop. Reverse
transcription was performed to convert 200 ng of RNA into cDNA. A 200 ng sample of
RNA was added to a master mix containing 10X RT Buffer (2 µl), 5 mM MgCl2 (4.4
µl), 2 mM deoxyribonucleotide triphosphates (dNTPs) (1 µl), Random Hexamers (1 µl),
RNase inhibitor (0.4 µl) and Multiscribe (0.5 µl) and then made to a final volume of 20
µl with RNase free water. Samples were then placed in a thermal cycler and run on a
standard reverse transcription program of 25°C for 10 min, 48°C for 60 min and 95°C
for 5 min. The RT-qPCR reaction contained cDNA (10ng), forward and reverse primers
(0.3 µM), SYBR® GREEN PCR Master Mix (10 µl) and RNase free water to make a
final volume of 20 µl. RT-qPCR was performed on an ABI Prism® 7300 (refer to
2.3.15). Results were analysed as previously described and gene expression of all
samples was expressed relative to the expression of the house keeping gene PPIA.
2.5.14 Total cellular protein extraction
Total cellular protein from cell cultures was extracted with CEB (refer to 2.4.2.3.3)
After aspirating the culture supernatant, cell pellets were re-suspended in 900 µl of CEB
and 100 µl of protease inhibitor cocktail was added. The cell suspension was placed on
ice to prevent protein degradation. Cells were then lysed by mechanical force with a 27-
gauge needle and syringe and stored at -80°C until required.
Looi 2015
70
2.5.15 Total cellular protein quantification
Total protein concentration was determined with the micro-Bicinchoninic Acid (BCA)
Protein Assay Reagent Kit (Pierce, Rockford, IL, USA) as previously described (Kicic
et al. 2006; Stevens et al. 2008; Sutanto et al. 2011). This assay is based on the
reduction of Cu2+ to Cu1+ by protein in an alkaline medium with the highly sensitive and
selective colorimetric detection of the cuprous cation (Cu1+) by bicinchoninic acid.
Briefly, protein samples were diluted 1:5, 1:10 and 1:20 in 1X PBS (refer to 2.4.1.10)
and the BSA protein standard constructed which consisted of a concentration range
between 12.5 and 500 µg/ml. Forty microliters of sample or standard was added to each
well of a 96-well microtitre plate. Secondary kit reagents were then combined in a
50:48:2 ratios and 200 µl of the mixture added to each well and incubated for 60 min at
37°C and the absorbance of the wells read at 562 nm. The absorbance of the standards
was plotted against their known concentrations and a standard curve generated. The
concentration of the sample was then determined from the standard curve incorporating
any dilution factor utilised.
2.5.16 Western Blot
Protein was collected from cells by CEB (refer to 2.4.2.3.3), quantitated by BCA assay
(refer to 2.5.15) and stored at -80°C. Prior to Western Blot analysis, the protein samples
were thawed but placed on ice to prevent protein degradation. A 10 µg protein sample
was mixed with NUPAGE® Lithium Dodecyl Sulphate (LDS) buffer, NUPAGE®
reducing agent and ddH2O (refer to 2.4.1.1) to make up a final volume of 20 µl. The
samples were then heated for 10 min at 70°C on a heating block (refer to 2.3.7) for
optimal denaturation before being loaded into a pre-cast 4 - 12% 1.0 mm Bis-Tris Plus
polyacrylamide gel (Novex BOLT®). Samples were then electrophoresed using a Novex
BOLT® Western Blot apparatus (Life Technologies) in MES SDS running buffer (refer
to 2.4.3.4.1) at a constant 200 V for 35 min at RT. A pre-stained protein ladder was run
on all gels in addition to samples for reference purposes. After separation, proteins were
transferred to onto a PVDF membrane using a semi-dry transfer method on iBlot
(Invitrogen®) system at 200 V for 7 min or a wet transfer method at a constant 230 mA
Looi 2015
71
for 2 h at 4°C. Upon completion of protein transfer, the PVDF membrane was blocked
for non-specific staining by using the LI-COR Odyssey Blocking Buffer for 60 min at
RT. Membranes were then incubated, with gentle rocking, overnight at 4°C with the
required primary antibodies made up in LI-COR Odyssey Blocking Buffer. The
membranes were then washed 3 times (15 min per wash) in 0.2% (v/v final) Tween-20
in 1X TBS solution (refer to 2.4.1.15) at RT. After washing, membranes were incubated
in the dark with respective IRDye® secondary antibodies made up in a solution of LI-
COR Odyssey Blocking Buffer with 2% (v/v final) Tween-20 diluent for 2 h at RT with
gentle rocking. The membranes were then washed 3 times (15 min per wash) in 0.2%
(v/v final) Tween-20 in 1X TBS solution (refer to 2.4.1.15) followed by 2 times (10 min
per wash) in 1X TBS (refer to 2.4.1.15) alone. The membranes were then scanned using
the LI-COR Odyssey infrared scanner at 680 nm and 800 nm channels. Bands of protein
expression were quantified using the LI-COR Odyssey v.3.0 software. The integrated
intensity (I.I) of each band was then normalised to the I.I of the house-keeping protein,
β-actin.
2.5.17 Statistical analysis
Each experiment performed in this thesis was conducted between 6 and 8 times with at
least 2 replicates per experiment. Student’s t-test and Mann-Whitney test were used to
compare means as appropriate. Values are presented as means ± standard error of mean
(SEM) or means ± standard deviation (SD) where appropriate. All p values less than
0.05 were considered to be significant. IBM SPSS 21 software package was used to
perform all statistical analysis.
Looi 2015
72
CHAPTER 3: Optimisation of In Cell™ Western and Transepithelial
permeability assays
3.1 Introduction
Tight junctions play a role in regulating the passage of solutes through the paracellular
pathway of epithelial cells and are crucial in the establishment of various
compositionally distinct fluid compartments within the body of multicellular organisms
(Tsukita et al. 2001; Matter and Balda 2003). Moreover, for the epithelium to function
efficiently as a barrier, the inter-cellular space must remain well sealed to prevent
unwanted trafficking of injurious solutes. However, it has been postulated that there
exists, either in health or disease, along the epithelium, weak points within the TJ
barrier where solutes remain capable of traversing (Ikenouchi et al. 2005).
In order to elucidate the function of epithelial TJ complexes, the ability to accurately
assess the expression of these complexes becomes an integral requirement in various
experimental procedures. Numerous studies have been performed that have investigated
the expression of junctional complexes in either health or disease and have employed
the use of western blotting in determining junctional protein expression (West et al.
2002; Coyne et al. 2003; Xiao et al. 2011; Hardyman et al. 2013). Although considered
to be a benchmark assay for protein quantification, western blotting is an intensive
process which includes, briefly; extraction of cellular protein and denaturation, gel
electrophoresis, protein transfer onto a blotting membrane followed by blocking of non-
specific binding. The membrane is then incubated with primary followed by secondary
antibodies, upon which chemiluminescent or fluorescent detection of the target proteins
is achieved through a detector. One major limitation of western blotting is that it is only
capable of analysing a single target protein for any given sample at one time. Hence,
analysis of multiple target proteins becomes very time-consuming. This becomes more
impractical when there is a need to analyse multiple target proteins in large sample
sizes, since typically 10 – 50 µg of protein lysate is required per sample. Additionally,
Looi 2015
73
when initial sample sizes are small and repeated sampling is unavailable, the use of
traditional western blotting becomes less practical to semi-quantify protein expression.
To circumvent these limitations, a novel, quantitative immunofluorescence assay,
termed In-Cell™ Western (ICW), can be used to quantify multiple proteins
simultaneously from small sample sizes. Briefly, ICW assays involve the culture of
cells on a 96-well micro-titre plate and upon confluence, are fixed. Afterwards, cells are
blocked to prevent non-specific binding and subsequently incubated with antibodies for
specific target proteins. Cells are then incubated with a solution containing IRDye®-
labelled secondary antibodies, non-specific cell stain Sapphire700 and a DNA stain
Draq5, which acts to normalise cell numbers within each well. The micro-titre plate is
subsequently washed and analysed using a near-infrared detector, which then semi-
quantifies the expression of the target proteins, following normalisation to cell densities.
The advantage of this assay is that it is a small scale, high throughput method that
enables analysis of multiple samples and target proteins, both membrane-bound and
intracellular simultaneously. Furthermore, since cells are cultured and analysed in a
micro-titre plate set-up, it is a rapid procedure to perform as additional steps necessary
for traditional western blotting, which includes protein extraction and quantification are
no longer required.
Since this assay’s development, it has been used in a variety of applications including;
monitoring effects of drug compounds on signalling pathways (Chen et al. 2005),
timing and kinetics of cellular signal transduction (Hannoush 2008), examining
functional consequences of cell receptor mutation (Chan et al. 2009) and for the
identification of inhibitors of signalling pathways (Hoffman et al. 2010). In all
investigations mentioned, it has been demonstrated that the ICW assay provided
accurate and robust high-throughput screening for the quantitative measurements of the
target proteins. Nevertheless, the use of the ICW assay in the quantification of epithelial
junctional complex proteins remains relatively absent. Hence, in this investigation, the
ICW assay was established and optimised to elucidate the expression of multiple TJ
proteins, in AECs derived from asthmatic and non-asthmatic children.
Looi 2015
74
Ultimately, TJ expression must be translated into a functional context, especially when
trying to elucidate differences between healthy and diseased states. Transepithelial
permeability is dependent upon the functioning of various inter-cellular junctions such
as TJs, which forms a seal at the apical end of the epithelium. This acts to selectively
regulate the passage of most molecules and ions as well as restrict lateral movement of
molecules in the cell membrane. Many disease settings are often exacerbated by or
result from a loss of epithelial barrier function. As a consequence, this permits the
passage of harmful pathogens into the sub-epithelial layer, causing further
exacerbations. Hence, the ability to functionally assess the epithelial barrier integrity in
both healthy or disease states is critical in improving our understanding of the airway
epithelium.
There are several variations to the transepithelial permeability assay, however, the most
routinely utilised method involves the initial culturing of cells on a semi-permeable
culture insert (Hubatsch et al. 2007). Upon reaching confluence, cells can either be
utilised immediately for the transepithelial permeability assay or air-lifted into air-liquid
interface (ALI) cultures, whereby, cells become polarised and fully differentiated. A
small volume of fluorescently-labelled inert molecules dissolved in a buffer is then
added onto the apical layer while the basolateral layer is concurrently filled with the
same buffer without the fluorescent molecule. The culture plate, together with the insert,
is placed on a platform shaker within a humidified incubator at 37°C with 5% CO2 /
95% air for a duration of 6 hours. At regular intervals, a pre-determined volume of
buffer is collected from the basolateral layer and subsequently replenished with fresh
buffer. Following the last sample collection, sample volumes collected are then
transferred into a micro-titre plate and the absorbance read using a fluorescence counter.
Various epithelial cells in culture, including the human epithelial colorectal
adenocarcinoma cell (Caco-2), form confluent monolayers which are capable of
developing junctional complexes. Moreover, Caco-2 cells, when cultured under specific
conditions, are also capable of becoming polarised. Hence, these cells have been the
most routinely used for the in vitro assessment of transepithelial drug permeability and
absorption (Hubatsch et al. 2007). However, a more applicable model utilising human
Looi 2015
75
derived primary AECs is needed when investigating transepithelial permeability within
the airway epithelium in children.
The transepithelial permeability assay has been used in several investigations assessing
permeability following various insults (Wan et al. 1999; Dreschers et al. 2007; Xiao et
al. 2011) and have proven its reliability in providing greater insights into airway
epithelial function in adults. However, little is known on the functional consequences of
epithelial TJ complex disruptions within the paediatric population. Hence, in this
investigation, the transepithelial permeability assay was established and optimised to
allow for the functional assessment of airway epithelial barrier integrity in asthmatic
and non-asthmatic children.
3.2 In Cell™ Western assay
3.2.1 Materials
All general materials and equipment used are as described in Chapter 2 (refer to 2.1 -
2.4).
3.2.1.1 Cell lines and paediatric-derived primary airway epithelial cells
All cell lines and paediatric-derived primary AECs utilised in this investigation were
obtained and maintained as previously described (refer to 2.5.1.6 and 2.5.4).
3.2.1.2 Human Tight Junction primary antibodies
Human TJ primary antibodies to claudin-1, occludin and zonula occluden-1 were
prepared and utilised as previously described (refer to 2.5.10).
Looi 2015
76
3.2.1.3 Human Tight Junction secondary antibodies
IRDye® secondary antibodies to either rabbit or mouse primary antibodies were
prepared and utilised as previously described (refer to 2.5.10).
3.2.2 Methods
In order to optimise this assay for primary AECs, a standard protocol derived from LI-
COR Biosciences was initially utilised as a template. As recommended by the
manufacturer, optimisation studies were performed on the following parameters, 1;
Concentration of primary antibodies, 2; Incubation temperature of primary antibodies
and 3; Concentration of secondary antibodies.
3.2.2.1 Concentration of primary antibodies
In accordance with the standard protocol, various dilutions of the different human TJ
primary antibodies between the recommended ranges of 1:50 to 1:200 were performed.
NuLi-1 cells cultured on 96 well micro-titre plates, once confluent were fixed in 3.7%
(v/v final) formalin (refer to 2.4.3.1.1) for 20 min without agitation. To determine total
protein expression, selected wells were treated with a permeabilising solution (refer to
2.4.3.1.2) while non-permeabilised wells were treated with the LI-COR odyssey
blocking buffer. The range of diluted primary antibodies was then added to the NuLi-1
cells to determine the most appropriate dilution at which optimal fluorescence occurred.
Detection of target proteins was performed by adding the recommended 1:800 dilution
of IRDye® secondary antibodies in a solution containing the cell and DNA stains
Sapphire700 and Draq5 respectively. Analysis using a near-infrared detector, which
semi-quantifies the expression of the target proteins, following normalisation to cell
densities was then performed. A similar series of experiments was then performed in
paediatric-derived primary AECs to confirm initial findings.
Looi 2015
77
3.2.2.2 Incubation temperature of primary antibodies
As recommended in the manufacturer’s protocol, incubation of primary antibodies may
be performed at either 25°C for 2.5 h or 4°C overnight. Thus, experiments were then
performed whereby NuLi-1 cells were plated and grown in 96 well micro-titre plates.
Primary antibodies were then added to wells in the dilution range recommended by the
manufacturer and plates then incubated at the two recommended temperature and
duration. Experiments were then repeated and confirmed in paediatric-derived primary
AECs to confirm initial findings.
3.2.2.3 Concentration of secondary antibodies
From the standard protocol, various dilutions of the different IRDye® secondary
antibodies between the recommended ranges of 1:200 to 1:1200 were tested. The range
of diluted secondary antibodies were added to NuLi-1 cells probed with the optimal
dilution of primary antibodies (refer to 3.2.2.1) to determine the most appropriate
secondary antibody dilution at which optimal fluorescence occurred. A similar set of
experiments were then performed in paediatric-derived primary AECs to confirm initial
findings.
3.2.3 Results / Discussion
3.2.3.1 Concentration of primary antibodies
Since a number of different primary antibodies were utilised in this investigation, the
optimal concentration of each primary antibody used was addressed. As evident, for the
semi-quantification of total protein expression, the strongest signal intensity was
observed in the 1:50 dilution of occludin, claudin-1 and ZO-1 primary antibody used
while very low signal intensity was observed in the 1:400 dilution for the same primary
antibodies (Figure 3.1 A – Total). Similar intensities were observed for membrane
bound protein expression of occludin, claudin-1 and ZO-1 (Figure 3.1 A – Membrane).
Cell normalisation staining using a combination of cell and nuclear stains Sapphire700
Figure 3.1 Effect of primary antibody concentration on NuLi-1 TJ signal intensity:
NuLi-1 cells, seeded on 96-well micro-titre plates and grown to confluence were treated
as previously mentioned (refer to 2.5.10). Incubation with primary antibodies to
occludin, claudin-1 and ZO-1 was performed at 4°C overnight followed by incubation
with IRDye™ secondary antibodies. (A) Total and membrane TJ signal intensities over
dilution range between 1:50 to 1:400 of primary antibodies observed at 800 nm channel
showed strongest intensity at 1:50 dilution while 1:400 dilution showed the weakest
intensity staining. (B) Uniform cell densities in all wells after staining with Sapphire700
and Draq5 indicates a confluent monolayer as observed at 700 nm channel. (C) Merged
image of (A) and (B) is utilised for the quantification of TJ protein expression as
normalised to cell densities. (D) Total signal intensity of occludin, claudin-1 and ZO-1
in a confluent NuLi-1 monolayer post normalisation to cell densities. Highest total TJ
signal intensity was observed in 1:50 dilution of primary antibodies, however, 1:400
dilution resulted in minimal total TJ signal intensity. (E) Similarly, membrane-bound
signal intensity of occludin, claudin-1 and ZO-1 in a confluent NuLi-1 monolayer post
normalisation to cell densities was observed to be highest in 1:50 dilution while 1:400
dilution demonstrated minimal membrane TJ signal intensity.
Dilutions
Sign
al In
tens
ity
1:50 1:100 1:200 1:4000.0
0.5
1.0
1.5
2.0
2.5occludinclaudin-1ZO-1
Dilutions
Sign
al In
tens
ity
1:50 1:100 1:200 1:4000.0
0.5
1.0
1.5
2.0
2.5occludinclaudin-1ZO-1
1:50 1:100 1:200 1:4000.0
0.2
0.4
0.6
D
E
A
B
C
Total Membrane
occludin claudin-1 ZO-1
Cell & Nuclear Stain
Merged
Looi 2015
78
and Draq5 respectively demonstrated uniform cell densities in all wells (Figure 3.1 B).
The target protein signal intensities were then merged with the cell normalisation stains
to then quantify target protein expression (Figure 3.1 C). When the signal intensity was
represented graphically, 1:50 dilution of the occludin, claudin-1 and ZO-1 antibodies
again demonstrated the highest total signal intensity staining while very low signal
intensity was observed in the 1:400 dilution (Figure 3.1 D). Graphical representation of
membrane signal intensities also demonstrated similar observations with highest
intensity seen at 1:50 dilutions and lowest detection seen in the 1:400 dilutions (Figure
3.1 E).
A similar series of experiments was also performed in paediatric-derived primary AEC
of healthy individuals (pAECHNA) to confirm initial observations seen in the NuLi-1
cells. As demonstrated, the strongest signal intensity was observed in the 1:50 dilution
of occludin, claudin-1 and ZO-1 primary antibody used while very low signal intensity
was observed in the 1:400 dilution for the same primary antibodies (Figure 3.2 A –
Total). Similar intensities were observed for membrane bound protein expression of
occludin, claudin-1 and ZO-1 (Figure 3.2 A – Membrane). Cell normalisation staining
using a combination of cell and nuclear stains Sapphire700 and Draq5 respectively
demonstrated uniform cell densities in all wells (Figure 3.2 B). The target protein signal
intensities were then merged with the cell normalisation stains to allow quantification of
target protein expression (Figure 3.2 C). When the signal intensity was represented
graphically, 1:50 dilution of the occludin, claudin-1 and ZO-1 antibodies again
demonstrated the highest total signal intensity staining while very low signal intensity
was observed in the 1:400 dilution (Figure 3.2 D). Graphical representation of
membrane signal intensities also demonstrated similar observations with highest
intensity seen at 1:50 dilutions and lowest detection seen in the 1:400 dilutions (Figure
3.2 E). Collectively, these results indicate that the 1:50 dilutions provided the strongest
signal intensity, however, it is considered an overly strong signal which may not
provide an accurate quantification of the target antibody signal. Furthermore, data
generated showed that the 1:400 dilutions provided the lowest signal intensity for all
antibodies tested and thus could also provide an inaccurate low quantification of the
target antibody signal. As a result, a mid-range dilution of 1:200 was selected for all
Figure 3.2 Effect of primary antibody concentration on paediatric derived
pAECHNA TJ signal intensity: Paediatric derived pAECHNA cells, seeded on 96-well
micro-titre plates and grown to confluence were treated as previously mentioned (refer
to 2.5.10). Incubation with primary antibodies to occludin, claudin-1 and ZO-1 was
performed at 4°C overnight followed by incubation with IRDye™ secondary antibodies.
(A) Total and membrane TJ signal intensity over dilution range between 1:50 to 1:400
of primary antibodies observed at 800 nm channel showed strongest intensity at 1:50
dilution while 1:400 dilution showed the weakest intensity staining. (B) Uniform cell
densities in all wells after staining with Sapphire700 and Draq5 indicates a confluent
monolayer as observed at 700 nm channel. (C) Merged image of (A) and (B) is utilised
for the quantification of TJ protein expression as normalised to cell densities. (D) Signal
intensity of occludin, claudin-1 and ZO-1 in a confluent pAECHNA monolayer post
normalisation to cell densities. Highest total TJ signal intensity was observed in 1:50
dilution of primary antibodies, however, 1:400 dilution resulted in minimal total TJ
signal intensity. (E) Similarly, membrane-bound signal intensity of occludin, claudin-1
and ZO-1 in a confluent pAECHNA monolayer post normalisation to cell densities was
observed to be highest in 1:50 dilution while 1:400 dilution demonstrated minimal
membrane TJ signal intensity.
Dilutions
Sign
al In
tens
ity
1:50 1:100 1:200 1:4000
1
2
3occludinclaudin-1ZO-1
Dilutions
Sign
al In
tens
ity
1:50 1:100 1:200 1:4000
1
2
3occludinclaudin-1ZO-1
D
E
A
B
C
Total Membrane
occludin claudin-1 ZO-1
Cell & Nuclear Stain
Merged
Looi 2015
79
primary antibodies and utilised in subsequent experiments for the detection of target
protein expression.
3.2.3.2 Incubation temperature of primary antibodies
As indicated by the manufacturer and performed here, incubation of primary antibodies
were performed at either 25°C for 2.5 h or at 4°C overnight. Initial experiments
performed in NuLi-1 cells at 25°C demonstrated strongest signal intensity at 1:50
dilution of occludin, claudin-1 and ZO-1 primary antibody used while very low signal
intensity was observed in the 1:400 dilution for the same primary antibodies (Figure 3.3
A – Total). Similar intensities were observed for membrane bound protein expression of
occludin, claudin-1 and ZO-1 (Figure 3.3 A – Membrane). Cell normalisation staining
using a combination of cell and nuclear stains Sapphire700 and Draq5 respectively
demonstrated uniform cell densities in all wells (Figure 3.3 B). The target protein signal
intensities were then merged with the cell normalisation stains (Figure 3.3 C) to allow
quantification of target protein expression. When the signal intensity was represented
graphically, 1:50 dilution of the occludin, claudin-1 and ZO-1 antibodies again
demonstrated the highest total signal intensity staining while very low signal intensity
was observed in the 1:400 dilution (Figure 3.3 D). Graphical representation of
membrane signal intensities also demonstrated similar observations with highest
intensity seen at 1:50 dilutions and lowest detection seen in the 1:400 dilutions (Figure
3.3 E).
However, when the NuLi-1 cells were incubated with primary antibodies at 4°C
overnight, overall signal intensities for occludin, claudin-1 and ZO-1 primary antibodies
were stronger for total protein expression (Figure 3.4 A – Total). Similarly, overall
signal intensities of occludin, claudin-1 and ZO-1 primary antibodies were also stronger
for membrane bound protein expression (Figure 3.4 A – Membrane). When the signal
intensities were represented graphically, 1:50 dilution of occludin, claudin-1 and ZO-1
primary antibodies again demonstrated highest total protein expression while minimal
or non-detectable signal intensity was observed in the 1:400 dilution (Figure 3.4 D).
Figure 3.3 Effect of incubation temperature of primary antibody at 25°C on NuLi-
1 TJ signal intensity: NuLi-1 cells, seeded on 96-well micro-titre plates and grown to
confluence were treated as previously mentioned (refer to 2.5.10). Incubation with
primary antibodies to occludin, claudin-1 and ZO-1 was performed at 25°C for 2.5 h
followed by incubation with IRDye™ secondary antibodies. (A) Total and membrane
TJ signal intensity over dilution range between 1:50 to 1:400 of primary antibodies
observed at 800 nm channel showed strongest intensity at 1:50 dilution while 1:400
dilution showed the weakest intensity staining. (B) Uniform cell densities in all wells
after staining with Sapphire700 and Draq5 indicates a confluent monolayer as observed
at 700 nm channel. (C) Merged image of (A) and (B) is utilised for the quantification of
TJ protein expression as normalised to cell densities. (D) Total signal intensity of
occludin, claudin-1 and ZO-1 in a confluent NuLi-1 monolayer post normalisation to
cell densities. Highest total TJ signal intensity was observed in 1:50 dilution of primary
antibodies, however, 1:400 dilution resulted in minimal total TJ signal intensity
staining. (E) Similarly, membrane-bound signal intensity of occludin, claudin-1 and
ZO-1 in a confluent NuLi-1 monolayer post normalisation to cell densities was
observed to be highest in 1:50 dilution while 1:400 dilution demonstrated minimal
membrane TJ signal intensity staining.
Dilutions
Sign
al In
tens
ity
1:50 1:100 1:200 1:4000.0
0.5
1.0
1.5
2.0
2.5occludinclaudin-1ZO-1
Dilutions
Sign
al In
tens
ity
1:50 1:100 1:200 1:4000.0
0.5
1.0
1.5
2.0
2.5occludinclaudin-1ZO-1
1:50 1:100 1:200 1:4000.0
0.1
0.2
0.3
0.4
D
E
A
B
C
Total Membrane
occludin claudin-1 ZO-1
Cell & Nuclear Stain
Merged
Figure 3.4 Effect of incubation temperature of primary antibody at 4°C on NuLi-1
TJ signal intensity: NuLi-1 cells, seeded on 96-well micro-titre plates and grown to
confluence were treated as previously mentioned (refer to 2.5.10). Incubation with
primary antibodies to OCLN, CLDN-1 and ZO-1 was performed at 4°C overnight
followed by incubation with IRDye™ secondary antibodies. (A) Total and membrane
TJ signal intensity over dilution range between 1:50 to 1:400 of primary antibodies
observed at 800 nm channel showed strongest intensity at 1:50 dilution while 1:400
dilution showed the weakest intensity staining. (B) Uniform cell densities in all wells
after staining with Sapphire700 and Draq5 indicates a confluent monolayer as observed
at 700 nm channel. (C) Merged image of (A) and (B) is utilised for the quantification of
TJ protein expression as normalised to cell densities. (D) Total signal intensity of
occludin, claudin-1 and ZO-1 in a confluent NuLi-1 monolayer post normalisation to
cell densities. Highest total TJ signal intensity was observed in 1:50 dilution of primary
antibodies, however, 1:400 dilution resulted in minimal total TJ signal intensity. (E)
Similarly, membrane-bound signal intensity of occludin, claudin-1 and ZO-1 in a
confluent NuLi-1 monolayer post normalisation to cell densities was observed to be
highest in 1:50 dilution while 1:400 dilution demonstrated minimal membrane TJ signal
intensity.
Dilutions
Sign
al In
tens
ity
1:50 1:100 1:200 1:4000.0
0.5
1.0
1.5
2.0
2.5occludinclaudin-1ZO-1
Dilutions
Sign
al In
tens
ity
1:50 1:100 1:200 1:4000.0
0.5
1.0
1.5
2.0
2.5occludinclaudin-1ZO-1
1:50 1:100 1:200 1:4000.0
0.2
0.4
0.6
D
E
A
B
C
Total Membrane
occludin claudin-1 ZO-1
Cell & Nuclear Stain
Merged
Looi 2015
80
Graphical representation of membrane bound protein expression also demonstrated
similar observations with highest expression seen in 1:50 dilutions and lowest or no
detection seen in the 1:400 dilutions (Figure 3.4 E).
A similar series of experiments was also performed in pAECHNA to confirm initial
observations seen in the NuLi-1 cells. As demonstrated, the strongest signal intensity
was observed in the 1:50 dilution of occludin, claudin-1 and ZO-1 primary antibody
used, while very low signal intensity was observed in the 1:400 dilution for the same
primary antibodies (Figure 3.5 A – Total). Similar intensities were observed for
membrane bound protein expression of occludin, claudin-1 and ZO-1 (Figure 3.5 A –
Membrane). Cell normalisation staining using a combination of cell and nuclear stains
Sapphire700 and Draq5 respectively confirms uniform cell densities in all wells (Figure
3.5 B). The target protein signal intensities were then merged with the cell
normalisation stains (Figure 3.5 C) to allow quantification of target protein expression.
When the signal intensity was represented graphically, 1:50 dilution of the occludin,
claudin-1 and ZO-1 antibodies again demonstrated the highest total signal intensity
staining while very low signal intensity was observed in the 1:400 dilution (Figure 3.5
D). Graphical representation of membrane signal intensities also demonstrated similar
observations with highest intensity seen at 1:50 dilutions and lowest detection seen in
the 1:400 dilutions (Figure 3.5 E).
Interestingly and of significance, when the pAECHNA were incubated with primary
antibodies at 4°C overnight, overall signal intensities for occludin, claudin-1 and ZO-1
primary antibodies were stronger for total protein expression (Figure 3.6 A – Total).
Similarly, overall signal intensities of occludin, claudin-1 and ZO-1 primary antibodies
were also stronger for membrane bound protein expression (Figure 3.6 A – Membrane).
When the signal intensities were represented graphically, 1:50 dilution of occludin,
claudin-1 and ZO-1 primary antibodies again demonstrated highest total protein
expression while minimal or non-detectable signal intensity was observed in the 1:400
dilution (Figure 3.6 D). Graphical representation of membrane bound protein expression
also demonstrated similar observations with highest expression seen in 1:50 dilutions
and lowest or no detection seen in the 1:400 dilutions (Figure 3.6 E).
Figure 3.5 Effect of incubation temperature of primary antibody at 25°C on
paediatric derived pAECHNA TJ signal intensity: Paediatric derived pAECHNA cells,
seeded on 96-well micro-titre plates and grown to confluence were treated as previously
mentioned (refer to 2.5.10). Incubation with primary antibodies to occludin, claudin-1
and ZO-1 was performed at 25°C for 2.5 h followed by incubation with IRDye™
secondary antibodies. (A) Total and membrane TJ signal intensity over dilution range
between 1:50 to 1:400 of primary antibodies observed at 800 nm channel showed
strongest intensity at 1:50 dilution while 1:400 dilution showed the weakest intensity
staining. (B) Uniform cell densities in all wells after staining with Sapphire700 and
Draq5 indicates a confluent monolayer as observed at 700 nm channel. (C) Merged
image of (A) and (B) is utilised for the quantification of TJ protein expression as
normalised to cell densities. (D) Total signal intensity of occludin, claudin-1 and ZO-1
in a confluent NuLi-1 monolayer post normalisation to cell densities. Highest total TJ
signal intensity was observed in 1:50 dilution of primary antibodies, however, 1:400
dilution resulted in minimal total TJ signal intensity staining. (E) Similarly, membrane-
bound signal intensity of occludin, claudin-1 and ZO-1 in a confluent NuLi-1
monolayer post normalisation to cell densities was observed to be highest in 1:50
dilution while 1:400 dilution demonstrated minimal membrane TJ signal intensity
staining.
Dilutions
Sign
al In
tens
ity
1:50 1:100 1:200 1:4000.0
0.5
1.0
1.5occludinclaudin-1ZO-1
Dilutions
Sign
al In
tens
ity
1:50 1:100 1:200 1:4000.0
0.5
1.0
1.5occludinclaudin-1ZO-1
1:50 1:100 1:200 1:4000.0
0.1
0.2
0.3
0.4
0.5
D
E
A
B
C
Total Membrane
occludin claudin-1 ZO-1
Cell & Nuclear Stain
Merged
Figure 3.6 Effect of incubation temperature of primary antibody at 4°C on
paediatric derived pAECHNA TJ signal intensity: Paediatric derived pAECHNA cells,
seeded on 96-well micro-titre plates and grown to confluence were treated as previously
mentioned (refer to 2.5.10). Incubation with primary antibodies to occludin, claudin-1
and ZO-1 was performed at 4°C overnight followed by incubation with IRDye™
secondary antibodies. (A) Total and membrane TJ signal intensity over dilution range
between 1:50 to 1:400 of primary antibodies observed at 800 nm channel showed
strongest intensity at 1:50 dilution while 1:400 dilution showed the weakest intensity
staining. (B) Uniform cell densities in all wells after staining with Sapphire700 and
Draq5 indicates a confluent monolayer as observed at 700 nm channel. (C) Merged
image of (A) and (B) is utilised for the quantification of TJ protein expression as
normalised to cell densities. (D) Signal intensity of occludin, claudin-1 and ZO-1 in a
confluent pAECHNA monolayer post normalisation to cell densities. Highest total TJ
signal intensity was observed in 1:50 dilution of primary antibodies, however, 1:400
dilution resulted in minimal total TJ signal intensity. (E) Similarly, membrane-bound
signal intensity of occludin, claudin-1 and ZO-1 in a confluent pAECHNA monolayer
post normalisation to cell densities was observed to be highest in 1:50 dilution while
1:400 dilution demonstrated minimal membrane TJ signal intensity staining.
Dilutions
Sign
al In
tens
ity
1:50 1:100 1:200 1:4000
1
2
3occludinclaudin-1ZO-1
Dilutions
Sign
al In
tens
ity
1:50 1:100 1:200 1:4000
1
2
3occludinclaudin-1ZO-1
D
E
A
B
C
Total Membrane
occludin claudin-1 ZO-1
Cell & Nuclear Stain
Merged
Looi 2015
81
Collectively, when comparing the different incubation temperatures tested, the results
generated demonstrate that both the length and temperatures at which primary
antibodies are incubate do affect the eventual signal intensities measured, with those
incubated at 4°C overnight having higher signal intensities. As a result, these
parameters were utilised in all subsequent incubations of primary antibodies for this
assay.
3.2.3.3 Concentration of secondary antibodies
Once the optimal dilution and incubation temperature of the different primary
antibodies was determined, the final parameter examined was the concentration of
secondary antibodies used for the detection of primary antibodies. In an initial series of
experiments using NuLi-1 cells, a range of secondary antibody dilution from 1:200 to
1:1200 was utilised. As shown for total protein expression, the strongest signal intensity
was observed in the 1:200 dilution while very low signal intensity was observed at the
1:1200 dilution of the IRDye® secondary antibodies (Figure 3.7 A – Total). Similar
intensities were observed for membrane bound protein expression (Figure 3.7 A –
Membrane). When cells were co-stained with both Sapphire700 and Draq5, uniform cell
densities were observed throughout all wells (Figure 3.7 B). Target protein signal
intensities were then merged with the cell normalisation stains (Figure 3.7 C), the
resulting images were utilised for the analysis and semi-quantification of target protein
expression. When signal intensity was represented graphically, 1:200 dilution of the
IRDye® secondary antibodies demonstrated highest total protein expression while very
low signal intensity was observed in the 1:1200 dilution (Figure 3.7 D). Graphical
representation of membrane bound protein expression also demonstrated similar
observations with highest expression seen in 1:200 dilutions and very low intensity seen
in the 1:1200 dilutions (Figure 3.7 E).
In a similar series of experiments performed in pAECHNA, the observations seen in the
NuLi-1 cells were repeated and confirmed (Figure 3.8). As demonstrated, the strongest
Figure 3.7 Effect of secondary antibody concentration on NuLi-1 TJ signal
intensity: NuLi-1 cells, seeded on 96-well micro-titre plates and grown to confluence
were treated as previously mentioned (refer to 2.5.10). Incubation with primary
antibodies to occludin, claudin-1 and ZO-1 was performed at 4°C overnight (1:200
dilution) followed by incubation with IRDye™ secondary antibodies over a dilution
range between 1:200 to 1:1200. (A) Total and membrane TJ signal intensity over the
dilution range of secondary antibodies observed at 800 nm channel showed strongest
intensity at 1:200 dilution while 1:1200 dilution showed the weakest intensity staining.
(B) Uniform cell densities in all wells after staining with Sapphire700 and Draq5
indicates a confluent monolayer as observed at 700 nm channel. (C) Merged image of
(A) and (B) is utilised for the quantification of TJ protein expression as normalised to
cell densities. (D) Total signal intensity of occludin, claudin-1 and ZO-1 in a confluent
NuLi-1 monolayer post normalisation to cell densities. Highest total TJ signal intensity
was observed in 1:200 dilution of secondary antibody, however, 1:1200 dilution
resulted in minimal total TJ signal intensity staining. (E) Similarly, membrane-bound
signal intensity of occludin, claudin-1 and ZO-1 in a confluent NuLi-1 monolayer post
normalisation to cell densities was observed to be highest in 1:200 dilution while 1:1200
dilution demonstrated minimal membrane TJ signal intensity staining.
Dilutions
Sign
al In
tens
ity
1:200 1:400 1:800 1:12000.0
0.5
1.0
1.5
2.0occludinclaudin-1ZO-1
Dilutions
Sign
al In
tens
ity
1:200 1:400 1:800 1:12000.0
0.5
1.0
1.5
2.0occludinclaudin-1ZO-1
1:200 1:400 1:800 1:12000.0
0.1
0.2
0.3
0.4
0.5
D
E
A
B
C
Total Membrane
occludin claudin-1 ZO-1
Cell & Nuclear Stain
Merged
Figure 3.8 Effect of secondary antibody concentration on paediatric derived
pAECHNA TJ signal intensity: Paediatric derived pAECHNA cells, seeded on 96-well
micro-titre plates and grown to confluence were treated as previously mentioned (refer
to 2.5.10). Incubation with primary antibodies to occludin, claudin-1 and ZO-1 was
performed at 4°C overnight (1:200 dilution) followed by incubation with IRDye™
secondary antibodies over a dilution range between 1:200 to 1:1200. (A) Total and
membrane TJ signal intensity over the dilution range of secondary antibodies observed
at 800 nm channel showed strongest intensity at 1:200 dilution while 1:1200 dilution
showed the weakest intensity staining. (B) Uniform cell densities in all wells after
staining with Sapphire700 and Draq5 indicates a confluent monolayer as observed at
700 nm channel. (C) Merged image of (A) and (B) is utilised for the quantification of TJ
protein expression as normalised to cell densities. (D) Total signal intensity of occludin,
claudin-1 and ZO-1 in a confluent pAECHNA monolayer post normalisation to cell
densities. Highest total TJ signal intensity was observed in 1:200 dilution of secondary
antibody, however, 1:1200 dilution resulted in minimal total TJ signal intensity staining.
(E) Similarly, membrane-bound signal intensity of occludin, claudin-1 and ZO-1 in a
confluent pAECHNA monolayer post normalisation to cell densities was observed to be
highest in 1:200 dilution while 1:1200 dilution demonstrated minimal membrane TJ
signal intensity staining.
Dilutions
Sign
al In
tens
ity
1:200 1:400 1:800 1:12000
1
2
3occludinclaudin-1ZO-1
Dilutions
Sign
al In
tens
ity
1:200 1:400 1:800 1:12000
1
2
3occludinclaudin-1ZO-1
1:200 1:400 1:800 1:12000.0
0.5
1.0
1.5
D
E
A
B
C
Total Membrane
occludin claudin-1 ZO-1
Cell & Nuclear Stain
Merged
Looi 2015
82
signal intensity was observed in the 1:200 dilution of occludin, claudin-1 and ZO-1
primary antibody used while very low signal intensity was observed in the 1:400
dilution for the same primary antibodies (Figure 3.8 A – Total). Similar intensities were
observed for membrane bound protein expression of occludin, claudin-1 and ZO-1
(Figure 3.8 A – Membrane). Cell normalisation staining using a combination of cell and
nuclear stains Sapphire700 and Draq5 respectively demonstrated uniform cell densities
in all wells (Figure 3.8 B). The target protein signal intensities were then merged with
the cell normalisation stains (Figure 3.8 C) to allow quantification of target protein
expression. When the signal intensity was represented graphically, 1:50 dilution of the
occludin, claudin-1 and ZO-1 antibodies again demonstrated the highest total signal
intensity staining while very low signal intensity was observed in the 1:400 dilution
(Figure 3.8 D). Graphical representation of membrane signal intensities also
demonstrated similar observations with highest intensity seen at 1:50 dilutions and
lowest detection seen at the 1:400 dilutions (Figure 3.8 E). Collectively and
comparative to primary antibody results, the data generated indicated that the 1:200
dilutions provided the strongest signal intensity and was considered an overly strong
signal which may not provide an accurate quantification of the target protein. In
addition, it was also observed that the 1:400 dilutions provided the lowest signal
intensity and thus, conversely, provides an inaccurate low quantification of the target
protein signal. As a result, a mid-range dilution of 1:800 was selected for all secondary
antibody dilutions and utilised in subsequent experiments for the detection of target
protein expression.
3.2.4 Conclusion
From the experiments conducted, an optimised and specific ICW assay protocol was
established on which all subsequent assays utilising paediatric-derived primary AECs
were based (Figure 3.9). In these assays, paediatric-derived primary AECs were plated
onto 96-well microplates pre-coated with fibronectin coating buffer (10 mM) (refer to
2.4.2.3.1) at a high seeding density of 1.2 x 105 cells/cm2 and incubated at 37°C in an
atmosphere of 5% CO2 / 95% air in BEBM containing growth supplements as described
previously (refer to 2.4.2.2.6). Upon reaching confluence, growth media was aspirated
Figure 3.9 Methodology of In-Cell™ Western (ICW) assay: A schematic
representation of the optimised ICW assay utilised in this investigation.
(Adapted from Li-Cor BioSciences)
Cells were seeded at 1.2 x 105 cells / cm2 in BEBM containing growth supplements as previously described (refer to 2.4.2.2.4).
Cells were then treated with the desired stimuli in accordance with experimental design when confluent. If no stimulus is applied, proceed onto next phase.
Fixation and permeabilisation of cells.
Incubation with primary antibody at 4°C overnight.
Incubation the cells with IRDye® secondary antibody for 1 h at RT followed by wash.
Image plate with Li-Cor Biosciences Odyssey Imager at 700 nm and 800 nm.
Looi 2015
83
and cells were immediately fixed using 150 µl of 3.7% (v/v final) formalin (refer to
2.4.3.1.1) for 20 min at RT. Cells were then washed with 1X PBS containing 0.1% (v/v
final) Triton X-100 (refer to 2.4.3.1.2) (5 x 5 min / wash at RT) with gentle shaking to
permeabilise cells. If membrane proteins were to be detected, cells were incubated for
1.5 h at RT using 150 µl of LI-COR Odyssey Blocking Buffer. Cells were then
incubated overnight at 4°C with primary antibodies diluted in LI-COR Odyssey
Blocking Buffer (1:200). The following day, cells were washed with 1X PBS containing
0.1% (v/v final) Tween-20 (refer to 2.4.3.1.3) (5 x 5 min / wash at RT) with gentle
shaking and incubated with respective IRDye secondary antibodies, made up in LI-COR
Odyssey Blocking Buffer (1:800) with DRAQ5 (1:10000), Sapphire700 (1:1000) and
0.2% (v/v final) Tween-20 for 1 h at RT with gentle shaking in a dark room. Cells were
then washed in 1X PBS containing 0.1% (v/v final) Tween-20 (refer to 2.4.3.1.3) (5 x 5
min / wash at RT). Specific antibody staining for protein expression was then
immediately visualised using an infrared imaging system at both 680 and 800 nm
channels. Protein expression was quantified using the LI-COR Odyssey v.3.0 software
whereby the integrated intensity (I.I) of each well at 800 nm was normalised to the I.I of
the cell densities at 680 nm in the corresponding well and resulting protein expression
was graphically represented in arbitrary units.
3.3 Transepithelial permeability assay
3.3.1 Materials
All general materials and equipment used are as described in Chapter 2 (refer to 2.1 -
2.4).
Looi 2015
84
3.3.1.1 Cell lines and paediatric-derived primary airway epithelial cells
All cell lines and paediatric-derived primary AECs utilised in this investigation were
obtained and maintained as previously described (refer to 2.5.1.3, 2.5.1.6 and 2.5.4).
3.3.1.2 Fluorescein isothiocynate-dextran (FITC-dextran)
Fluorescein isothiocynate-dextran of either 4kDa or 20kDa molecular weight was
prepared and utilised as previously described (refer to 2.5.11).
3.3.1.3 HEPES buffered Hank’s Balance Salt Solution (HEPES-HBSS)
HEPES buffered Hank’s Balanced Salt Solution was prepared and utilised as previously
described (refer to 2.5.11).
3.3.2 Methods
In order to optimise this assay specific to the investigation, a standard protocol derived
from the literature and used by various groups (Hubatsch et al. 2007; Sajjan et al. 2008;
Xiao et al. 2011) was utilised. Modifications were then performed and assessed on the
following parameters, 1; the selection of the fluorescent compound of interest for flux
assay and 2; sampling period.
3.3.2.1 Fluorescein isothiocynate labelled flux compounds
Previous studies have utilised various fluorescently labelled inert compounds including
inulin and dextran for the study of airway epithelium permeability (Ehrhardt et al. 2002;
Grainger et al. 2006; Dreschers et al. 2007; Xiao et al. 2011). However, fluorescently
labelled dextran (FITC-dextran) has been consistently utilised due to its availability in a
range of molecular weights. Thus, this study chose to utilise FITC-dextran at two
different molecular weights, namely 4 and 20 kDa, at a < 3 mg/ml concentration.
Looi 2015
85
3.3.2.2 Sampling period
From past transepithelial permeability studies performed (Ehrhardt et al. 2002; Grainger
et al. 2006; Sajjan et al. 2008), the length of sampling from the receiver compartment
was found to be an essential criterion in the analysis of flux and subsequently, the
determination of apparent permeability coefficient (Papp) across the airway epithelium.
Ehrhardt et al. (2002) as well as Grainger et al. (2006), performed transepithelial
permeability experiments over a period of 4 h, whilst others performed their
transepithelial permeability experiments over 6 h (Sajjan et al. 2008). Despite the
differences in the length of sampling between these studies, it remains unknown as to
whether an increase in the sampling period would result in a more precise flux analysis
and ultimately, more accurate determination of Papp coefficients. Thus, in this
investigation, the transepithelial permeability assay was performed over a period of 6 h.
3.3.3 Results / Discussion
3.3.3.1 Fluorescein isothiocynate labelled dextran
The transepithelial permeability assay is based upon the flux of fluorescently labelled
inert compounds from the apical surface layer of cultured epithelial cells to the
basolateral layer. Therefore, one of the first criteria to be established was the selection
of a suitable fluorescently labelled inert compound. As indicated earlier, various
fluorescently labelled compound have been utilised, however, the most commonly used
compound has been fluorescein isothiocynate labelled dextran (FITC-dextran) (Balda et
al. 1996; Ehrhardt et al. 2002; Forbes and Ehrhardt 2005; Grainger et al. 2006; Xiao et
al. 2011). The advantage of FITC-dextran is the availability in a range of molecular
sizes from 4 kDa to 2000 kDa. This allows for the determination of transepithelial
permeability of the airway epithelium towards different molecular sizes and most
importantly, provides a comparative to known respiratory allergens, bacteria and viruses
of known sizes. For this study, FITC-dextran of molecular sizes 4 kDa and 20 kDa were
utilised as it allowed for the investigation of transepithelial permeability of a small and
Looi 2015
86
larger sized molecules across the epithelial layer of healthy AECs. Moreover, the two
different molecular size of FITC-dextran provides the ability to add new information
about epithelial permeability as well as addressing the hypotheses and aims of this
study.
The studies utilising FITC-dextran have done so at a number of different concentrations
(Coyne et al. 2002; Grainger et al. 2006; Xiao et al. 2011). However, in most of them,
the concentration is always greater than 1 mg / ml (w/v final). Thus, in this
investigation, a concentration of 2 mg / ml (w/v final) was selected in order to provide a
higher concentration of FITC-dextran within the apical surface to maintain the sink
conditions in the receiver chamber within the culture well.
3.3.3.2 Sampling period
A variety of studies utilising the transepithelial permeability assay have been performed
over different lengths of time. Ehrhardt et al. (2002) as well as Grainger et al. (2006), in
their studies, performed the transepithelial permeability assay over a period of 4 h while
in other studies by Hubatsch et al (2007) and Sajjan et al. (2008), the transepithelial
permeability assay was performed over 6 h. In this investigation, a series of experiments
utilising different cell types were initially conducted over 4 h and subsequently, 6 h to
ascertain whether the length of the sampling period had any effect on absorbance and
ultimately, permeability coefficient levels. As demonstrated, an increase in absorbance
was observed over 4 h of sampling time in Caco-2, NuLi-1 and pAECHNA cells (Figures
3.10 A, B, and C respectively). However, when the experiments were extended over 6 h,
a further increase in absorbance was observed at the 5 h sampling interval. Absorbance
values continue to increase within the Caco-2 cells (Figure 3.10 A) while a plateau in
absorbance values was attained by the 6 h sampling interval in NuLi-1 and pAECHNA
cells (Figures 3.10 B & C). Collectively, the data generated suggest that maximum
absorbance is achieved at 6 h which then corresponds to a maximum calculated
permeability coefficient. As a result, a sampling period of 6 h was then utilised in all
subsequent transepithelial permeability assays.
Figure 3.10 Effect of sampling time on FITC-dextran molecules across cell
monolayers: Cells were cultured on Corning transwell inserts and grown to confluence
and transepithelial permeability assay performed as previously mentioned (refer to
2.5.11). An increase in FITC-dextran molecules of both 4kDa and 20kDa in the
basolateral compartment is observed over 4 h in confluent monolayers of (A) Caco-2
cells, (B) NuLi-1 cells and (C) pAECHNA cells. (A) When sampling time was increased
over 6 h, a further increase in both FITC-dextran molecules was observed within the
basolateral compartment in confluent monolayers of Caco-2 cells. (B and C) An
increase in both FITC-dextran molecules was similarly observed within the basolateral
compartment in confluent monolayers of NuLi-1 cells and pAECHNA cells at the 5 h
time point before a plateau was attained at the 6 h time point for both cell types. Results
are the mean ± SEM of five samples.
Time (h)
Abso
rban
ce a
t 520
nm
0 1 2 3 40.0
0.5
1.0
1.5
5 6
4kDa20kDa
Time (h)
Abso
rban
ce a
t 520
nm
0 1 2 3 40
50
100
150
5 6
20kDa4kDa
Time (h)
Abso
rban
ce a
t 520
nm
0 1 2 3 40
10
20
30
40
50
5 6
20kDa4kDa
A
B
C
Looi 2015
87
3.3.4 Conclusion
From the experiments conducted in this chapter, a standard transepithelial permeability
assay protocol was established on which all subsequent assays utilising paediatric-
derived primary AECs of this thesis were based (Figure 3.11). Here, primary AECs
were seeded onto culture inserts (Corning Incorporated Life Sciences, MA, USA) pre-
coated with fibronectin coating buffer at a density of 1.2 x 105 cells/cm2. Culture inserts
were then incubated at 37°C in an atmosphere of 5% CO2 / 95% air in BEBM
containing growth supplements as described previously (refer to 2.4.2.2.6). Growth
media within the apical and basolateral compartments was replaced with HEPES
buffered Hank’s balanced salt solution (HEPES-HBSS) (refer to 2.4.3.3.2). FITC-
dextran of molecular weight 4kDa or 20kDa (2 mg/ml w/v final) (refer to 2.4.3.3.1) was
added to the apical chamber and 50 µl of apical solution was immediately sampled. Five
hundred microliters of HEPES-HBSS from the basolateral compartment was sampled at
hourly intervals over a period of 6 h. The volume of the basolateral compartment was
maintained by addition of 500 µl fresh buffered HBSS-HEPES. All experiments were
performed at 37°C and on a calibrated orbital shaker at 100 rpm to minimise the
unstirred buffer layer. Fluorescence of FITC-dextran was detected using a PerkinElmer
Enspire® multilabel plate reader at an excitation wavelength of 492 nm and emission
wavelength of 520 nm. The apparent permeability of the epithelial monolayer to FITC-
dextran from the apical to basolateral compartment (Papp) was then calculated following
the general equation: Papp = (dQ/dt) x (1/AC0) where dQ/dt is the steady –state flux, A is
the surface area of the membrane and C0 is the initial concentration in the donor
compartment as previously described (Stutts et al. 1981).
Figure 3.11 Methodology of Transepithelial permeability assay: A schematic
representation of the optimised transepithelial permeability assay utilised in this
investigation.
Cells were seeded at 1.2 x 105 cells / cm2 in BEBM containing growth supplements as previously described (refer to 2.4.2.2.6).
Cells were then treated with the desired stimuli in accordance with experimental design when confluent. If no stimulus is applied, proceed onto next phase.
Growth media replaced with HEPES-HBSS in basolateral chamber. FITC-dextran (2mg/ml w/v final) in HEPES-HBSS added to apical chamber.
Over 6 h, 500µl of HEPES-HBSS sampled from basolateral chamber at determined time point and subsequently replaced with fresh HEPES-HBSS.
Sampled HEPES-HBSS then transferred to 96 well micro-titre plate.
Fluorescence detected via PerkinElmer Enspire® multilabel plate reader at excitation wavelength of 492 nm and emission wavelength of 520 nm.
Looi 2015
88
CHAPTER 4: Effect of human rhinovirus infection on tight junction
disassembly and the subsequent changes to barrier function
4.1 Introduction
A pseudostratified mucosal barrier consisting of a multitude of cell types function as the
initial protective interface between the internal milieu of the lung and the external
environment of micro-organisms, aeroallergens and noxious gases within the human
respiratory tract. A range of junctional complexes from tight junctions (TJ) to connexins
constitutes this protective barrier. Tight junctions that are located at the apical borders
of adjacent epithelial cells play a major role in the maintenance of epithelial barrier
function. They serve to regulate the movement of ions and solutes as well as to prevent
unwanted migration of pathogens and their products to the sub-epithelial space. Thus, a
breach in the epithelial barrier function, such as disruption in the TJ protein, zonula
occludens protein-1 (ZO-1) (Sajjan et al. 2008) may increase the paracellular traffic of
pathogenic molecules into the interstitium, resulting in the release of pro-inflammatory
cytokines such as interlukin-8 (IL-8), eotaxin, regulated on activation, normal T-cell
expressed and secreted (RANTES), interferon-inducible protein-10 (IP-10) and
macrophage inflammatory protein 1α (Wark et al. 2007).
Compromisation of the airway barrier integrity occurs after exposure to injurious
stimuli including airborne pollutants, aeroallergens, bacteria and respiratory viruses.
Respiratory viruses such as human rhinovirus (HRV) are common insults of the airway
epithelium and despite evidence suggesting that a significant reduction in TJ protein
expression and a disassembly of the apical junction proteins is associated with an
attenuated barrier function (Sajjan et al. 2008; Rezaee et al. 2011; Xiao et al. 2011), the
molecular mechanisms involved in the regulation of airway epithelial TJ proteins
following live HRV infection and the effects on barrier function are still not well
understood. Hence, this investigation was conducted to establish a direct correlation
between HRV infection, altered TJ expression and transepithelial permeability by
Looi 2015
89
utilising a modified human AEC, NuLi-1 with the hypothesis that TJ gene expression
would be altered following HRV infection which translates into a disassembly of TJ
complexes, resulting in a change in epithelial permeability. Therefore, using healthy
AECs, the specific aims of this chapter was to assess mRNA and protein of TJ
expression changes following HRV-1B infection using qPCR focussed arrays and in-
cell westerns. Furthermore, effects of HRV-1B infection on barrier function were
directly correlated using the optimised transepithelial permeability assay.
4.2 Materials and Methods
The general materials and methods used in this part of the investigation are listed in
detail in Chapter 2.
4.2.1 Cell culture
The modified human AEC, NuLi-1 and the sub-culture methodology used in this
investigation has been described in detail in Chapter 2 (refer to 2.4.2.2.6, 2.5.1.6, 2.5.2)
4.2.2 Human rhinovirus and titrations
Human rhinovirus (HRV) minor serotype 1B (HRV-1B) utilised in this investigation
has been described in detail in Chapter 2 (refer to 2.5.7).
4.2.3 Human tight junction Polymerase Chain Reaction (PCR) arrays
To assess for genes associated with TJ disassembly and altered barrier function, a
focused PCR array consisting of 84 key genes encoding for proteins forming the
epithelial barrier was utilised. Briefly, total cellular RNA was initially extracted as
previously described (refer to 2.5.13) and RNA quality and quantity assessed using a
NanoDrop. Reverse transcription was performed according to the manufacturer’s
Looi 2015
90
guidelines using the provided RT2 First Strand Kit which converts 1000 ng of RNA
into cDNA. A 1000 ng sample of RNA was added to a reverse transcription mix
containing 5X Buffer BC3 (4 µl), Control P2 (1 µl), RE3 Reverse Transcription Mix (2
µl) and made to a final volume of 10 µl with RNase free water. Samples were then
placed in a thermal cycler and run on a RT2 Profiler™ PCR array reverse transcription
program of 95°C for 10 min, 95°C for 15 sec and 60°C for 1 min. RT-qPCR was
performed on an ABI Prism® 7300 (refer to 2.3.15).
4.2.4 Infection of cell cultures
The modified human AEC, NuLi-1, grown on culture plates or inserts until confluence,
were infected with HRV-1B and incubated for 24 h. Briefly, growth media was replaced
with fresh basal media and subsequently infected with HRV-1B at a 50% Tissue Culture
Infectivity Dose (TCID50) of 2.5, 10, 20, 40 or 80 x 104 TCID50/ml. After each
incubation period, media was collected and stored at -80°C and infected cells were
utilised for various downstream assays.
4.2.5 In Cell™ Western assay
The optimised In Cell™ Western assay, as described in detail (refer to Chapter 3) was
utilised for the determination of TJ membrane protein expression prior and following
human rhinovirus infection.
4.2.6 MTS cell viability assay
For the assessment of NuLi-1 cell viability, a CellTitre 96® AQueous Non-Radioactive
Cell Proliferation Assay (Promega, Madison, WI, USA) was utilised. This is a
colorimetric assay based upon the conversion of a tetrazolium salt into a coloured
compound by dehydrogenase enzymes found only in metabolically active cells. The
assay was performed in accordance with the manufacturer’s instructions and
Looi 2015
91
measurements were recorded at 0, 24, 48 and 72 h post HRV infection to determine the
percentage of viable cells.
4.2.7 Quantification of Human Rhinovirus viral copy number
Viral copy number of all HRV samples was determined quantitatively via two-step RT-
PCR reactions using a HRV-1B advanced kit and HRV standard kit (both
PrimerDesign Ltd, UK) in combination with MultiScribe™ Reverse Transcriptase
and Taqman Universal Master Mix (Applied Biosystems, USA) as previously
described (Sutanto et al. 2011). Briefly, 200 ng total RNA was reverse transcribed in a
20 l total reaction volume containing 1X RT buffer, 5.5 mM MgCl2, 0.5 mM of each
of the dNTPs, 1 µl HRV-1B/ACTB primer mix, 0.4 U/l RNase inhibitor, 0.5 U/l
MultiScribe reverse transcriptase and RNase-DNase free water. The reactions were
carried out as follow: initial primer incubation step at 25C for 10 minutes followed by
1 h incubation at 48C and ended by heating at 95C for 5 minutes. The cDNA was then
used in a final PCR reaction volume of 20 l containing 1X Taqman Universal Master
Mix, 1 l HRV-1B primer/probe mix and 5 l of cDNA which has been diluted 5-fold.
The PCR conditions were as described by manufacturer: 50C for 2 minutes, 95C for
10 minutes followed by 40 cycles of 15 seconds at 95C and 1 minute at 60C. A copy
number was determined from a set of standards ranging from 2 copy number/mL to
2x107 copy number/ml that was included in each run.
4.2.8 Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
Extraction and quantification of RNA, as well as the methodology for RT-qPCR has
been described in detail in Chapter 2 (2.5.13).
4.2.9 Single-stranded DNA (ssDNA) apoptosis assay
To determine the percentage of cells that underwent apoptosis during HRV infection, a
ssDNA apoptosis ELISA kit was utilised. This procedure is based upon the selective
Looi 2015
92
denaturation of DNA in apoptotic cells by formamide and the detection of denatured
DNA with a specific monoclonal antibody for ssDNA. The assay was performed in
accordance with the manufacturer’s instructions as previously described (Sutanto et al.
2011). Briefly, cells were plated onto 96-well microplates pre-coated with fibronectin
(10 mM) at a seeding density of 6 x 104 cells/cm2 and incubated at 37°C in an
atmosphere of 5% CO2 / 95% air in BEBM containing growth supplements as described
previously (refer to 2.4.2.2.6). Cells were then infected with HRV-1B at three viral
concentrations: 2.5 x 104 TCID50/ml, 10 x 104 TCID50/ml and 80 x 104 TCID50/ml for
24 h. The plates were then centrifuged at 200 g for 5 minutes and the media collected
and replaced with 200 µl of 80% (v/v final) methanol fixative and incubated at RT for
30 minutes. The fixative was removed from the cell monolayers and the plates dried at
RT for 1-2 h to allow for permanent attachment of cells to the plate. Once fully dry, 50
µl of formamide solution was added to each well and incubated at RT for 10 minutes.
To denature the DNA in apoptotic cells, plates were heated to 75°C for 10 minutes in an
oven, cooled in a refrigerator for 5 minutes and finally the formamide removed. Wells
were then rinsed 3 times with 1X PBS and blocked with 200 µl of 3% (w/v final) non-
fat milk solution for 1 h at 37°C. The blocking solution was removed and replaced with
100 µl of supplied antibody mixture to each well followed by a 30 minutes incubation at
RT. Plates were then washed a further 3 times with 250 µl of 1X wash solution and 100
µl of supplied ABTS solution added to each well and incubated for 30 minutes at RT.
The reaction was stopped by the addition of 100 µl of stop solution and resulting
absorbance read at 405 nm.
4.2.10 Transepithelial permeability assay
The optimised transepithelial permeability assay, as described in detail (refer to Chapter
3) were utilised for the functional determination of epithelial TJ membrane integrity
prior and following human rhinovirus infection.
Looi 2015
93
4.2.11 Statistical analysis
Before statistical evaluation, all results were tested for population normality and
homogeneity of variance, and where applicable, a Student t test was performed.
Experiments were performed in at least in triplicates and all data were non-parametric,
with analysis performed using Mann-Whitney test. Values were presented as mean ±
SD. All p values less than 0.05 were considered to be significant.
4.3 Results
4.3.1 Effect of human rhinoviral infection on NuLi-1 cell viability
Although HRV has been reported to have a cytotoxic effect on pAECs (Stevens 2009),
the effects on epithelial TJ and subsequently barrier function, remains largely
unanswered. Hence, to determine the effects of HRV infection on epithelial barrier
integrity and function in a modified human AEC, NuLi-1, initial validation of cellular
viability response upon infection by HRV-1B was conducted. Human rhinovirus
cytotoxicity assays were performed to determine the effects of HRV-1B exposure on
NuLi-1 cellular viability. The assays were performed using viral titres from 2.5 to
80x104 TCID50/ml HRV-1B and infection times of 24 to 72 h to assess both dose
response and time course effects.
Infection of NuLi-1 cells with HRV-1B affected culture viability in both a time and
dose dependent manner. Following infection with a viral titre of 2.5x104 TCID50/ml of
HRV-1B, despite significant loss of cell viability at 24 h (93.2% ± 2.2) and 48 h (93.6%
± 1.2) but no significant loss at 72 h (95.2% ± 5.2), infection with the low viral titre
demonstrated the least effect on cellular viability at all infection times (Figure 4.1 -
2.5x104 TCID50/ml; p<0.05). Interestingly, no significant loss of viability was observed
when infected with viral titre of 10x104 TCID50/ml of HRV-1B at 24 h (100% ± 2.8)
and 48 h (93.7% ± 4.1) but significance was observed when infection was extended to
72 h (79.6% ± 3.1) (Figure 4.1 - 10x104 TCID50/ml; p<0.05). However, when infected
Figure 4.1 Effect of HRV-1B on cellular viability in NuLi-1 over time: NuLi-1 cells, seeded on 96-well micro-titre plates were grown to confluence
subsequently infected with a range of HRV-1B titres (2.5 – 80x104 TCID50/ml) and cell viability assessed at 24, 48 and 72 h post infection via a
colorimetric MTS assay as described (refer to 4.2.6). Results were presented as whisker box plots (mean, Min – Max) in percentages from at least three
different experiments with each data assayed in triplicate and normalised to non-infected control cells (---). Infection with HRV-1B caused a time and
dose-dependent cytotoxic effect on NuLi-1 cells. *Statistical significance relative to control (p < 0.05).
Viral titre (x104 TCID50/ml)
Cel
l Via
blity
(% r
elat
ive
to c
ontr
ol)
Control 80 40 20 10 2.5 80 40 20 10 2.5 80 40 20 10 2.5
0
25
50
75
100
12572h48h24h
*
*
*
** **
* *
Looi 2015
94
with viral titre of 20x104 TCID50/ml of HRV-1B, increasing significant loss of viability
was observed at 24 (88.8% ± 3.7), 48 (91.1% ± 1.2) and 72 h (60.8% ± 4.8) (Figure 4.1
- 20x104 TCID50/ml; p<0.05). When infected with viral titre of 40x104 TCID50/ml of
HRV-1B, no significant loss of viability was observed at 24 (82.3% ± 10) and 48 h
(79.2% ± 8.3) but significance was observed when infection was extended to 72 h
(32.1% ± 4.8) (Figure 4.1 - 40x104 TCID50/ml; p<0.05). Infection with the maximal
viral titre of 80x104 TCID50/ml of HRV-1B demonstrated significantly increased loss of
cellular viability at 24 (91.8% ± 0.2), 48 h (81.4% ± 6.3) with the greatest loss of
viability observed at 72 h (25.9% ± 0.6) (Figure 4.1 - 80x104 TCID50/ml; p<0.05).
4.3.2 Apoptotic response and viral replication following infection with HRV-1B
Apoptotic responses in virally infected cells are key protective mechanisms to prevent
and minimise viral replication and release. Previous studies have demonstrated an
apoptotic response in pAECs following HRV-1B infection (Stevens 2009; Sutanto et al.
2011), however, prior utilising NuLi-1 cells for the determination of tight junctional
expression and response to HRV infection, initial validation of cellular apoptotic
response to HRV-1B infection was conducted. Hence, a ssDNA apoptosis ELISA was
performed to determine the extent of apoptosis in NuLi-1 cells following infection with
HRV-1B.
Infection with HRV-1B induced significant apoptotic response at all viral titres,
however, the level of apoptosis induced was dependent on the viral titre, with a 50%
increase in apoptosis at a low viral titre of 2.5x104 TCID50/ml of HRV-1B compared to
non-infected controls (Figure 4.2A; p<0.05). Furthermore, determination of viral copy
number in HRV infected samples after 24 h infection with viral titres of 2.5 to 40x104
TCID50/ml of HRV-1B demonstrated significant increase in viral copy numbers,
indicative of increased viral replication, which was concomitant with increasing viral
titres (Figure 4.2B; p<0.05).
Figure 4.2 Effect of HRV-1B on apoptosis and viral replication in NuLi-1: (A) NuLi-1 cells, seeded on 96-well micro-titre plates and grown to
80% confluence were infected with a range of HRV-1B titres (2.5 – 40x104 TCID50/ml) for 24 h and apoptotic response of the cells determined using a
colorimetric assay ssDNA apoptosis kit (refer to 4.2.9). Following infection with HRV-1B, overall apoptotic response increases with significance
observed at all viral titres (p<0.05). Data were presented as mean ± SD percentage apoptosis relative to control from at least three different experiments
with each data assayed in triplicate. (B) NuLi-1 cells were established and infected with a range of HRV-1B titres (2.5 – 40x104 TCID50/ml) for 24 h.
Cells were harvested to extract RNA and HRV-1B RNA measured using qPCR. Viral copy number increased with increasing viral titre and was
significant for all viral titres used (p<0.05). Data were normalised to microgram RNA and presented as mean ± SD; n = 3 individual experiments each
performed in duplicates. *Statistical significance relative to control (p<0.05). **Statistical significance relative to control (p<0.01).
A B
Control 2.5 10 20 400
50
100
150
200
250 **
Viral titre (x104 TCID50/ml)
Incr
ease
in a
popt
osis
(% r
elat
ive
to c
ontr
ol)
****
*
Control 2.5 10 20 400
10
20
30
40
50
Viral titre (x104 TCID50/ml)
Vira
l cop
y #/
g R
NA
*
*
**
Looi 2015
95
4.3.3 Effect of HRV-1B infection on mRNA expression of tight junction complexes
In order to directly correlate HRV infection with altered expression in tight junctional
and associated proteins, a focussed qPCR array was performed. Briefly, RNA was
collected from non-infected and infected cultures, isolated, purified and transferred onto
a focussed array which contained primers for 84 key genes encoding for proteins that
form impermeable barriers between epithelial cells to regulate polarity, proliferation and
differentiation.
Results demonstrated that following infection with viral titre of 20x104 TCID50/ml of
HRV-1B for 9 h, down-regulation of mRNA was observed for 58 key genes encoding
for epithelial barrier junction proteins with the most down-regulated being CLDN8
(14.2-fold) and up-regulation of 26 key genes with the most up-regulated being Crb3
(1.9-fold). Interestingly, from the data, significant down-regulation was only observed
for CLDN8 (14.2-fold), PTEN (3.5-fold), CLDN12 (2.3-fold), ASH1L (1.9-fold), and
ZO-1 (1.3-fold) (Figure 4.3 – CLDN8, PTEN, CLDN12, ASH1L, ZO-1; p<0.05).
However, of relevance to the barrier integrity of the respiratory epithelium, the
ubiquitously expressed claudin-1, occludin and ZO-1 were analysed following HRV-1B
infection. The data generated demonstrated down-regulation of mRNA for claudin-1
(1.1-fold), occludin (1.2-fold) and ZO-1 (1.3-fold), however, significance was only
observed for ZO-1 (Figure 4.3 – ZO-1; p<0.05).
4.3.4 Effect of human rhinovirus infection on membrane tight junction disassembly
At present, there remains a paucity of data on the effects HRV infection has on other
tight junctional complexes despite evidence from a seminal study demonstrating
disassembly of ZO-1 protein (Sajjan et al. 2008). Hence, an In-Cell™ Western assay
(refer to Chapter 3) was utilised to corroborate membrane protein disassembly of
claudin-1, occludin and ZO-1 with their respective down-regulated mRNA expression
following HRV-1B infection.
Figure 4.3 Effect of HRV-1B on mRNA expression of TJ in NuLi-1: NuLi-1 cells, seeded on 12-well plates and grown to confluence were infected
with a viral titre of 20x104 TCID50/ml of HRV-1B for 9 h. Cells were harvested to extract RNA and human tight junction gene expression assessed
using a focused RT-qPCR array (refer to 4.2.3). Down-regulation of mRNA was observed in 58 key genes with significance observed in CLDN8,
PTEN, CLDN12, ASH1L and ZO-1 following HRV-1B infection. Down-regulation was also observed for the identified genes of interest (Blue) with
significance observed for ZO-1. Data were presented as fold up- or down-regulation from at least three different experiments relative to non-infected
control cells. *Statistical significance relative to non-infected control (p<0.05).
Human TJ genes
mR
NA
expr
essi
on(fo
ld u
p- o
r do
wn-
regu
latio
n re
lativ
e to
con
trol
)
CLD
N8
PEC
AM
1SP
TA1
PTEN
CLD
N19
MA
GI2
IGSF
5ES
AM
CLD
N12
ICA
M2
AR
HG
EF2
ASH
1LZA
KC
LDN
14C
LDN
3SP
TBM
LLT4
CLD
N9
CR
B1
VAPA
PAR
D3
TJP3
CLD
N15
CLD
N5
CSN
K2A
2C
TNN
A3
PAR
D6B
JAM
2A
CTN
2M
AR
K2
EPB
41C
ASK
F11R
TJP1
GN
AI1
CD
99M
PDZ
MA
GI1
OC
LNJA
M3
RA
C1
LLG
L2C
GN
CLD
N1
RH
OA
CTT
NC
LDN
18TJ
AP1
INA
DL
CTN
NA
1SY
MPK
MPP
6A
CTN
4LL
GL1
CLD
N6
AC
TN1
ILK
SMU
RF1
AC
TN3
ICA
M1
CLD
N7
CD
K4
CTN
NB
1A
MO
TL1
CLD
N10
CTN
NA
2TJ
P2C
LDN
11PR
KC
IC
SDA
MPP
5H
CLS
1C
LDN
17SP
TAN
1C
SNK
2A1
CLD
N2
PRK
CZ
TIA
M1
CD
C42
CLD
N16
CLD
N4
CSN
K2B
PAR
D6A
CR
B3
-20
-15
-10
-5
0
5
*
*
** *
Looi 2015
96
The data demonstrated high basal membrane occludin expression (0.038AU ± 0.007)
within NuLi-1 cells, while, basal membrane claudin-1 and ZO-1, which demonstrated
similar levels of expression were lower (0.015AU ± 0.002 and 0.016AU ± 0.002
respectively) when compared to membrane occludin expression (Figure 4.4 - Control).
Following infection with a viral titre of 2.5x104 TCID50/ml of HRV-1B for 24 h, a
decrease in membrane occludin and ZO-1 expression was observed (0.02AU ± 0.001
and 0.012AU ± 0.0004 respectively), although this was not statistically significant.
However, a significant decrease in membrane claudin-1 expression (0.007AU ± 0.0002)
was observed at the same viral titre (Figure 4.4 - 2.5x104 TCID50/ml; p<0.05). When
NuLi-1 cells were infected with a high viral titre of 20x104 TCID50/ml of HRV-1B,
significant decreases in all membrane protein expressions of claudin-1 (0.007AU ±
0.0001), occludin (0.016AU ± 0.002) and ZO-1 (0.007AU ± 0.00009) were observed in
contrast to non-infected controls (Figure 4.4 – 20x104 TCID50/ml; p<0.05).
4.3.5 Effect of human rhinovirus infection on transepithelial permeability
Epithelial paracellular permeability is a key functional indicator of cellular junctional
integrity. Hence, to correlate HRV-1B induced disassembly of membrane TJ with
barrier function, a transepithelial permeability assay was performed after 24 h infection
with a low (2.5x104 TCID50/ml) and high viral titre (20x104 TCID50/ml) of HRV-1B.
From the data generated following infection with a low viral titre (2.5x104 TCID50/ml)
of HRV-1B for 24 h, a significant increase in permeability to FITC-dextran of 4 kDa
(292.6 x 10-4 cm/sec ± 2.4) and 20 kDa (249.8 x 10-4 cm/sec ± 10.33) was observed
when compared to non-infected controls (221.9 x 10-4 cm/sec ± 8.5 and 115 x 10-4
cm/sec ± 4.5 respectively) (Figure 4.5 - 2.5x104 TCID50/ml; p<0.05). Moreover,
permeability to FITC-dextran 4 kDa was observed to be significantly higher (292.6 x
10-4 cm/sec ± 2.4) when compared to 20 kDa (249.8 x 10-4 cm/sec ± 10.33) following
infection with the low viral titre of HRV-1B. Interestingly, when NuLi-1 cells were
infected with a high viral titre (20x104 TCID50/ml) of HRV-1B for 24 h, significant
increase in transepithelial permeability of FITC-dextran 4 kDa (357.9 x 10-4 cm/sec ±
12.2) and 20 kDa (302.2 x 10-4 cm/sec ± 7.2) was similarly observed compared to non-
Figure 4.4 Effect of HRV-1B infection on membrane TJ protein expression in
NuLi-1: NuLi-1 cells, seeded on 96-well micro-titre plates and grown to confluence
were treated as previously mentioned (refer to 2.5.10). Cells were exposed to two
different HRV-1B titres (2.5 and 20x104 TCID50/ml) for 24 h and membrane TJ protein
expression assessed via a previously optimised In-Cell™ Western assay (refer to 4.2.5).
As observed, overall membrane claudin-1, occludin and ZO-1 protein expression
decreased following exposure to HRV-1B at both viral titres. Significance was observed
for claudin-1 at the lower titre while significance was observed for all three TJ protein
at the higher viral titre (p<0.05). Data were normalised to cell numbers and presented as
mean ± SD; n = 5 individual experiments each performed in duplicates. *Statistical
significance relative to control (p<0.05).
Viral titre (x104 TCID50/ml)
Mem
bran
e pr
otei
n ex
pres
sion
(Arb
itary
uni
ts)
Control 2.5 200.00
0.01
0.02
0.03
0.04
0.05
claudin-1occludinZO-1
* *
*
*
Figure 4.5 Effect of HRV-1B infection on transepithelial permeability in NuLi-1:
NuLi-1 cells, seeded onto Corning transwell inserts and grown to confluence were
infected with two different HRV-1B titres (2.5 and 20x104 TCID50/ml) for 24 h and
epithelial permeability assessed via a transepithelial permeability assay (refer to 4.2.10).
As observed, overall transepithelial permeability to FITC-dextran 4 kDa and 20 kDa
was significantly increased at both viral titres (p<0.05). Results are presented as mean ±
SD; n = 5 individual experiments each performed in duplicates. *Statistical significance
relative to control (p<0.05). #Statistical significance relative to 20 kDa (p<0.05).
Control 2.5 200
100
200
300
4004 kDa20 kDa
*#
*
*
Viral titre (x104 TCID50/ml)
Papp
coe
ffici
ent (
cm/s
ec) x
10-4
*#
#
Looi 2015
97
infected controls (221.9 x 10-4 cm/sec ± 8.5 and 115 x 10-4 cm/sec ± 4.5 respectively)
(Figure 4.5 - 20x104 TCID50/ml; p<0.05). In addition, permeability to FITC-dextran 4
kDa was observed to be significantly higher (357.9 x 10-4 cm/sec ± 12.2) when
compared to 20 kDa (302.2 x 10-4 cm/sec ± 7.2) following infection with the low viral
titre of HRV-1B. Interestingly, when comparing transepithelial permeability between
the viral titres, permeability to FITC-dextran of 4 and 20 kDa was observed to be
significantly higher following infection with the high viral titre in contrast to epithelial
permeability post infection with the low viral titre.
4.4 Discussion
The associations between HRV infection, expression and regulation of TJ genes and
subsequent disassembly of TJ proteins resulting in impairment of epithelial barrier
functions are poorly understood. Various studies have used cell lines or pAECs for
understanding the effects of viral infection on membrane TJ dissociation alone or
disassembly in membrane TJ proteins leading to an observed increase in epithelial
permeability (Sajjan et al. 2008; Comstock et al. 2011; Xiao et al. 2011). However, no
study has yet incorporated both and at present, this is the first study to examine a direct
correlation between live-viral infection and the effects on TJ gene expression,
disassembly of membrane TJ proteins and eventual impairment of barrier function
resulting in increased transepithelial permeability.
Airway epithelial cells are of vital importance during viral infections as they serve as
the host cell for viral replications as well as initiating the innate and adaptive immune
responses. Past studies have demonstrated that pAECs are susceptible to HRV
infections and are able to successfully replicate resulting in a cytotoxic effect (Subauste
et al. 1995; Papadopoulos et al. 2000; Sutanto et al. 2011; Cakebread et al. 2014).
However, limited access to pAECs as well as variability between different donor
epithelia often restricts and confounds the experimental design and subsequent
interpretation of data. Hence, to answer the main objective of this study, this
investigation utilised modified human AECs, NuLi-1 for assessing the associations
Looi 2015
98
between HRV infection with changes in TJ gene, protein expression as well as
alterations in transepithelial permeability.
Initial validation results demonstrated a typical viral titre and time dependant effect on
NuLi-1 viability following HRV-1B infection. Similarly, elevated cellular apoptosis as
well as increased viral replication was also observed when infected with increasing viral
titres of HRV-1B. Collectively, these observations parallel those observed by others in
pAECs (Stevens 2009; Sutanto et al. 2011), where they similarly reported reduced
cellular viability, increased levels of apoptosis as well as increased viral replication
following infection with HRV-1B, thus validating the utilisation of NuLi-1 cells in this
investigation.
Tight junction complexes which are the most apical of the junctional complex family
not only serve to provide intercellular adhesion but also form a continuous permeability
barrier which regulates the trafficking of molecules across the epithelial layer. A myriad
of junctional complex interact to provide structural support for the regulation and
integrity of airway epithelium. Perturbations in these integral TJ complexes could
possibly result in increased epithelial permeability, facilitate trafficking of aeroallergens
or pathogens as well as increased exposure of basolateral receptors to the inhaled air.
Through a focussed qPCR array, this study was able to demonstrate a down-regulation
of 58 key genes with an up-regulation of 26 key genes encoding for epithelial barrier
junction proteins following infection with HRV-1B. In particular, claudin-8 mRNA
(CLDN8), which is responsible for a TJ seal, was found to be significantly down-
regulated following infection, while the pore-forming claudin-2 mRNA (CLDN2), was
found to be up-regulated. However, past evidence have demonstrated a wide disparity in
claudin expression among different tissue types (Morita et al. 1999) and in a study
conducted by Coyne and colleagues, they provide further evidence of respiratory airway
specific expression of claudins (Coyne et al. 2003). Based on these evidence, the
present study focussed on the key gene encoding for claudin-1, occludin and ZO-1 and
from the focussed qPCR array analysis, the data obtained mirror those reported by Yeo
and colleague (Yeo and Jang 2010), where they demonstrated significant decreases in
Looi 2015
99
mRNA levels of claudin-1, occludin and ZO-1, hence, indicating the effects of HRV-1B
on modulating TJ gene expression.
Furthermore, corroborating the gene expression findings, data obtained from this study
similarly demonstrated significant disassembly of membrane claudin-1, occludin and
ZO-1 proteins following infection with HRV-1B. Furthermore, disassembly of these TJ
protein complexes was shown to result in increased transepithelial permeability of
macromolecules. Collectively, these observations, in addition to mirroring those
reported by Sajjan and colleagues (2008), where they also demonstrated the effects of
HRV-1B infection on the dissociation of membrane ZO-1 proteins, also extends those
observations with the investigation of expression of membrane claudin-1 and occludin
proteins. Observations from this study suggest that increase epithelial permeability
could possibly result in increased exposure of basolateral receptors thereby facilitating
increased viral entry and eventual dissemination throughout the respiratory system.
Moreover, this increased transepithelial permeability would also result in co-migration
of bacteria into the sub-epithelial space, an observation reported by Sajjan and co-
workers (2008). Elevated entry of pathogens could potentiate the inflammatory
response, which could exacerbate existing conditions especially in airway diseases such
as cystic fibrosis and asthma.
4.5 Conclusion
This study demonstrated the direct associations between alterations in a number of TJ
genes, protein expression and the impaired functionality of the epithelium in regulating
passage of macromolecules following HRV infection. Data demonstrated that HRV
infection was capable of modulating the expression of TJ genes encoding for claudin-1,
occludin and ZO-1 as well as causing a reduction of membrane protein expression. The
diminished membrane protein expression resulted in increased transepithelial
permeability of macromolecules and when interpreted collectively, strongly suggests
the capacity of HRV in disrupting epithelial integrity and attenuating barrier function.
However, this study utilised a non-asthmatic modified primary human AEC type, thus,
Looi 2015
100
to corroborate these findings in unmodified primary human AECs, further studies
utilising human-derived pAECs are required to determine the association of HRV
infection on modulating TJ gene, protein expression and barrier functionality.
Moreover, this study only investigated the expression and functionality of tight
junctional complexes within a non-asthmatic setting. Given that HRV infection is the
most common trigger of acute asthma in children, further studies to determine whether
there is an intrinsic vulnerability of the epithelium in asthma following HRV infection is
required.
Looi 2015
101
CHAPTER 5: Epithelial barrier integrity and function in paediatric
asthma
5.1 Introduction
The respiratory airway epithelium is the primary interface with the external
environment and under normal circumstances forms a physical barrier complemented
with the mucociliary escalator clearance to form the first line of defence. In addition, it
also represents a dynamic system of innate host defence mechanisms (Diamond et al.
2000; Holgate et al. 2000). During normal function, the epithelium forms a highly
regulated and impermeable barrier through the formation of tight junctions (TJ) at the
apical end of the ciliated columnar cells. In conjunction with TJ, adherens junctions
(AJ), hemidesmosomes and desmosomes form a continuous junctional belt (Farquhar
and Palade 1963) which interconnects with neighbouring cells to enable inter-cell
communication as well as selectively regulating intercellular trafficking of ions, solutes
and cells through the paracellular space (Roche et al. 1993).
Impairment of the epithelial barrier function and dysregulation of the junctional
complex proteins can often result in the development or exacerbation of numerous
diseases. For example, filaggrin is a pivotal protein involved in epidermal
differentiation and the maintenance of an intact skin barrier function. However, a
functional mutation in the gene which encodes for the protein can result in increased
predisposition towards atopic dermatitis (Palmer et al. 2006). Furthermore, a recent
study by De Benedetto and colleagues (2011) has implicated claudin-1 as a novel
susceptibility gene for atopic dermatitis, where it might be involved in barrier
dysfunction and TH2 polarisation. With relevance to airway diseases, due to the
traditional difficulties in accessing tissue from appropriate human populations, the
majority of investigations have focussed on TJ disruptions in response to exogenous
stimuli through immortalised cell lines or animal models. These have included; house
dust mite allergen Dermatophagoides pteronyssinus 1 (Der p1) exposure on
Looi 2015
102
immortalised AEC lines (Wan et al. 2000; Friedlander and Busse 2005; Johnston 2005)
as well as ovalbumin exposure on sensitised mice (Evans et al. 2002; Tillie-Leblond et
al. 2007). Although these studies provide critical insight for the response of TJ to
external stimuli, due to the experimental models used in these studies, little can be
extrapolated to establish TJ profile patterns and investigate how these differ between
healthy and disease states. Surprisingly, despite advancements in the ability to obtain
primary airway cellular tissue (Doherty et al. 2003; Looi et al. 2011), there remains
limited studies that have attempted to profile TJs in healthy and disease states (de Boer
et al. 2008; Xiao et al. 2011). In addition, due to the lack of appropriate controls for
atopic asthmatic cohorts in de Boer and colleagues’ study, the observations from the
study failed to account for the potential impact atopy might exert on TJ profile
expression. Furthermore, the studies by de Boer et al (2008) and Xiao et al (2011)
predominantly utilised adult-derived primary AECs. Hence, there remain limited studies
on basal tight junctional complex gene and protein expression within the paediatric
epithelium. This provides the rationale for assessing whether the abnormality of
dysregulated TJ gene and protein expression is intrinsic or extrinsic to the paediatric
asthmatic epithelium.
Although a previous seminal study has identified intrinsic differences between healthy
and asthmatic epithelium (Kicic et al. 2006), a paucity of data exists on whether these
intrinsic differences extend to the expression of epithelial junctional proteins. Thus, this
study tested the hypotheses that epithelial barrier integrity and function is defective in
children with asthma and that a defective barrier function in asthma is independent of
atopy. Utilising cell cultures obtained from paediatric cohorts, this study was able to
assess basal levels of multiple membrane TJ gene and protein expression in the presence
or absence of atopy. Moreover, basal levels of barrier function were also assessed to
determine basal epithelial permeability of solutes across the epithelial layer.
Collectively, this study attempts to characterise the basal tight junctional complex
profiles in non-asthmatic and asthmatic cohorts in the presence or absence of atopy and
establishes the premise upon which future studies involving injurious stimuli can be
peformed.
Looi 2015
103
5.2 Materials and Methods
The general materials and methods used in this part of the investigation are listed in
detail in Chapter 2
5.2.1 Patient Demographics
As previously described (refer to 2.5.4), four cohorts were used in this study. For this
section of the investigation, samples were obtained from 56 healthy non-atopic (HNA;
23 female, 33 male), 39 healthy atopic (HA; 14 female, 25 male), 13 non-atopic
asthmatic (NAA; 4 female, 9 male) and 25 atopic asthmatic (AA; 10 female, 15 male)
children who were not currently receiving any corticosteroid therapy. Patient
demographics are summarised in Table 5.1.
5.2.2 Cell culture
Maintenance and subsequent sub-culture of paediatric derived pAECs used in this
investigation has been described in detail in Chapter 2 (refer to 2.4.2.2.6 and 2.5.4).
5.2.3 In Cell™ Western
The optimised In Cell™ Western assay, as described in detail within Chapter 3 was
utilised for the determination of basal TJ membrane protein expression.
5.2.4 Immunocytochemistry
Immunocytochemistry of ex vivo pAECs prepared on cytospins has been described in
detail in Chapter 2 (refer to 2.5.6, 2.5.8).
Table 5.1 Demographic of patient cohort categorised according to atopy
HNA – Healthy non-atopic; HA – Healthy atopic; NAA – Non-atopic asthmatic;
AA – Atopic asthmatic; F – Female; M - Male
Phenotype Gender Average Age (yr)
Age Range (yr) Number Total (n)
HNA F 7.2 1.9 – 18.4 23 56
M 5.3 1.4 – 10.9 33
HA F 8.4 2.5 – 15.5 14 39
M 6.9 2.2 – 16.4 25
NAA F 5.7 4.3 – 6.9 4 13
M 5.2 2.2 – 11 9
AA F 8.1 2.9 – 14.7 10 25
M 7.4 3.9 – 13.5 15
Looi 2015
104
5.2.5 Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR)
Extraction and quantification of RNA, as well as the methodology for RT-qPCR has
been described in detail in Chapter 2 (refer to 2.5.13).
5.2.6 Transepithelial permeability assay
The optimised transepithelial permeability assay, as described in detail within Chapter 3
was utilised to elucidate functionality of epithelial TJ membrane expression at basal
level.
5.2.7 Statistical analysis
Before statistical evaluation, all results were tested for population normality and
homogeneity of variance, and where applicable, a Student t test was performed.
Experiments were performed in at least duplicates using a minimum of three patients of
each cohort per experiment. Statistical analyses were performed using a Mann-Whitney
non-parametric test and values presented are mean ± SD. P values less than 0.05 were
considered to be significant.
5.3 Results
5.3.1 Basal tight junction gene expression
Knowing that basal membrane TJ proteins in cultured human AEC lines are expressed
in different levels, basal gene expression of three TJs, claudin-1, occludin, and ZO-1 in
non-asthmatic and asthmatic pAECs were assessed immediately ex vivo following non-
bronchoscope brushing of the airways.
Looi 2015
105
5.3.1.1 Comparison between pAECs of non-asthmatic and asthmatic cohorts
Data generated showed that when mRNA expression was compared between both
cohorts, the asthmatic cohorts demonstrated significantly higher levels of basal TJ
mRNA expression of claudin-1 (1.4-fold) and occludin (2.6-fold) (Figure 5.1 A – B
respectively; p<0.05). However, there was no statistically significant difference in ZO-1
mRNA expression between non-asthmatic and asthmatic cohorts (Figure 5.1 C).
Furthermore, when comparing between the three TJ, mRNA expression of claudin-1
was the most highly expressed in both non-asthmatic (7.86AU ± 0.95) and asthmatic
(11.28AU ± 1.03) cohorts, followed by occludin (non-asthmatic, 2.26AU ± 0.18 ;
asthmatic, 6.04AU ± 0.34) and with mRNA expression of ZO-1 being the least
expressed (non-asthmatic, 1.07AU ± 0.12 ; asthmatic, 1.16AU ± 0.1). (Figure 5.1 A –
C). The difference in mRNA expression of each TJ within the cohorts was observed to
be significant (Figure 5.1 A – C; Appendix E 1 & 2; p<0.05).
5.3.1.2 Comparison between pAECs of non-asthmatic and asthmatic cohorts based on
atopic status
When the non-asthmatic and asthmatic cohorts were further classified according to
atopy, data generated demonstrated significantly lower levels of ex vivo claudin-1
mRNA expression in the pAECHA cohorts (4.2AU ± 0.5) compared to pAECHNA
(10.9AU ± 1.1) (Figure 5.2 A; p<0.05). Interestingly, no significant difference in
claudin-1 mRNA expression was observed between pAECHNA, pAECNAA and pAECAA
cohorts. However, when pAECHA was compared to pAECNAA and pAECAA,
significantly higher levels of claudin-1 gene expression was observed in both pAECNAA
(11.1AU ± 1.5) and pAECAA (14.5AU ± 3.3) cohorts (Figure 5.2 A; p<0.05). Claudin-1
mRNA expression was not observed to be significantly different between pAECHA and
pAECAA.
In contrast, ex vivo occludin mRNA expression was observed to be significantly higher
in pAECHA (2.6AU ± 0.2), pAECNAA (5.9AU ± 0.6) and pAECAA (6.2AU ± 0.3) when
compared to pAECHNA (1.8AU ± 0.2). Similarly, occludin mRNA expression was also
Figure 5.1 Ex vivo mRNA expression of TJs from pAECs of non-asthmatic and
asthmatic cohorts: mRNA expression of claudin-1 (green), occludin (blue) and ZO-1
(red) in pAECs of non-asthmatic and asthmatic cohorts was quantified by RT-qPCR as
described (refer to 5.2.4). (A) mRNA expression of claudin-1 was significantly higher
in the asthmatic cohort compared to the non-asthmatic counterpart. (B) mRNA
expression of occludin was observed to be significantly higher in the asthmatic cohort.
(C) No significant differences were observed between the two cohorts for expression of
ZO-1. (A – C) mRNA expression of claudin-1 was most abundantly expressed
compared to occludin and ZO-1. *Statistical significance relative to non-asthmatic
cohort (p < 0.05). Statistical significance between tight junctions (Appendix E; p<0.05).
Gen
e ex
pres
sion
(rel
ativ
e to
PPI
A)
Non-asthmatic Asthmatic0
5
10
15
20 *
n=22 n=13
Gen
e ex
pres
sion
(rel
ativ
e to
PPI
A)
Non-asthmatic Asthmatic0
2
4
6
8
10 *
n=42 n=15
Gen
e ex
pres
sion
(rel
ativ
e to
PPI
A)
Non-asthmatic Asthmatic0
1
2
3
4
5
n=29 n=16
A
B
C
Figure 5.2 Ex vivo mRNA expression of TJs in pAECS of non-asthmatic and
asthmatic cohorts with each cohort further categorised based on atopy: mRNA
expression of claudin-1 (green), occludin (blue) and ZO-1 (red) in each phenotypic
cohort was quantified by RT-qPCR as described (refer to 5.2.4). (A) mRNA expression
of claudin-1 was significantly lower in pAECHA compared to pAECHNA. There was no
significant difference between pAECHNA, pAECNAA and pAECAA. However, both
pAECNAA and pAECAA demonstrated significantly higher expression levels when
compared to pAECHA while no significant difference was observed between pAECNAA
and pAECAA. (B) In contrast, mRNA expression of occludin was significantly higher in
pAECHA, pAECNAA and pAECAA compared to pAECHNA. Moreover, pAECNAA and
pAECAA demonstrated significantly higher mRNA expression of occludin compared to
pAECHA. There was no significant difference in mRNA expression between pAECNAA
and pAECAA. (C) mRNA expression of ZO-1 was observed to be higher in pAECHA,
pAECNAA and pAECAA compared to pAECHNA. When compared to pAECHA, lower ZO-
1 expression was observed in pAECNAA while pAECAA showed higher expression.
Similarly, mRNA expression of ZO-1 was also higher in pAECAA compared to
pAECNAA. However, statistical analysis did not demonstrate any significant differences
in mRNA expression of ZO-1 between the phenotypic cohorts. (A – C) mRNA
expression of claudin-1 was significantly most abundantly expressed in all phenotypic
cohorts compared to occludin and ZO-1. *Statistical significance (p<0.05). Statistical
significance between tight junctions (Appendix F; p<0.05).
Gen
e ex
pres
sion
(rel
ativ
e to
PPI
A)
HNA HA NAA AA0
10
20
30
40
50
*
**
n=12 n=10 n=7 n=6
Gen
e ex
pres
sion
(rel
ativ
e to
PPI
A)
HNA HA NAA AA0
2
4
6
8
10
n=17 n=7n=25 n=8
*
*
* **
Gen
e ex
pres
sion
(rel
ativ
e to
PPI
A)
HNA HA NAA AA0
1
2
3
4
n=15 n=8n=14 n=8
A
B
C
Looi 2015
106
observed to be significantly higher in pAECNAA and pAECAA in comparison to pAECHA
(Figure 5.2 B; p<0.05). No significant statistical difference was shown between
occludin mRNA expression in pAECNAA and pAECAA cohorts.
When ZO-1 mRNA expression was assessed in all four cohorts, higher levels of ZO-1
mRNA expression were observed in pAECHA (1.3AU ± 0.25), pAECNAA (1.1AU ±
0.13) and pAECAA (1.5AU ± 0.32) cohorts compared to pAECHNA (1AU ± 0.19).
However, the data obtained did not demonstrate any statistical significance between all
phenotypic cohorts (Figure 5.2 C).
When assessing the level of mRNA expression of each TJ within the individual
phenotypic cohort, mRNA expression of claudin-1 was observed to be the highest,
followed by occludin and ZO-1. The same expression profile was observed in all 4
phenotypic cohorts and was of significance (Figure 5.2 A – C; Appendix F 1 – 4;
p<0.05).
5.3.2 Basal tight junction protein expression
Having shown differences in ex vivo TJ gene expression, ex vivo protein levels of the
same three TJ were assessed to determine basal expression levels. Membrane claudin-1,
occludin and ZO-1 TJ protein expression were determined via immunocytochemistry
staining of cells obtained ex vivo.
5.3.2.1 Comparison between pAECs of non-asthmatic and asthmatic cohorts
Immunocytochemical staining of pAECs from the non-asthmatic cohort demonstrated
stronger intensities of membrane claudin-1, occludin and ZO-1 TJ protein in ex vivo
cytospin samples in comparison with pAECs from the asthmatic cohort (Figure 5.3).
When comparing between the TJs within each cohort, strongest intensity of membrane
claudin-1 was observed followed by occludin with membrane ZO-1 showing the lowest
intensity in pAECs of the non-asthmatic cohort (Figure 5.3 – Non-asthmatic).
Figure 5.3 Ex vivo membrane protein expression of TJs from pAECs of non-asthmatic and asthmatic cohorts: Cytospins were prepared from
cells obtained from non-asthmatic and asthmatic cohorts as previously described (refer to 2.5.6). Briefly, slides were incubated with primary antibodies
to claudin-1 (CLDN-1), occludin (OCLN) and zonula occluden-1 (ZO-1) for 24 h at 4°C followed by fluorescently conjugated secondary antibodies
(FITC in green) for a similar period. The slides were counterstained with DAPI, which illuminates cellular nuclear material (blue).
Immunocytochemical staining of claudin-1, occludin and ZO-1 respectively in a representative sample of pAECs from non-asthmatic cohort
demonstrates strong membrane protein expression of each tight junction protein. In contrast, immunocytochemical staining of claudin-1, occludin and
ZO-1 respectively within the asthmatic cohort demonstrates a marked decrease in membrane protein expression of each tight junction. Images are
representative of n = 3 (Total magnification 100x).
Non-asthmatic Asthmatic
CLDN-1
OCLN
ZO-1
CLDN-1
OCLN
ZO-1
DAPI
DAPI
DAPI
DAPI
DAPI
DAPI
Looi 2015
107
Interestingly, in pAECs of the asthmatic cohort, strongest intensity was observed for
membrane occludin, while claudin-1 and ZO-1 showed similar diminished intensities
(Figure 5.3 – Asthmatic).
5.3.2.2 Comparison between pAECs of non-asthmatic and asthmatic cohorts based on
atopic status
When pAECs from the non-asthmatic and asthmatic cohorts were further classified
according to atopy, immunocytochemical staining of cytospins demonstrated strongest
intensity for membrane claudin-1 within the pAECHNA cohorts, followed by similar
intermediate intensities in both pAECHA and pAECAA cohorts, while markedly
diminished intensity was observed for pAECNAA cohorts (Figure 5.4 – CLDN-1). A
similar profile of intensity staining was observed for membrane occludin (Figure 5.4 –
OCLN). Comparable strong intensity was also observed for membrane ZO-1 in
pAECHNA cohorts, however, pAECHA cohort showed a marked decrease in intensity
followed by pAECAA cohort with pAECNAA cohort showing minimal intensity for
membrane ZO-1 TJ protein (Figure 5.4 – ZO-1).
When assessing the level of intensities of the TJ protein within each phenotypic cohort,
the results demonstrated strongest intensity of membrane claudin-1, followed by
occludin and subsequently ZO-1 within the pAECHNA cohort (Figure 5.4 – HNA).
However, in the pAECHA cohort, similar levels of intensity were observed for both
membrane occludin and ZO-1 with the lowest intensity observed in membrane claudin-
1 (Figure 5.4 – HA). Interestingly, strongest intensity was observed for membrane
occludin followed by membrane claudin-1 with membrane ZO-1 showing markedly
decreased intensity in the pAECAA cohort (Figure 5.4 – AA). However, within the
pAECNAA cohorts, strongest intensity was observed for membrane claudin-1 while both
membrane occludin and ZO-1 demonstrated similar markedly diminished levels of
intensity (Figure 5.4 – NAA).
Figure 5.4 Ex vivo membrane protein expression of TJs of pAECs from non-
asthmatic and asthmatic cohorts with each cohort further categorised based on
atopy: Cytospins were prepared from cells obtained from each phenotypic cohorts as
previously described (refer to 2.5.6). Briefly, slides were incubated with primary
antibodies to claudin-1 (CLDN-1), occludin (OCLN) and zonula occluden-1 (ZO-1) for
24 h at 4°C followed by fluorescently conjugated secondary antibodies (FITC in green)
for a similar period (refer to 5.2.4). Immunocytochemical staining of claudin-1,
occludin and ZO-1 respectively in a representative sample of pAECHNA demonstrates
the strongest membrane protein expression of each tight junction protein while
intermediate levels of membrane claudin-1, occludin and ZO-1 expression of each tight
junction protein were observed in representative samples of pAECHA and pAECAA
respectively. Immunocytochemical staining of membrane claudin-1, occludin and ZO-1
respectively in a representative sample of pAECNAA demonstrates the lowest expression
of each tight junction protein among the four phenotypic cohorts. Images are
representative of n = 3 (Total magnification 100x).
I
HNA HNA HNA
HA HA HA
AA AA AA
NAA NAA NAA
CLDN-1 OCLN ZO-1
Looi 2015
108
5.3.3 In vitro tight junction protein expression
Differences in membrane TJ protein expression between pAECs of non-asthmatic and
asthmatic cohorts have been previously demonstrated via immunocytochemical
staining. However, to validate this observation as well as to semi-quantify expression
levels of the three membrane TJ proteins, in vitro monolayer cultures of non-asthmatic
and asthmatic pAECs, in conjunction with an In-Cell™ Western assay was utilised for
this assessment.
5.3.3.1 Comparison between pAECs of non-asthmatic and asthmatic cohorts
Data obtained demonstrated that membrane claudin-1 expression in pAECs of the non-
asthmatic cohort was significantly higher (0.09AU ± 0.04) in contrast to pAECs of the
asthmatic cohort (0.01AU ± 0.005) (Figure 5.5 A; p<0.05). Similarly, membrane
occludin expression was observed to be significantly higher (0.09AU ± 0.02) in pAECs
of the non-asthmatic cohort compared to their asthmatic counterpart (0.03AU ± 0.006)
(Figure 5.5 B; p<0.05). Significantly higher levels of membrane ZO-1 was observed in
pAECs from the non-asthmatic cohort (0.02AU ± 0.005) in comparison to the asthmatic
cohort (0.01AU ± 0.002) (Figure 5.5 C; p<0.05).
When assessing membrane TJ protein expression of pAECs within the non-asthmatic
cohort, results demonstrated similar levels of membrane claudin-1 (0.09AU ± 0.04) and
occludin (0.09AU ± 0.02) expression with membrane ZO-1 showing the lowest level of
expression (0.02AU ± 0.005). No significant difference in membrane claudin-1 and
occludin expression was observed in pAECs of the non-asthmatic cohort. However,
significance was observed for the difference in membrane TJ protein expression
between occludin and ZO-1 (Figure 5.5 B – C, Non-asthmatic; Appendix G1; p<0.05).
In contrast, pAECs from the asthmatic cohort demonstrated significantly lower levels of
membrane claudin-1 expression (0.01AU ± 0.005) when compared to occludin (0.03AU
± 0.006) (Figure 5.5 A – B, Asthmatic; Appendix G2; p<0.05). No significant
difference in membrane claudin-1 and ZO-1 expression was observed in pAECs of the
asthmatic cohort. However, membrane occludin expression (0.03AU ± 0.006) was
Figure 5.5 Basal membrane TJ protein expression in pAECs from non-asthmatic
and asthmatic cohorts: pAECs seeded on 96-well micro-titre plates and grown to
confluence were treated as previously mentioned (refer to 2.5.10) and membrane TJ
protein expression assessed via a previously optimised In-Cell™ Western assay as
described (refer to 3.2.4). (A) pAECs from asthmatic cohort expressed significantly
lower levels of membrane TJ claudin-1. (B) Membrane occludin was also significantly
lower in pAECs of asthmatic cohort compared to non-asthmatic. (C) Similarly, pAECs
from asthmatic cohort also showed lower levels of membrane ZO-1 expression when
compared to pAECs of non-asthmatic cohort. (A-C) Similar levels of membrane protein
expression were observed for claudin-1 and occludin in pAECs of non-asthmatic cohort
and was significantly elevated compared to membrane ZO-1. Interestingly, pAECs of
asthmatic cohort demonstrated significantly elevated level of basal membrane occludin
protein expression compared to claudin-1 and ZO-1. No significant difference in
membrane protein expression was observed between claudin-1 and ZO-1 in pAECs of
asthmatic cohort. Data were normalised to cell numbers and presented as mean ± SD.
*Statistical significance relative to non-asthmatic cohort (p<0.05). Statistical
significance between TJ protein in each cohort (Appendix G; p<0.05).
Non-asthmatic Asthmatic0.00
0.05
0.10
0.15
n=18 n=7
*
Mem
bran
e pr
otei
n ex
pres
sion
(Arb
itary
uni
ts)
Non-asthmatic Asthmatic0.00
0.05
0.10
0.15
n=20
*
n=11
Mem
bran
e pr
otei
n ex
pres
sion
(Arb
itary
uni
ts)
Non-asthmatic Asthmatic0.00
0.05
0.10
0.15
n=20 n=7
*
Mem
bran
e pr
otei
n ex
pres
sion
(Arb
itary
uni
ts)
A
B
C
Looi 2015
109
observed to be significantly higher compared to ZO-1 expression (0.01AU ± 0.002) in
pAECs of the asthmatic cohort (Figure 5.5 B – C, Asthmatic; Appendix G2; p<0.05).
5.3.3.2 Comparison between pAECs of non-asthmatic and asthmatic cohorts based on
atopic status
When the non-asthmatic and asthmatic cohorts were further classified according to
atopy, data demonstrated lower membrane claudin-1 protein expression in the pAECHA
(0.014AU ± 0.002), pAECNAA (0.006AU ± 0.003) and pAECAA (0.011AU ± 0.003)
cohorts when compared to pAECHNA (0.033AU ± 0.005) cohort. Significance was
observed in both pAECHA and pAECAA compared to pAECHNA (Figure 5.6 A; p<0.05).
In addition, membrane claudin-1 expression was observed to be lower in both the
pAECNAA (2.3-fold) and the pAECAA (1.3-fold) cohorts in comparison with the pAECHA
cohort. Furthermore, a lower level of membrane claudin-1 expression was observed in
the pAECNAA (1.8-fold) cohort in contrast with the pAECAA cohort. However, due to the
limited availability of pAECNAA, statistical analysis could not be performed for claudin-
1 expression to determine the level of significance.
Similarly, occludin expression was observed to be significantly lower in the pAECHA
(0.053AU ± 0.009), pAECNAA (0.023AU ± 0.013) and pAECAA (0.04AU ± 0.007)
cohorts in comparison with pAECHNA (0.148AU ± 0.038) cohort (Figure 5.6 B; p<0.05).
Furthermore, membrane occludin expression was observed to be lower in both
pAECNAA (2.3-fold) and pAECAA (1.3-fold) cohorts in comparison with the pAECHA
cohort. In addition, a lower level of membrane occludin expression was observed in the
pAECNAA (1.7-fold) cohort in contrast with the pAECAA cohort. However, these
differences in membrane expression were not significant.
When ZO-1 expression was assessed, results generated were similar to claudin-1 and
occludin, with lower expression in the pAECHA (0.017AU ± 0.002), pAECNAA
(0.011AU ± 0.004) and pAECAA (0.008AU ± 0.002) cohorts in contrast to the pAECHNA
(0.04AU ± 0.01) cohort (Figure 5.6 C; p<0.05). Comparison of ZO-1 protein expression
Figure 5.6 Basal membrane TJ protein expression in pAECs from non-asthmatic
and asthmatic cohorts with each cohort further categorised based on atopy: pAECs
from each phenotypic cohort, seeded on 96-well micro-titre plates and grown to
confluence were treated as previously mentioned (refer to 2.5.10) and membrane TJ
protein expression assessed via a In-Cell™ Western assay as described (refer to 3.2.4).
Due to limited numbers of pAECNAA, the cohort was excluded from statistical analysis
for claudin-1 and ZO-1 membrane expression. (A) As observed, membrane claudin-1
expression was highest within the pAECHNA cohorts and significant differences were
shown when compared to pAECHA and pAECAA cohorts. However, there was no
significant difference in membrane protein expression between pAECHA and pAECAA.
(B) Similarly, membrane occludin expression was highest within the pAECHNA cohort
and was significantly elevated when compared to pAECHA, pAECNAA and pAECAA
cohorts. No significant differences were observed between pAECHA, pAECNAA and
pAECAA cohorts. (C) Membrane claudin-1 expression was similarly observed to be
elevated in pAECHNA compared to pAECHA, pAECNAA and pAECAA. However this was
only significant for pAECHA and pAECAA. Interestingly, membrane ZO-1 expression
was significantly higher in pAECHA compared to pAECAA cohorts. (A – C) Membrane
occludin was observed to be most expressed in all phenotypic cohorts compared to
claudin-1 and ZO-1 and this was shown to be significant for pAECHNA, pAECHA and
pAECAA cohorts. No significant difference in membrane expression was observed for
all phenotypic cohorts between membrane claudin-1 and ZO-1 proteins. Data were
normalised to cell numbers and presented as mean ± SD. *Statistical significance
relative to pAECHNA (p<0.05). Statistical significance between TJ protein in each
phenotypic cohort (Appendix H; p<0.05).
Mem
bran
e pr
otei
n ex
pres
sion
(Arb
itary
uni
ts)
HNA HA NAA AA0.00
0.05
0.10
0.15
0.20
n=8 n=5n=2n=10
**
Mem
bran
e pr
otei
n ex
pres
sion
(Arb
itary
uni
ts)
HNA HA NAA AA0.00
0.05
0.10
0.15
0.20
n=10 n=7n=4n=10
**
*
Mem
bran
e pr
otei
n ex
pres
sion
(Arb
itary
uni
ts)
HNA HA NAA AA0.00
0.05
0.10
0.15
0.20
n=10 n=5n=2n=10
***
A
B
C
Looi 2015
110
between the pAECHA, pAECNAA and pAECAA cohorts demonstrated lower expression in
both pAECNAA (1.5-fold) and pAECAA (2.1-fold) cohorts and this was observed to be
significant for the pAECAA cohort. Interestingly, in contrast to membrane claudin-1 and
occludin expression, membrane ZO-1 expression was observed to be lower in the
pAECAA (1.4-fold) cohort compared to the pAECNAA. However, due to the limited
availability of pAECNAA, statistical analysis could not be performed for ZO-1
expression to determine the level of significance.
5.3.4 In vitro transepithelial permeability
Knowing that epithelial paracellular permeability is an indicator of a functional barrier,
transepithelial permeability towards two different sizes of inert macromolecules was
also performed at baseline. The flux of the fluorescently labelled inert macromolecule
through the epithelial monolayer allowed for barrier functionality to be determined.
5.3.4.1 Comparison between pAECs of non-asthmatic and asthmatic cohorts
Results generated demonstrates increased levels of basal transepithelial permeability to
both FITC-dextran of both 4 (344.9 x 10-4 cm/sec ± 37.3) and 20 kDa (130.2 x 10-4
cm/sec ± 41.9) for the asthmatic cohort compared to the non-asthmatic cohort (302.9 x
10-4 cm/sec ± 20.5 and 96.5 x 10-4 cm/sec ± 26.8 respectively) (Figure 5.7 A). However,
no statistical significance between the two cohorts was observed. When assessing
epithelial permeability to the different sized inert macromolecule within each cohort, a
significantly higher level of transepithelial permeability for FITC-dextran of 4 kDa was
observed in the non-asthmatic (302.9 x 10-4 cm/sec ± 20.5) and asthmatic (344.9 x 10-4
cm/sec ± 37.3) cohort in comparison with FITC-dextran of 20 kDa (96.5 x 10-4 cm/sec ±
26.8 and 130.2 x 10-4 cm/sec ± 41.9 respectively) (Figure 5.7 A; p<0.05).
Looi 2015
111
5.3.4.2 Comparison between pAECs of non-asthmatic and asthmatic cohorts based on
atopic status
When the non-asthmatic and asthmatic cohorts were further classified according to
atopy, interestingly, the results generated demonstrated lower permeability to FITC-
dextran of 4 kDa in the pAECHA (1.3-fold, 272.5 x 10-4 cm/sec ± 14.6), pAECNAA (79.4
x 10-4 cm/sec ± 0.9) and pAECAA (344.9 x 10-4 cm/sec ± 37.3) cohorts compared to the
pAECHNA (370.3 x 10-4 cm/sec ± 13.2) cohort and this was observed to be significant
for pAECHA (Figure 5.7 B – HA; p<0.05). Transepithelial permeability of pAECNAA to
FITC-dextran 4 kDa was observed to be lower (3.4-fold) than pAECHA. However,
pAECAA demonstrated slightly higher permeability (1.3-fold) when compared to
pAECHA. Moreover, when comparing permeability between pAECNAA and pAECAA
cohort, lower epithelial permeability was observed within the pAECNAA cohort (4.3-
fold). Despite these observations, due to the limited availability of pAECNAA, statistical
analysis could not be performed to determine the level of significance.
Transepithelial permeability to FITC-dextran 20 kDa was observed to be similarly
lower in pAECHA (179.7 x 10-4 cm/sec ± 53.9), pAECNAA (24.4 x 10-4 cm/sec ± 6.2) and
pAECAA (183.6 x 10-4 cm/sec ± 44.1) cohorts when compared to the pAECHNA cohort
(201.7 x 10-4 cm/sec ± 34.1) (Figure 5.7 B). However, this was not observed to be
significant. Transepithelial permeability of pAECNAA to FITC-dextran 20 kDa was
observed to be lower (7.3-fold) than pAECHA. However, pAECAA demonstrated similar
levels of permeability when compared to pAECHA. Moreover, when comparing
permeability between pAECNAA and pAECAA cohorts, lower epithelial permeability was
observed for the pAECNAA cohort (7.5-fold). However, statistical analysis did not
demonstrate any significant differences in transepithelial permeability to FITC-dextran
20 kDa between the cohorts. Due to limited numbers of pAECNAA, this cohort was
precluded from analysis.
Figure 5.7 Basal transepithelial permeability in pAECs from non-asthmatic and
asthmatic cohorts and with each cohort further categorised based on atopy: pAECs
from non-asthmatic and asthmatic cohorts, seeded onto Corning transwell inserts and
grown to confluence were treated as previously mentioned (refer to 2.5.11). A
transepithelial permeability assay as described was performed to determine basal
epithelial permeability to FITC-dextran 4 kDa and 20 kDa (refer to 3.3.4). (A) pAECs
from asthmatic cohort demonstrated higher basal transepithelial permeability to both
FITC-dextran 4 kDa and 20 kDa but no significance was observed when compared to
the non-asthmatic cohort. Permeability to FITC-dextran 4 kDa was observed to be
significantly greater in both non-asthmatic and asthmatic cohorts when compared to
FITC-dextran 20 kDa. (B) pAECs further categorised based on atopy demonstrate lower
transepithelial permeability to FITC-dextran 4 kDa in pAECHA, pAECNAA and pAECAA
cohorts and this was shown to be significant for pAECHA and pAECAA. Due to the low
sample size of pAECNAA, this cohort was excluded from statistical analysis. Lower
transepithelial permeability to FITC-dextran 20 kDa was observed in pAECHA,
pAECNAA and pAECAA cohorts compared to pAECHNA however, this was not shown to
be significant. Permeability to FITC-dextran 4 kDa was observed to be greater in all
phenotypic cohorts compared to 20 kDa, however, significance was only observed for
pAECHNA, pAECHA and pAECAA cohorts. *Statistical significance relative to pAECHNA
(p<0.05). # Statistical significance between FITC-dextran 4 and 20 kDa (p<0.05).
Non-asthmatic Asthmatic0
100
200
300
400
5004kDa20kDa
Papp
coe
ffici
ent (
cm/s
ec) x
10-4
n=10 n=7
#
#
HNA HA NAA AA0
100
200
300
400
5004kDa20kDa
Papp
coe
ffici
ent (
cm/s
ec) x
10-4
n=5 n=5 n=2 n=5
#
*#
#
A
B
Looi 2015
112
5.4 Discussion
Changes in transepithelial permeability are often a feature of airway inflammation,
however, the exact molecular mechanisms involved in the regulation of epithelial
permeability remain poorly understood. A pivotal component of the conductive airway
epithelium is the apico-lateral junctional complexes consisting of tight and adherens
junctions, which contributes significantly to the barrier function as well as providing a
link to the cellular cytoskeleton via various adaptor proteins. Although the presence of
TJs between epithelial cells has long been recognised, there still remains a lack of
understanding of the regulation of junctional complex assembly and disassembly and
the resulting changes in epithelial permeability in respiratory diseases such as asthma.
Previous studies have shown the effects of TJ gene and protein expression following
various insults (Sajjan et al. 2008; Comstock et al. 2011; Xiao et al. 2011) in both non-
asthmatic and asthmatic epithelium, however, these studies were performed in either
established epithelial cell lines or adult-derived primary AECs. Currently, there exists a
paucity of data on the intrinsic gene and protein expression of epithelial tight junctional
complexes particularly within the paediatric asthmatic population. This investigation
attempted to provide new insights into the presently limited understanding on baseline
expression of epithelial membrane TJ complexes in paediatric asthma.
Results from this parallel ex vivo and in vitro study demonstrated significant increases
in ex vivo mRNA expression of claudin-1 and occludin in pAECs of the asthmatic
cohorts in contrast to the non-asthmatic counterparts, while, ZO-1 gene expression was
not found to be significantly different. These findings extend those of Xiao and
colleagues (2011), who have previously reported an increase in mRNA expression of
occludin but not ZO-1 in adult individuals with asthma. Interestingly, when these
cohorts were sub-categorised based upon atopy, mRNA expression of claudin-1 was
observed to be significantly higher in the atopic asthmatic cohort in contrast to the
healthy atopic phenotype. The mRNA expression of occludin was also significantly
higher in the asthmatic cohort, irrespective of atopy, when compared to the non-
asthmatic cohort. This suggests that the presence of asthma might be characterised by an
Looi 2015
113
altered expression of specific TJ complex genes. Furthermore, when comparing mRNA
expression between non-atopic and atopic cohorts, claudin-1 was revealed to be
significantly lower in the atopic compared to the non-atopic phenotype within the non-
asthmatic cohort. This is consistent with an earlier work in individuals with atopic
dermatitis conducted by De Benedetto and colleagues (2011), where they showed
reduced mRNA expression levels of claudin-1 and claudin-23 compared to healthy
subjects.
Elevated mRNA expression of occludin in non-asthmatic atopic patients from this study
contrasts that of De Benedetto and colleagues, highlighting that the possible difference
in expression could be attributed to the different epithelial sites assessed, the epidermal
layer of the skin in De Benedetto’s study in contrast with the respiratory bronchial
epithelium in the present study. In addition, differences in age range as De Benedetto’s
study utilised an adult cohort in contrast to this study, which utilised a paediatric cohort.
The dichotomy in occludin mRNA expression could also be partially explained by the
complex interactions between the myriad of junctional proteins. The current lack of data
provides the rationale for the assessment of basal TJ mRNA expression in the AECs of
non-asthmatic or asthmatic paediatric cohorts with or without atopy.
Within the asthmatic cohort, mRNA expression of claudin-1, occludin and ZO-1 was
higher in the atopic asthmatic phenotype in comparison to non-atopic asthmatic. This
suggests that although atopy might be implicated in the significant augmentation of TJ
protein expression, as demonstrated by De Benedetto and colleagues in non-asthmatic
individuals, the precise role of atopy in altering TJ complex expression, whether causal,
co-contributing or a consequence of asthma especially within asthmatic cohorts
warrants further investigation.
Interestingly, when membrane TJ protein expression was assessed, ex vivo expression of
claudin-1, occludin and ZO-1 proteins were markedly lower within the asthmatic
compared to the non-asthmatic cohort. This observation was further validated with in
vitro analysis of membrane TJ proteins in submerged paediatric derived pAECs cultures
from non-asthmatic and asthmatic cohorts, which is consistent to those observed by
Looi 2015
114
Xiao and colleagues (2011) However, this study is unique with regards to several
factors. The children with asthma are all mild asthmatics who have not taken either
inhaled β2-agonists or corticosteroids in the past six months prior to sampling. This
enables the investigation of intrinsic TJ protein expression to be as similar to unaltered
conditions as possible. In addition, classification based on atopic status within non-
asthmatic and asthmatic cohorts, provides further insights into the potential differences
in intrinsic TJ protein expression. However, one drawback to this approach is the
limited availability of children who are non-atopic asthmatic. Nonetheless, despite low
numbers of non-atopic asthmatic subjects, data from this study demonstrated that
membrane TJ protein expression of claudin-1, occludin and ZO-1 progressively
diminishes with the involvement of either atopy, asthma or a combination of both, an
observation validated with in vitro analysis of membrane TJ proteins in submerged
paediatric derived pAECs cultures from each phenotypic cohort. When comparing
between non-atopic and atopic phenotypes within the non-asthmatic cohort, lower
membrane claudin-1 expression in the atopic phenotype corroborates the observation of
a decreased mRNA expression of claudin-1, an observation in line with those reported
by De Benedetto and colleagues showing reduced expression of claudin-1 protein in
patients with atopic dermatitis compared to non-atopic individuals.
A decrease in membrane occludin expression was observed in the non-asthmatic atopic
phenotype which contrasts observations of an elevated mRNA expression of occludin,
suggesting that the effect on membrane occludin expression involves a post-
transcriptional mechanism, an observation which mirrors those of Xiao and co-workers
(2011). Collectively, this disparity in mRNA and protein expression could suggest
probable post-transcriptional regulation by transcription factors such as Snail (Ohkubo
and Ozawa 2004) or other factors such as cytokines IL-4, IL-13 and IFN-γ (Ahdieh et
al. 2001; Bruewer et al. 2005), resulting in either increased TJ protein internalisation
and redistribution or disruption in their interaction with the scaffolding proteins. In
addition, host microRNAs have also been identified to play a regulatory role. For
example, miR-122a, which when overexpressed due to increased TNF-α levels, has
been demonstrated to result in degradation of occludin, thereby contributing to
increased intestinal epithelial permeability (Ying et al. 1991; Bradding et al. 1994; Ye
Looi 2015
115
et al. 2011). In another recent study, Yang and colleagues (2014) showed that
repression of claudin-1 expression post-transcriptionally by miR-155 resulted in
decreased epithelial barrier functionality (Yang et al. 2014). Although microRNAs
functions have been studied in human disease, their roles in the control of signalling
pathways in epithelial cells, their impact on the development and phenotypic stability of
immune cells as well as their regulation of inflammation in allergic diseases such as
asthma have only recently been uncovered (Makeyev and Maniatis 2008; Djuranovic et
al. 2011). Moreover, due to the numerous biological functions microRNAs regulate,
modulating their expression could potentially provide rationale for new therapeutic
regimen. MicroRNAs have already been shown to limit allergic airway inflammation
mouse models (Mattes et al. 2009; Collison et al. 2011; Collison et al. 2011; Qin et al.
2012), inhibition of hepatitis C virus (HCV) replication in primates (Lanford et al.
2010) or suppression of tumour metastasis in mouse models (Liu et al. 2011; Yang et al.
2012). Furthermore, the dichotomy in TJ mRNA and protein expression could also be
explained by a probable compensatory effect via other epithelial junctional complexes.
This has been demonstrated in occludin knock-out studies showing that occludin was
not required for the formation of morphologically intact TJs and strongly suggested that
other junctional complexes were capable of compensating for the lack of occludin
expression (Saitou et al. 1998; Saitou et al. 2000). Strikingly, unlike membrane claudin-
1 and occludin protein expression, which were observed to be lower in the non-atopic
asthmatic phenotype, membrane ZO-1 expression was observed to be lower in the
atopic asthmatic phenotype, an observation which parallels that of de Boer and
colleagues (2008). However, due to the limited availability of non-atopic asthmatic
participants, the elevated expression of membrane claudin-1 and occludin protein as
well as the diminished expression of membrane ZO-1 protein expression in atopic
asthmatic cannot be fully attributed to atopy rather than asthma, a limitation which
needs to be addressed in future.
When these differences in basal membrane TJ protein expression were translated into a
functional context, data from this study demonstrated high permeability to
macromolecules in submerged monolayer pAECs cultures of both non-asthmatic and
asthmatic cohort. However, in both cohorts, permeability towards the 20 kDa dextran
Looi 2015
116
was lower, compared to 4 kDa, suggesting that for aeroallergens, environmental
particles or respiratory viruses to breach the epithelial barrier, these pathogens or their
fragments must have relatively small molecular weights. Interestingly, when the non-
asthmatic cohort was sub-categorised based on atopy, significantly diminished
permeability to 4 kDa dextran pAECHA compared to pAECHNA cohort was observed.
This contrasts with observations reported by De Benedetto and colleagues (2011),
where they reported increased permeability of FITC-conjugated albumin in the
epidermal cells of adult individuals with atopic dermatitis. Furthermore, De Benedetto
and colleagues also reported lower transepithelial electrical resistance measurements
within the same sample population, an observation consistent with the increase in
transepithelial permeability. The contrasting observations presented in this study
suggest potential differences in membrane tight junctional complex permeability
between different epithelium despite similar mRNA and protein expression profiles
reported. In addition, samples obtained from a paediatric population in this study in
contrast with an adult population indicate that a less environmentally exposed
epithelium may translate to a less immunologically active epithelium hence, reduced
impact on epithelial TJ dissociation thereby maintaining epithelial permeability.
When comparing pAECHNA and the pAECNAA cohorts, the pAECNAA cohorts
demonstrated less epithelial permeability to both sizes of the inert macromolecule.
Although pAECAA cohorts demonstrates increased levels of epithelial permeability
compared to the pAECNAA cohorts, indicating a possibility of asthma in altering
epithelial tight junctional complex mRNA, protein expression as well as function, the
present limited number of pAECNAA samples highlights the limitation of this study as
well as the need for attention when attempting to elucidate the effects of asthma on in
vitro epithelial TJ complex protein expression and function.
Despite current limitations of this investigation such as the use of submerged monolayer
culture for the assessment of epithelial permeability, preliminary observations have
provided the rationale as well as various interesting avenues for future studies. This
would involve the assessment of not only additional epithelial junctional complexes to
profile basal expression levels of both mRNA and protein, but also the extent of atopy
Looi 2015
117
as a contributing factor and its association with epithelial junctional complex
expression. This could provide further insights into understanding potential
compensatory responses by other junctional complexes to maintain a protective barrier
against further environmental insult.
5.5 Conclusion
This study was able to distinguish intrinsic differences in basal expression of epithelial
TJ mRNA and protein between non-asthmatic and asthmatic cohorts that might partially
explain the increased susceptibility to aeroallergen sensitisation and pathogenic
challenges in children with asthma. Furthermore, the results demonstrate differences
between non-atopic and atopic phenotypes in the non-asthmatic cohort, suggesting that
the presence of atopy might be a contributor to an increased predisposition towards
membrane TJ protein disassembly. However, due to limited availability of non-atopic
asthmatic subjects, the relationship between atopy and asthma, whether solely or co-
contributing to membrane TJ protein disassembly certainly requires further
investigation. Furthermore, when alterations in membrane TJ protein were translated
into a functional aspect, although non-significant, differences in transepithelial
permeability between non-asthmatic and asthmatic cohorts and subsequently, individual
phenotypes, were observed. However, in all phenotypes, transepithelial permeability
towards small-sized macromolecules was significantly higher, which would indicate the
increased susceptibility for various injurious stimuli such as aeroallergens, haptens or
pathogens to traverse the epithelium based on molecular size. Additional samples would
provide greater determination of the differences between individual phenotypes and
enable future investigations into TJ protein expression and barrier functionality in
response to injurious stimuli and addressing the limitations within the current
knowledge in epithelial tight junctional complex biology.
Looi 2015
118
CHAPTER 6: Effects of human rhinovirus on epithelial barrier
integrity and function in vitro and its role in paediatric asthma
6.1 Introduction
Respiratory viruses have been identified as causal agents of epithelial barrier
compromisation, altered innate immunity defences and modulation of cell membranes
(Jacoby et al. 1988; Kristjansson et al. 2005; Sajjan et al. 2008). Human rhinovirus in
particular has been identified as a primary trigger in the majority of asthma
exacerbations in children (Johnston et al. 1995; Friedlander and Busse 2005; Johnston
2005). Although HRV typically affects the upper respiratory airways, there are evidence
to suggest the association between lower airway infection and subsequent increased
bronchial responsiveness in patients with asthma (Fraenkel et al. 1995; Grunberg et al.
1997). In vitro studies have also shown that viral replication is elevated in the bronchial
epithelial cells of asthmatic patients due to reduced antiviral protein responses as
compared to bronchial epithelial cells from healthy participants (Wark et al. 2005;
Contoli et al. 2006).
Human rhinovirus infections have also been previously demonstrated to affect the
barrier integrity and function of healthy AECs. Yeo and Jang (2010) examined the
effects of HRV infection on nasal epithelial barrier function and observed that post
HRV infection, mRNA expression of TJ and adherens junction proteins were reduced
compared to the non-infected healthy control group. In the same study, protein
expression was similarly observed to be reduced in the HRV infected cells compared to
non-infected controls. Findings from this study indicate that HRV infection has the
propensity to decrease expression of junctional protein complexes in order to exert
potentially detrimental effects on the nasal epithelial barrier function. However, their
study utilised cells obtained from the nasal passages of non-asthmatic, non-atopic
individuals and thus, do not reflect the bronchial airway setting following HRV
infection, especially in asthma. A seminal study by Sajjan and colleagues (2008)
Looi 2015
119
demonstrated the capability of HRV infection to disrupt the barrier function of polarised
AECs obtained from tracheal trimmings of donor lungs during transplantation.
Observations from this study reported a loss of the ZO-1 TJ protein complexes
following HRV infection and an increased in the paracellular permeability of FITC-
inulin, suggesting the ability of HRV to disrupt epithelial barrier function in vitro.
Although evident that HRV infection has the proclivity to disrupt epithelial barrier
function, there currently exists a paucity of data in the understanding of the effects of
HRV infection on barrier integrity and function of a paediatric epithelium that is already
inherently dysregulated.
Along with the known association between HRV infection and disruption of the
epithelial barrier from previous in vitro studies (Sajjan et al. 2008; Yeo and Jang 2010;
Comstock et al. 2011), this study hypothesised that HRV infection within asthmatic
airways results in greater compromisation of epithelial barrier integrity and function
compared to healthy airways. Utilising cell cultures obtained from a paediatric cohort,
this study was able to assess membrane expression levels of multiple membrane TJ
proteins prior and following HRV infection through an In-Cell Western® assay.
Moreover, through a transepithelial permeability assay adapted for pAECs, this study
was also able to functionally assess transepithelial permeability of inert solutes of two
different molecular weights across the epithelial layer.
6.2 Materials and Methods
The general materials and methods used in this part of the investigation are listed in
detail in Chapter 2
6.2.1 Patient Demographics
As previously described (refer to 2.5.4), four cohorts were used in this study. For this
section of the investigation, samples were obtained from 16 healthy non-atopic (HNA; 8
female, 8 male), 17 healthy atopic (HA; 7 female, 10 male), 5 non-atopic asthmatic
Looi 2015
120
(NAA; 2 female, 3 male) and 6 atopic asthmatic (AA; 2 female, 4 male) children who
did not previously receive any corticosteroid therapy. Patient demographics specific for
this chapter are summarised in Table 6.1.
6.2.2 Cell culture
Maintenance and subsequent sub-culture of paediatric derived pAECs used in this
investigation has been described in detail in Chapter 2 (refer to 2.4.2.2.6 and 2.5.4).
6.2.3 Human rhinovirus and titrations
The source, propagation and viral titre determination of the HRV-1B utilised in this
investigation has been described in detail in Chapter 2 (refer to 2.5.7, 2.5.7.1 and
2.5.7.2).
6.2.4 Infection of cell cultures
Paediatric derived pAECs grown on culture plates or inserts, were infected with HRV-
1B and incubated for 24 h. Briefly, growth media was replaced with fresh basal media
and subsequently infected with HRV-1B at a 50% Tissue Culture Infectivity Dose
(TCID50) of 2.5 x 104 TCID50/ml and 10 or 20 x 104 TCID50/ml to mimic an in vivo
chronic and acute viral infection. After each incubation period, media was collected and
stored at -80°C and infected cells were utilised for various downstream assays.
6.2.5 In Cell™ Western
The optimised In Cell™ Western assay, as described in detail within Chapter 3 was
utilised for the determination of TJ membrane protein expression prior and following
HRV-1B infection.
Table 6.1 Demographic of patient cohort categorised according to atopy
HNA – Healthy non-atopic; HA – Healthy atopic; NAA – Non-atopic asthmatic;
AA – Atopic asthmatic; F – Female; M - Male
Phenotype Gender Average Age (yr)
Age Range (yr) Number Total (n)
HNA F 7.1 3.0 – 15.1 8 16
M 4.1 1.4 – 6.2 8
HA F 5.9 3.3 – 15.4 7 17
M 5.9 2.2 – 16.4 10
NAA F 6.9 6.9 – 7 2 5
M 3.9 2.2 – 6.1 3
AA F 8.1 2.9 – 14.7 2 6
M 6.6 5.3 – 8.1 4
Looi 2015
121
6.2.6 Transepithelial permeability assay
The optimised transepithelial permeability assay, as described in detail within Chapter 3
was utilised for the functional determination of epithelial TJ membrane integrity prior
and following HRV infection.
6.2.7 Statistical analysis
Data were tested for population normality and homogeneity of variance, and where
applicable, a Student t test was performed. Experiments were performed in at least
duplicates and using a minimum of three patients of each cohort per experiment.
Statistical analyses were performed using Mann-Whitney non-parametric test and
values presented are mean ± SD. P values less than 0.05 were considered to be
significant.
6.3 Results
6.3.1 Effect of human rhinovirus infection on membrane tight junction protein
expression after 24 and 48 h
Having previously demonstrated that the basal membrane TJ protein expression of
claudin-1, occludin and ZO-1 in paediatric derived pAECs differed between non-
asthmatic and asthmatic cohorts, this chapter focused on the effects of HRV-1B
infection on TJ expression. Hence, this investigation characterised the changes to
epithelial TJ proteins following HRV-1B infection in non-asthmatic and asthmatic
cohorts using an In-Cell™ Western assay to assess barrier integrity and a transepithelial
permeability assay for the assessment of barrier functionality. A low viral titre of 2.5 x
104 TCID50/ml HRV-1B and a high viral titre of 20 x 104 TCID50/ml HRV-1B was
utilised in this study to mimic a chronic and acute viral infection respectively.
Looi 2015
122
6.3.1.1 Comparison between pAECs of non-asthmatic and asthmatic cohorts
When assessing membrane claudin-1 expression between non-asthmatic and asthmatic
cohorts, results obtained in this section demonstrated significantly lower basal
membrane claudin-1 (11.08%) within the asthmatic cohort compared to the non-
asthmatic counterpart (100%) (Figure 6.1 A – 0 h; p<0.05), corroborating basal data
from the previous chapter. Following 24 h infection with a low viral titre of 2.5 x 104
TCID50/ml of HRV-1B, a significant decrease in membrane claudin-1 expression
(35.5% ± 0.002) was observed in comparison with non-infected controls in pAECs of
non-asthmatic cohort (Figure 6.1 A – Non-asthmatic, 24 h; p<0.05). However, at 48 h
post infection with the same viral titre, a significant increase back to baseline values in
membrane claudin-1 expression (105.8% ± 0.002) was shown within pAECs from the
non-asthmatic cohort (Figure 6.1 A – Non-asthmatic, 48 h; p<0.05). When infected
with a high viral titre of 20 x 104 TCID50/ml of HRV-1B for 24 h, a significant decrease
in membrane claudin-1 expression (25.3% ± 0.001) was observed in comparison with
non-infected controls (Figure 6.1 A – Non-asthmatic, 24 h; p<0.05). Interestingly, at 48
h post infection, a significant increase towards baseline values in membrane claudin-1
expression (82.2% ± 0.002) was similarly observed (Figure 6.1 A – Non-asthmatic, 48
h; p<0.05).
In addition, 24 h post infection with the higher viral titre resulted in a significant
decrease in membrane claudin-1 expression (25.3% ± 0.001) within pAECs of the non-
asthmatic cohort compared to the lower viral titre (35.5% ± 0.002) (Figure 6.1 A – Non-
asthmatic, 24 h; p<0.05). Furthermore, 48 h post infection, infection with the higher
viral titre continued to demonstrate significantly lower levels of membrane claudin-1
expression (82.2% ± 0.002) compared to expression levels post infection with the lower
viral titre (105.8% ± 0.002) (Figure 6.1 A – Non-asthmatic, 48 h; p<0.05).
When membrane claudin-1 expression of pAECs from the asthmatic cohort were
assessed following infection with viral titre of 2.5 x 104 TCID50/ml of HRV-1B, the data
demonstrated, at 24 h post infection, significant differences in membrane claudin-1
expression in pAECs of the asthmatic cohort (8.53% ± 0.0002) was observed in
Looi 2015
123
comparison to non-infected controls (Figure 6.1 A – Asthmatic, 24 h; p<0.05). In
addition, 48 h post infection, a further significant decrease in membrane claudin-1
expression was observed (3.63% ± 0.001) compared to non-infected controls (Figure 6.1
A – Asthmatic, 48 h; p<0.05). Similarly, following 24 h infection with a high viral titre
of 20 x 104 TCID50/ml of HRV-1B, the data demonstrated a significant decrease
(12.02% ± 0.002) in membrane claudin-1 expression in pAECs of the asthmatic cohort
compared to non-infected controls (Figure 6.1 A – Asthmatic, 24 h; p<0.05). At 48 h
post infection, a further decrease in membrane claudin-1 expression was observed
(3.73% ± 0.002) compared to non-infected controls (Figure 6.1 A – Asthmatic, 48 h;
p<0.05).
Interestingly, 24 h post infection, infection with the high viral titre resulted in increased
levels of membrane claudin-1 expression (12.02% ± 0.002) in contrast to decreased
expression levels post infection with the low viral titre (8.53% ± 0.0002). The
differences in expression was observed to be significant (Figure 6.1 A – Asthmatic, 24
h; p<0.05). Moreover, 48 h post infection, significant differences in membrane claudin-
1 expression was observed between both viral titres (Figure 6.1 A – Asthmatic, 48 h;
p<0.05).
When assessing membrane occludin expression between non-asthmatic and asthmatic
cohorts, results corroborated data from the previous chapters, demonstrating
significantly lower basal membrane occludin (40.3%) within the asthmatic cohort
compared to the non-asthmatic counterpart (100%) (Figure 6.1 B – 0 h; p<0.05).
Following 24 h infection with low viral titre of 2.5 x 104 TCID50/ml of HRV-1B, a
significant decrease in membrane occludin expression (57.8% ± 0.002) was observed
compared to non-infected controls in pAECs of non-asthmatic cohort (Figure 6.1 B –
Non-asthmatic, 24 h; p<0.05). Interestingly, a significant increase in membrane
occludin expression (83.5% ± 0.002) was shown at 48 h post infection (Figure 6.1 B –
Non-asthmatic, 48 h; p<0.05). After 24 h infection with a high viral titre of 20 x 104
TCID50/ml of HRV-1B, a significant decrease in membrane occludin expression (28.3%
± 0.001) was similarly observed compared to non-infected controls in pAECs of the
non-asthmatic cohort (Figure 6.1 B – Non-asthmatic, 24 h; p<0.05). In contrast, a
Looi 2015
124
significant increase towards baseline values in membrane occludin expression (71.4% ±
0.002) was observed 48 h post infection (Figure 6.1 B – Non-asthmatic, 48 h; p<0.05).
In addition, 24 h post infection with a higher viral titre resulted in a significant decrease
in membrane occludin expression (28.3% ± 0.001) within pAECs of the non-asthmatic
cohort in contrast to expression levels following infection with the lower viral titre
(57.8% ± 0.002) (Figure 6.1 B – Non-asthmatic, 24 h; p<0.05). Furthermore, 48 h post
infection, despite an increase in membrane occludin expression in pAECs of the non-
asthmatic cohort, infection with the higher viral titre continued to demonstrate
significantly lower level of membrane occludin expression (71.4% ± 0.002) in contrast
to expression levels post infection with the lower viral titre (83.5% ± 0.002) (Figure 6.1
B – Non-asthmatic, 48 h; p<0.05).
When membrane occludin expression of pAECs from the asthmatic cohort were
assessed following infection with a low viral titre of 2.5 x 104 TCID50/ml of HRV-1B,
the data demonstrated, at 24 h post infection, a significant decrease in membrane
occludin expression in pAECs of the asthmatic cohort (7.5% ± 0.003) compared to non-
infected controls (Figure 6.1 B – Asthmatic, 24 h; p<0.05). Furthermore, a continued
decrease in membrane occludin expression was observed (3.56% ± 0.005) 48 h post
infection (Figure 6.1 B – Asthmatic, 48 h; p<0.05). Following infection with a high
viral titre of 20 x 104 TCID50/ml of HRV-1B, results obtained demonstrated a
significant decrease in membrane occludin expression (3.1% ± 0.002) 24 h post
infection compared to non-infected controls (Figure 6.1 B – Asthmatic, 24 h; p<0.05).
Moreover, a sustained decrease in membrane occludin expression (3.3% ± 0.005) was
observed at 48 h post infection compared to non-infected controls(Figure 6.1 B –
Asthmatic, 48 h; p<0.05).
When assessing effects of viral titres on membrane occludin expression, 24 h post
infection with the higher viral titre resulted in significantly lower levels of membrane
occludin expression (3.1% ± 0.002) in contrast to expression levels following infection
with the lower viral titre (7.5% ± 0.003) (Figure 6.1 B – Asthmatic, 24 h; p<0.05).
Interestingly, 48 h post infection, data demonstrated a further decrease in membrane
Looi 2015
125
occludin expression following infection with the lower viral titre (3.56% ± 0.005) while
infection with higher viral titre showed a sustained low level of membrane occludin
expression (3.3% ± 0.005), however, there was no significant difference in membrane
occludin expression between both viral titres (Figure 6.1 B – Asthmatic, 48 h).
Assessment of membrane ZO-1 expression between non-asthmatic and asthmatic
cohorts demonstrated significantly lower basal membrane ZO-1 (57.4%) expression
within the asthmatic cohort compared to the non-asthmatic counterpart (100%),
corroborating earlier observations from the previous chapter (Figure 6.1 C – 0 h;
p<0.05). Following 24 h infection with a low viral titre of 2.5 x 104 TCID50/ml of HRV-
1B, a significant decrease in membrane ZO-1 expression (66.5% ± 0.0007) was
observed in comparison with non-infected controls in pAECs of non-asthmatic cohort
(Figure 6.1 C – Non-asthmatic, 24 h; p<0.05). A significant increase towards baseline in
membrane ZO-1 expression (95.1% ± 0.001) was observed at 48 h post infection
(Figure 6.1 C – Non-asthmatic, 48 h; p<0.05). When infected with a high viral titre of
20 x 104 TCID50/ml of HRV-1B, a significant decrease in membrane ZO-1 expression
(54.2% ± 0.0005) was similarly observed compared to non-infected controls at 24 h post
infection (Figure 6.1 C – Non-asthmatic, 24 h; p<0.05). A significant increase towards
baseline in membrane ZO-1 expression (76.5% ± 0.001) was equally observed at 48 h
post infection (Figure 6.1 C – Non-asthmatic, 48 h; p<0.05).
In addition, 24 h post infection with the higher viral titre resulted in a significant
decrease in membrane ZO-1 expression (54.2% ± 0.0005) within pAECs of the non-
asthmatic cohort in contrast to the expression levels following infection with the lower
viral titre (66.5% ± 0.0007) (Figure 6.1 C – Non-asthmatic, 24 h; p<0.05). Furthermore,
48 h post infection, despite an increase in membrane ZO-1 expression in pAECs of the
non-asthmatic cohort, infection with the higher viral titre continued to demonstrate
significantly lower levels of membrane ZO-1 expression (76.5%± 0.001) in contrast to
expression levels post infection with the lower viral titre (95.1% ± 0.001) (Figure 6.1C
– Non-asthmatic, 48 h; p<0.05).
Looi 2015
126
When membrane ZO-1 expression of pAECs from the asthmatic cohort was assessed
following infection with a low viral titre of 2.5 x 104 TCID50/ml of HRV-1B, the data
demonstrated a significant decrease in membrane ZO-1 expression (2.5% ± 0.0005) at
24 h post infection in comparison to non-infected controls (Figure 6.1 C – Asthmatic,
24 h; p<0.05). A further significant decrease in membrane ZO-1 expression was
observed (0.53% ± 0.001) at 48 h post infection compared to non-infected controls
(Figure 6.1 C – Asthmatic, 48 h; p<0.05). Data obtained following infection with a high
viral titre of 20 x 104 TCID50/ml of HRV-1B demonstrated a significant decrease in
membrane ZO-1 expression (1.9% ± 0.0006) at 24 h post infection compared to non-
infected controls (Figure 6.1 C – Asthmatic, 24 h; p<0.05). A further significant
decrease in membrane ZO-1 expression was observed (0.29% ± 0.0005) at 48 h post
infection with the high viral titre compared to non-infected controls (Figure 6.1 C –
Asthmatic, 48 h; p<0.05).
When assessing effects of viral titres on membrane ZO-1 expression, 24 h post infection
with the higher viral titre resulted in significantly lower levels of membrane ZO-1
expression (1.9% ± 0.0006) in contrast to expression levels following infection with the
lower viral titre (2.5% ± 0.0005) (Figure 6.1 C – Asthmatic, 24 h; p<0.05).
Furthermore, 48 h post infection, data demonstrated a significantly greater decrease in
membrane ZO-1 expression following infection with the higher viral titre (6.9-fold,
0.29% ± 0.0005) while infection with the lower viral titre showed a similar decrease in
membrane ZO-1 expression but of a smaller magnitude (4.8-fold, 0.53% ± 0.001)
(Figure 6.1 C – Asthmatic, 48 h; p<0.05).
When assessing membrane TJ protein expression of pAECs within the non-asthmatic
cohort following infection, results showed similar profiles of decreased membrane
protein expression at 24 h post infection with low viral titre, demonstrating the lowest
expression in membrane claudin-1 (35.5% ± 0.002), followed by occludin (57.8% ±
0.002) and ZO-1 (66.5% ± 0.0007) (Figure 6.1 A – C, Non-asthmatic, 24 h; p<0.05).
Interestingly, the greatest increase towards baseline expression values was observed in
membrane claudin-1 (105.8% ± 0.002), followed by ZO-1 (95.1% ± 0.001) and
occludin (83.5% ± 0.002) at 48 h post infection with the low viral titre (Figure 6.1 A –
Figure 6.1 Membrane TJ protein expression over time in pAECs from non-
asthmatic and asthmatic cohorts following viral infection: pAECs seeded on 96-well
micro-titre plates and grown to confluence were infected with two different HRV-1B
titres (2.5 and 20 x 104 TCID50/ml) over 48 h and membrane TJ protein expression
assessed via an optimised In-Cell™ Western assay as previously described (refer to
3.2.4). (A) Membrane claudin-1 protein expression decreased following infection with
HRV-1B at both viral titres at 24 h in the non-asthmatic cohort. However, at 48 h post
infection, a significant increase in membrane claudin-1 expression was observed in this
cohort. Significant difference in membrane claudin-1 expression was observed in
pAECs of asthmatic cohort at 24 h post infection compared to 0 h. Further significant
decrease in expression was observed at 48 h following infection compared to 0 h. (B)
Membrane occludin protein expression decreased following infection with HRV-1B at
both viral titres at 24 h in the non-asthmatic cohort. However, at 48 h post infection, a
significant increase in membrane occludin expression was observed within this cohort.
Significant decrease in membrane occludin expression was observed in pAECs of
asthmatic cohort at 24 h post infection with both viral titres compared to 0 h. Further
significant decrease in expression was similarly observed at 48 h following infection
compared to 0 h. (C) A significant decrease in membrane ZO-1 protein expression was
observed following infection with HRV-1B at both viral titres at 24 h in the non-
asthmatic cohort. However, at 48 h post infection, a significant increase in membrane
ZO-1 expression was observed in this cohort. Significant decrease in membrane ZO-1
expression was observed in pAECs of asthmatic cohort at 24 h post infection with both
viral titres compared to 0 h. Further significant decrease in expression was also
observed at 48 h following infection compared to 0 h. Data were normalised to cell
numbers and presented as mean ± SD percentage relative to control. *Statistical
significance relative to non-infected controls (p<0.05).
Time (h)
Mem
bran
e cl
audi
n ex
pres
sion
(% r
elat
ive
to c
ontr
ol)
0 24 480
25
50
75
100
125
150
2.5 x 104 TCID50/ml20 x 104 TCID50/ml
Non-asthmatic
2.5 x 104 TCID50/ml20 x 104 TCID50/ml
Asthmatic
* *
**
**
** *
Time (h)
Mem
bran
e oc
clud
in e
xpre
ssio
n(%
rel
ativ
e to
con
trol
)
0 24 480
25
50
75
100
125
150
2.5 x 104 TCID50/ml20 x 104 TCID50/ml
2.5 x 104 TCID50/ml20 x 104 TCID50/ml
Non-asthmatic
Asthmatic
* *
**
*
*
* *
Time (h)
Mem
bran
e ZO
1 ex
pres
sion
(% r
elat
ive
to c
ontr
ol)
0 24 480
25
50
75
100
125
150
2.5 x 104 TCID50/ml20 x 104 TCID50/ml
Non-asthmatic
2.5 x 104 TCID50/ml20 x 104 TCID50/ml
Asthmatic
* *
*
**
*
* *
A
B
C
Looi 2015
127
C, Non-asthmatic, 48 h; p<0.05). Following 24 h infection with a high viral titre, the
lowest expression was observed in membrane claudin-1 expression (25.3% ± 0.001),
followed by occludin (and 28.3% ± 0.001) and ZO-1 (54.2% ± 0.0005) (Figure 6.1 A –
C, Non-asthmatic, 24 h; p<0.05). A greatest increase towards baseline expression
values was similarly observed in membrane claudin-1 (82.2% ± 0.002), followed by
ZO-1 (76.5% ± 0.001) and occludin (71.4% ± 0.002) at 48 h post infection (Figure 6.1
A – C, Non-asthmatic, 48 h; p<0.05).
Similarly, when assessing membrane TJ protein expression of pAECs within the
asthmatic cohort following 24 h infection with a low viral titre, the lowest expression
was observed in membrane ZO-1 (2.5% ± 0.0005), followed by occludin (7.5% ± 0.003)
and claudin-1 (8.53% ± 0.0002) (Figure 6.1 A – C, Asthmatic, 24 h; p<0.05).
Surprisingly, similar levels of expression was observed between membrane claudin-1
(3.63% ± 0.001) and occludin (3.56% ± 0.005) with lowest expressed being membrane
ZO-1 (0.53% ± 0.001) at 48 h post infection (Figure 6.1 A – C, Asthmatic, 48 h;
p<0.05). Infection with a high viral titre demonstrated the greatest decrease in
membrane ZO-1 (1.9% ± 0.0006), followed by occludin (3.1% ± 0.002) and claudin-1
(12.02% ± 0.002) at 24 h post infection (Figure 6.1 A – C, Asthmatic, 24 h; p<0.05).
Interestingly, at 48 h post infection, similar levels of expression were observed between
membrane claudin-1 (3.73% ± 0.002) and occludin (3.3% ± 0.005) with membrane ZO-
1 being the lowest (0.29% ± 0.0005) (Figure 6.1 A – C, Asthmatic, 48 h; p<0.05).
6.3.1.2 Comparison between pAECs of non-asthmatic and asthmatic cohorts based on
atopic status
When the non-asthmatic and asthmatic cohorts were further classified according to
atopy, the results generated corroborated data from the previous chapter demonstrating
lower basal expression of membrane claudin-1 in pAECHA (10.2%), pAECNAA (5.7%)
and pAECAA (6.1%) when compared to pAECHNA (100%). In addition, following 24 h
infection with a low viral titre of 2.5x104 TCID50/ml of HRV-1B, results showed a
greater magnitude in the decrease of membrane claudin-1 expression in the pAECHNA
Looi 2015
128
cohort (33.2% ± 0.01) while expression of membrane claudin-1 in pAECHA was
maintained (10.3% ± 0.005) and a decrease in membrane claudin-1 protein expression
was observed in the pAECNAA (5.4%) and pAECAA (5.2% ± 0.001) cohorts when
compared to non-infected controls (Figure 6.2 A – 24 h; p<0.05). Interestingly, 48 h
post infection, significant return to baseline values for membrane claudin-1 expression
was observed in the pAECHNA (114% ± 0.002) and pAECHA (12.3% ± 0.02) cohorts,
while a decreased expression was observed in the pAECNAA (0.8%) and pAECAA (2.9%
± 0.005) cohorts in comparison to non-infected controls (Figure 6.2 A – 48 h; p<0.05).
When the effects of a low viral titre infection on membrane claudin-1 protein expression
at 24 h post infection was assessed, membrane expression was found to be lower in
pAECHA (10.3% ± 0.005), pAECNAA (5.4%) and pAECAA (5.2% ± 0.001) in contrast to
pAECHNA (33.2% ± 0.01). This was observed to be significant for the pAECHA and
pAECAA cohorts. Expression of membrane claudin-1 protein was also lower in
pAECNAA (5.4%) and pAECAA (5.2% ± 0.001) in comparison with pAECHA (10.3% ±
0.005) and this was observed to be of significance for the pAECAA cohort. Although
there was no observable difference in membrane claudin-1 expression between the
pAECNAA and pAECAA cohorts, due to the limited availability of pAECNAA, statistical
analysis could not be performed (Figure 6.2 A – 24 h; p<0.05). At 48 h post infection,
membrane expression of claudin-1 was similarly lower in the pAECHA (12.3% ± 0.02),
pAECNAA (0.8%) and pAECAA (2.9% ± 0.005) in contrast to pAECHNA (114% ±0.002).
This was observed to be significant for the pAECHA and pAECAA cohorts. Expression of
membrane claudin-1 protein was also lower in pAECNAA (0.8%) and pAECAA (2.9% ±
0.005) in comparison with pAECHA (12.3% ± 0.02) and this was observed to be of
significance for the pAECAA cohort. Moreover, membrane claudin-1 expression was
observed to be lower in pAECNAA (0.8%) compared to pAECAA (12.3% ± 0.02).
However, due to the limited availability of pAECNAA, statistical analysis could not be
performed (Figure 6.2 A – 48 h; p<0.05) for this cohort.
Following 24 h infection with a high viral titre of 20 x 104 TCID50/ml of HRV-1B, a
decrease in membrane claudin-1 protein expression was demonstrated in the pAECHNA
(21.6% ± 0.003), pAECHA (8.8% ± 0.005) and pAECNAA (5.4%) cohorts while an
Looi 2015
129
increase in expression was observed in the pAECAA (8.1% ± 0.008) cohort. These were
observed to be significant in the pAECHNA, pAECHA and pAECAA cohorts when
compared to non-infected controls (Figure 6.2 D – 24 h; p<0.05). Interestingly, despite
an increase in membrane claudin-1 expression at 48 h post infection compared to 24 h
post infection, membrane claudin-1 expression remained significantly lower than non-
infected controls in the pAECHNA (76.5% ± 0.003) and pAECHA (9.9% ± 0.02) cohorts.
In contrast, a decrease in membrane claudin-1 expression was observed in pAECNAA
(0.8%) and pAECAA (3.1% ± 0.005) cohorts when compared to non-infected controls.
This was observed to be significant in the pAECAA cohort (Figure 6.2 D – 48 h;
p<0.05). Due to the limited availability of pAECNAA, statistical analysis could not be
performed for this cohort.
In the assessment of the effects of a high viral titre infection on membrane claudin-1
protein expression at 24 h post infection, membrane expression of claudin-1 was lower
in pAECHA (8.8% ± 0.005), pAECNAA (5.4%) and pAECAA (8.1% ± 0.008) in contrast to
pAECHNA (21.6% ± 0.003). This was observed to be significant for the pAECHA and
pAECAA cohorts. Expression of membrane claudin-1 protein was also lower in the
pAECNAA (5.4%) and pAECAA (8.1% ± 0.001) in comparison with pAECHA (8.8% ±
0.005) and this was observed to be of significance for the pAECAA cohort (Figure 6.2 D
– 24 h; p<0.05). Although membrane claudin-1 expression was observed to be lower in
pAECNAA compared to the pAECAA cohorts, statistical analysis could not be performed
due to limited availability of pAECNAA. At 48 h post infection, membrane expression of
claudin-1 was similarly lower in pAECHA (9.9% ± 0.02), pAECNAA (0.8%) and pAECAA
(3.1% ± 0.005) in contrast to pAECHNA (76.5% ± 0.003). This was observed to be
significant for the pAECHA and pAECAA cohorts. Expression of membrane claudin-1
protein was also lower in pAECNAA (0.8%) and pAECAA (3.1% ± 0.005) in comparison
to pAECHA (9.9% ± 0.02) and this was observed to be of significance for the pAECAA
cohort. Moreover, membrane claudin-1 expression was observed to be lower in
pAECNAA (0.8%) compared to pAECAA (3.1% ± 0.005). However, due to the limited
availability of pAECNAA, statistical analysis could not be performed (Figure 6.2 D – 48
h; p<0.05).
Looi 2015
130
When membrane occludin expression was assessed, the results also corroborated data
from the previous chapter demonstrating lower basal expression of membrane occludin
in pAECHA (35.9%), pAECNAA (27.2%) and pAECAA (27.5%) when compared to
pAECHNA (100%). In addition, following 24 h infection with a low viral titre, data
showed a greater decrease of membrane occludin expression in the pAECHNA cohort
(46.4% ± 0.03) while expression in pAECHA was maintained (34.5% ± 0.02) and a
decrease in membrane occludin protein expression was observed for both the pAECNAA
(20.2% ± 0.03) and pAECAA (20.2% ± 0.01) cohorts (Figure 6.2 B – 24 h; p<0.05).
Interestingly, 48 h post infection, although an increase in membrane occludin
expression was observed compared to expression levels at 24 h post infection,
expression was still significantly lower in pAECHNA (84.7% ±0.02) when compared to
non-infected controls. Further decrease in membrane occludin expression was observed
in the pAECHA (20% ± 0.02), pAECNAA (3.8%) and pAECAA (12.6% ± 0.02) cohorts
when compared to non-infected controls and this was significant for both the pAECHA
and pAECAA cohorts (Figure 6.2 B – 48 h; p<0.05). Due to the limited availability of
pAECNAA, statistical analysis could not be performed.
In assessing the effects of a low viral titre infection on membrane occludin protein
expression at 24 h post infection, membrane expression of occludin was significantly
lower in pAECHA (34.5% ± 0.02), pAECNAA (20.2% ± 0.03) and pAECAA (20.2% ±
0.01) in contrast to pAECHNA (46.4% ± 0.03). Expression of membrane occludin was
also significantly lower in pAECNAA (20.2% ± 0.03) and pAECAA (20.2% ± 0.01) in
comparison with pAECHA (34.5% ± 0.02). In addition, there was no observable
differences in membrane occludin expression between the pAECNAA and pAECAA
cohorts (Figure 6.2 B – 24 h; p<0.05). At 48 h post infection, membrane expression of
occludin was similarly lower in pAECHA (20% ± 0.02), pAECNAA (3.8%) and pAECAA
(12.6% ± 0.02) compared to pAECHNA (84.7% ±0.02). This was observed to be
significant for the pAECHA and pAECAA cohorts. Expression of membrane occludin was
also lower in pAECNAA (3.8%) and pAECAA (12.6% ± 0.02) in comparison with
pAECHA (20% ± 0.02) and this was observed to be of significance for the pAECAA
cohort. Moreover, membrane occludin expression was observed to be lower in
pAECNAA (3.8%) compared to pAECAA (12.6% ± 0.02). However, due to the limited
Looi 2015
131
availability of pAECNAA, statistical analysis could not be performed to determine
significance (Figure 6.2 B – 48 h; p<0.05).
Following 24 h infection with a high viral titre of 20 x 104 TCID50/ml of HRV-1B, a
significant decrease in membrane occludin protein expression was demonstrated in the
pAECHNA (16.2% ± 0.007), pAECHA (21% ± 0.01), pAECNAA (3.7% ± 0.001) and
pAECAA (14.7% ± 0.01) cohorts when compared to non-infected controls (Figure 6.2 E
– 24 h; p<0.05). Interestingly, despite an increase in membrane occludin expression at
48 h post infection compared to expression levels at 24 h, membrane occludin
expression remained significantly lower than non-infected controls in the pAECHNA
(68.7% ± 0.01) cohort. In contrast, a further decrease in membrane occludin expression
was observed in pAECHA (17.7% ± 0.01), pAECNAA (3.6%) and pAECAA (11.8% ±
0.02) cohorts when compared to expression levels both at 24 h post infection as well as
in non-infected controls. This was observed to be significant in both the pAECHA and
pAECAA cohorts (Figure 6.2 E – 48 h; p<0.05). Due to the limited availability of
pAECNAA, statistical analysis could not be performed to determine significance.
When the effects of a high viral titre infection on membrane occludin protein expression
at 24 h post infection were assessed, membrane expression of occludin was significantly
higher in pAECHA (21% ± 0.01) compared to pAECHNA (16.2% ± 0.01) while membrane
occludin expression was lower in pAECNAA (3.7% ± 0.001) and pAECAA (14.7% ±
0.01) compared to pAECHNA (16.2% ± 0.01). Expression of membrane occludin protein
was also significantly lower in pAECNAA (3.7% ± 0.001) and pAECAA (14.7% ± 0.01)
in comparison with pAECHA (21% ± 0.01) (Figure 6.2 E – 24 h; p<0.05). Membrane
occludin expression was observed to be lower in pAECNAA (3.7% ± 0.001) compared to
pAECAA cohorts (14.7% ± 0.01). At 48 h post infection, membrane expression of
occludin was similarly lower in pAECHA (17.7% ± 0.01), pAECNAA (3.6%) and pAECAA
(11.8% ± 0.02) in contrast to pAECHNA (68.7% ± 0.01). This was observed to be
significant for pAECHA and pAECAA cohorts. Expression of membrane occludin protein
was also lower in pAECNAA (3.6%) and pAECAA (11.8% ± 0.02) in comparison with
pAECHA (17.7% ± 0.01) and this was observed to be of significance for the pAECAA
cohort. Moreover, membrane occludin expression was observed to be lower in
Looi 2015
132
pAECNAA (3.6%) compared to pAECAA (11.8% ± 0.02). However, due to the limited
availability of pAECNAA, statistical analysis could not be performed to determine
significance (Figure 6.2 E – 48 h; p<0.05).
Similarly, when membrane ZO-1 protein expression was assessed, the data generated
corroborated results from the previous chapter demonstrating lower basal expression of
membrane ZO-1 in pAECHA (49.2%), pAECNAA (40%) and pAECAA (45%) when
compared to pAECHNA (100%). In addition, following 24 h infection with a low viral
titre, the obtained data showed the greatest magnitude in decrease of membrane ZO-1
expression in the pAECHNA cohort (59.1% ± 0.01). A decrease in expression of
membrane ZO-1 was similarly observed in pAECHA (43.8% ± 0.005), pAECNAA
(38.5%) and pAECAA (36.3% ± 0.002) cohorts when compared to non-infected controls
(Figure 6.2 C – 24 h; p<0.05). Interestingly, , although an increase in membrane ZO-1
expression was observed at 48 h post infection compared to expression levels at 24 h,
membrane ZO-1 expression was still significantly lower in pAECHNA (94.3% ±0.004) in
contrast to non-infected controls. A further decrease in membrane ZO-1 expression was
observed in the pAECHA (27.3% ± 0.001), pAECNAA (11.8%) and pAECAA (3.8%)
cohorts compared to non-infected controls and this was significant for the pAECHA
cohort (Figure 6.2 C – 48 h; p<0.05). Due to the limited availability of pAECNAA and
pAECAA, statistical analysis could not be performed to determine the level of
significance.
In the assessment of the effects of a low viral titre infection on membrane ZO-1 protein
expression at 24 h post infection, membrane expression of ZO-1 was lower in pAECHA
(43.8% ± 0.005), pAECNAA (38.5%) and pAECAA (36.3% ± 0.002) in contrast to
pAECHNA (59.1% ± 0.01). This was observed to be significant for the pAECHA and
pAECAA cohorts. Expression of membrane ZO-1 protein was also lower in pAECNAA
(38.5%) and pAECAA (36.3% ± 0.002) compared to pAECHA (43.8% ± 0.005) and this
was observed to be of significance for the pAECAA cohort. Moreover, there was no
observable difference in membrane ZO-1 expression between pAECNAA and pAECAA
cohorts and since there was limited availability of pAECNAA, statistical analysis could
not be performed (Figure 6.2 C – 24 h; p<0.05). At 48 h post infection, membrane
Looi 2015
133
expression of ZO-1 was similarly lower in pAECHA (27.3% ± 0.01), pAECNAA (11.8%)
and pAECAA (3.8%) compared to pAECHNA (94.3% ±0.004). This was observed to be
significant for the pAECHA cohort. Expression of membrane ZO-1 protein was also
lower in pAECNAA (11.8%) and pAECAA (3.8%) in comparison to pAECHA (27.3% ±
0.01). Moreover, membrane ZO-1 expression was observed to be lower in pAECNAA
(0.8%) compared to pAECAA (12.3% ± 0.02), however, due to the limited availability of
pAECNAA and pAECAA, statistical analysis could not be performed to determine
significance (Figure 6.2 C – 48 h).
Following 24 h infection with a high viral titre of 20 x 104 TCID50/ml of HRV-1B, a
significant decrease in membrane ZO-1 protein expression was demonstrated in the
pAECHNA (54% ± 0.003), pAECHA (30.9% ± 0.003), pAECNAA (37.7%) and pAECAA
(25.7% ± 0.0004) cohorts when compared to non-infected controls (Figure 6.2 F – 24 h;
p<0.05). Interestingly, despite an increase in membrane ZO-1 expression at 48 h post
infection compared to expression levels at 24 h, membrane ZO-1 expression remained
significantly lower than non-infected controls in the pAECHNA (63.1% ± 0.005) cohort.
In contrast, a further decrease in membrane ZO-1 expression was observed in the
pAECHA (23.5% ± 0.01), pAECNAA (7.3%) and pAECAA (2.7% ± 0.001) cohorts when
compared to expression levels at 24 h post infection as well as in non-infected controls.
This was observed to be significant in pAECHA and pAECAA cohorts (Figure 6.2 F – 48
h; p<0.05). Due to the limited availability of pAECNAA, statistical analysis could not be
performed to determine significance at this time point.
When assessing the effects of a high viral titre infection on membrane ZO-1 protein
expression at 24 h post infection, membrane expression of ZO-1 was lower in pAECHA
(30.9% ± 0.003), pAECNAA (37.7%) and pAECAA (25.7% ± 0.0004) in contrast to
pAECHNA (54% ± 0.003). This was observed to be significant for the pAECHA and
pAECAA cohorts (Figure 6.2 F – 24 h; p<0.05). Expression of membrane ZO-1 protein
was also lower in pAECNAA (37.7%) and pAECAA (25.7% ± 0.0004) in comparison with
pAECHA (30.9% ± 0.003). This was observed to be of significance in pAECAA cohort
(Figure 6.2 F – 24 h; p<0.05). Membrane ZO-1 expression was also observed to be
lower in pAECNAA (37.7%) compared to pAECAA cohorts (25.7% ± 0.0004), however,
Figure 6.2 Membrane TJ protein expression over time in pAECs from non-asthmatic and asthmatic cohorts following viral infection with each
cohort further categorised based on atopy: pAECs seeded on 96-well micro-titre plates and grown to confluence were infected with two different
HRV-1B titres (2.5 and 20 x 104 TCID50/ml) for 24 and 48 h and membrane TJ protein expression assessed via an optimised In-Cell™ Western assay as
previously described (refer to 3.2.4). (A - C) Following infection with HRV-1B at viral titre of 2.5 x 104 TCID50/ml ( ), a significant decrease in
membrane claudin-1 (green), occludin (blue) and ZO-1 (red) protein respectively was observed in pAECHNA cohort at 24 h. However, at 48 h post
infection, membrane protein expression for all 3 tight junctions was significantly higher. A significant decrease in all 3 membrane tight junction
protein expression was observed in pAECHA, pAECNAA and pAECAA cohorts at 24 h post infection. In all 3 phenotypic cohorts at 48 h following
infection, significantly sustained decreased membrane protein expression was observed for claudin-1 while a significantly further decrease was
observed for both occludin and ZO-1. (D – F) Following infection with HRV-1B at viral titre of 20 x 104 TCID50/ml ( ), a significant decrease in all
3 membrane tight junction protein was observed in pAECHNA cohort at 24 h. Although membrane protein expression for all 3 tight junctions were
significantly higher at 48 h compared to 24 h, expression levels remain significantly lower compared to non-infected control. A significant decrease in
all 3 membrane tight junction protein expression was observed in pAECHA, pAECNAA and pAECAA cohorts at 24 h post infection. In all 3 phenotypic
cohorts at 48 h following infection, significantly sustained decreased membrane protein expression was observed for claudin-1 and occludin while a
significantly further decrease was observed for ZO-1. Data were normalised to cell numbers and presented as percentage mean ± SD; n = 5 individual
experiments each performed in duplicates with the exception of pAECNAA phenotype (n=2). *Statistical significance relative to non-infected control
(p<0.05).
0 24 480
25
50
75
100
125
150
*
*
* *0 24 48
0
25
50
75
100
125
150
*
*
**
0 24 480
25
50
75
100
125
150
*
*
**
0 24 480
25
50
75
100
125
150
*
*
* *0 24 48
0
25
50
75
100
125
150
*
* *
0 24 480
25
50
75
100
125
150
* *
**
A
D
B C
E F
Me
mb
ran
e p
rote
in e
xpre
ssio
n (
% r
elat
ive
to c
on
tro
l)
Time (h)
2.5 x 104 TCID50/ml 20 x 104 TCID50/ml
0 24 480
25
50
75
100
125
150HNA C
HNA HA NAA AA
0 24 480
25
50
75
100
125
150HNA C
HNA HA NAA AA
0 24 480
25
50
75
100
125
150HNA C
HNA HA NAA AA
0 24 480
25
50
75
100
125
150HNA C
HNA HA NAA AA
0 24 480
25
50
75
100
125
150HNA C
HNA HA NAA AA
0 24 480
25
50
75
100
125
150HNA C
HNA HA NAA AA
0 24 480
25
50
75
100
125
150HNA C
HNA HA NAA AA
Looi 2015
134
due to limited availability of pAECNAA, statistical analysis could not be performed to
determine significance. At 48 h post infection, membrane expression of ZO-1 was
similarly lower in pAECHA (23.5% ± 0.01), pAECNAA (7.3%) and pAECAA (2.7% ±
0.001) in contrast to pAECHNA (63.1% ± 0.005). This was observed to be significant for
the pAECHA and pAECAA cohorts. The expression of membrane ZO-1 protein was also
lower in pAECNAA (7.3%) and pAECAA (2.7% ± 0.001) compared to pAECHA (23.5% ±
0.01) and this was observed to be of significance for the pAECAA cohort. Moreover,
membrane ZO-1 expression was observed to be lower in pAECNAA (7.3%) compared to
pAECAA (2.7% ± 0.001). However, due to the limited availability of pAECNAA,
statistical analysis could not be performed (Figure 6.2 F – 48 h; p<0.05).
6.3.2 Effect of human rhinovirus infection on in vitro transepithelial permeability
In order to correlate HRV-1B induced disassembly of membrane TJ with barrier
function, a transepithelial permeability assay was performed after 24 h infection with a
viral titre of 10x104 TCID50/ml of HRV-1B. This viral titre has been previously
demonstrated (Kicic, unpublished data) to result in a significant loss of cellular viability
but no increase in cellular apoptosis in pAECs of non-asthmatic and asthmatic cohorts.
Hence, any change in epithelial permeability would be implicated with an alteration of
membrane TJ protein expression.
6.3.2.1 Comparison between pAECs of non-asthmatic and asthmatic cohorts
Non-asthmatic pAECs demonstrated an increase in transepithelial permeability of
FITC-dextran 4 (427 x 10-4 cm/sec ± 17.8) and 20 (187.9 x 10-4 cm/sec ± 27.1) kDa
following 24 h infection with HRV-1B when compared to non-infected controls (302.9
x 10-4 cm/sec ± 20.5 and 99.1 x 10-4 cm/sec ± 32.7 respectively). This was observed to
be significant for FITC-dextran 4 kDa (Figure 6.3 A; p<0.05). However, a significantly
higher level of transepithelial permeability for FITC-dextran of 4 kDa (427 x 10-4
cm/sec ± 17.8) was observed when compared to epithelial permeability towards FITC-
dextran 20 kDa (187.9 x 10-4 cm/sec ± 27.1) (Figure 6.3 A – Infected; p<0.05).
Figure 6.3 Transepithelial permeability in pAECs from non-asthmatic and asthmatic cohorts following viral infection: pAECs from non-
asthmatic and asthmatic cohorts, seeded onto Corning transwell inserts and grown to confluence were treated as previously mentioned (refer to 2.5.11).
Following 24 h infection with a viral titre of 10 x 104 TCID50/ml of HRV-1B, an optimised transepithelial permeability assay as previously described
was performed to determine epithelial permeability to FITC-dextran 4 kDa (blue) and 20 kDa (grey) (refer to 3.3.4). (A) Increase in transepithelial
permeability towards both FITC-dextran 4 and 20 kDa was observed in pAECs of non-asthmatic cohorts following infection, however, this was only
observed to be significant for FITC-dextran 4 kDa. Epithelial permeability towards FITC-dextran 4 kDa was significantly higher when compared to
FITC-dextran 20 kDa in non-infected and infected pAECs of non-asthmatic cohort. (B) No significant difference in transepithelial permeability
towards both FITC-dextran 4 and 20 kDa was observed in pAECs of asthmatic cohorts following infection. However, permeability towards FITC-
dextran 4 kDa was significantly higher when compared to FITC-dextran 20 kDa in non-infected and infected pAECs of asthmatic cohort. Results are
presented as mean ± SD. *Statistical significance relative to non-infected control (p<0.05). # Statistical significance relative to FITC-dextran 20 kDa
(p<0.05).
Non-infected Infected0
100
200
300
400
5004kDa20kDa
*#
Pap
p co
effic
ient
(cm
/sec
) x10
-4
n=10 n=10
#
Non-infected Infected0
100
200
300
400
5004kDa20kDa
Pap
p co
effic
ient
(cm
/sec
) x10
-4
n=7 n=7
##
A B
Looi 2015
135
Similarly, in pAECs of the asthmatic cohort following infection with HRV-1B, data
demonstrated an increase in transepithelial permeability of FITC-dextran 4 and 20 kDa
compared to non-infected controls but this was not found to be statistically significant
(Figure 6.3 B). However, a significantly higher level of transepithelial permeability for
FITC-dextran of 4 kDa (371.1 x 10-4 cm/sec ± 17.8) was observed when compared to
epithelial permeability for FITC-dextran 20 kDa (219.1 x 10-4 cm/sec ± 27.1) (Figure
6.3 B – Infected; p<0.05).
6.3.2.2 Comparison between pAECs of non-asthmatic and asthmatic cohorts based on
atopic status
When the non-asthmatic and asthmatic cohorts were further classified according to
atopy, the results demonstrated a significant increase in transepithelial permeability for
both FITC-dextran 4 kDa (442.4 x 10-4 cm/sec ± 6.8) and 20 kDa (288.9 x 10-4 cm/sec ±
6.9) within the pAECHNA cohorts following infection compared to non-infected controls
(370.3 x 10-4 cm/sec ± 13.3 and 201.8 x 10-4 cm/sec ± 34.2 respectively) (Figure 6.4 A;
p<0.05). In addition, a significantly higher level of transepithelial permeability towards
FITC-dextran of 4 kDa (442.4 x 10-4 cm/sec ± 6.8) was observed in comparison to
epithelial permeability towards FITC-dextran 20 kDa (288.9 x 10-4 cm/sec ± 6.9)
(Figure 6.4 A – Infected; p<0.05).
A significant increase in permeability to FITC-dextran 4 (461.8 x 10-4 cm/sec ± 13.9)
and 20 kDa (276.9 x 10-4 cm/sec ± 2.9) was observed following similar exposure to
HRV-1B in the pAECHA cohorts compared to their non-infected controls (272.6 x 10-4
cm/sec ± 14.6 and 188.3 x 10-4 cm/sec ± 34.8 respectively) (Figure 6.4 B; p<0.05). In
addition, a significantly higher level of transepithelial permeability towards FITC-
dextran of 4 kDa (461.8 x 10-4 cm/sec ± 13.9) was observed when compared to
epithelial permeability towards FITC-dextran 20 kDa (276.9 x 10-4 cm/sec ± 2.9)
(Figure 6.4 B – Infected; p<0.05).
Figure 6.4 Transepithelial permeability in pAECs from non-asthmatic and asthmatic cohorts following viral infection with each cohort
further categorised based on atopy: pAECs from non-asthmatic and asthmatic cohorts, seeded onto Corning transwell inserts and grown to
confluence were treated as previously mentioned (refer to 2.5.11). Following 24 h infection with a viral titre of 10 x 104 TCID50/ml of HRV-1B, an
optimised transepithelial permeability assay as previously described was performed to determine epithelial permeability to FITC-dextran 4 kDa (blue)
and 20 kDa (grey) (refer to 3.3.4). (A) Significant increase in transepithelial permeability was observed for both FITC-dextran 4 and 20 kDa following
infection in the pAECHNA cohort. Epithelial permeability to FITC-dextran 4 kDa was also significantly higher compared to FITC-dextran 20 kDa in
both non-infected and infected pAECHNA. (B) Significant increase in transepithelial permeability was observed for both FITC-dextran 4 and 20 kDa
following infection in the pAECHA cohort. Epithelial permeability to FITC-dextran 4 kDa was also significantly higher compared to FITC-dextran 20
kDa in both non-infected and infected pAECHA. (C) No observable difference in epithelial permeability was shown in pAECNAA cohort and due to the
low sample size of pAECNAA, statistical analysis could not be performed to determine significance and was excluded from comparative statistical
analysis. (D) Significant increase in transepithelial permeability was only observed for FITC-dextran 4 kDa following infection in the pAECAA cohort.
Epithelial permeability to FITC-dextran 4 kDa was also significantly higher compared to FITC-dextran 20 kDa in only the infected pAECAA. Results
are presented as mean ± SD. *Statistical significance relative to non-infected control (p<0.05). # Statistical significance relative to FITC-dextran 20
kDa (p<0.05).
Non-infected Infected0
100
200
300
400
500*#
*
n=5 n=5
#
Non-infected Infected0
100
200
300
400
500
*
n=5 n=5
#
*#
Non-infected Infected0
100
200
300
400
500
n=2 n=2
Non-infected Infected0
100
200
300
400
500
n=5 n=5
*#
A B
C D
Non-infected Infected0
100
200
300
400
500
4kDa 20kDa
*
*
Papp
coe
ffic
ient
(cm
/sec
) x10
-4
Papp c
oef
fici
en
t (c
m /
se
c) x
10
-4
Looi 2015
136
An increase in permeability to FITC-dextran 4 (91.6 x 10-4 cm/sec) and 20 kDa (37.7 x
10-4 cm/sec) was observed following similar exposure to HRV-1B in the pAECNAA
cohorts when compared to their non-infected controls (78.6 x 10-4 cm/sec and 30.6 x 10-
4 cm/sec) (Figure 6.4 C). Furthermore, a higher level of transepithelial permeability to
FITC-dextran of 4 kDa (91.6 x 10-4 cm/sec) was observed in comparison to epithelial
permeability to FITC-dextran 20 kDa (37.7 x 10-4 cm/sec) (Figure 6.4 C – Infected).
However, due to the limited availability of pAECNAA cultures, statistical analysis could
not be performed to determine significance.
Similarly, following infection with HRV-1B in the pAECAA cohort, an increase in
permeability to FITC-dextran 4 (442.2 x 10-4 cm/sec ± 17.2; p<0.05) and 20 kDa (268.1
x 10-4 cm/sec ± 16.3) was observed compared to non-infected controls (320.5 x 10-4
cm/sec ± 39.9 and 221.7 x 10-4 cm/sec ± 28.9) (Figure 6.4 D). In addition, a
significantly higher level of transepithelial permeability towards FITC-dextran of 4 kDa
(442.2 x 10-4 cm/sec ± 17.2) was observed compared to the epithelial permeability
towards FITC-dextran 20 kDa (268.1 x 10-4 cm/sec ± 16.3) (Figure 6.4 D – Infected;
p<0.05).
Interestingly, no significant differences in epithelial permeability was observed (Figures
6.4 A - D, Infected) when assessing epithelial permeability to FITC-dextran 4 and 20
kDa following viral infection between pAECHNA, pAECHA, pAECNAA and pAECAA
cohorts.
6.4 Discussion
A seminal study by Sajjan and colleagues (2008) has previously shown that HRV
infection has the capacity to disrupt epithelial barrier integrity disruption in non-
asthmatic AECs. In a separate study, Kicic and colleagues (2006) have previously
demonstrated that there are intrinsic biochemical and functional differences between the
epithelium of children with and without asthma and that the paediatric asthmatic
epithelium exhibits an inability for complete repair after injury (Stevens et al. 2008).
Looi 2015
137
Hence, when viewed collectively, these studies provide the rationale and aims of the
current study, which aimed to assess tight junctional expression and barrier
functionality in response to HRV infection in paediatric AECs of non-asthmatic and
asthmatic cohorts.
The airway epithelium is constantly exposed to a myriad of potentially injurious
physical, chemical and biological agents. Some of these agents are capable of causing
inflammatory responses which can also result in further exacerbations of any underlying
respiratory conditions such as asthma, chronic obstructive pulmonary disease (COPD)
or other serious respiratory diseases. Human rhinoviruses have been shown to be the
most common precipitants of acute exacerbations of asthma (Johnston et al. 1995;
Corne et al. 2002; Chauhan et al. 2003; Grissell et al. 2005; Papi et al. 2006) and that
different serotypes of HRV could induce different responses in AECs (Nakagome et al
2014). However, the lack of a suitable animal model of asthma and HRV infection has
led to numerous studies utilising in vitro primary AECs from both non-asthmatic and
asthmatic individuals to better understand the airway biology following experimental
HRV infection in different cells of the lungs (Wark et al. 2005; Bochkov et al. 2010;
Cakebread et al. 2011).
Although Yeo and Jang were able to demonstrate an association between HRV infection
and decreased expression of epithelial junctional complexes as well as impaired barrier
function through measurement of transepithelial electrical resistance measurements, the
study was performed strictly on nasal derived AECs. A previous study by Lopez-Souza
and co-workers (2009) have demonstrated differences in resistance to HRV infection
between nasal and bronchial epithelial cells while others have demonstrated increased
susceptibility of bronchial epithelial cells to HRV infection (Jakiela et al. 2008).
Furthermore, evidence from past studies have demonstrated increased viral replication
in bronchial epithelial cells of asthmatic patients compared to healthy individuals,
suggesting that HRV infection could be an important cause of lower respiratory airway
disease (Papadopoulos et al. 2000; Contoli et al. 2006). Collectively, this emphasises
the limitation of utilising nasal AECs to study junctional complex expression in
Looi 2015
138
bronchial asthma as well as the need for caution when extrapolating data to bronchial
AECs.
A body of evidence has shown that HRV infections not only constitute the most
common cause of acute illness and wheezing during infancy, but has also been
implicated in the possible development and subsequent exacerbations of asthma later in
life (Kotaniemi-Syrjänen et al. 2003; Hyvärinen et al. 2005; Lemanske et al. 2005;
Kusel et al. 2007; Lee et al. 2007; Jackson et al. 2008; Kusel et al. 2012). Despite this
evidence which have been pivotal in demonstrating dissociation of specific TJ
complexes following HRV infection or exposure to cigarette smoke extract resulting in
a change in epithelial permeability, present studies have continued to utilise non-
paediatric cohorts for assessing epithelial barrier integrity. Hence, there remains a
paucity of data within the paediatric population and thus, findings from this study would
provide a glimpse of epithelial TJ expression profiles and function following HRV
infection in paediatric asthma. This complements those observed by Xiao and
colleagues in providing a snap-shot overview of epithelial TJ expression profiles and
function in early life for comparison to adulthood.
Basal expression data in this chapter is corroborated by those observed in Chapter 5,
demonstrating differences in basal membrane TJ protein expression within asthmatic
pAECs compared to non-asthmatic controls. Furthermore, when infected with HRV-1B
for 24 h, a loss in membrane TJ expression as observed in both non-asthmatic and
asthmatic cohorts could indicate an increased propensity for the movement of
pathogenic molecules or aeroallergens into the basement membrane. Interestingly,
despite the loss in both occludin and ZO-1 expression following infection at 24 h within
the asthmatic cohort, no change in membrane claudin-1 expression was observed. This
suggests a possible compensatory effect by the epithelial cells to maintain barrier
integrity, as shown by Saitou and colleagues (1998; 2000) in their occludin knock-out
studies demonstrating that occludin was not required for the formation of
morphologically intact TJs and strongly suggested that other junctional complexes were
capable of compensating for the lack of occludin expression.
Looi 2015
139
Interestingly, when HRV infection was extended over 48 h, a restoration of membrane
TJ expression of claudin-1, occludin and ZO-1 was observed within the non-asthmatic
cohort, suggesting that, in individuals without asthma, the epithelial cells might attempt
to re-assemble membrane TJ complexes in order to regain barrier integrity. In contrast,
membrane TJ protein expression within the asthmatic cohort was not restored. This
complements previous findings that the asthmatic epithelium is intrinsically different
and dysregulated (Kicic et al. 2006; Stevens et al. 2008; Kicic 2010) and suggests that
infection with HRV could result in a further loss of restorative capability in re-forming
membrane TJ complexes over extended periods.
When the data obtained in this study was further categorised according to atopy, it was
observed that the pAECHA, pAECNAA and pAECAA cohorts demonstrated similar
diminished membrane TJ protein expression profiles at a basal level in contrast to
pAECHNA. When infection was extended over 48 h, similar decrease in membrane TJ
protein expression profiles were observed for the pAECHA, pAECNAA and pAECAA
cohorts compared to pAECHNA, which demonstrated a restoration of membrane TJ
protein expression. This suggests the possible contribution of atopy in influencing TJ
protein expression, as demonstrated in studies investigating the effects of atopic
dermatitis on epidermal barrier integrity and function (De Benedetto et al. 2011; Kuo et
al. 2012) as well as the potential interaction with asthma in influencing eventual
membrane TJ protein expression.
Epithelial permeability towards various sized molecules is often a defining hallmark of
barrier integrity as demonstrated in numerous studies (Wan et al. 1999; Dreschers et al.
2007; Sajjan et al. 2008; Xiao et al. 2011). In the current study, when the observed post
HRV infection differences in membrane TJ protein expression were assessed
functionally, an increase in permeability, especially towards smaller sized
macromolecules, was observed in pAECs from the non-asthmatic cohort. A separate
study by Stevens and colleagues (2009) demonstrated that the viral titre utilised in this
study did not result in cellular apoptosis. Hence any change in epithelial permeability
could very likely be attributed to the disassembly of membrane TJ proteins following
HRV infection. Although different cell types were utilised, results from this study is in
Looi 2015
140
accordance as well as extend those from Sajjan and colleagues (2008), where they
demonstrated a significant increase in epithelial permeability following HRV infection
in polarised immortalised bronchial epithelial cell lines when compared to non-infected
or sham-infected controls.
Data from this chapter corroborated earlier observations of low basal membrane protein
expression levels in pAECAA and went on to demonstrate that although infection with
HRV causes further decreases in specific membrane TJ proteins, this does not result in
significantly increased epithelial permeability. Collectively, these results suggest that,
with the current monolayer asthmatic culture model, HRV infection has no additional
impact on an epithelium which is already inherently dysregulated and impaired.
When the data was further classified according to atopy, despite significant increases in
epithelial permeability towards the small sized macromolecule following HRV infection
in the pAECHNA, pAECHA, pAECNAA and pAECAA cohorts, there were no observable
differences between the cohorts. However, a drawback of the approach to assessing
barrier functionality in the present study is the use of a monolayer culture model, which
might not be the most reflective of an in vivo environment. Xiao and colleagues (2011),
in their study, utilised differentiated adult-derived pAECs of both non-asthmatic and
asthmatic cohorts to demonstrate significant differences in baseline epithelial
permeability of macromolecules of two different sizes. Interestingly, when basal
epithelial permeability of pAECs from non-asthmatic and asthmatic cohorts in this
present study were compared to the observations by Xiao and colleagues, results from
this study demonstrated significantly higher levels of baseline permeability. This
suggests that a lack of differentiation within the pAECs could partially explain the lack
of observable difference between the phenotypic cohorts following HRV infection
despite significant differences in permeability at baseline. This emphasises the potential
limitation of using a monolayer culture model in the assessment of transepithelial
permeability and provides the rationale for utilising a well-differentiated culture model
of paediatric derived pAECs to elucidate airway epithelium biology in response to HRV
infections.
Looi 2015
141
6.5 Conclusion
Human rhinovirus infections have been shown to be a major trigger in asthma
exacerbations (Nicholson et al. 1993; Johnston et al. 1995; Wark et al. 2002; Grissell et
al. 2005; Bizzintino et al. 2011; Cox et al. 2013) and in this chapter, data obtained has
demonstrated that disassembly of specific TJ complexes ensues in response to HRV
infection in both pAECs of non-asthmatic and asthmatic cohorts. However, restoration
of membrane TJ complexes occurs within pAECs of the non-asthmatic cohort while
sustained disassembly of TJ complexes were observed in pAECs of the asthmatic
cohort. Increases in epithelial permeability following HRV infection in the non-
asthmatic cohort further confirm disassembly of TJ complexes. However, a non-
significant difference in permeability post infection in the asthmatic cohort indicates a
lack of observable impact of HRV infection on increasing epithelial permeability. This
is observed despite an apparent decline in membrane TJ complexes expression. In
addition, although results from the different phenotypic cohorts are indicative of an
increase in epithelial permeability following HRV infection, the non-significant
differences between non-atopic and atopic phenotypes in each cohort is contrary to the
significant differences observed in TJ protein expression within the cohorts. This
suggests and establishes the premise for the utilisation of a physiologically
representative culture model in the assessment of transepithelial permeability.
Looi 2015
142
CHAPTER 7: Effects of human rhinovirus on epithelial barrier
integrity and function in well-differentiated air-liquid interface
cultures
7.1 Introduction
In healthy individuals, the respiratory epithelium is observed to be a pseudostratified
columnar layer consisting of ciliated, goblet and basal cells. These cells are involved in
a continual process of epithelial repair in response to cell senescence and injury,
characterised by cell proliferation and differentiation to maintain a homeostatic
epithelial layer (Bishop 2004; Rawlins and Hogan 2006; Crystal et al. 2008). In airway
diseases such as asthma, there are data that indicate that the respiratory epithelium has
an important role in the progression and pathogenesis of disease (Knight 2003; Holgate
2011). Moreover, studies have also shown that in asthma, the disease process often
originates in early life (Van Den Toorn et al. 2001; Evans et al. 2002; Stevens 2009).
Hence, the rationale for examining the respiratory epithelium in early life in order to
better comprehend the origins of this chronic disease.
Cell culture models utilising immortalised cell lines or human derived primary AEC are
often the preferred method for studying the complex and varied functions of the
respiratory epithelium (Grainger et al. 2006) . Moreover, the ability of human derived
primary AEC to differentiate in vitro whilst retaining their in vivo characteristics
provides a physiologically more representative culture model to assess cellular
characteristics, mechanisms and potential therapeutic interventions (Grainger et al.
2006; Lin et al. 2007; Kesimer et al. 2009; Pezzulo et al. 2011). Human derived
differentiated primary AEC cultures have been utilised in several studies to investigate
the differences in the respiratory epithelium between healthy and asthmatic individuals,
however, most of these studies were performed utilising adult-derived primary AECs
(Hackett et al. 2011; Xiao et al. 2011). Despite a previous study utilising paediatric
derived differentiated primary AECs to illustrate differences between healthy and
Looi 2015
143
asthmatic paediatric individuals (Parker 2010), there is a paucity of data on respiratory
epithelial barrier integrity and function in children and, in particular, children with
asthma. Furthermore, at present, there have been limited attempts to investigate the
airway epithelial integrity and function in paediatric asthmatic population following
exposure to viral exacerbations and the effects on epithelial function.
Hence, this study sought to test the hypothesis that HRV disrupts the epithelial barrier
integrity through disassembly of TJ proteins and that infection with HRV would result
in elevated transepithelial permeability in asthmatic cohorts. The initial aim of this
investigation was to generate reliable, robust air-liquid interface cultures (ALI) of
ciliated, pseudostratified pAECs from non-asthmatic and asthmatic children.
Subsequently, this investigation then compares and contrasts the epithelial barrier
integrity at basal level and following exposure to human rhinovirus between non-
asthmatic and asthmatic children. Utilising cell cultures obtained from paediatric
cohorts, this study was able to generate well-differentiated ALI cultures. Together with
TEER measurements and a permeability assay adapted for pAECs, this study was able
to functionally assess transepithelial permeability of inert macromolecules of two
different molecular weights following HRV infection between non-asthmatic and
asthmatic cohorts in the presence or absence of atopy.
7.2 Materials and Methods
The general materials and methods used in this part of the investigation are listed in
detail in Chapter 2.
7.2.1 Patient Demographics
As previously described (refer to 2.5.4), four cohorts were used in this study. For this
section of the investigation, samples were obtained from 6 healthy non-atopic (HNA; 5
female, 1 male), 4 healthy atopic (HA; 1 female, 3 male), 2 non-atopic asthmatic (NAA;
0 female, 2 male) and 4 atopic asthmatic (AA; 3 female, 1 male) children who did not
Looi 2015
144
previously receive any corticosteroid therapy. Patient demographics are summarised in
Table 7.1.
7.2.2 Cell culture
Maintenance and subsequent sub-culture of paediatric derived pAECs used in this
investigation has been described in detail in Chapter 2 (refer to 2.4.2.2.6 and 2.5.4).
7.2.3 Establishment of air-liquid interface (ALI) cultures
Primary AECs were initially grown on 6.5-mm Transwell-Clear inserts 0.4 µm pore size
pre-coated with human placental collagen type IV, which has been previously
demonstrated to support AEC growth (Tillie-Leblond et al. 2007). Cells were grown
under submerged conditions in Bronchial-Air Liquid Interface (B-ALI™, Lonza) growth
media until confluent. To differentiate into ciliated pseudostratified AECs, media was
removed from the apical side. This was considered Day 0 of ALI culture and the start of
the experimental period. Cells were then grown in B-ALI™ differentiation media, added
to the basolateral side every alternate day, and the apical side washed with tissue-culture
sterile 1X PBS (refer to 2.4.1.10) weekly. Cultures were grown for 28 days at ALI to
ensure maximal differentiation as assessed by the presence of beating cilia as well as
mucus production, as evident by mucus build-up on the apical side of the cultures.
7.2.4 Immunohistochemistry for visualisation of ciliated and goblet cells
Selected non-asthmatic and asthmatic cultures grown at ALI were washed with tissue-
culture sterile 1X PBS, fixed in Carnoy’s fixative solution (refer to 2.4.1.19) for 24 h,
dehydrated in 100% ethanol and paraffin embedded. Five-micrometre sections were
obtained according to standard procedure and subsequently stained with haematoxylin
and eosin as well as periodic acid-Schiff (PAS).
Table 7.1 Demographic of patient cohort categorised according to atopy
HNA – Healthy non-atopic; HA – Healthy atopic; NAA – Non-atopic asthmatic;
AA – Atopic asthmatic; F – Female; M - Male
Phenotype Gender Average Age (yr)
Age Range (yr) Number Total (n)
HNA F 3.1 1.5 – 4.2 5 6
M 2.2 2.2 1
HA F 3.4 3.4 1 4
M 4.3 3.1 – 5.5 3
NAA F – – – 2
M 7 2.4 – 11.5 2
AA F 4 3.4 – 4.5 3 4
M 16.7 16.7 1
Looi 2015
145
7.2.5 Immunofluorescence and confocal microscopy
Cells were fixed using ice cold methanol and acetone (1:1 dilution) for occludin or ZO-
1 stains. Following fixation, cells were washed in 1X TBS (3 x 5 min / wash) (refer to
2.4.1.15). Samples were blocked for non-specific binding in diluent containing 10%
normal goat serum (v/v final) (Gibco, USA), 10% FCS (v/v final) and 1% BSA (w/v
final) (refer to 2.4.2.1.2) in 1X TBS for 30 min at room temperature. Cells were
incubated with primary antibodies to occludin and ZO-1 for 1 h in diluent, followed by
washing with 1X TBS, (6 x 10 min / wash). Secondary antibodies in diluent were then
added to the cells for 1 h in the dark at room temperature. Cells were washed with 1X
TBS for 1 h and counterstained with Hoechst 33342 (Sigma, USA) for 5 min. All
samples were mounted with fluorescent mounting medium containing DABCO (Sigma,
USA). Control samples were included where the primary antibody was omitted to
eliminate any non-specific secondary antibody binding from analysis. Due to limited
availability of samples as well as the time limitation of this pilot study, staining of
membrane claudin-1 was not performed.
Samples were imaged using a Nikon A1 inverted confocal microscope (Nikon, Japan),
with a Nikon Plan Apo VC 60x NA 1.4 oil immersion objective (Nikon, Japan) and
NIS-AR Elements software (v4.2.22, Nikon, Japan), with 6 random fields acquired per
sample. Individual channels were captured sequentially, where a 405 nm laser was used
for Hoechst 33342 with collection through a 450/50 bandpass filter, whilst AF488 and
AF568 were imaged with 488 nm and 561 nm lasers, and 525/50 and 585/50 bandpass
filters respectively. Z-stack images with step size of 0.5 µm were collected with a
pinhole of 35.8 µm (1.2 A.U. for 488 nm laser), where the top and bottom of the stacks
were determined visually due to the uneven nature of the membrane.
7.2.6 Stereological analysis and quantification of tight junction expression
Quantification of TJ expression was performed on Maximum Intensity Projections
(ImageJ, NIH, USA) using standard stereology techniques (Schmitz et al. 1999; Matter
and Balda 2003; Aijaz et al. 2007). Briefly, grid overlays of 1000 µm2 (Grid Plugin,
Looi 2015
146
ImageJ, NIH, USA) were applied to images obtained from 6 random fields of each
sample in an unbiased manner. Where the TJs form a complete junction with a
contiguous membrane on both sides of the grid line, they were counted and analysed as
previously described (Rønn et al. 2000). However, where the connections between cells
are interrupted, the junction was excluded from the analyses. The number of junctions
were then tabulated and expressed as an average of the sample.
7.2.7 Human rhinovirus and titrations
The source, propagation and viral titre determination of the human rhinovirus minor
serotype 1B (HRV-1B) utilised in this investigation has been described in detail in
Chapter 2 (refer to 2.5.7, 2.5.7.1 and 2.5.7.2).
7.2.8 Infection of cell cultures
Paediatric-derived pAECs cultured on inserts, were infected with HRV-1B and
incubated for 24 h. Briefly, 50 µl of HRV-1B at a 50% Tissue Culture Infectivity Dose
(TCID50) of 10 x 104 TCID50/ml was added apically to the culture inserts for 5 h, after
which HRV-1B was removed and the culture inserts allowed to incubate for an
additional 19 h at 33°C in an atmosphere of 5% CO2 / 95% air. Infection with this viral
titre has been previously demonstrated to elicit cellular responses such as inflammation
but no significant increase in cell apoptosis (Stevens 2009). After each incubation
period, basolateral media was collected and stored at -80°C and infected cells were
utilised for various downstream assays.
7.2.9 Transepithelial electrical resistance measurement
Transepithelial electrical resistance (TEER) measurement were performed on days 7,
14, 21 and 28 to ensure the formation and integrity of epithelial TJ between cells using
an epithelial voltohmeter with silver chloride ‘chopstick’ electrodes. Prior to
measurement, the apical layer of the ALI cultures were washed with tissue-culture
Looi 2015
147
sterile 1X PBS (refer to 2.4.1.10) and HEPES buffered Hank’s Balanced Salt Solution
(HEPES-HBSS) (refer to 2.4.3.3.2) added to both apical and basolateral sides to
equilibrate the cultures. Triplicate measurements per well were made and the mean
resistance calculated. The resistance obtained from a cell-free culture insert was
subtracted from the resistance measured across each cell monolayer and corrected for
the surface area of the culture insert to yield the TEER of the epithelial cells with values
expressed in Ω/cm2.
7.2.10 Transepithelial permeability assay
The optimised transepithelial permeability assay, as described in detail within Chapter 3
was utilised for the functional determination of epithelial TJ membrane integrity prior
and following human rhinovirus infection.
7.2.11 Statistical analysis
Where applicable, data were tested for population normality and homogeneity of
variance, and a Student t test was performed. Experiments were performed in at least in
duplicates and using a minimum of three patients of each cohort per experiment.
Statistical analyses were performed, where applicable, using Mann-Whitney non-
parametric test and values presented are mean ± SD and P values less than 0.05 were
considered to be significant.
7.3 Results
7.3.1 Establishment of air-liquid interface cultures
When visualised under a light microscope at a low magnification (10X), the confluent
monolayer of cells demonstrated a typical ‘cobblestone’ appearance that was
characteristic of epithelial cells in culture. The confluent cell monolayer was then ‘air-
Looi 2015
148
lifted’ according to the supplied protocol. At ~20 days post ‘air-lifting’, mucus was
visible on the apical layer and this was evident until the termination of the experiment.
When visualised under high magnification (40X), ciliary movement was also observed
at ~ 20 days post ‘air-lift’ until experiment was performed, at ~ 31 days post ‘air-lift’.
7.3.2 Physical properties of pAEC derived ALI cell cultures of non-asthmatic and
asthmatic cohorts
When viewed under high magnification (40X Oil), the presence of a number of layers of
cells was observed, including ciliated cells on the apical surface following haematoxylin
and eosin (H&E) stains. Furthermore, observations showed well-differentiated, multi-
layered ALI cultures of 3 – 4 cell layers in vitro, with ciliated cells on the apical surface
of the epithelial cell layer (Figure 7.1 A and B respectively). To further assess
differentiation and confirm the cellular identity of pAEC ALI culture, periodic acid-
Schiff (PAS) staining which was performed, revealed the presence of goblet cells
associated with mucus secretion at the apical surface (Figure 7.1 C and D respectively).
The observed presence of a mucus-producing, multi-layered epithelium containing
ciliated and goblet cells strongly indicated the complete differentiation of pAECs into a
well-differentiated and functional epithelium.
When pAEC ALI cultures of both non-asthmatic and asthmatic cohort were further
classified according to atopy, well-differentiated, multi-layered ALI cultures of 2 – 4
cell layers, with ciliated cells observed on the apical surface of the epithelial cell layer
following H&E stains (Figure 7.2 A - D) was observed within each phenotype while
PAS staining revealed the presence of a mucus layer and goblet cells in all phenotypes
(Figure 7.2 E - H).
Figure 7.1 Generation of ALI cultures from pAECs of non-asthmatic and
asthmatic cohorts: Air-liquid interface cultures of airway epithelial cells derived from
non-asthmatic (A and C) and asthmatic (B and D) paediatric donors were fixed,
embedded and sectioned for subsequent analysis of morphology and cilia formation
(black arrows) by haematoxylin-and-eosin (H&E) and mucin production (red arrows) by
periodic-acid-schiff (PAS) stained sections respectively. Images are representative of
n=3 (Total magnification 40X Oil).
A C
D B
H&E PAS
Figure 7.2 Generation of ALI cultures from pAECs of non-asthmatic and
asthmatic cohorts with each cohort further categorised based on atopy: Air-liquid
interface cultures of airway epithelial cells derived from healthy non-atopic (A and E);
healthy atopic (B and F); non-atopic asthmatic (C and G) and atopic asthmatic (D and
H) paediatric cohorts were fixed, embedded and sectioned for subsequent analysis of
morphology and cilia formation (black arrows) by haematoxylin-and-eosin (H&E) and
mucin production (red arrows) by periodic-acid-schiff (PAS) stained sections
respectively. Images are representative of n=3 (Total magnification 40X Oil).
A
B
C
D
E
F
G
H
H&E PAS
Looi 2015
149
7.3.3 Effect of human rhinovirus infection on membrane tight junction protein
expression in pAEC derived well differentiated air-liquid interface (ALI) cultures
Having demonstrated differences in in vitro TJ protein expression on monolayer
cultures following HRV infection, protein expression of the same TJs were assessed in
well-differentiated pAEC ALI cultures of non-asthmatic and asthmatic cohorts
following infection. Due to the limited availability of samples in this pilot study, the
analysis of membrane claudin-1 expression was not performed. Membrane occludin and
ZO-1 TJ protein expression were determined via confocal microscopy of well-
differentiated ALI cultures on semi-permeable insert membranes.
7.3.3.1 Comparison between pAECs of non-asthmatic and asthmatic cohorts
Under confocal microscopy, the presence of a continuous, uninterrupted membrane
protein expression of both occludin and ZO-1 TJs proteins were observed in the apical
regions of the in vitro differentiated ALI cultures of both non-asthmatic (Figure 7.3 A -
D) and asthmatic (Figure 7.4 A – D) cohorts prior viral infection. A less continuous and
more punctate membrane protein expression of both TJs was observed in the apical
regions of both non-asthmatic (Figure 7.3 E – H) and asthmatic (Figure 7.4 E - H)
cohorts following viral infection. A more disrupted membrane protein expression in the
apical region was observed in the asthmatic ALI (Figure 7.4 H) cultures compared to
the non-asthmatic counterpart (Figure 7.3 H).
When assessing membrane occludin expression between non-asthmatic and asthmatic
cohorts, results obtained demonstrated significantly lower basal membrane occludin
within the asthmatic cohort compared to the non-asthmatic counterpart (Figure 7.5 A –
Non-infected). Following 24 h infection with viral titre of 10 x 104 TCID50/ml of HRV-
1B, results demonstrated minimal change in membrane occludin expression (276.6AU ±
17.9) compared to their non-infected controls (278.6AU ± 11.7) in the non-asthmatic
cohort. When membrane occludin expression from the asthmatic ALI cultures were
assessed following infection, the data demonstrated significantly diminished membrane
occludin expression (37.3AU ± 5.9) in the asthmatic ALI cultures in comparison to non-
Figure 7.3 Membrane TJ protein expression in ALI cultures generated from
pAECs of non-asthmatic cohorts following viral infection: Air-liquid interface
cultures of airway epithelial cells derived from non-asthmatic paediatric donors were
fixed and incubated with primary antibodies to zonula occluden-1 (ZO-1) (green; A and
E) and occludin (red; B and F) for 1 h at room temperature followed by secondary
antibodies for 1 h in the dark at room temperature. Cultures were then counterstained
with Hoechst 33342, which illuminates cellular nuclear material (blue). (C and G)
Merged image of (A) and (B), (E) and (F) respectively demonstrates the areas of tight
junction expression. (D) Confocal imaging of occludin and ZO-1 in representative ALI
samples of pAECs from non-infected non-asthmatic cohort demonstrates continuous
uninterrupted membrane protein expression of both TJ proteins at the apical region of
the differentiated culture (white arrows). (H) Confocal imaging of occludin and ZO-1 in
representative ALI samples of pAECs from infected non-asthmatic cohort demonstrates
loss in expression of membrane protein expression of both TJ proteins at the apical
region of the differentiated culture (red arrows). Images are representative of n=3 (Total
magnification 60X Oil).
A
B
C
D
E
F
G
H
Figure 7.4 Membrane TJ protein expression in ALI cultures generated from
pAECs of asthmatic cohorts following viral infection: Air-liquid interface cultures of
airway epithelial cells derived from asthmatic paediatric donors were fixed and
incubated with primary antibodies to zonula occluden-1 (ZO-1) (green; A and E) and
occludin (red; B and F) for 1 h at room temperature followed by secondary antibodies
for 1 h in the dark at room temperature. Cultures were then counterstained with Hoechst
33342, which illuminates cellular nuclear material (blue). (C and G) Merged image of
(A) and (B), (E) and (F) respectively demonstrates the areas of tight junction
expression. (D) Confocal imaging of occludin and ZO-1 in representative ALI samples
of pAECs from non-infected asthmatic cohort demonstrates continuous uninterrupted
membrane protein expression of both TJ proteins at the apical region of the
differentiated culture (white arrows). (H) Confocal imaging of occludin and ZO-1 in
representative ALI samples of pAECs from infected asthmatic cohort demonstrates loss
in expression of membrane protein expression of both TJ proteins at the apical region of
the differentiated culture (red arrows). Images are representative of n=3 (Total
magnification 60X Oil).
A
B
C
D
E
F
G
H
50 µm
Figure 7.5 Expression of membrane TJ protein in ALI cultures from pAECs of non-asthmatic and asthmatic cohorts following viral infection:
pAECs seeded on culture inserts and grown to confluence were treated as previously mentioned (refer to 7.2.3). Cultures were infected with HRV-1B
at 10 x 104 TCID50/ml for 24 h and membrane protein expression assessed via confocal microscopy and standard stereology techniques (refer to 7.2.5).
(A) Minimal decrease in membrane occludin expression following infection with HRV-1B was observed in ALI cultures of the non-asthmatic cohort.
Significant decrease in membrane occludin expression was observed in ALI cultures of the asthmatic cohort following infection. Significant difference
in membrane protein expression was also observed between ALI cultures of asthmatic and non-asthmatic cohorts. (B) A significant decrease in
membrane ZO-1 expression was observed in ALI cultures of non-asthmatic cohort following HRV-1B infection. Similarly, a significant decrease in
membrane ZO-1 expression was also observed in ALI cultures of asthmatic cohort. Difference in membrane ZO-1 expression between ALI cultures of
non-asthmatic and asthmatic cohorts was observed to be of significance. Data were presented as mean ± SD relative to control. *Statistical significance
relative to non-infected controls (p<0.05) # Statistical significance relative to non-asthmatic cohort (p<0.05).
Non-infected Infected0
100
200
300
400
Non-asthmatic Asthmatic
Mem
bran
e pr
otei
n ex
pres
sion
(Arb
itrar
y Un
its)
Non-infected Infected0
100
200
300
400
Non-asthmatic Asthmatic
*
*
*#
#
A B
Looi 2015
150
infected controls (165.7AU ± 10.8). Interestingly, following 24 h infection, membrane
occludin expression was observed to be significantly lower (37.3AU ± 5.9) in the
asthmatic cultures in comparison to the non-asthmatic cultures (276.5AU ± 17.9)
(Figure 7.5 A; p<0.05)
Similarly, when ZO-1 expression was compared between non-asthmatic and asthmatic
cohorts, results obtained demonstrated significantly lower basal ZO-1 expression in
asthmatic ALI pAECs (325.2AU ± 5.2) compared to non-asthmatic ALI pAECs (338.4
± 6.7) (Figure 7.5 B, Non-infected; p<0.05). After 24 h infection, results showed a
significantly lower membrane ZO-1 expression (270.6AU ± 8.5) in contrast to non-
infected, non-asthmatic controls (338.4AU ± 6.7) (Figure 7.5 B; p<0.05). When
membrane ZO-1 expression of the asthmatic cultures were analysed, results
demonstrated significantly lower ZO-1 expression (239.1AU ± 13.9) in comparison to
non-infected controls (325.2AU ± 5.2). In addition, following 24 h infection, membrane
ZO-1 expression was observed to be significantly lower (239.1AU ± 13.9) in the
asthmatic cohort in comparison with the non-asthmatic cohort (270.6AU ± 8.5) (Figure
7.5 B; p<0.05).
7.3.3.2 Comparison between pAECs of non-asthmatic and asthmatic cohorts based on
atopic status
When the non-asthmatic and asthmatic cohorts were further classified according to
atopy, the presence of a continuous, uninterrupted membrane protein expression of both
TJs was observed in the apical regions of the in vitro differentiated ALI cultures of non-
asthmatic non-atopic (Figure 7.6 A - D), non-asthmatic atopic (Figure 7.7 A - D) and
asthmatic atopic (Figure 7.8 A - D) cohorts prior viral infection. In contrast, a less
continuous and more punctate membrane protein expression of both TJs was observed
in the apical regions of all three phenotypic cohorts following viral infection (Figure 7.6
– 7.8 E - H respectively). Due to limited availability of pAECNAA and the time
constraints of this preliminary investigation, the pAECNAA cohort was excluded from all
statistical and comparative analysis.
Figure 7.6 Membrane TJ protein expression in ALI cultures generated from
pAECHNA cohorts following viral infection: Air-liquid interface cultures of airway
epithelial cells derived from non-asthmatic, non-atopic paediatric donors were fixed and
incubated with primary antibodies to zonula occluden-1 (ZO-1) (green; A and E) and
occludin (red; B and F) for 1 h at room temperature followed by secondary antibodies
for 1 h in the dark at room temperature. Cultures were then counterstained with Hoechst
33342, which illuminates cellular nuclear material (blue). (C and G) Merged image of
(A) and (B), (E) and (F) respectively demonstrates the areas of tight junction
expression. (D) Confocal imaging of occludin and ZO-1 in representative ALI samples
of pAECs from non-infected non-asthmatic cohort demonstrates continuous
uninterrupted membrane protein expression of both TJ proteins at the apical region of
the differentiated culture (white arrows). (H) Confocal imaging of occludin and ZO-1 in
representative ALI samples of pAECs from infected non-asthmatic cohort demonstrates
loss in expression of membrane protein expression of both TJ proteins at the apical
region of the differentiated culture (red arrows). Images are representative of n=3 (Total
magnification 60X Oil).
A
B
C
D
E
F
G
H
Figure 7.7 Membrane TJ protein expression in ALI cultures generated from
pAECHA cohorts following viral infection: Air-liquid interface cultures of airway
epithelial cells derived from atopic, non-asthmatic paediatric donors were fixed and
incubated with primary antibodies to zonula occluden-1 (ZO-1) (green; A and E) and
occludin (red; B and F) for 1 h at room temperature followed by secondary antibodies
for 1 h in the dark at room temperature. Cultures were then counterstained with Hoechst
33342, which illuminates cellular nuclear material (blue). (C and G) Merged image of
(A) and (B), (E) and (F) respectively demonstrates the areas of tight junction
expression. (D) Confocal imaging of occludin and ZO-1 in representative ALI samples
of pAECs from non-infected non-asthmatic cohort demonstrates continuous
uninterrupted membrane protein expression of both TJ proteins at the apical region of
the differentiated culture (white arrows). (H) Confocal imaging of occludin and ZO-1 in
representative ALI samples of pAECs from infected non-asthmatic cohort demonstrates
loss in expression of membrane protein expression of both TJ proteins at the apical
region of the differentiated culture (red arrows). Images are representative of n=3 (Total
magnification 60X Oil).
A
B
C
D
E
F
G
H
50 µm 50 µm
Figure 7.8 Membrane TJ protein expression in ALI cultures generated from
pAECAA cohorts following viral infection: Air-liquid interface cultures of airway
epithelial cells derived from atopic, asthmatic paediatric donors were fixed and
incubated with primary antibodies to zonula occluden-1 (ZO-1) (green; A and E) and
occludin (red; B and F) for 1 h at room temperature followed by secondary antibodies
for 1 h in the dark at room temperature. Cultures were then counterstained with Hoechst
33342, which illuminates cellular nuclear material (blue). (C and G) Merged image of
(A) and (B), (E) and (F) respectively demonstrates the areas of tight junction
expression. (D) Confocal imaging of occludin and ZO-1 in representative ALI samples
of pAECs from non-infected asthmatic cohort demonstrates continuous uninterrupted
membrane protein expression of both TJ proteins at the apical region of the
differentiated culture (white arrows). (H) Confocal imaging of occludin and ZO-1 in
representative ALI samples of pAECs from infected asthmatic cohort demonstrates loss
in expression of membrane protein expression of both TJ proteins at the apical region of
the differentiated culture (red arrows). Images are representative of n=3 (Total
magnification 60X Oil).
A
B
C
D
E
F
G
H
50 µm
Looi 2015
151
In the assessment of membrane protein expression, data demonstrated higher basal
expression of membrane occludin in pAECHA (300.1AU ± 15.4) when compared to
pAECHNA (257.3AU ± 15.1). In contrast, basal membrane occludin expression was
observed to be significantly lower in pAECAA (165.7AU ± 10.8) when compared to both
pAECHNA and pAECHA ALI cultures (Figure 7.9 A, Non-infected; p<0.05). In addition,
following 24 h infection with a viral titre of 10x104 TCID50/ml of HRV-1B, the
obtained data showed a significant decrease in membrane occludin expression within
the pAECHNA and pAECAA cohorts (201.8AU ± 17.5 and 37.3AU ± 5.9 respectively)
while expression of membrane occludin in pAECHA cohort was significantly elevated
(351.1AU ± 5.1) (Figure 7.9 A, Infected; p<0.05).
When assessing the effects of the viral infection on membrane occludin protein
expression at 24 h post infection, membrane expression of occludin was significantly
higher in pAECHA (351.1AU ± 5.1) in contrast to pAECHNA (201.8AU ± 17.5).
Expression of membrane occludin was also significantly lower in pAECAA (37.3AU ±
5.9) in contrast to pAECHNA (201.8AU ± 17.5) and pAECHA (351.1AU ± 5.1).
Similarly, when membrane ZO-1 protein expression was assessed, data generated
demonstrated significantly lower basal expression of membrane ZO-1 in pAECHA
(343.8AU ± 6.3) when compared to pAECHNA (364.4AU ± 6.3) (Figure 7.9 B, Non-
infected; p<0.05). Interestingly, basal expression of membrane ZO-1 was observed to
be higher in the pAECAA cohort compared to pAECHNA. However, this was found to be
not significant (Figure 7.9 B, Non-infected). In addition, following 24 h infection with a
viral titre of 10x104 TCID50/ml of HRV-1B, the obtained data showed a significant
decrease in membrane ZO-1 expression within the pAECHNA (228.1AU ± 9.6), pAECHA
(303.6AU ± 13.1) and pAECAA (204.2AU ± 10.7) when compared to non-infected
controls (Figure 7.9 B, Infected; p<0.05).
When assessing the effects of the viral infection on membrane ZO-1 protein expression
at 24 h post infection, membrane expression of ZO-1 was lower pAECAA (204.2AU ±
10.7) in contrast to pAECHNA (228.1AU ± 9.6). Membrane expression of ZO-1 was
significantly higher in pAECHA (303.6AU ± 13.1) when compared to pAECHNA (Figure
Figure 7.9 Expression of membrane TJ protein in ALI cultures from pAECs of non-asthmatic and asthmatic cohorts with each cohort further
categorised based on atopy: pAECs seeded on culture inserts and grown to confluence were treated as previously mentioned (refer to 7.2.3). Cultures
were infected with HRV-1B at 10 x 104 TCID50/ml for 24 h and membrane protein expression assessed via confocal microscopy and standard
stereology techniques (refer to 7.2.5). (A) Following infection with HRV-1B at viral titre of 10 x 104 TCID50/ml, a significant decrease in membrane
occludin expression was observed in pAECHNA and pAECAA ALI cultures compared to non-infected controls. However, a significant increase in
membrane occludin expression was observed in pAECHA ALI cultures in contrast to non-infected controls. (B) A significant decrease in membrane
ZO-1 expression was observed in pAECHNA, pAECHA and pAECAA ALI cultures following infection compared to non-infected controls. Data were
presented as mean ± SD; n = 4 individual experiments each performed in duplicates. *Statistical significance relative to non-infected control (p<0.05).
Non-infected Infected0
100
200
300
400
500
HNA HA AA
Mem
bran
e pr
otei
n ex
pres
sion
(Arb
itrar
y U
nits
)
Non-infected Infected0
100
200
300
400
500
HNA HA AA
*
*
*
**
A B
Looi 2015
152
7.9 B, Infected; p<0.05). Expression of membrane ZO-1 was also significantly lower in
pAECAA (204.2AU ± 10.7) in comparison with pAECHA (303.6AU ± 13.1) (Figure 7.9
B, Infected; p<0.05).
7.3.4 Effect of human rhinovirus infection on transepithelial electrical resistance
(TEER) and permeability in pAEC derived well differentiated air-liquid interface
(ALI) cultures
Having demonstrated a change in TJ expression, transepithelial permeability towards
the same inert macromolecule sizes of 4 and 20 kDa was then assessed across the
differentiated ALI cultures following HRV infection.
7.3.4.1 Comparison between pAECs of non-asthmatic and asthmatic cohorts
Results generated demonstrated higher transepithelial resistance (RT) of non-infected
controls (851.4 Ω/cm2 ± 156.6) and following HRV infection, a significant decrease in
RT (402.8 Ω/cm2 ± 54.6) was observed (Figure 7.10 A - TEER; p<0.05). Consistent with
the decrease in RT, infected non-asthmatic ALI cultures demonstrated an increase in
levels of transepithelial permeability to FITC-dextran 4 (22.4 x 10-4 cm/sec ± 8.4) and
20 (3.1 x 10-4 cm/sec ± 0.5) kDa following 24 h infection in contrast with non-infected
controls (9.2 x 10-4 cm/sec ± 2.4 and 2.6 x 10-4 cm/sec ± 0.4 respectively) (Figure 7.10
A). This was observed to be significant for FITC-dextran 4 kDa (Figure 7.10 A – 4 kDa;
p<0.05). Moreover, when assessing epithelial permeability to the different sized inert
macromolecule within the non-infected non-asthmatic cultures, significantly higher
level of transepithelial permeability towards FITC-dextran of 4 kDa (9.2 x 10-4 cm/sec ±
2.4) was observed in comparison to FITC-dextran 20 kDa (2.6 x 10-4 cm/sec ± 0.4)
(Figure 7.10 A – Non-infected; p<0.05). Similar observations of significantly higher
level of transepithelial permeability to FITC-dextran of 4 kDa (22.4 x 10-4 cm/sec ± 8.4)
was observed in comparison to FITC-dextran 20 kDa (3.1 x 10-4 cm/sec ± 0.5) in the
infected non-asthmatic cultures (Figure 7.10 A - Infected; p<0.05).
Figure 7.10 Transepithelial electrical resistance (RT) and permeability in ALI cultures from pAECs of non-asthmatic and asthmatic cohorts:
pAECs from non-asthmatic and asthmatic cohorts, seeded onto Corning transwell inserts and grown to confluence were cultured at ALI conditions
until differentiation and mucus generation occurred. Following 24 h infection with a viral titre of 10 x 104 TCID50/ml of HRV-1B, an optimised
transepithelial permeability assay as previously described was performed to determine epithelial permeability to FITC-dextran 4 kDa (blue) and 20
kDa (grey) (refer to 3.3.4). (A) Corroborating the reduced RT, an increase in transepithelial permeability towards both FITC-dextran 4 and 20 kDa was
observed in pAEC ALI cultures of non-asthmatic cohorts following infection . Epithelial permeability towards FITC-dextran 4 kDa was significantly
higher when compared to FITC-dextran 20 kDa in non-infected and infected pAEC ALI cultures of non-asthmatic cohort. (B) Significant reduction in
RT was concomitant with significant difference in transepithelial permeability towards FITC-dextran 4 kDa but not 20 kDa in pAEC ALI cultures of
asthmatic cohorts following infection. However, permeability towards FITC-dextran 4 kDa was significantly higher when compared to FITC-dextran
20 kDa in non-infected and infected pAEC ALI cultures of asthmatic cohort. Results are presented as mean ± SD; n = 8 individual experiments each
performed in duplicates with the exception of asthmatic cohort (n=6). *Statistical significance relative to non-infected control (p < 0.05). # Statistical
significance relative to FITC-dextran 20 kDa (p<0.05).
Non-infected Infected0
10
20
30
40
0
200
400
600
800
1000
Pap
p co
effic
ient
(cm
/sec
) x10
-4R
T ( / cm
2)
Non-infected Infected0
10
20
30
40
0
200
400
600
800
1000
4kDa 20kDa TEER (RT)
*
*
*#
*#
##
A B
Looi 2015
153
Similarly, in pAECs of the asthmatic cohort prior to infection with HRV, data
demonstrated higher RT in asthmatic pAEC ALI cultures (611.5 Ω/cm2 ± 350.7) and
following infection, a significant decrease (183.7 Ω/cm2 ± 112.8) was observed (Figure
7.10 B - TEER; p<0.05). In addition, consistent with the decrease in RT, a significant
increase in transepithelial permeability of FITC-dextran 4 kDa (31.4 x 10-4 cm/sec ±
5.5) (Figure 7.10 B; p<0.05) was observed in infected cultures in contrast to non-
infected controls, however, permeability to FITC-dextran 20 kDa, although higher, was
found to be non-significant. Nonetheless, when assessing epithelial permeability to the
different sized inert macromolecule in the non-infected asthmatic cultures, significantly
higher level of transepithelial permeability towards FITC-dextran of 4 kDa (15.4 x 10-4
cm/sec ± 3.2) was observed in comparison to FITC-dextran 20 kDa (6.1 x 10-4 cm/sec ±
1.8) (Figure 7.10 B – Non-infected; p<0.05). A significantly higher level of
transepithelial permeability to FITC-dextran of 4 kDa (31.4 x 10-4 cm/sec ± 5.5) was
observed in comparison to epithelial permeability towards FITC-dextran 20 kDa (6.2 x
10-4 cm/sec ± 2.7) in the infected asthmatic cultures (Figure 7.10 B - Infected; p<0.05).
7.3.4.2 Comparison between pAECs of non-asthmatic and asthmatic cohorts based on
atopic status
When the non-asthmatic and asthmatic cohorts were further classified according to
atopy, results generated demonstrated a higher RT in the pAECHNA ALI cohort (994.4
Ω/cm2 ± 1.9) and post HRV-1B infection, RT in pAECHNA ALI cohort was significantly
lower (452.7 Ω/cm2 ± 2.8) (Figure 7.11 A – TEER; p<0.05). Consistent with the
decrease in RT, infected pAECHNA ALI cultures demonstrated an increase in levels of
transepithelial permeability of FITC-dextran 4 (16.9 x 10-4 cm/sec ± 1.3) and 20 (3.1 x
10-4 cm/sec ± 0.8) kDa following infection compared to non-infected controls (7.2 x 10-
4 cm/sec ± 1.8 and 1.8 x 10-4 cm/sec ± 0.4 respectively). This was observed to be
significant for FITC-dextran 4 kDa (Figure 7.11 A – 4 kDa; p<0.05). In addition,
transepithelial permeability to FITC-dextran of 4 kDa (16.9 x 10-4 cm/sec ± 1.3) was
significantly higher in comparison to FITC-dextran 20 kDa (3.1 x 10-4 cm/sec ± 0.8)
(Figure 7.11 A – Infected; p<0.05).
Looi 2015
154
In comparison to non-infected controls (708.4 Ω/cm2 ± 1.9), a significant decrease in RT
was demonstrated following HRV-1B infection in the pAECHA ALI cohort (352.9
Ω/cm2 ± 2.5) (Figure 7.11 B – TEER; p<0.05). In conjunction with the decrease in RT,
infected pAECHA ALI cultures similarly demonstrated increase in levels of
transepithelial permeability of FITC-dextran 4 (49.3 x 10-4 cm/sec ± 18.8) and 20 (3 x
10-4 cm/sec ± 0.3) kDa following infection with compared to non-infected controls (5.6
x 10-4 cm/sec ± 1.4 and 2.1 x 10-4 cm/sec ± 0.2 respectively). This was observed to be
non-significant for FITC-dextran 4 kDa (Figure 7.11 A – 4 kDa; p = 0.055).
Furthermore, when assessing epithelial permeability to the different sized inert
macromolecule following infection, transepithelial permeability to FITC-dextran of 4
kDa (49.3 x 10-4 cm/sec ± 18.8) was significantly higher in comparison to epithelial
permeability to FITC-dextran 20 kDa (3 x 10-4 cm/sec ± 0.3) (Figure 7.11 B – Infected;
p<0.05).
In contrast to non-infected controls (291.4 Ω/cm2 ± 1.3), a significant decrease in RT
was similarly observed following HRV-1B infection in pAECNAA ALI cohort (81.1
Ω/cm2 ± 2) (Figure 7.11 C – TEER; p<0.05). Together with the reduction in RT,
infected pAECNAA ALI cultures demonstrated an increase in levels of transepithelial
permeability to FITC-dextran 4 (27.7 x 10-4 cm/sec ± 13.6) and 20 (4.2 x 10-4 cm/sec ±
2.6) kDa following infection which was in contrast to non-infected controls (15.7 x 10-4
cm/sec ± 3.5 and 4 x 10-4 cm/sec ± 1.2 respectively) (Figure 7.11 C). Moreover,
epithelial permeability to the different sized inert macromolecules following infection
was observed to be higher for FITC-dextran of 4 kDa (27.7 x 10-4 cm/sec ± 13.6) in
comparison to FITC-dextran 20 kDa (4.2 x 10-4 cm/sec ± 2.6) (Figure 7.11 C -
Infected). However, due to the limited availability of pAECNAA ALI, statistical analysis
could not be performed to determine the level of significance.
When compared to non-infected controls (931.7 Ω/cm2 ± 1.9), significant decrease in R-
T was observed in pAECAA ALI cohort (286.5 Ω/cm2 ± 13.2) following HRV infection
(Figure 7.11 D – TEER; p<0.05). Concurrent with the decrease in RT, infected pAECAA
ALI cultures also showed significant increase in level of transepithelial permeability of
FITC-dextran 4 (33.9 x 10-4 cm/sec ± 7.1) but not FITC-dextran 20 kDa (6.8 x 10-4
Figure 7.11 Transepithelial electrical resistance (RT) and permeability in ALI cultures from pAECs of non-asthmatic and asthmatic cohorts
with each cohort further categorised based on atopy: pAECs from non-asthmatic and asthmatic cohorts, seeded onto Corning transwell inserts and
grown to confluence were cultured at ALI conditions until differentiation and mucus generation occurred. Following 24 h infection with a viral titre of
10 x 104 TCID50/ml of HRV-1B, an optimised transepithelial permeability assay as previously described was performed to determine epithelial
permeability to FITC-dextran 4 kDa (blue) and 20 kDa (grey) (refer to 3.3.4). (A) Concomitant with a significantly reduced RT, significant increase in
transepithelial permeability was observed for FITC-dextran 4 following infection in the pAECHNA cohort. Epithelial permeability to FITC-dextran 4
kDa was also significantly higher compared to FITC-dextran 20 kDa in both non-infected and infected pAECHNA. (B) Associated with a significant
decreased RT, an increase in transepithelial permeability was observed for FITC-dextran 4 following infection in the pAECHA cohort, however, this was
observed to be just not significant. Epithelial permeability to FITC-dextran 4 kDa was also significantly higher compared to FITC-dextran 20 kDa in
both non-infected and infected pAECHA. (C) Concomitant with a significantly reduced RT, an increase in transepithelial permeability was observed for
FITC-dextran 4 following infection in the pAECNAA cohort, however, due to low sample size of pAECNAA, statistical analysis could not be performed
to determine significance and was excluded from comparative statistical analysis. (D) Associated with a significant decreased RT, an increase in
transepithelial permeability was observed for FITC-dextran 4 following infection in the pAECAA cohort, increase in transepithelial permeability was
observed for both FITC-dextran 4 and 20 kDa following infection in the pAECAA cohort. Epithelial permeability to FITC-dextran 4 kDa was also
significantly higher compared to FITC-dextran 20 kDa in only the infected pAECAA. Results are presented as mean ± SD; n = 4 individual experiments
each performed in duplicates with the exception of pAECNAA phenotype (n=2). *Statistical significance relative to non-infected control (p<0.05). #Statistical significance relative to FITC-dextran 20 kDa (p<0.05).
Non-infected Infected0
20
40
60
80
0
500
1000
1500
*
Non-infected Infected0
20
40
60
80
0
500
1000
1500
Non-infected Infected0
20
40
60
80
0
500
1000
1500
Non-infected Infected0
20
40
60
80
0
500
1000
1500
4kDa 20kDa TEER (RT)
**
**
*#
#
*#
##
Papp c
oef
fici
en
t (c
m /
se
c) x
10-4
RT (Ω
/ cm2)
A B
C D
Looi 2015
155
cm/sec ± 3.8) following infection with HRV-1B in comparison to non-infected controls
(11.7 x 10-4 cm/sec ± 7.2 and 5.1 x 10-4 cm/sec ± 2.1 respectively). Furthermore,
epithelial permeability to the different sized inert macromolecule was not significantly
different in non-infected pAECAA cultures (Figure 7.11 D – Non-infected). However,
following infection, significantly higher epithelial permeability to FITC-dextran of 4
kDa (33.9 x 10-4 cm/sec ± 7.1) was observed in comparison to FITC-dextran 20 kDa
(6.8 x 10-4 cm/sec ± 3.8) (Figure 7.11 D – Infected; p<0.05).
When RT between the phenotypic cohorts were assessed, pAECHA, pAECNAA and
pAECAA ALI cultures demonstrated significantly lower basal and post infection RT
values compared to pAECHNA. Furthermore, when assessing the magnitude of decrease
in RT following HRV-1B infection, pAECNAA and pAECAA ALI cohorts demonstrated a
greater magnitude of decrease (3.6-fold and 3.3-fold respectively) when compared to
pAECHNA and pAECHA (2.2-fold and 2-fold respectively). Similar observations were
shown when data obtained from the ALI cultures were further analysed based on atopy.
Interestingly, when assessing epithelial permeability to FITC-dextran 4 and 20 kDa
following infection, permeability to FITC-dextran 4 kDa was just significantly higher in
pAECHA (49.3 x 10-4 cm/sec ± 18.8) ALI cohort compared to pAECHNA (16.9 x 10-4
cm/sec ± 1.3), while there was no significant difference in pAECNAA and pAECAA
cultures when compared to pAECHNA ALI cultures. Further comparative analysis
between pAECHA, pAECNAA and pAECAA did not demonstrate any significant
difference in epithelial permeability towards FITC-dextran 4 kDa following HRV-1B
infection.
7.4 Discussion
Air-liquid interface (ALI) cultures are an immensely powerful tool for the investigation
of the human respiratory epithelium in vitro and are used to model airway epithelial
differentiation, injury and repair; to assess the function of specific genes and biological
pathways as well as for the assessment of gene transfers (Wu et al. 1986; Whitcutt et al.
Looi 2015
156
1988; Gruenert et al. 1990; De Jong et al. 1993; Pickles et al. 1998; Fulcher et al. 2005;
Zabner et al. 2005; Pierrou et al. 2007; Ross et al. 2007). Hence, this study aimed to
recapitulate the observations of the previous chapters by providing additional insights
on tight junctional complex expression through the utilisation of a well-differentiated
culture model which better mimics the in vivo tracheo-bronchial epithelium compared to
submerged monolayer cultures. This would offer a better understanding of the paediatric
asthmatic epithelium and the effects on barrier compromisation following HRV
infection.
Initial observations of ALI cultures in this study are consistent with other studies that
have demonstrated that ALI cultures consists of various cells types including ciliated,
mucus and basal cells (Parker 2010; Hackett et al. 2011). Despite the small samples
sizes tested in this preliminary in vitro study of well-differentiated non-asthmatic and
asthmatic epithelium, results from confocal microscopy stereological analysis
corroborated earlier findings demonstrating lower basal membrane TJ protein
expression within the asthmatic epithelium compared to non-asthmatic counterpart.
Basal transepithelial permeability was not significantly different between non-asthmatic
and asthmatic ALI cultures, corroborating earlier findings. However, lower basal RT
values were observed in the asthmatic ALI cultures in contrast to their non-asthmatic
counterpart, which strongly suggests that the asthmatic epithelial ALI cultures could be
less differentiated and retaining a more basal characteristic, an observation in line with
that demonstrated by Hackett and colleagues (2011) showing increased expression of
cytokeratin-5, a cytoskeleton protein expressed in basal cells. Moreover, the lack of a
significant difference in epithelial permeability could possibly be attributed to the
severity of asthma as this study utilised samples obtained from paediatric individuals
who had mild, stable asthma and were not on corticosteroid therapy for at least 3
months. Future studies involving samples obtained from paediatric individuals with
moderate to severe asthma could certainly anticipate a difference in epithelial
permeability, as previously demonstrated by Xiao and colleagues despite the study
utilising adult derived asthmatic airway epithelial cells.
Looi 2015
157
Interestingly, when the data were further categorised according to atopy, it was
observed that the pAECHA ALI cultures demonstrated significantly higher levels of
basal membrane occludin expression and no significant difference in basal membrane
ZO-1 expression compared to pAECHNA and pAECAA ALI cultures, which contrasts
earlier findings demonstrating significantly lower membrane occludin and ZO-1
expression within the pAECHA cultures. This suggests the possible role of atopy in
regulating membrane TJ protein expression, as demonstrated by De Benedetto and
colleagues (2011) in non-asthmatic individuals. Interestingly, basal epithelial
permeability was not significantly different between pAECHNA, pAECHA and pAECAA
ALI cultures, suggesting that allergic sensitisation of non-asthmatic or asthmatic airway
epithelium does not occur through trafficking of aeroallergens through the epithelial
layer into the sub-epithelial space but rather, through the interaction with dendritic cells,
as demonstrated in a study by Jahnsen and colleagues (2001).
However, as most studies which have investigated the contributing role of atopy in
affecting TJ complexes have utilised the epidermal layer (Weidinger et al. 2006; De
Benedetto et al. 2011; Kuo et al. 2012), there remains a lack of studies examining the
impact of atopy on TJ complex expression within the respiratory airways. As such, the
contrariety of the data could possibly be attributed to the type and severity of the atopic
status, wherein an increased allergic reaction to a particular allergen could result in
compensatory effects by different epithelial TJs not assessed in this study, to maintain
barrier functionality. In addition, the dichotomy in the data could also be possibly
attributed to the structure of the ALI cultures, being well-differentiated and stratified
compared to submerged monolayer cultures or the use of confocal microscopy and
stereological analysis compared to the In-Cell™ Western assay in providing TJ
membrane analysis.
When membrane occludin and ZO-1 was assessed following infection, the data showed
disassembly of membrane TJ protein interaction at the apical regions in pAECHNA and
pAECAA ALI cultures, with an exaggerated disassembly in pAECAA ALI cultures. In
contrast, membrane TJ protein was elevated in the pAECHA ALI cultures but
interestingly, a reduction in RT with an increase in epithelial permeability was observed
Looi 2015
158
in pAECHA ALI cultures following infection. The contrast in data could be attributed to
a probable dissociation of other junctional proteins that not assessed in the current
study, hence resulting in increased permeability. In pAECHNA and pAECAA ALI cultures
following infection, a disassembly of membrane TJ protein was concomitant with a
reduction in RT and a corresponding increase in epithelial permeability in both ALI
cultures with a greater increase observed in the pAECAA ALI cultures. Despite the
counter intuitiveness as well as the demonstrated impaired apoptotic response to
infection (Wark et al. 2005), infection with HRV could induce the disassembly of TJ
proteins through the initiation of apoptosis, albeit delayed, eventually leading to the
dissociation of infected cells from the neighbouring non-infected cells. Consequently,
TJ disassembly and dissociation from adjacent cells could ultimately result in increased
epithelial permeability. This increase in permeability could either facilitate the passage
of inhaled pathogenic agents from the airway lumen to the sub-epithelial space or
conversely, provide the opportunity for cells associated with the innate immune system
to migrate out from the submucosa into the airway lumen to sample aeroallergens,
bacteria, fine particulate matter or respiratory viruses resulting in allergic sensitisation,
infection and inflammation in each process. Although a restoration of TJ proteins was
observed in pAECHNA cultures in contrast to a sustained loss of TJs in pAECHA,
pAECNAA and pAECAA cultures following extended HRV infection in earlier chapters,
whether barrier functionality changes with extended periods or recurrent viral infections
in ALI cultures require further investigation.
Collectively, the results emphasises the importance of using ALI cultures in the
assessment of barrier functionality. More importantly, the results indicate that HRV
infection would lead to an increase in epithelial permeability in ALI cultures, with a
greater magnitude in increase observed in asthmatic ALI cultures. This would result in
elevated passage of pathogenic challenges or migration of defence cells, eventually
leading to increased sensitisation, infection, and further asthma exacerbations.
Looi 2015
159
7.5 Conclusion
Human AECs cultured in vitro at air-liquid interface (ALI), are capable of forming a
pseudostratified epithelium with functioning TJs, cilia and mucin production. There are
limited data regarding the effects of HRV infection on epithelial TJs and the subsequent
effects on barrier function in paediatric cohorts. Data obtained in this investigation,
which corroborated findings from earlier chapters, demonstrated diminished basal TJ
expression in asthmatic epithelial cells and an exaggerated disassembly of TJ proteins
following HRV infection concomitant with increased epithelial permeability. However,
the dichotomy in the data with regards to membrane TJ protein expression and epithelial
permeability in submerged monolayer cultures and ALI cultures is attributed to the
difference in structure between the two culture models. The decision to utilise
submerged monolayer cultures or ALI cultures is dependent on the experimental
questions raised and the assessment methodologies used, as data from this study has
clearly demonstrated and supported the need for ALI cultures in contrast to data from
submerged monolayer culture when assessing barrier functionality due to the ability of
ALI cultures in establishing barrier integrity and function. However, in a previous study
by Hackett and colleagues (2011), they demonstrated significantly higher levels of the
basal cell marker, cytokeratin-5 in asthmatic epithelial cells, indicating that asthmatic
cells are more basal-like. Hence, in this circumstance, the use of submerged monolayer
cultures with only a single cell type for the assessment of membrane TJ protein
expression prior and post HRV infection would also be suitable, in addition to the use of
more sophisticated methods such as confocal microscopy and stereological assessments.
Collectively, this study has demonstrated, in addition to the applicable use of confocal
microscopy and stereology for the assessment of TJ protein expression, the importance
of ALI cultures in the assessment of barrier functionality at basal levels or in response
to HRV infection to demonstrate the impact of infection in causing greater impairment
of barrier function within the asthmatic epithelium.
Looi 2015
160
Chapter 8: General Discussion
Asthma has often been regarded as a variety of disorders initiated at different phases
throughout life by a spectrum of environmental factors interacting with a susceptible
genetic background. Paediatric asthma is among the most common chronic conditions
worldwide, resulting in a substantial burden on the health care system, society as well as
families. Despite decades of asthma research, there have been no significant advances in
treatment, emphasising the need to investigate possible alternative cellular and
molecular mechanisms which could contribute to the heterogeneity of asthma. There is
increasing consensus that the respiratory epithelium as well as being a physical barrier
between the external environment and internal parenchyma, also plays important roles
in actively responding to noxious irritants, allergens and pathogens.
A number of studies have suggested that the epithelium is abnormal in asthma (Holgate
2007), however is unclear whether these abnormalities are intrinsic to asthma because
atopic status, a common association with asthma, has not been adequately accounted for
(Laberge et al. 1999; Wark et al. 2005; Contoli et al. 2006; Kicic et al. 2006; Qiu et al.
2007). Furthermore, most evidence has been derived from adult cohorts and is therefore
temporally dissociated from early disease initiating pathogenic factors. Thus, there is a
need for more direct information to determine whether observations regarding the
epithelium can be attributed to intrinsic abnormalities, a consequence of chronic
inflammation, related to an atopic predisposition. These gaps in the literature provide
the rationale for the current hypotheses that epithelial barrier integrity and function is
defective in children with asthma and that the defective barrier integrity and function in
asthma is independent of atopy. Finally, infection with respiratory viruses, in particular,
HRV, account for an estimated 90% of acute asthma exacerbations in children and have
been shown to be implicated in the development of asthma (Sly et al. 2006; Kusel et al.
2007; Kusel et al. 2012). Hence, this study also tested the hypothesis that epithelial
barrier integrity and function is compromised to a greater extent following HRV
infection in the asthmatic compared to healthy airway.
Looi 2015
161
This study firstly characterised the basal tight junction (TJ) expression of claudin-1,
occludin and ZO-1 within paediatric derived pAECs of non-asthmatic and asthmatic
children. The data demonstrated basal differences in TJ gene and protein expression
between non-asthmatic and asthmatic children, indicative of an intrinsic alteration in
epithelial barrier integrity within the asthmatic AECs. The rationale for including these
three TJ proteins stems from their crucial roles in regulating epithelial permeability, as
previously demonstrated (Farquhar and Palade 1963; Furuse et al. 1993; Roche et al.
1993; Nusrat et al. 1995; Balda et al. 1996; McCarthy et al. 1996; Balda et al. 2000;
Coyne et al. 2003; Wang et al. 2003). Although studies have identified some
differences in epithelial barrier integrity in asthma (de Boer et al. 2008; Swindle 2009;
Xiao et al. 2011), there remains a lack of comprehensive analyses of the roles airway
epithelial TJ proteins play in supporting the epithelial barrier infrastructure and
regulating epithelial permeability. Moreover, a paucity of data within the paediatric
asthmatic population further fuels the need for paediatric junctional complex analyses as
studies have shown the effects of early life environmental challenges resulting in the
development of asthma (Sly et al. 2006; Kusel et al. 2007). This study addresses the
current gaps within the literature and from the observed data, the intrinsically altered
expression in asthmatic AECs could translate to an inherently impaired barrier function.
This suggests an increased propensity for allergic sensitisation or the induction of
inflammatory responses following pathogenic challenge. Furthermore, intrinsic
differences between the non-asthmatic and asthmatic epithelial cells implicate the
airway epithelium as a potential therapeutic target to reduce predisposition or to
ameliorate disease severity in asthma through improvement of barrier integrity and
function or limiting viral replication.
Interestingly, the data indicated a discordance between the ex vivo gene and protein
expression within asthmatic AECs. This could suggest direct transcriptional repression
or post-transcriptional regulation by various factors including the pleotropic
transcription repressor Snail, which act to down-regulate expression of TJ gene
components required for junctional complex formation or decrease translation of
junctional proteins (Ohkubo and Ozawa 2004). T-helper type-2 cytokines have also
been implicated such as IL-4 and IL-13 which has been shown to inhibit cellular
Looi 2015
162
migration and wound healing respectively (Ahdieh et al. 2001), This, in turn leads to a
diminished epithelial barrier integrity and consequently, a possible decreased barrier
function. Other factors that might account for the discordance in the observations could
be host microRNAs such as miR-122a, which are involved in the degradation of
occludin as well as the involvement of miR-155 in post-transcriptional repression of
claudin-1 expression, resulting in decrease barrier functionality. Further studies are
required in this area to identify novel molecules that could be translated into a
personalised therapeutic regimen for the improvement of impaired barrier function in
asthma.
Although a previous study by Xiao and colleagues (2011) demonstrated increased
airway epithelial permeability in adults with moderate and severe asthma, little is
known about airway epithelial permeability in paediatric asthma, whether it is intrinsic
or a consequence of airway inflammation. In the current study, basal barrier function of
ALI cultures established from paediatric individuals with mild, stable asthma and not on
corticosteroid treatment for at least 3 months showed no significant difference in the
levels of epithelial permeability compared to non-asthmatic counterpart However, future
studies involving the assessment of barrier functionality in paediatric individuals with
moderate to severe asthma would anticipate an increase in epithelial permeability.
Moreover, when assessing epithelial permeability towards various sized inert molecules,
data demonstrated significantly increased permeability towards smaller sized molecules
in both non-asthmatic and asthmatic epithelial cells. These observations suggest that the
asthmatic airway epithelium has increased susceptibility towards small molecular sized
allergens or pathogens including house dust mites, fine particulate matter in diesel
exhaust, cigarette smoke extract or respiratory viruses. With the increased facilitation of
haptens, allergens or pathogens across the airway epithelium, this may translate to an
increased predisposition towards allergic sensitisation and / or viral infection. Repeated
exposure to allergen and / or viral infection could subsequently result in co-infection
with other micro-organisms such as bacteria, as demonstrated by Sajjan and colleagues
(2008). Having shown differences in basal epithelial permeability between non-
asthmatic and asthmatic paediatric airway epithelium, the next focus will be
Looi 2015
163
determining the pathways behind these differences, through the integration of genomic
or mRNA profiles to advance the current understanding of tight junctional complexes.
Collectively, these observations are to the first to implicate an association between
basally dysregulated barrier integrity and impaired barrier function towards small-sized
particles in paediatric asthma.
Data from the second approach demonstrated differential expression of basal TJ
complexes in non-asthmatic and asthmatic AECs that were atopic, suggestive of the
involvement of atopy in altering TJ expression. Despite ongoing controversy about the
relationship between atopy and asthma, there is substantial evidence supporting the role
of atopy in asthma development and progression (Shirakawa et al. 2000; de Boer et al.
2008; Holgate et al. 2009; Scott et al. 2010; Spergel 2010; Baraldo et al. 2012;
Lambrecht and Hammad 2012). However, most studies that have investigated the
contributing role of atopy to the disruption of TJ complexes, have utilised the epidermal
layer (Palmer et al. 2006; Weidinger et al. 2006; De Benedetto et al. 2011; Kuo et al.
2012) and few have examined the impact of atopy on TJ complex expression within the
respiratory airways, let alone, the interaction of atopy with asthma in altering TJ
complex expression. Furthermore, the only study that have attempted this, utilised non-
atopic non-asthmatic and atopic asthmatic subjects, raising the issues of appropriate
controls and whether the reported data adequately addressed the significance of atopy in
altering junctional complex expression in asthma (de Boer et al. 2008). Thus, this study
established baseline values for tight junctional complex expression of non-asthmatic
and asthmatic AECs with or without atopy. Interestingly, basal TJ complex expression
profiles of pAECHA were observed to be significantly different from pAECHNA and
resembled those of pAECAA. This indicates the contribution of atopy in the alteration of
tight junctional complex expression and consequently, a probable increase in epithelial
permeability towards aeroallergen sensitisation or viral infection.
In the assessment of barrier integrity in the presence of atopy, the only study to have
been performed have been in the assessment of atopic dermatitis (De Benedetto et al.
2011). At present, there remains a paucity of data on the influence of atopy on tight
junctional function of the respiratory airways. Pilot data from this study demonstrated
Looi 2015
164
pAECHA had no significant difference in basal epithelial permeability compared to
pAECHNA. These findings are in contrast with those observed by De Benedetto and
colleagues (2011) which could likely be attributed to the different epithelial sites
sampled. An alternative is the suggestion that pAECHA could in fact, be a ‘pre-
asthmatic’ phenotype and as data obtained showed, pAECHA ALI cultures had
significantly higher basal permeability towards small sized molecules, which could
indicate increased susceptibility towards fragments of aeroallergens or respiratory
viruses, thereby facilitating sensitisation or infection, eventually leading to the induction
of asthma.
Although this study has shown differences in epithelial barrier integrity and function
between non-atopic and atopic AECs, the major limitation of the study was the
availability of non-atopic asthmatic AECs and the inability to perform longitudinal
follow-up assessment. Nonetheless, future work to further define the relationship
between atopy and barrier integrity and function should categorise the type and severity
of atopy and correlate this with the level of impairment in barrier integrity and barrier
functionality could then be subsequently assessed. Focussed PCR arrays could also be
performed to determine the magnitude difference in gene expression of TJ complexes
between atopic and non-atopic AECs. Furthermore, genomic and proteomic pathway
analysis would elucidate the effects of atopy on TJ disassembly and epithelial
permeability. Collectively, these observations highlight the significance of atopy in the
influence of tight junctional complex formation and the contribution towards altering
epithelial barrier function in health and disease.
In a seminal study, respiratory viral infections were shown to cause TJ complex
disorganisation and altered epithelial permeability AECs from non-asthmatic (Sajjan et
al. 2008). Hence, very little is known about TJ complex expression and function in
asthmatic AECs following viral insult. Therefore, the hypothesis that HRV infection
differentially disrupts TJs and barrier function in asthmatic compared to non-asthmatic
AECs was tested in the final set of experiments.
Looi 2015
165
Data demonstrated significant disassembly of TJ complex following 24 h HRV-1B
infection in both non-asthmatic and asthmatic AECs but 48 h post infection, a
restoration towards non-infected levels of expression was observed for non-asthmatic
cultures, while, diminished TJ expression levels was sustained in asthmatic cultures.
When barrier function was assessed at 24 h, data demonstrated significantly reduced
basal RT in asthmatic compared to non-asthmatic AECs and was concomitant with an
increased epithelial permeability. Although not performed in the current study, future
experiments to assess epithelial permeability at 48 h would anticipate a restitution of
barrier functionality in non-asthmatic epithelial cells concomitant with the observed
restoration of membrane TJ protein levels to non-infected levels. However, whether
decreased barrier functionality in asthmatic epithelial cells would be sustained remains
to be answered
When the data was stratified according to atopy, pilot data demonstrated significant
decrease in TJ expression following 24 h HRV-1B infection in pAECHNA cultures with
restoration to non-infected levels 48 h post infection. Interestingly, the decrease in TJ
expression in pAECHA cultures was sustained at 48 h after infection. This profile of
sustained decrease was similar to both pAECNAA and pAECAA cultures. The evidence
presented suggests that HRV-1B infection in conjunction with the presence of either
atopy and / or asthma could contribute to the sustained disorganisation and disassembly
of TJ complexes. This would have serious implications, especially for individuals with
asthma as continued disassembly of TJ complexes could potentially translate to a
prolonged compromised barrier state. Hence, the likelihood of allergens, haptens or
pathogens traversing the epithelial layer into the sub-epithelial and endothelial layers
would be significantly increased. The consequence of such an increased epithelial
permeability could enhance airway inflammation in a manner which leads to disease
exacerbations through generation of a variety of pro-inflammatory cytokines including
IL-1β, IL-6, GM-CSF and IL-11 (Einarsson et al. 1996; Terajima et al. 1997; Sanders et
al. 1998; Sanders et al. 2001) as well as chemokines such as IL-8, IP-10 and RANTES
(Subauste et al. 1995; Schroth et al. 1999; Donninger et al. 2003; Spurrell et al. 2005),
ultimately resulting in chronic airway inflammation and eventually, structural
remodelling (Kumar et al. 2002; Johnson et al. 2004; Grainge et al. 2011).
Looi 2015
166
As this study is the first to investigate the relationship between atopy and HRV
infection on tight junctional complex expression, there remains a lack of comparative
literature from which to draw significant conclusions. Hence, further investigations
involving genomic and pathway analyses for TJs of asthmatic AECs in the presence or
absence of atopy could provide candidate TJ genes of interest for this compensatory
effect. In addition, matched investigations which further categorises the type and
severity of atopy with the level of dysregulation in barrier integrity and impairment in
barrier function are warranted to elucidate the contributions of atopy on regulating TJ
complexes during HRV infection.
Current findings have highlighted the emergence of HRV-C as a predominant trigger of
asthma exacerbations in children (Evans et al. 2002; Stevens 2009; Baraldo et al. 2012;
Cakebread et al. 2014). Furthermore, recent studies have successfully propagated HRV-
C in vitro through the use of well-differentiated air-liquid interface cultures (Ahdieh et
al. 2001; Ohkubo and Ozawa 2004; Tillie-Leblond et al. 2007; Schneider et al. 2012).
The present data has demonstrated a sustained decreased of TJ complex expression in
pAECHA, pAECNAA and pAECAA except pAECHNA at extended infection periods.
However, limited availability of paediatric AEC cultures and time constraints has
prevented the present investigation from determining the effects of extended HRV
infection as well as repeated viral infection on barrier functionality. The next phase of
the study may utilise HRV-C to assess the effects on TJ complex disassembly and
barrier function impairment in non-asthmatic and asthmatic AECs in the presence and
absence of atopy as well as the effect of time. Genomic and proteomic pathway analysis
could be performed in conjunction with focussed qPCR arrays to elucidate the potential
pathways in which HRV-C infection is capable of altering tight junctional complex
expression. Furthermore, in vivo experiments utilising appropriate mouse models which
simulate the different facets of asthma could be performed to provide additional insights
on the effects of HRV infection on the airway epithelium.
The initial studies focussed on TJ proteins as past investigations have implicated TJ in
the regulation of epithelial permeability. Based on these preliminary findings, future
studies should also examine the global expression and function of tight junctional
Looi 2015
167
complexes such as junctional adhesion molecules (JAMs), tricellulin, ZO-2, ZO-3 as
well as the other members of the claudin family as well as their relationship with barrier
functionality. The present findings highlight the potential relationship between atopy
and asthma in altering tight junctional complex formation. However, future
investigations with increased numbers of non-atopic asthmatic participants would better
define this relationship and the effects on barrier integrity and permeability. In addition,
the current study has also demonstrated the effects of HRV infection on altering
epithelial permeability. The increase in epithelial permeability would result in increased
susceptibility to additional insults from aeroallergens, haptens or pathogens, resulting in
airway inflammation and / or asthma exacerbations. Conversely, innate immune cells
such as dendritic cells (DCs), which have been shown to express TJ proteins (Sung et
al. 2006), often interact directly with TJ proteins to sample the airway lumen without
disruption of the epithelial barrier (Takano et al. 2006; Blank et al. 2011; Veres et al
2011). However, in the presence of HRV infection, as shown in the current findings, the
presence and interaction of certain subsets of DCs with epithelial cells could potentially
result in further perturbation of epithelial integrity and permeability through increased
exposure surface to haptens, allergens or pathogens, resulting in further allergic
sensitisation or infection of the airways (Jahnsen et al. 2001; Jahnsen et al. 2006). This
would have serious consequences in the initiation and perpetuation of asthma
exacerbations. Future studies should examine the interaction between DCs or other cells
of innate immunity such as neutrophils with airway epithelial cells and the resulting
effect on bronchial epithelial integrity and permeability in non-asthmatic and asthmatic
epithelial cells with or without atopy.
In summary, epithelial barrier integrity is intrinsically altered in asthmatic compared to
non-asthmatic AECs and that this intrinsic characteristic translates to impaired epithelial
barrier function towards small sized molecules. Furthermore, this investigation has
provided pilot data on the possible contribution of atopy to the dysregulation of barrier
integrity and altering barrier function. These characteristics were further examined by
exposing AECs to HRV. A greater impact of HRV on barrier integrity in asthmatic
compared to non-asthmatic AECs was observed. In addition to demonstrating that
asthmatic AECs have an intrinsically different tight junctional complex expression and
Looi 2015
168
function, this study has also raised the questions of the impact of early life sensitisation
and infection in causing dysregulation of barrier integrity and function. Finally, this
investigation has provided new insight regarding important intrinsic epithelial
vulnerability in asthma and has provided further rationale for investigating epithelium-
centred asthma therapies in young children with asthma.
Looi 2015
169
References
Abraham, W. M., Delehunt, J. C., et al. (1983). Characterization of a late phase pulmonary response after antigen challenge in allergic sheep. The American review of respiratory disease 128(5): 839-844.
Abraham, W. M., Sielczak, M. W., et al. (1988). Cellular markers of inflammation in the airways of allergic sheep with and without allergen-induced late responses. The American review of respiratory disease 138(6): 1565-1571.
Ahdieh, M., Vandenbos, T., et al. (2001). Lung epithelial barrier function and wound healing are decreased by IL-4 and IL-13 and enhanced by IFN-γ. American Journal of Physiology - Cell Physiology 281(650-6): C2029-C2038.
AIHW (2011). Australian Centre for Asthma Monitoring 2011. Asthma in Australia 2011: With a focus chapter on chronic obstructive pulmonary disease. Canberra, Australian Institute of Health and Welfare.
Aijaz, S., Balda, M. S., et al. (2006). Tight Junctions: Molecular Architecture and Function. International Review of Cytology 248: 261 - 298.
Aijaz, S., Sanchez-Heras, E., et al. (2007). Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2. BMC Cell Biology 8(1): 49.
Aikawa, T., Shimura, S., et al. (1992). Marked goblet cell hyperplasia with mucus accumulation in the airways of patients who died of severe acute asthma attack. CHEST Journal 101(4): 916-921.
Asher, M. I., Keil, U., Anderson, H. R., et al. (1995). "International Study of Asthma and Allergies in Childhood (ISAAC): rationale and methods." European Respiratory Journal 8(3): 483-491.
Ayers, M. and Jeffery, P. (1988). Proliferation and differentiation in mammalian airway epithelium. European Respiratory Journal 1(1): 58-80.
Bacharier, L. B., Cohen, R., et al. (2012). Determinants of asthma after severe respiratory syncytial virus bronchiolitis. Journal of Allergy and Clinical Immunology 130(1): 91-100.e103.
Balda, M. S. and Matter, K. (2008). Tight junctions at a glance. Journal of Cell Science 121(22): 3677-3682.
Balda, M. S., Flores-Maldonado, C., et al. (2000). Multiple domains of occludin are involved in the regulation of paracellular permeability. Journal of Cellular Biochemistry 78(1): 85 - 96.
Balda, M. S., Whitney, J. A., et al. (1996). Functional dissociation of paracellular permeability and transepithelial electrical resistance and disruption of the apical-basolateral intramembrane diffusion barrier by expression of a mutant tight junction membrane protein. Journal of Cell Biology 134(4): 1031 - 1049.
Balda, M. S., Whitney, J. A., et al. (1996). Functional dissociation of paracellular permeability and transepithelial electrical resistance and disruption of the apical-basolateral intramembrane diffusion barrier by expression of a mutant tight junction membrane protein. Journal of Cell Biology 134(4): 1031 - 1049.
Ball, T. M., Castro-Rodriguez, J. A., et al. (2000). Siblings, Day-Care Attendance, and the Risk
of Asthma and Wheezing during Childhood. New England Journal of Medicine 343(8): 538-543.
Baraldo, S., Contoli, M., et al. (2012). Deficient antiviral immune responses in childhood: Distinct roles of atopy and asthma. Journal of Allergy and Clinical Immunology 130(6): 1307-1314.
Looi 2015
170
Barbato, A., Turato, G., et al. (2006). Epithelial Damage and Angiogenesis in the Airways of Children with Asthma. American Journal of Respiratory and Critical Care Medicine 174(9): 975-981.
Bartlett, N., Walton, R., et al. (2008). Mouse models of rhinovirus-induced disease and exacerbation of allergic airway inflammation. Nature Medicine 14(2): 199-204.
Bayram, H. (1998). Comparison of ciliary activity and inflammatory mediator release from bronchial epithelial cells of nonatopic nonasthmatic subjects and atopic asthmatic patients and the effect of diesel exhaust particles in vitro. Journal of Allergy and Clinical Immunology 102(5): 771.
Bishop, A. (2004). Pulmonary epithelial stem cells. Cell proliferation 37(1): 89-96. Bizzintino, J., Lee, W., et al. (2011). Association between human rhinovirus C and severity of
acute asthma in children. European Respiratory Journal 37(5): 1037-1042. Blank F, Wehrli M, Lehmann A, Baum O, Gehr P, von Garnier C, Rothen-Rutishauser BM.
Macrophages and dendritic cells express tight junction proteins and exchange particles in an in vitro model of the human airway wall. Immunobiology 2011;216:86–95
Bleecker, E. R. (2004). Similarities and differences in asthma and COPD: the Dutch hypothesis. CHEST Journal 126(2 Suppl 1): 93S-95S.
Bochkov, Y. A., Hanson, K. M., et al. (2010). Rhinovirus-induced modulation of gene expression in bronchial epithelial cells from subjects with asthma. Mucosal Immunology 3(1): 69-80.
Boers, J. E., Ambergen, A. W., et al. (1998). Number and proliferation of basal and parabasal cells in normal human airway epithelium. American Journal of Respiratory and Critical Care Medicine 157(6): 2000-2006.
Borish, L., Mascali, J. J., et al. (1992). Detection of alveolar macrophage-derived IL-1 beta in asthma. Inhibition with corticosteroids. The Journal of Immunology 149(9): 3078-3082.
Bosse, J. (1987). Chronic allergic airway disease in the sheep model: Functional and lung-lavage features. Journal of Allergy and Clinical Immunology 79(2): 339.
Bourgeois, E. A., Levescot, A., et al. (2011). A natural protective function of invariant NKT cells in a mouse model of innate‐cell‐driven lung inflammation. European journal of immunology 41(2): 299-305.
Boushey, H. A., Holtzman, M. J., et al. (1980). Bronchial hyperreactivity. The American review of respiratory disease 121: 389-413.
Bousquet, J., Jeffery, P. K., et al. (2000). Asthma: From Bronchoconstriction to Airways Inflammation and Remodeling. American Journal of Respiratory and Critical Care Medicine 161(5): 1720-1745.
Bradding, P., Roberts, J. A., et al. (1994). Interleukin-4, -5, and -6 and tumor necrosis factor-alpha in normal and asthmatic airways: evidence for the human mast cell as a source of these cytokines. American Journal of Respiratory Cell and Molecular Biology 10(5): 471-480.
Brewster, C. E., Howarth, P. H., et al. (1990). Myofibroblasts and subepithelial fibrosis in bronchial asthma. American Journal of Respiratory Cell and Molecular Biology 3(5): 507-511.
Brightling, C. E., Ward, R., et al. (2000). Induced Sputum Inflammatory Mediator Concentrations in Eosinophilic Bronchitis and Asthma. American Journal of Respiratory and Critical Care Medicine 162(3): 878-882.
Bruewer, M., Utech, M., et al. (2005). Interferon-γ induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB Journal 19(8): 923-933.
Looi 2015
171
Bucchieri, F. (2002). Asthmatic bronchial epithelium is more susceptible to oxidant-induced apoptosis. American Journal of Respiratory Cell and Molecular Biology 27(2): 179.
Bucchieri, F., Lordan, J., et al. (2000). Increased sensitivity of asthmatic bronchial epithelial cells to oxidant-induced injury. American Journal of Respiratory and Critical Care Medicine 161: A153.
Buchweitz, J. P., Harkema, J. R., et al. (2007). Time-Dependent Airway Epithelial and Inflammatory Cell Responses Induced by Influenza Virus A/PR/8/34 in C57BL/6 Mice. Toxicologic Pathology 35(3): 424-435.
Burchell, J. T. (2009). Attenuation of allergen-induced airway hyperresponsiveness is mediated by airway regulatory T cells. American Journal of Physiology - Lung Cellular and Molecular Physiology 296(3): L307.
Bush, A., Cole, P., et al. (1998). Primary ciliary dyskinesia: diagnosis and standards of care. European Respiratory Journal 12(4): 982-988.
Busse, W. W., Lemanske Jr, R. F., et al. (2010). Role of viral respiratory infections in asthma and asthma exacerbations. Lancet 376(9743): 826-834.
Cakebread, J. A., Haitchi, H. M., et al. (2014). Rhinovirus-16 Induced Release of IP-10 and IL-8 Is Augmented by Th2 Cytokines in a Pediatric Bronchial Epithelial Cell Model. PLoS One 9(4): e94010.
Cakebread, J., Xu, Y., et al. (2011). Exogenous IFN-β has antiviral and anti-inflammatory properties in primary bronchial epithelial cells from asthmatic subjects exposed to rhinovirus. Journal of Allergy and Clinical Immunology 127(5): 1148-1154.e1149.
Cane, P. A. (2001). Molecular epidemiology of respiratory syncytial virus. Reviews in Medical Virology 11(2): 103-116.
Carroll, N., Elliot, J., et al. (1993). The structure of large and small airways in nonfatal and fatal asthma. American Review of Respiratory Disease 147(2): 405-410.
Chakir, J., Pagé, N., et al. (2001). Bronchial mucosa produced by tissue engineering: a new tool to study cellular interactions in asthma. Journal of Allergy and Clinical Immunology 107(1): 36-40.
Chan, L. F., Chung, T. T., et al. (2009). Functional consequence of a novel Y129C mutation in a patient with two contradictory melanocortin-2-receptor mutations. European Journal of Endocrinology 160(4): 705-710.
Chan, R. W. Y., Yuen, K. M., et al. (2010). Influenza H5N1 and H1N1 Virus Replication and Innate Immune Responses in Bronchial Epithelial Cells Are Influenced by the State of Differentiation. PLoS One 5(1): e8713.
Chang, Y.-J., Kim, H. Y., et al. (2011). Innate lymphoid cells mediate influenza-induced airway hyper-reactivity independently of adaptive immunity. Nature Immunology 12(7): 631-638.
Chauhan, A. J., Inskip, H. M., et al. (2003). Personal exposure to nitrogen dioxide (NO2) and the severity of virus-induced asthma in children. Lancet 361(9373): 1939-1944.
Chen, H., Kovar, J., et al. (2005). A cell-based immunocytochemical assay for monitoring kinase signaling pathways and drug efficacy. Analytical biochemistry 338(1): 136-142.
Collison, A., Herbert, C., et al. (2011). Altered expression of microRNA in the airway wall in chronic asthma: miR-126 as a potential therapeutic target. BMC pulmonary medicine 11(1): 29.
Collison, A., Mattes, J., et al. (2011). Inhibition of house dust mite–induced allergic airways disease by antagonism of microRNA-145 is comparable to glucocorticoid treatment. Journal of Allergy and Clinical Immunology 128(1): 160-167. e164.
Looi 2015
172
Comstock, A. T., Ganesan, S., et al. (2011). Rhinovirus-Induced Barrier Dysfunction in Polarized Airway Epithelial Cells Is Mediated by NADPH Oxidase 1. Journal of Virology 85(13): 6795-6808.
Contoli, M., Message, S., et al. (2006). Role of deficient type III interferon-λ production in asthma exacerbations. Nature Medicine 12(9): 1023-1026.
Cooke, R. A. and Vander Veer, A. (1916). Human sensitization. Journal of Immunology 1: 201-305.
Corne, J. M., Marshall, C., et al. (2002). Frequency, severity, and duration of rhinovirus infections in asthmatic and non-asthmatic individuals: a longitudinal cohort study. Lancet 359(9309): 831-834.
Corrigan, C. and Kay, A. (1992). T cells and eosinophils in the pathogenesis of asthma. Immunology today 13(12): 501-507.
Corry, D. B. and Irvin, C. G. (2006). Promise and pitfalls in animal-based asthma research: building a better mousetrap. Immunologic Research 35: 279-294.
Cox, D. W., Bizzintino, J., et al. (2013). Human rhinovirus species C infection in young children with acute wheeze is associated with increased acute respiratory hospital admissions. American Journal of Respiratory and Critical Care Medicine 188(11): 1358-1364.
Coyne, C. B., Gambling, T. M., et al. (2003). Role of claudin interactions in airway tight junctional permeability. American Journal of Physiology - Lung Cellular and Molecular Physiology 285(5): L1166-1178.
Coyne, C., Vanhook, M., et al. (2002). Regulation of airway tight junctions by proinflammatory cytokines. Molecular Biology of the Cell 13(9): 3218-3234.
Cozens, A. L., Yezzi, M. J., Kunzelmann, K., et al. (1994). "CFTR expression and chloride secretion in polarized immortal human bronchial epithelial cells." American Journal of Respiratory Cell and Molecular Biology 10(1): 38-47.
Crystal, R. G., Randell, S. H., et al. (2008). Airway Epithelial Cells: Current Concepts and Challenges. Proceedings of the American Thoracic Society 5(7): 772-777.
Dahl, M. E., Dabbagh, K., et al. (2004). Viral-induced T helper type 1 responses enhance allergic disease by effects on lung dendritic cells. Nature Immunology 5(3): 337-343.
Dahl, R. (1993). Monitoring bronchial asthma in the blood. Allergy 48: 77-80. De Benedetto, A., Rafaels, N. M., et al. (2011). Tight junction defects in patients with atopic
dermatitis. Journal of Allergy and Clinical Immunology 127(3): 773-786. e777. de Boer, W. I., Sharma, H. S., et al. (2008). Altered expression of epithelial junctional proteins
in atopic asthma: possible role in inflammation. Canadian Journal of Physiology and Pharmacology 86(3): 105-112.
De Jong, P. M., Van Sterkenburg, M. A. J. A., et al. (1993). Serial Culturing of Human Bronchial Epithelial Cells Derived from Biopsies. In Vitro Cellular & Developmental Biology - Animal 29A(5): 379-387.
De Monchy, J., Kauffman, H., et al. (1985). Bronchoalveolar eosinophilia during allergen-induced late asthmatic reactions. American Journal of Respiratory and Critical Care Medicine 131(3): 373-376.
de Waal Malefyt, R., Yssel, H., et al. (1993). Direct effects of IL-10 on subsets of human CD4+ T cell clones and resting T cells. Specific inhibition of IL-2 production and proliferation. The Journal of Immunology 150(11): 4754-4765.
De Water, R., Willems, L., et al. (1986). Ultrastructural localization of bronchial antileukoprotease in central and peripheral human airways by a gold-labeling technique using monoclonal antibodies. The American review of respiratory disease 133(5): 882-890.
Looi 2015
173
Devalia, J. L., Bayram, H., et al. (1999). Differences between Cytokine Release from Bronchial Epithelial Cells of Asthmatic Patients and Non-Asthmatic Subjects: Effect of Exposure to Diesel Exhaust Particles. International Archives of Allergy and Immunology 118(2-4): 437-439.
Diamond, G., Legarda, D., et al. (2000). The innate immune response of the respiratory epithelium. Immunological Reviews 173(1): 27-38.
Djukanović, R., Roche, W., et al. (1990). Mucosal inflammation in asthma. The American review of respiratory disease 142(2): 434-457.
Djuranovic, S., Nahvi, A., et al. (2011). A parsimonious model for gene regulation by miRNAs. Science 331(6017): 550-553.
Doherty, G. M., Christie, S. N., et al. (2003). Non-bronchoscopic sampling and culture of bronchial epithelial cells in children. Clinical and Experimental Allergy 33(9): 1221-1225.
Donninger, H., Glashoff, R., et al. (2003). Rhinovirus induction of the CXC chemokine epithelial-neutrophil activating peptide-78 in bronchial epithelium. Journal of Infectious Diseases 187(11): 1809-1817.
Doyle, A. G., Buttigieg, K., et al. (1999). The Activated Type 1–Polarized CD8+ T Cell Population Isolated from an Effector Site Contains Cells with Flexible Cytokine Profiles. The Journal of Experimental Medicine 190(8): 1081-1092.
Dreschers, S., Dumitru, C., et al. (2007). The cold case: are rhinoviruses perfectly adapted pathogens? Cellular and Molecular Life Sciences 64(2): 181-191.
Ebnet, K. (2008). Organization of multiprotein complexes at cell–cell junctions. Histochemistry & Cell Biology 130(1): 1-20.
Ehrhardt, C., Kneuer, C., et al. (2002). Influence of apical fluid volume on the development of functional intercellular junctions in the human epithelial cell line 16HBE14o–: implications for the use of this cell line as an in vitro model for bronchial drug absorption studies. Cell and Tissue Research 308(3): 391-400.
Einarsson, O., Geba, G. P., et al. (1996). Interleukin-11: stimulation in vivo and in vitro by respiratory viruses and induction of airways hyperresponsiveness. Journal of Clinical Investigation 97(4): 915.
Evans, M. J. and Plopper, C. G. (1988). The role of basal cells in adhesion of columnar epithelium to airway basement membrane. The American review of respiratory disease 138(2): 481-483.
Evans, M. J., Cox, R. A., et al. (1989). The role of basal cells in attachment of columnar cells to the basal lamina of the trachea. American Journal of Respiratory Cell and Molecular Biology 1(6): 463-469.
Evans, M. J., Cox, R. A., et al. (1990). Junctional adhesion mechanisms in airway basal cells. American Journal of Respiratory Cell and Molecular Biology 3(4): 341-347.
Evans, S. M., Blyth, D. I., et al. (2002). Decreased distribution of lung epithelial junction proteins after intratracheal antigen or lipopolysaccharide challenge: correlation with neutrophil influx and levels of BALF sE-cadherin. American Journal of Respiratory Cell and Molecular Biology 27(4): 446-454.
Fanning, A. S. and Anderson, J. M. (2009). Zonula Occludens-1 and -2 Are Cytosolic Scaffolds That Regulate the Assembly of Cellular Junctions. Annals of the New York Academy of Sciences 1165(1): 113-120.
Farquhar, M. G. and Palade, G. E. (1963). Junctional complexes in various epithelia. Journal of Cell Biology 17: 375 - 412.
Fattouh, R., Midence, N. G., et al. (2008). Transforming Growth Factor-β Regulates House Dust Mite-induced Allergic Airway Inflammation but Not Airway Remodeling. American Journal of Respiratory and Critical Care Medicine 177(6): 593-603.
Looi 2015
174
Fedorov, I., Wilson, S., et al. (2005). Epithelial stress and structural remodelling in childhood asthma. Thorax 60(5): 389-394.
Ferris, B. G. (1978). "Epidemiology Standardization Project (American Thoracic Society)." The American review of respiratory disease 118: 1-120.
Fiorentino, D. F., Bond, M. W., et al. (1989). Two types of mouse T helper cell. IV. Th2 clones secrete a factor that inhibits cytokine production by Th1 clones. The Journal of Experimental Medicine 170(6): 2081-2095.
Fogh, J. and Trempe, G. (1975). New human tumour cell lines. Human tumour cells in vitro. Fogh, J. New York, Plenum Publishing Corp: 115-141.
Fonceca, A. M., Flanagan, B. F., et al. (2012). Primary airway epithelial cultures from children are highly permissive to respiratory syncytial virus infection. Thorax 67(1): 42-48.
Forbes, B. and Ehrhardt, C. (2005). Human respiratory epithelial cell culture for drug delivery applications. European Journal of Pharmaceutics and Biopharmaceutics 60(2): 193-205.
Fraenkel, D. J., Bardin, P. G., et al. (1995). Lower airways inflammation during rhinovirus colds in normal and in asthmatic subjects. American Journal of Respiratory and Critical Care Medicine 151(3): 879-886.
Freishtat, R. J., Watson, A. M., et al. (2010). Asthmatic Bronchial Epithelium Is Intrinsically
Inflammogenic, Mitotically Dyssynchronous, And Is Rescued By Glucocorticoids. American Journal of Respiratory and Critical Care Medicine 181(1 Meeting Abstracts): A2491.
Freymuth, F., Vabret, A., et al. (1999). Detection of viral, Chlamydia pneumoniae and Mycoplasma pneumoniae infections in exacerbations of asthma in children. Journal of Clinical Virology 13(3): 131-139.
Friedlander, S. L. and Busse, W. W. (2005). The role of rhinovirus in asthma exacerbations. Journal of Allergy and Clinical Immunology 116(2): 267-273.
Fujitsuka, A., Tsukagoshi, H., et al. (2011). A molecular epidemiological study of respiratory viruses detected in Japanese children with acute wheezing illness. BMC Infectious Diseases 11(1): 168-177.
Fulcher, M. L., Gabriel, S., et al. (2005). Well-Differentiated Human Airway Epithelial Cell Cultures. Human Cell Culture Protocols. Picot, J., Humana Press. 107: 183-206.
Furuse, M., Fujita, K., et al. (1998). Claudin-1 and -2: novel integral membrane proteins localizing at tight junctions with no sequence similarity to occludin. Journal of Cell Biology 141: 1539 - 1550.
Furuse, M., Hirase, T., et al. (1993). Occludin: A novel integral membrane protein localizing at tight junctions. Journal of Cell Biology 123: 1777 - 1788.
Furuse, M., Sasaki, H., et al. (1998). A single gene product, claudin-1 or -2, reconstitutes tight junction strands and recruits occludin in fibroblasts. Journal of Cell Biology 143: 391 - 401.
Gama, R. E., Horsnell, P. R., et al. (1989). Amplification of rhinovirus specific nucleic acids from clinical samples using the polymerase chain reaction. Journal of Medical Virology 28(2): 73-77.
Gern, J. E. (2010). The ABCs of Rhinoviruses, Wheezing, and Asthma. Journal of Virology 84(15): 7418-7426.
Giard, D. J., Aaronson, S. A., Todaro, G. J., et al. (1973). "In Vitro Cultivation of Human Tumors: Establishment of Cell Lines Derived From a Series of Solid Tumors." Journal of the National Cancer Institute 51(5): 1417-1423.
GINA (2011). Global Strategy for Asthma Management and Prevention, Global Initiative for Asthma (GINA).
Looi 2015
175
Glezen, W. P., Taber, L. H., et al. (1986). Risk of primary infection and reinfection with respiratory syncytial virus. Archives of Pediatrics & Adolescent Medicine 140(6): 543-546.
Gonzalez-Mariscal, L. (2001). The Relationship between Structure and Function of Tight Junctions. Tight Junctions. Cereijido, M. Boca Raton, FL, CRC Press Inc: 90-100.
Grainge, C. L., Lau, L. C., et al. (2011). Effect of bronchoconstriction on airway remodeling in asthma. New England Journal of Medicine 364(21): 2006-2015.
Grainger, C., Greenwell, L., et al. (2006). Culture of Calu-3 Cells at the Air Interface Provides a Representative Model of the Airway Epithelial Barrier. Pharmaceutical Research 23(7): 1482-1490.
Gras, D., Bourdin, A., et al. (2012). An ex vivo model of severe asthma using reconstituted human bronchial epithelium. Journal of Allergy and Clinical Immunology 129(5): 1259-1266.e1251.
Green, S. A., Malice, M. P., et al. (2004). Increase in urinary leukotriene LTE4 levels in acute asthma: correlation with airflow limitation. Thorax 59(2): 100-104.
Grissell, T. V., Powell, H., et al. (2005). Interleukin-10 Gene Expression in Acute Virus-induced Asthma. American Journal of Respiratory and Critical Care Medicine 172(4): 433-439.
Gruenert, D., Basbaum, C., et al. (1990). Long-term culture of normal and cystic fibrosis epithelial cells grown under serum-free conditions. In Vitro Cellular and Developmental Biology - Plant 26(4): 411-418.
Grunberg, K., Smits, Hermelijn H., et al. (1997). Experimental Rhinovirus 16 Infection . Effects on Cell Differentials and Soluble Markers in Sputum in Asthmatic Subjects. American Journal of Respiratory and Critical Care Medicine 156(2): 609-616.
Gueders, M., Paulissen, G., et al. (2009). Mouse models of asthma: a comparison between C57BL/6 and BALB/c strains regarding bronchial responsiveness, inflammation, and cytokine production. Inflammation Research 58(12): 845-854.
Guillemot, L. (2008). The cytoplasmic plaque of tight junctions: a scaffolding and signalling center. Biochimica et Biophysica Acta 1778(3): 601-613.
Gumbiner, B. M. (2005). Regulation of cadherin-mediated adhesion in morphogenesis. Nature Reviews Molecular Cell Biology 6(8): 622-634.
Gwaltney, J. M. (1995). Rhinovirus Infection of the Normal Human Airway. American Journal of Respiratory and Critical Care Medicine 152(4 Pt 2): S36-S39.
Gwaltney, J. M., Jr., Phillips, C. D., et al. (1994). Computed tomographic study of the common cold. New England Journal of Medicine 330(1): 25-30.
Hackett, T. L. (2008). Characterization of side population cells from human airway epithelium. Stem Cells 26(10): 2576.
Hackett, T.-L., Singhera, G. K., et al. (2011). Intrinsic Phenotypic Differences of Asthmatic Epithelium and its Inflammatory Responses to RSV and Air Pollution. American Journal of Respiratory Cell and Molecular Biology: 2011-0031OC.
Hackett, T.-L., Warner, S. M., et al. (2009). Induction of Epithelial-Mesenchymal Transition in Primary Airway Epithelial Cells from Patients with Asthma by Transforming Growth Factor-β1. American Journal of Respiratory and Critical Care Medicine 180(2): 122-133.
Haley, K. J., Sunday, M. E., et al. (1998). Inflammatory Cell Distribution within and along Asthmatic Airways. American Journal of Respiratory and Critical Care Medicine 158(2): 565-572.
Hall, C. B. (2001). Respiratory Syncytial Virus and Parainfluenza Virus. New England Journal of Medicine 344(25): 1917-1928.
Looi 2015
176
Halldorsson, S., Gudjonsson, T., et al. (2010). Azithromycin maintains airway epithelial integrity during Pseudomonas aeruginosa infection. American Journal of Respiratory Cell and Molecular Biology 42(1): 62-68.
Hamelmann, E., Oshiba, A., et al. (1997). Antiinterleukin-5 antibody prevents airway hyperresponsiveness in a murine model of airway sensitization. American Journal of Respiratory and Critical Care Medicine 155(3): 819-825.
Hammad, H. and Lambrecht, B. N. (2008). Dendritic cells and epithelial cells: linking innate and adaptive immunity in asthma. Nature Reviews Immunology 8(3): 193-204.
Hannoush, R. N. (2008). Kinetics of Wnt-driven β-catenin stabilization revealed by quantitative and temporal imaging. PLoS One 3(10): e3498.
Hardyman, M. A., Wilkinson, E., et al. (2013). TNF-α–mediated bronchial barrier disruption and regulation by src-family kinase activation. Journal of Allergy and Clinical Immunology 132(3), 665-675.
Hasegawa, S., Hirano, R., et al. (2011). Characteristics of atopic children with pandemic H1N1 influenza viral infection: Pandemic H1N1 influenza reveals ‘occult’ asthma of childhood. Pediatric Allergy and Immunology 22(1pt2): e119-e123.
Hastie, A. T., Moore, W. C., et al. (2010). Analyses of asthma severity phenotypes and inflammatory proteins in subjects stratified by sputum granulocytes. Journal of Allergy and Clinical Immunology 125(5): 1028-1036. e1013.
Hein, W. R. and Griebel, P. J. (2003). A road less travelled: large animal models in immunological research. Nature Reviews - Immunology 3(1): 79-84.
Hirst, S. J., Martin, J. G., et al. (2004). Proliferative aspects of airway smooth muscle. Journal of Allergy and Clinical Immunology 114(2): S2-S17.
Hoffman, G. R., Moerke, N. J., et al. (2010). A high-throughput, cell-based screening method for siRNA and small molecule inhibitors of mTORC1 signaling using the In Cell Western technique. Assay and drug development technologies 8(2): 186-199.
Holgate, S. T. (1998). The inflammation–repair cycle in asthma: the pivotal role of the airway epithelium. Clinical & Experimental Allergy 28: 97-103.
Holgate, S. T. (2007). Epithelium dysfunction in asthma. Journal of Allergy and Clinical Immunology 120(6): 1233-1244.
Holgate, S. T. (2011). The sentinel role of the airway epithelium in asthma pathogenesis. Immunological Reviews 242(1): 205-219.
Holgate, S. T., Lackie, P., et al. (2000). Bronchial Epithelium as a Key Regulator of Airway Allergen Sensitization and Remodeling in Asthma. American Journal of Respiratory and Critical Care Medicine 162(3): S113-117.
Holgate, S. T., Roberts, G., et al. (2009). The Role of the Airway Epithelium and its Interaction with Environmental Factors in Asthma Pathogenesis. Proceedings of the American Thoracic Society 6(8): 655-659.
Holtzman, M., Aizawa, H., et al. (1983). Selective generation of leukotriene B4 by tracheal epithelial cells from dogs. Biochemical and Biophysical Research Communications 114(3): 1071-1076.
Hong, K. U., Reynolds, S. D., et al. (2001). Clara cell secretory protein–expressing cells of the airway neuroepithelial body microenvironment include a label-retaining subset and are critical for epithelial renewal after progenitor cell depletion. American Journal of Respiratory Cell and Molecular Biology 24(6): 671-681.
Hovenberg, H. W. (1996). Different mucins are produced by the surface epithelium and the submucosa in human trachea: identification of MUC5AC as a major mucin from the goblet cells. Biochemical Journal 318(Pt 1): 319.
Looi 2015
177
Hubatsch, I., Ragnarsson, E. G., et al. (2007). Determination of drug permeability and prediction of drug absorption in Caco-2 monolayers. Nature protocols 2(9): 2111-2119.
Huber, H. L. and Koessler, K. K. (1922). The pathology of bronchial asthma. Studies from the Otho SA Sprague Memorial Institute: Collected Reprints 10(1021): 1.
Hyvärinen, M. K., Kotaniemi-Syrjänen, A., et al. (2005). Teenage asthma after severe early childhood wheezing: An 11‐year prospective follow‐up. Pediatric pulmonology 40(4): 316-323.
Ikenouchi, J., Furuse, M., et al. (2005). Tricellulin constitutes a novel barrier at tricellular contacts of epithelial cells. Journal of Cell Biology 171(6): 939 - 945.
Irie, K., Shimizu, K., et al. (2004). Roles and modes of action of nectins in cell–cell adhesion. Seminars in Cell & Developmental Biology 15(6): 643-656.
Ivanova, J. I., Bergman, R., et al. (2012). Effect of asthma exacerbations on health care costs among asthmatic patients with moderate and severe persistent asthma. Journal of Allergy and Clinical Immunology 129(5): 1229-1235.
Jackson, D. J., Gangnon, R. E., et al. (2008). Wheezing rhinovirus illnesses in early life predict asthma development in high-risk children. American Journal of Respiratory and Critical Care Medicine 178(7): 667-672.
Jacoby, D. B., Tamaoki, J., et al. (1988). Influenza infection causes airway hyperresponsiveness by decreasing enkephalinase. Journal of Applied Physiology 64(6): 2653-2658.
Jahnsen, F. L., Moloney, E., et al. (2001). Rapid dendritic cell recruitment to the bronchial mucosa of patients with atopic asthma in response to local allergen challenge. Thorax 56(11): 823-826.
Jahnsen, F. L., Strickland, D. H., et al. (2006). Accelerated antigen sampling and transport by airway mucosal dendritic cells following inhalation of a bacterial stimulus. The Journal of Immunology 177(9): 5861-5867.
Jain, S., Kamimoto, L., et al. (2009). Hospitalized Patients with 2009 H1N1 Influenza in the United States, April–June 2009. New England Journal of Medicine 361(20): 1935-1944.
Jakiela, B., Brockman-Schneider, R., et al. (2008). Basal cells of differentiated bronchial epithelium are more susceptible to rhinovirus infection. American Journal of Respiratory Cell and Molecular Biology 38(5): 517-523.
James, A. L., Paré, P. D., et al. (1989). The mechanics of airway narrowing in asthma. The American review of respiratory disease 139(1): 242-246.
Jeffery, P. (1983). Morphologic features of airway surface epithelial cells and glands. The American review of respiratory disease 128(2 Pt 2): S14.
Jeffery, P. K. (1991). Morphology of the airway wall in asthma and in chronic obstructive pulmonary disease. The American review of respiratory disease 143(5 pt 1): 1152-1158.
Jewell , N. A., Cline, T., et al. (2010). Lambda Interferon Is the Predominant Interferon Induced by Influenza A Virus Infection In Vivo. Journal of Virology 84(21): 11515-11522.
Jiang, C., Lee, E. R., et al. (2001). Partial correction of defective Cl− secretion in cystic fibrosis epithelial cells by an analog of squalamine. American Journal of Physiology - Lung Cellular and Molecular Physiology 281(5): L1164-L1172.
Jin, Y., Yuan, X.-H., et al. (2009). Prevalence and Clinical Characterization of a Newly Identified Human Rhinovirus C Species in Children with Acute Respiratory Tract Infections. Journal of Clinical Microbiology 47(9): 2895-2900.
Johnson, J. R., Wiley, R. E., et al. (2004). Continuous exposure to house dust mite elicits chronic airway inflammation and structural remodeling. American Journal of Respiratory and Critical Care Medicine 169(3): 378-385.
Looi 2015
178
Johnston, R. A., Zhu, M., et al. (2007). Allergic Airway Responses in Obese Mice. American Journal of Respiratory and Critical Care Medicine 176(7): 650-658.
Johnston, S. L. (2005). Overview of Virus-induced Airway Disease. Proceedings of the American Thoracic Society 2(2): 150-156.
Johnston, S. L. (2007). Innate immunity in the pathogenesis of virus-induced asthma exacerbations. Proceedings of the American Thoracic Society 4(3): 267-270.
Johnston, S. L. and Tyrrell, D. A. J. (1995). Diagnostic Procedures for Viral, Rickettsial and Chlamydial Infections Washington D.C, American Public Health Association.
Johnston, S. L., Pattemore, P. K., et al. (1995). Community study of role of viral infections in exacerbations of asthma in 9-11 year old children. British Medical Journal 310(6989): 1225-1229.
Johnston, S. L., Pattemore, P. K., et al. (1996). The relationship between upper respiratory infections and hospital admissions for asthma: a time-trend analysis. American Journal of Respiratory and Critical Care Medicine 154(3): 654-660.
Kariyawasam, H. H., Aizen, M., et al. (2007). Remodeling and airway hyperresponsiveness but not cellular inflammation persists after allergen challenge in asthma. American Journal of Respiratory and Critical Care Medicine 175(9): 896-904.
Kay, A. B. (2001). Allergy and Allergic Diseases. New England Journal of Medicine 344(2): 109-113.
Keeney, E. L. (1964). The history of asthma from Hippocrates to Meltzer. Journal of Allergy 35(3): 215-226.
Kenny, P., Lancsar, E., et al. (2005). The individual and health sector costs of asthma: the first year of a longitudinal study in New South Wales. Australian and New Zealand Journal of Public Health 29(5): 429-435.
Kesimer, M., Kirkham, S., et al. (2009). Tracheobronchial air-liquid interface cell culture: a model for innate mucosal defense of the upper airways? American Journal of Physiology - Lung Cellular and Molecular Physiology 296(1): L92-L100.
Khetsuriani, N., Kazerouni, N. N., et al. (2007). Prevalence of viral respiratory tract infections in children with asthma. Journal of Allergy and Clinical Immunology 119(2): 314-321.
Kicic, A. (2010). Decreased Fibronectin Production Significantly Contributes to Dysregulated Repair of Asthmatic Epithelium. American Journal of Respiratory and Critical Care Medicine 181(9): 889.
Kicic, A., Sutanto, E. N., Stevens, P. T., et al. (2006). "Intrinsic Biochemical and Functional Differences in Bronchial Epithelial Cells of Children with Asthma." American Journal of Respiratory and Critical Care Medicine 174(10): 1110-1118.
Kilburn, K. (1968). A hypothesis for pulmonary clearance and its implications. The American review of respiratory disease 98(3): 449.
Kim, E. Y., Battaile, J. T., et al. (2008). Persistent activation of an innate immune response translates respiratory viral infection into chronic lung disease. Nature Medicine 14(6): 633-640.
Kips, J. C., Anderson, G. P., et al. (2003). Murine models of asthma. European Respiratory Journal 22(2): 374-382.
Kirschvink, N. (2008). Use of alternative animals as asthma models. Current Drug Targets 9(6): 470.
Kline, J. N., Waldschmidt, T. J., et al. (1998). Cutting Edge: Modulation of Airway Inflammation by CpG Oligodeoxynucleotides in a Murine Model of Asthma. Journal of Immunology 160(6): 2555-2559.
Kling, S. (2005). Persistence of rhinovirus RNA after asthma exacerbation in children. Clinical and Experimental Allergy 35(5): 672.
Looi 2015
179
Knight, D. A. (2001). Epithelium-fibroblast interactions in response to airway inflammation. Immunology and Cell Biology 79(2): 160-164.
Knight, D. A. (2003). The airway epithelium: structural and functional properties in health and disease. Respirology 8(4): 432.
Köhler, K. and Zahraoui, A. (2005). Tight junction: a co-ordinator of cell signalling and membrane trafficking. Biology of the Cell 97(8): 659–665.
Koppelman, G. H., Meyers, D. A., et al. (2009). Identification of PCDH1 as a novel susceptibility gene for bronchial hyperresponsiveness. American Journal of Respiratory and Critical Care Medicine 180(10): 929-935.
Kotaniemi-Syrjänen, A., Vainionpää, R., et al. (2003). Rhinovirus-induced wheezing in infancy—the first sign of childhood asthma? Journal of Allergy and Clinical Immunology 111(1): 66-71.
Koumoundouros, E., Bischof, R. J., et al. (2006). Chronic Airway Disease: Deteriorating pulmonary function in sheep associated with repeated challenges of house dust mite. Experimental Lung Research 32(7): 321-330.
Kraft, M., Djukanovic, R., et al. (1996). Alveolar tissue inflammation in asthma. American Journal of Respiratory and Critical Care Medicine 154(5): 1505-1510.
Kraft, M., Martin, Richard J., et al. (1999). Lymphocyte and Eosinophil Influx into Alveolar Tissue in Nocturnal Asthma. American Journal of Respiratory and Critical Care Medicine 159(1): 228-234.
Krishnamoorthy, N., Khare, A., et al. (2012). Early infection with respiratory syncytial virus impairs regulatory T cell function and increases susceptibility to allergic asthma. Nature Medicine 18(10): 1525-1530.
Kristjansson, S., Bjarnarson, S. P., et al. (2005). Respiratory syncytial virus and other respiratory viruses during the first 3 months of life promote a local Th2-like response. Journal of Allergy and Clinical Immunology 116(4): 805-811.
Krug, N. (2008). Animal models for human asthma: the perspective of a clinician. Current Drug Targets 9(6): 438.
Kumar, R., Herbert, C., et al. (2002). Role of interleukin‐13 in eosinophil accumulation and airway remodelling in a mouse model of chronic asthma. Clinical & Experimental Allergy 32(7): 1104-1111.
Kuo, I.-H., Carpenter-Mendini, A., et al. (2012). Activation of epidermal toll-like receptor 2 enhances tight junction function: implications for atopic dermatitis and skin barrier repair. Journal of Investigative Dermatology 133(4): 988-998.
Kusel, M. M., de Klerk, N. H., et al. (2007). Early-life respiratory viral infections, atopic sensitization, and risk of subsequent development of persistent asthma. Journal of Allergy and Clinical Immunology 119(5): 1105-1110.
Kusel, M. M., Kebadze, T., et al. (2012). Febrile respiratory illnesses in infancy and atopy are risk factors for persistent asthma and wheeze. European Respiratory Journal 39(4): 876-882.
Kuwano, K., Bosken, C. H., et al. (1993). Small airways dimensions in asthma and in chronic obstructive pulmonary disease. The American review of respiratory disease 148(5): 1220-1225.
Laberge, S., Pinsonneault, S., et al. (1999). Phenotype of IL-16 Producing Cells in Bronchial Mucosa: Evidence for the Human Eosinophil and Mast Cell as Cellular Sources of IL-16 in Asthma. International Archives of Allergy and Immunology 119(2): 120-125.
Laitinen, L. A., Laitinen, A., et al. (1991). Eosinophilic airway inflammation during exacerbation of asthma and its treatment with inhaled corticosteroid. The American review of respiratory disease 143(2): 423-427.
Looi 2015
180
Lambert, H. P. and Stern, H. (1972). Infective Factors in Exacerbations of Bronchitis and Asthma. British Medical Journal 3(5822): 323-327.
Lambrecht, B. N. and Hammad, H. (2012). The airway epithelium in asthma. Nature Medicine 18(5): 684-692.
Lane, C. (2005). "The use of non-bronchoscopic brushings to study the paediatric airway." Respiratory Research 6(1): 53.
Lanford, R. E., Hildebrandt-Eriksen, E. S., et al. (2010). Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection. Science 327(5962): 198-201.
Lee, K. K., Hegele, R. G., et al. (2007). Relationship of early childhood viral exposures to respiratory symptoms, onset of possible asthma and atopy in high risk children: the Canadian Asthma Primary Prevention Study. Pediatric pulmonology 42(3): 290-297.
Lemanske, R. F., Jackson, D. J., et al. (2005). Rhinovirus illnesses during infancy predict subsequent childhood wheezing. Journal of Allergy and Clinical Immunology 116(3): 571-577.
Leopold, P. L., O'Mahony, M. J., et al. (2009). Smoking Is Associated with Shortened Airway Cilia. PLoS One 4(12): e8157.
Li, X. and Wilson, J. W. (1997). Increased vascularity of the bronchial mucosa in mild asthma. American Journal of Respiratory and Critical Care Medicine 156(1): 229-233.
Lin, H., Li, H., et al. (2007). Air-liquid interface (ALI) culture of human bronchial epithelial cell monolayers as an in vitro model for airway drug transport studies. Journal of Pharmaceutical Sciences 96(2): 341-350.
Liu, C., Kelnar, K., et al. (2011). The microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44. Nature Medicine 17(2): 211-215.
Looi, K., Sutanto, E. N., et al. (2011). Bronchial brushings for investigating airway inflammation and remodelling. Respirology 16(5): 725-737.
Lopez-Souza, N., Favoreto, S., et al. (2009). In vitro susceptibility to rhinovirus infection is greater for bronchial than for nasal airway epithelial cells in human subjects. Journal of Allergy and Clinical Immunology 123(6): 1384-1390.e1382.
Lordan, J. L., Bucchieri, F., et al. (2002). Cooperative Effects of Th2 Cytokines and Allergen on Normal and Asthmatic Bronchial Epithelial Cells. Journal of Immunology 169(1): 407-414.
Lumsden, A., McLean, A., et al. (1984). Goblet and Clara cells of human distal airways: evidence for smoking induced changes in their numbers. Thorax 39(11): 844-849.
Madara, J. L. (1990). Maintenance of the macromolecular barrier at cell extrusion sites in intestinal epithelium: physiological rearrangement of tight junctions. Journal of Membrane Biology 116(2): 177.
Makeyev, E. V. and Maniatis, T. (2008). Multilevel regulation of gene expression by microRNAs. Science 319(5871): 1789-1790.
Malm-Erjefalt, M., Persson, C. G. A., et al. (2001). Degranulation Status of Airway Tissue Eosinophils in Mouse Models of Allergic Airway Inflammation. American Journal of Respiratory Cell and Molecular Biology 24(3): 352-359.
Manetti, R., Parronchi, P., et al. (1993). Natural killer cell stimulatory factor (interleukin 12 [IL-12]) induces T helper type 1 (Th1)-specific immune responses and inhibits the development of IL-4-producing Th cells. The Journal of Experimental Medicine 177(4): 1199-1204.
Manolitsas, N., Trigg, C., et al. (1994). The expression of intercellular adhesion molecule-1 and the beta 1-integrins in asthma. European Respiratory Journal 7(8): 1439-1444.
Looi 2015
181
Marini, M. and Marini (1992). Expression of the potent inflammatory cytokines, granulocyte-macrophage-colony-stimulating factor and interleukin-6 and interleukin-8, in bronchial epithelial cells of patients with asthma. Journal of Allergy and Clinical Immunology 89(5): 1001-1009.
Masoli, M., Fabian, D., et al. (2004). The global burden of asthma: executive summary of the GINA Dissemination Committee Report. Allergy 59(5): 469-478.
Matter, K. and Balda, M. S. (2003). Functional analysis of tight junctions. Methods 30(3): 228 - 234.
Matter, K. and Balda, M. S. (2003). Signalling to and from tight junctions. Nature Reviews - Molecular Cell Biology 4(3): 225.
Mattes, J., Collison, A., et al. (2009). Antagonism of microRNA-126 suppresses the effector function of Th2 cells and the development of allergic airways disease. Proceedings of the National Academy of Sciences of USA 106(44): 18704-18709.
McCarthy, K. M., Skare, I. B., et al. (1996). Occludin is a functional component of the tight junction. Journal of Cell Science 109: 2287 - 2298.
McErlean, P., Shackelton, L. A., et al. (2008). Distinguishing Molecular Features and Clinical Characteristics of a Putative New Rhinovirus Species, Human Rhinovirus C (HRV C). PLoS One 3(4): e1847.
McNamara, P. S., Flanagan, B. F., et al. (2004). Pro- and anti-inflammatory responses in respiratory syncytial virus bronchiolitis. European Respiratory Journal 23(1): 106-112.
McNamara, P. S., Flanagan, B. F., et al. (2005). Production of Chemokines in the Lungs of Infants with Severe Respiratory Syncytial Virus Bronchiolitis. Journal of Infectious Diseases 191(8): 1225-1232.
McNamara, P. S., Fonceca, A. M., et al. (2013). Respiratory syncytial virus infection of airway epithelial cells, in vivo and in vitro, supports pulmonary antibody responses by inducing expression of the B cell differentiation factor BAFF. Thorax 68(1): 76-81.
McNamara, P. S., Kicic, A., Sutanto, E. N., et al. (2008). "Comparison of techniques for obtaining lower airway epithelial cells from children." European Respiratory Journal 32(3): 763-768.
Medzhitov, R. and Janeway, C. (2000). Innate Immunity. New England Journal of Medicine 343(5): 338-344.
Merikallio, V. J., Mustalahti, K., et al. (2005). Comparison of quality of life between asthmatic and healthy school children. Pediatric Allergy and Immunology 16(4): 332-340.
Mese, G., Richard, G., et al. (2007). Gap Junctions: Basic Structure and Function. Journal of Investigative Dermatology 127(11): 2516-2524.
Metzger, W., Zavala, D., et al. (1987). Local allergen challenge and bronchoalveolar lavage of allergic asthmatic lungs. Description of the model and local airway inflammation. The American review of respiratory disease 135(2): 433.
Miller, E. K., Edwards, K. M., et al. (2009). A novel group of rhinoviruses is associated with asthma hospitalizations. Journal of Allergy and Clinical Immunology 123(1): 98-104.e101.
Minor, T. E., Dick, E. C., et al. (1974). Viruses as precipitants of asthmatic attacks in children. JAMA: The Journal of the American Medical Association 227(3): 292-298.
Moffatt, M., Kabesch, L., et al. (2007). Genetic variants regulating ORMDL3 expression contribute to the risk of childhood asthma. Nature 448(7152): 470-473.
Moffatt, M. F., Gut, I. G., et al. (2010). A large-scale, consortium-based genomewide association study of asthma. New England Journal of Medicine 363(13): 1211-1221.
Looi 2015
182
Morita, K., Furuse, M., et al. (1999). Claudin multigene family encoding four-transmembrane domain protein components of tight junction strands. Proceedings of the National Academy of Sciences 96(2): 511-516.
Mosmann, T. R., Cherwinski, H., et al. (1986). Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. The Journal of Immunology 136(7): 2348-2357.
Nakagome, K., Bochkov, Y. A., et al. (2014). Effects of rhinovirus species on viral replication and cytokine production. Journal of Allergy and Clinical Immunology 134(2): 332-341
Nelson, W. J. (2003). Adaptation of core mechanisms to generate cell polarity. Nature 422(6933): 766-774.
Nicholson, K. G., Kent, J., et al. (1993). Respiratory viruses and exacerbations of asthma in adults. British Medical Journal 307(6910): 982-986.
Noble, V., Murray, M., et al. (1997). Respiratory status and allergy nine to 10 years after acute bronchiolitis. Archives of Disease in Childhood 76(4): 315-319.
Noone, P. G., Leigh, M. W., et al. (2004). Primary Ciliary Dyskinesia. American Journal of Respiratory and Critical Care Medicine 169(4): 459-467.
Nusrat, A., Giry, M., et al. (1995). Rho protein regulates tight junctions and perijunctional actin organization in polarized epithelia. Proceedings of the National Academy of Sciences 92(23): 10629-10633.
Ohkubo, T. and Ozawa, M. (2004). The transcription factor Snail downregulates the tight junction components independently of E-cadherin downregulation. Journal of Cell Science 117(9): 1675-1685.
Pabst, R. (2003). Animal models of asthma: controversial aspects and unsolved problems. Pathobiology 70(5): 252-254.
Palmenberg, A. C., Spiro, D., et al. (2009). Sequencing and Analyses of All Known Human Rhinovirus Genomes Reveal Structure and Evolution. Science 324(5923): 55-59.
Palmer, C. N., Irvine, A. D., et al. (2006). Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis. Nature Genetics 38(4): 441-446.
Papadopoulos, N. G., Bates, P. J., et al. (2000). Rhinoviruses Infect the Lower Airways. Journal of Infectious Diseases 181(6): 1875-1884.
Papadopoulos, N. G., Psarras, S., et al. (2003). The role of respiratory viruses in the origin and exacerbations of asthma. Current Opinion in Allergy and Clinical Immunology 3(1): 39-44.
Papi, A. and Johnston, S. L. (1999). "Rhinovirus Infection Induces Expression of Its Own Receptor Intercellular Adhesion Molecule 1 (ICAM-1) via Increased NF-κB-mediated Transcription." Journal of Biological Chemistry 274(14): 9707-9720.
Papi, A., Bellettato, C. M., et al. (2006). Infections and Airway Inflammation in Chronic Obstructive Pulmonary Disease Severe Exacerbations. American Journal of Respiratory and Critical Care Medicine 173(10): 1114-1121.
Parker, J. (2010). A 3-D Well-Differentiated Model of Pediatric Bronchial Epithelium Demonstrates Unstimulated Morphological Differences Between Asthmatic and Nonasthmatic Cells. Pediatric Research 67(1): 17.
Pattemore, P. K., Johnston, S. L., et al. (1992). Viruses as precipitants of asthma symptoms. I. Epidemiology. Clinical & Experimental Allergy 22(3): 325-336.
Pedemonte, C. H. (1995). Inhibition of Na+-pump expression by impairment of protein glycosylation is independent of the reduced sodium entry into the cell. The Journal of Membrane Biology 147(3): 223-231.
Looi 2015
183
Persson, C. (1985). On the medical history of xanthines and other remedies for asthma: a tribute to HH Salter. Thorax 40(12): 881.
Pezzulo, A. A., Starner, T. D., et al. (2011). The air-liquid interface and use of primary cell
cultures are important to recapitulate the transcriptional profile of in vivo airway epithelia. American Journal of Physiology - Lung Cellular and Molecular Physiology 300(1): L25-L31.
Pichavant, M., Goya, S., et al. (2008). Ozone exposure in a mouse model induces airway hyperreactivity that requires the presence of natural killer T cells and IL-17. The Journal of Experimental Medicine 205(2): 385-393.
Pickles, R. J., McCarty, D., et al. (1998). Limited entry of adenovirus vectors into well-differentiated airway epithelium is responsible for inefficient gene transfer. Journal of Virology 72(7): 6014-6023.
Pierrou, S., Broberg, P., et al. (2007). Expression of genes involved in oxidative stress responses in airway epithelial cells of smokers with chronic obstructive pulmonary disease. American Journal of Respiratory and Critical Care Medicine 175(6): 577-586.
Pilot, F. (2005). Compartmentalized morphogenesis in epithelia: from cell to tissue shape. Developmental Dynamics 232(3): 685.
Pin, I. (1992). Use of induced sputum cell counts to investigate airway inflammation in asthma. Thorax 47(1): 25.
Postma, D. S. and Boezen, H. M. (2004). Rationale for the Dutch hypothesis Allergy and airway hyperresponsiveness as genetic factors and their interaction with environment in the development of asthma and COPD. CHEST Journal 126(2 suppl 1): 96S-104S.
Powell, R. D. and Hartley, P. H. (1911). On diseases of the lung and pleurae including tuberculosis and mediastinal growths. Philadelphia, P.Blakiston's Son & Co: 215-236.
Pullan, C. R. (1982). Wheezing, asthma, and pulmonary dysfunction 10 years after infection with respiratory syncytial virus in infancy. British medical journal (Clinical research ed. 1981) 284(6330): 1665-1669.
Qin, H.-b., Xu, B., et al. (2012). Inhibition of miRNA-221 suppresses the airway inflammation in asthma. Inflammation 35(4): 1595-1599.
Qiu, Y., Zhu, J., et al. (2007). Bronchial mucosal inflammation and upregulation of CXC chemoattractants and receptors in severe exacerbations of asthma. Thorax 62(6): 475-482.
Rackemann, F. M. (1921). A Clinical Classification on Asthma Based Upon A Review of Six Hundred and Forty-Eight Cases. The American Journal of the Medical Sciences 162(6): 802-811.
Rakes, G. P., Arruda, E., et al. (1999). Rhinovirus and respiratory syncytial virus in wheezing children requiring emergency care: IgE and eosinophil analyses. American Journal of Respiratory and Critical Care Medicine 159(3): 785-790.
Rawlins, E. L. and Hogan, B. L. (2006). Epithelial stem cells of the lung: privileged few or opportunities for many? Development 133(13): 2455-2465.
Reuss, L. (2001). Tight Junction Permeability to Ions and Water. Tight Junctions. Cereijido, M. Boca Raton, FL, CRC Press Inc: 61-88.
Rezaee, F., Meednu, N., et al. (2011). Polyinosinic:polycytidylic acid induces protein kinase D–dependent disassembly of apical junctions and barrier dysfunction in airway epithelial cells. Journal of Allergy and Clinical Immunology 128(6): 1216-1224.e1211.
Looi 2015
184
Richardson, L. P., Lozano, P., et al. (2006). Asthma Symptom Burden: Relationship to Asthma Severity and Anxiety and Depression Symptoms. Pediatrics 118(3): 1042-1051.
Robinson, D. S., Hamid, Q., et al. (1992). Predominant TH2-like bronchoalveolar T-lymphocyte population in atopic asthma. New England Journal of Medicine 326(5): 298-304.
Roche, W. R., Montefort, S., et al. (1993). Cell adhesion molecules and the bronchial epithelium. The American review of respiratory diseases 148(6): S79-82.
Roche, W., Williams, J., et al. (1989). Subepithelial fibrosis in the bronchi of asthmatics. Lancet 333(8637): 520-524.
Román, E., Miller, E., et al. (2002). CD4 Effector T Cell Subsets in the Response to Influenza: Heterogeneity, Migration, and Function. The Journal of Experimental Medicine 196(7): 957-968.
Rønn, L. C., Ralets, I., et al. (2000). A simple procedure for quantification of neurite outgrowth based on stereological principles. Journal of neuroscience methods 100(1): 25-32.
Rosenblatt, J. (2001). An epithelial cell destined for apoptosis signals its neighbors to extrude it by an actin-and myosin-dependent mechanism. Current Biology 11(23): 1847.
Ross, A. J., Dailey, L. A., et al. (2007). Transcriptional profiling of mucociliary differentiation in human airway epithelial cells. American Journal of Respiratory Cell and Molecular Biology 37(2): 169-185.
Roth, M., Johnson, P. R., et al. (2004). Dysfunctional interaction of C/EBPα and the glucocorticoid receptor in asthmatic bronchial smooth-muscle cells. New England Journal of Medicine 351(6): 560-574.
Saitou, M., Fujimoto, K., et al. (1998). Occludin-deficient Embryonic Stem Cells Can Differentiate into Polarized Epithelial Cells Bearing Tight Junctions. Journal of Cell Biology 141(2): 397-408.
Saitou, M., Furuse, M., et al. (2000). Complex phenotype of mice lacking occludin, a component of tight junction strands. Molecular biology of the cell 11(12): 4131-4142.
Sajjan, U., Wang, Q., et al. (2008). Rhinovirus disrupts the barrier function of polarized airway epithelial cells. American Journal of Respiratory and Critical Care Medicine 178(12): 1271.
Sakula, A. (1988). A history of Asthma. The FitzPatrick Lecture 1987, Journal of the Royal College of Physicians London. 22: 36-44.
Sallenave, J.-M., Shulmann, J., et al. (1994). Regulation of secretory leukocyte proteinase inhibitor (SLPI) and elastase-specific inhibitor (ESI/elafin) in human airway epithelial cells by cytokines and neutrophilic enzymes. American Journal of Respiratory Cell and Molecular Biology 11(6): 733-741.
Sanders, S. P., Siekierski, E. S., et al. (1998). Nitric oxide inhibits rhinovirus-induced cytokine production and viral replication in a human respiratory epithelial cell line. Journal of virology 72(2): 934-942.
Sanders, S., Kim, J., et al. (2001). Nitric oxide inhibits rhinovirus-induced GM-CSF production in bronchial epithelial cells. American Journal of Respiratory Cell and Molecular Biology 24: 317-325.
Schmitz, H., Barmeyer, C., et al. (1999). Altered tight junction structure contributes to the impaired epithelial barrier function in ulcerative colitis. Gastroenterology 116(2): 301-309.
Schneider, D., Hong, J. Y., et al. (2012). Neonatal Rhinovirus Infection Induces Mucous Metaplasia and Airways Hyperresponsiveness. The Journal of Immunology 188(6): 2894-2904.
Looi 2015
185
Schroth, M. K., Grimm, E., et al. (1999). Rhinovirus replication causes RANTES production in primary bronchial epithelial cells. American Journal of Respiratory Cell and Molecular Biology 20(6): 1220-1228.
Scott, M., Raza, A., et al. (2010). Influence of atopy and asthma on exhaled nitric oxide in an unselected birth cohort study. Thorax 65(3): 258-262.
Shao, M. X. G., Nakanaga, T., et al. (2004). Cigarette smoke induces MUC5AC mucin overproduction via tumor necrosis factor-α-converting enzyme in human airway epithelial (NCI-H292) cells. American Journal of Physiology - Lung Cellular and Molecular Physiology 287(2): L420-L427.
Shapiro, S. D. (2006). Animal Models of Asthma: Pro: allergic avoidance of animal (model[s]) is not an option. American Journal of Respiratory and Critical Care Medicine 174(11): 1171-1173.
Shapiro, S. D. (2008). The use of transgenic mice for modeling airways disease. Pulmonary Pharmacology and Therapeutics 21(5): 699-701.
Sheehan, J. K., Kesimer, M., et al. (2008). Innate Immunity and Mucus Structure and Function. Innate Immunity to Pulmonary Infection, John Wiley & Sons, Ltd: 155-169.
Shen, L., Weber, C. R., et al. (2008). The tight junction protein complex undergoes rapid and continuous molecular remodeling at steady state. The Journal of Cell Biology 181(4): 683-695.
Shirakawa, T., Deichmann, K. A., et al. (2000). Atopy and asthma: genetic variants of IL-4 and IL-13 signalling. Immunology today 21(2): 60-64.
Sigurs, N., Bjarnason, R., et al. (2000). Respiratory Syncytial Virus Bronchiolitis in Infancy Is an Important Risk Factor for Asthma and Allergy at Age 7. American Journal of Respiratory and Critical Care Medicine 161(5): 1501-1507.
Sigurs, N., Gustafsson, P. M., et al. (2005). Severe Respiratory Syncytial Virus Bronchiolitis in Infancy and Asthma and Allergy at Age 13. American Journal of Respiratory and Critical Care Medicine 171(2): 137-141.
Simonella, L., Marks, G., et al. (2006). Cost-effectiveness of current and optimal treatment for adult asthma. Internal Medicine Journal 36(4): 244-250.
Simonsson, B., Jacobs, F., et al. (1967). Role of autonomic nervous system and the cough reflex in the increased responsiveness of airways in patients with obstructive airway disease. Journal of Clinical Investigation 46(11): 1812.
Sly, P. D., Kusel, M. M. H., et al. (2006). Role of Respiratory Viruses in Acute Upper and Lower Respiratory Tract Illness in the First Year of Life: A Birth Cohort Study. The Pediatric Infectious Disease Journal 25(8): 680-686
Sly, P. D., Kusel, M., et al. (2010). Do early-life viral infections cause asthma? Journal of Allergy and Clinical Immunology 125(6): 1202-1205.
Smirnova, M. G., Guo, L., et al. (2003). LPS up-regulates mucin and cytokine mRNA expression and stimulates mucin and cytokine secretion in goblet cells. Cellular Immunology 221(1): 42-49.
Solway, J. and Fredberg, J. J. (1997). Perhaps airway smooth muscle dysfunction contributes to asthmatic bronchial hyperresponsiveness after all. American Journal of Respiratory Cell and Molecular Biology 17: 144-146.
Sousa, A. R. (1996). Expression of interleukin-1 beta (IL-1b) and interleukin-1 receptor antagonist (IL-1ra) on asthmatic bronchial epithelium. American Journal of Respiratory and Critical Care Medicine 154(4): 1061-1066.
Sousa, A. R., Lams, B. E., et al. (1997). Expression of Interleukin-5 and Granulocyte-Macrophage Colony-stimulating Factor in Aspirin-sensitive and Non–Aspirin-sensitive Asthmatic Airways. American Journal of Respiratory and Critical Care Medicine 156(5): 1384-1389.
Looi 2015
186
Spergel, J. M. (2010). From atopic dermatitis to asthma: the atopic march. Annals of Allergy, Asthma & Immunology 105(2): 99-106.
Spina, D. (1998). Epithelium Smooth Muscle Regulation and Interactions. American Journal of Respiratory and Critical Care Medicine 158(Supplement 2): S141-S145.
Springall, D., Counihan, H., et al. (1991). Endothelin immunoreactivity of airway epithelium in asthmatic patients. Lancet 337(8743): 697-701.
Spurrell, J. C., Wiehler, S., et al. (2005). Human airway epithelial cells produce IP-10 (CXCL10) in vitro and in vivo upon rhinovirus infection. American Journal of Physiology-Lung Cellular and Molecular Physiology 289(1): L85-L95.
Stanway, G. (1994). Rhinoviruses. Encyclopedia of Virology. Webster, R. G. and Granoff, A. London, Academic Press. 3: 1253-1259.
Stephens, N. L., Li, W., et al. (2003). The biophysics of asthmatic airway smooth muscle. Respiratory physiology & neurobiology 137(2): 125-140.
Stevens, P. T. (2009). Intrinsic Differences of the Airway Epithelium in Childhood Allergic Asthma. School of Paediatrics and Child Health. Perth, University of Western Australia. Doctor in Philosophy.
Stevens, P. T., Kicic, A., Sutanto, E. N., et al. (2008). "Dysregulated repair in asthmatic paediatric airway epithelial cells: the role of plasminogen activator inhibitor-1." Clinical and Experimental Allergy 38(12): 1901-1910.
Stolkind, E. (1933). The history of bronchial asthma and allergy. Proceedings of the Royal Society of Medicine 26(9): 1120.
Stutts, M. J., Boucher, R. C., et al. (1981). Effects of ammonium and nitrate salts on ion transport across the excised canine trachea. Toxicology and Applied Pharmacology 60(1): 91-105.
Subauste, M. C., Jacoby, D. B., et al. (1995). Infection of a human respiratory epithelial cell line with rhinovirus. Induction of cytokine release and modulation of susceptibility to infection by cytokine exposure. The Journal of Clinical Investigation 96(1): 549-557.
Sutanto, E. N., Kicic, A., et al. (2011). Innate Inflammatory Responses of Pediatric Cystic Fibrosis Airway Epithelial Cells: Effects of Nonviral and Viral Stimulation. American Journal of Respiratory Cell and Molecular Biology 44(6): 761-767.
Sung, S.-S. J., Fu, S. M., et al. (2006). A major lung CD103 (αE)-β7 integrin-positive epithelial dendritic cell population expressing Langerin and tight junction proteins. The Journal of Immunology 176(4): 2161-2172.
Swindle, E. J. (2009). Breakdown in epithelial barrier function in patients with asthma: identification of novel therapeutic approaches. Journal of Allergy and Clinical Immunology 124(1): 23.
Takano, K.-i., Kojima, T., et al. (2005). HLA-DR-and CD11c-positive dendritic cells penetrate beyond well-developed epithelial tight junctions in human nasal mucosa of allergic rhinitis. Journal of Histochemistry & Cytochemistry 53(5): 611-619.
Takeyama, K., Dabbagh, K., et al. (1999). Epidermal growth factor system regulates mucin production in airways. Proceedings of the National Academy of Sciences 96(6): 3081-3086.
Tan, W. C., Xiang, X., et al. (2003). Epidemiology of respiratory viruses in patients hospitalized with near-fatal asthma, acute exacerbations of asthma, or chronic obstructive pulmonary disease. The American Journal of Medicine 115(4): 272-277.
Tarran, R., Grubb, B. R., et al. (2001). The Relative Roles of Passive Surface Forces and Active Ion Transport in the Modulation of Airway Surface Liquid Volume and Composition. The Journal of General Physiology 118(2): 223-236.
Looi 2015
187
Tate, M. D., Schilter, H. C., et al. (2011). Responses of mouse airway epithelial cells and alveolar macrophages to virulent and avirulent strains of influenza A virus. Viral Immunology 24(2): 77-88.
Terajima, M., Yamaya, M., et al. (1997). Rhinovirus infection of primary cultures of human tracheal epithelium: role of ICAM-1 and IL-1β. American Journal of Physiology 273(4 Pt 1): L749-759.
Tillie-Leblond, I., Gosset, P., et al. (2007). Keratinocyte growth factor improves alterations of lung permeability and bronchial epithelium in allergic rats. European Respiratory Journal 30(1): 31-39.
Trinchieri, G. (1994). Interleukin-12: a cytokine produced by antigen-presenting cells with immunoregulatory functions in the generation of T-helper cells type 1 and cytotoxic lymphocytes. Blood 84(12): 4008-4027.
Tsukita, S. and Furuse, M. (2002). Claudin-based barrier in simple and stratified cellular sheets. Current Opinion in Cell Biology 14(5): 531-536.
Tsukita, S., Furuse, M., et al. (2001). Multifunctional strands in tight junctions. Nature Reviews - Molecular Cell Biology 2(4): 285-293.
Turato, G., Barbato, A., et al. (2008). Nonatopic Children with Multitrigger Wheezing Have Airway Pathology Comparable to Atopic Asthma. American Journal of Respiratory and Critical Care Medicine 178(5): 476.
Turner, B. W., Cail, W. S., et al. (1992). Physiologic abnormalities in the paranasal sinuses during experimental rhinovirus colds. Journal of Allergy and Clinical Immunology 90(3 Pt 2): 474-478.
Van Den Toorn, L. M., Overbeek, S. E., et al. (2001). Airway Inflammation Is Present during Clinical Remission of Atopic Asthma. American Journal of Respiratory and Critical Care Medicine 164(11): 2107-2113.
Veres TZ, Voedisch S, Spies E, Tschernig T, Braun A. Spatiotemporal and functional behavior of airway dendritic cells visualized by two-photon microscopy. Am J Pathol 2011;179:603–609
Vignola, A. M., Campbell, A. M., et al. (1993). HLA-DR and ICAM-1 expression on bronchial epithelial cells in asthma and chronic bronchitis. The American review of respiratory disease 148(3): 689-694.
Vignola, A. M., Chanez, P., et al. (1998). Airway inflammation in mild intermittent and in persistent asthma. American Journal of Respiratory and Critical Care Medicine 157(2): 403-409.
Wan, H., Winton, H. L., et al. (1999). Der p 1 facilitates transepithelial allergen delivery by disruption of tight junctions. Journal of Clinical Investigation 104(1): 123-133.
Wan, Winton, et al. (2000). Quantitative structural and biochemical analyses of tight junction dynamics following exposure of epithelial cells to house dust mite allergen Der p 1. Clinical & Experimental Allergy 30(5): 685-698.
Wang, C. Q. F. and Cheng, C. Y. (2007). A seamless trespass: germ cell migration across the seminiferous epithelium during spermatogenesis. Journal of Cell Biology 178(4): 549-556.
Wang, F., Daugherty, B., et al. (2003). Heterogeneity of claudin expression by alveolar epithelial cells. American Journal of Respiratory Cell and Molecular Biology 29(1): 62-70.
Wark, P. A. B., Bucchieri, F., et al. (2007). IFN-γ–induced protein 10 is a novel biomarker of rhinovirus-induced asthma exacerbations. Journal of Allergy and Clinical Immunology 120(3): 586-593.
Wark, P. A. B., Grissell, T., et al. (2009). Diversity in the bronchial epithelial cell response to infection with different rhinovirus strains. Respirology 14(2): 180-186.
Looi 2015
188
Wark, P. A. B., Johnston, S. L., et al. (2002). Neutrophil degranulation and cell lysis is associated with clinical severity in virus-induced asthma. European Respiratory Journal 19(1): 68-75.
Wark, P. A. B., Johnston, S. L., et al. (2005). Asthmatic bronchial epithelial cells have a deficient innate immune response to infection with rhinovirus. Journal of Experimental Medicine 201(6): 937-947.
Warschburger, P., Landgraf, J., et al. (2003). Health-related quality of life in children assessed by their parents: Evaluation of the psychometric properties of the CHQ-PF50 in two German clinical samples. Quality of Life Research 12(3): 291-301.
Watson, L., Turk, F., et al. (2007). Burden of asthma in the hospital setting: an Australian analysis. International Journal of Clinical Practice 61(11): 1884-1888.
Wegner, C. D., Gundel, R. H., et al. (1990). Intercellular adhesion molecule-1 (ICAM-1) in the pathogenesis of asthma. Science (New York, N.Y.) 247(4941): 456-459.
Weidinger, S., Illig, T., et al. (2006). Loss-of-function variations within the filaggrin gene predispose for atopic dermatitis with allergic sensitizations. Journal of Allergy and Clinical Immunology 118(1): 214-219.
Wenner, C. A., Güler, M., et al. (1996). Roles of IFN-gamma and IFN-alpha in IL-12-induced T helper cell-1 development. The Journal of Immunology 156(4): 1442-1447.
West, M., Ferguson, D., et al. (2002). Maintenance of the epithelial barrier in a bronchial epithelial cell line is dependent on functional E-cadherin local to the tight junctions. Cell Communication and Adhesion 9(1): 29-44.
Whitcutt, M. J., Adler, K. B., et al. (1988). A biphasic chamber system for maintaining polarity of differentiation of culture respiratory tract epithelial cells. In vitro cellular & developmental biology 24(5): 420-428.
White, S. R., Fischer, B. M., et al. (2008). Interleukin-1β mediates human airway epithelial cell migration via NF-κB. American Journal of Physiology - Lung Cellular and Molecular Physiology 295(6): L1018-L1027.
Wickström, C. (1998). MUC5B is a major gel-forming, oligomeric mucin from human salivary gland, respiratory tract and endocervix: identification of glycoforms and C-terminal cleavage. Biochemical Journal 334(Pt 3): 685.
Willis-Owen, S. A., Cookson, W. O., et al. (2009). Genome-wide association studies in the genetics of asthma. Current Allergy and Asthma Reports 9(1): 3-9.
Wills-Karp, M. (1999). Immunologic basis of antigen-induced airway hyperresponsiveness. Annual review of immunology 17(1): 255-281.
Wu, P., Dupont, W. D., et al. (2008). Evidence of a Causal Role of Winter Virus Infection during Infancy in Early Childhood Asthma. American Journal of Respiratory and Critical Care Medicine 178(11): 1123-1129.
Wu, R., Sato, G. H., et al. (1986). Developing differentiated epithelial cell cultures: airway epithelial cells. Fundamental and Applied Toxicology 6(4): 580-590.
Xiao, C., Puddicombe, S. M., et al. (2011). Defective epithelial barrier function in asthma. Journal of Allergy and Clinical Immunology 128(3): 549-556.e512.
Yang, H., Rao, J., et al. (2014). Posttranscriptional Regulation of Intestinal Epithelial Tight Junction Barrier by RNA-binding Proteins and microRNAs. Tissue barriers 2(1): e28320-e28320.
Yang, S., Li, Y., et al. (2012). MicroRNA-34 suppresses breast cancer invasion and metastasis by directly targeting Fra-1. Oncogene 32(36): 4294-4303.
Ye, D., Guo, S., et al. (2011). MicroRNA Regulation of Intestinal Epithelial Tight Junction Permeability. Gastroenterology 141(4): 1323-1333.
Looi 2015
189
Yeo, N.-K. and Jang, Y. J. (2010). Rhinovirus infection-induced alteration of tight junction and adherens junction components in human nasal epithelial cells. The Laryngoscope 120(2): 346-352.
Ying, S., Robinson, D., et al. (1991). TNFα mRNA expression in allergic inflammation. Clinical & Experimental Allergy 21(6): 745-750.
Yu, A. S. L., McCarthy, K. M., et al. (2005). Knockdown of occludin expression leads to diverse phenotypic alterations in epithelial cells. American Journal of Physiology - Cell Physiology 288(6): C1231-C1241.
Zabner, J., Karp, P., Seiler, M., et al. (2003). "Development of cystic fibrosis and noncystic fibrosis airway cell lines." American Journal of Physiology - Lung Cellular and Molecular Physiology 284(5): L844-L854.
Zabner, J., Scheetz, T. E., et al. (2005). CFTR ΔF508 mutation has minimal effect on the gene expression profile of differentiated human airway epithelia. American Journal of Physiology-Lung Cellular and Molecular Physiology 289(4): L545-L553.
Zeitlin, P. L. (2008). Cystic fibrosis and estrogens: a perfect storm. The Journal of Clinical Investigation 118(12): 3841-3844.
Zhang, Y., Moffatt, M. F., et al. (2012). Genetic and genomic approaches to asthma: new insights for the origins. Current opinion in pulmonary medicine 18(1): 6-13.
Zhou, B., Comeau, M. R., et al. (2005). Thymic stromal lymphopoietin as a key initiator of allergic airway inflammation in mice. Nature Immunology 6(10): 1047-1053.
Zosky, G. R. (2009). Airway hyperresponsiveness is associated with activated CD4+ T cells in the airways. American Journal of Physiology - Lung Cellular and Molecular Physiology 297(2): L373.
Zosky, G. R. and Sly, P. D. (2007). Animal models of asthma. Clinical and Experimental Allergy 37(7): 973-988.
Zosky, G. R., Von Garnier, C., et al. (2004). The pattern of methacholine responsiveness in mice is dependent on antigen challenge dose. Respiratory Research 5: 15-10.
Looi 2015
190
Appendix A
Looi 2015
191
Looi 2015
192
Appendix B
Looi 2015
193
Looi 2015
194
Appendix C
Looi 2015
195
Looi 2015
196
Appendix D
CCATTATGGCGTGTAAAGTCA
TGAGCACTGGAGAGAAAGGA PPIA
Reverse
Forward
CTGGGTAAAAAGAGTAGGCTGGC Reverse
AGGCCTGATGAATTCAAACCG Forward Occludin
TCTTCTGCACCTCATCGTCTT Reverse
GGCAGATCCAGTGCAAAGTC Forward Claudin
CCGCCCGCTCCTCACGCCACAG Reverse
GCCCGTGCCCCGCTCGCTCTC Forward ZO-1
Sequence Primer Gene
Looi 2015
197
Appendix E
1:
pAECNon-asthmatic Claudin-1 Occludin ZO-1
Claudin-1 * *
Occludin * *
ZO-1 * *
2:
pAECAsthmatic Claudin-1 Occludin ZO-1
Claudin-1 * *
Occludin * *
ZO-1 * *
*, p<0.05
Looi 2015
198
Appendix F
1:
pAECHNA Claudin-1 Occludin ZO-1
Claudin-1 * *
Occludin * *
ZO-1 * *
2:
pAECHA Claudin-1 Occludin ZO-1
Claudin-1 * *
Occludin * *
ZO-1 * *
3:
pAECNAA Claudin-1 Occludin ZO-1
Claudin-1 * *
Occludin * *
ZO-1 * *
4:
pAECAA Claudin-1 Occludin ZO-1
Claudin-1 * *
Occludin * *
ZO-1 * *
*, p<0.05
Looi 2015
199
Appendix G
1:
pAECNon-asthmatic Claudin-1 Occludin ZO-1
Claudin-1 N.S *
Occludin N.S *
ZO-1 * *
2:
pAECAsthmatic Claudin-1 Occludin ZO-1
Claudin-1 * N.S
Occludin * *
ZO-1 N.S *
*, p<0.05
N.S, Non-significant
Looi 2015
200
Appendix H
1:
pAECHNA Claudin-1 Occludin ZO-1
Claudin-1 * N.S
Occludin * *
ZO-1 N.S *
2:
pAECHA Claudin-1 Occludin ZO-1
Claudin-1 * N.S
Occludin * *
ZO-1 N.S *
3:
pAECAA Claudin-1 Occludin ZO-1
Claudin-1 * N.S
Occludin * *
ZO-1 N.S *
*, p<0.05
N.S, Non-significant