Phragmites Control Methods

Mowing

Burning

Spraying Increased species diversity

Introduced Phragmites Native Marsh Community

Improved wildlife habitat

Changed structure & function

Tidal gates

Phragmites australis

Other Phragmites species

Over the past century, the distribution and abundance ofPhragmites australis (the common reed, hereafter Phragmites)in North American wetlands has dramatically increased.1,2 Notonly has Phragmites increased its dominance in sites whereit was historically found, but it has also spread into parts ofthe United States where it was not found prior to the 20th

century. Recent research using molecular markers hasdemonstrated that although Phragmites is native to NorthAmerica, a non-native lineage of the species has beenintroduced and is clearly linked to the widespread invasionsthat have been observed.1 This lineage is most likely Europeanin origin and first appeared along the Atlantic Coast of NorthAmerica, probably in the 18th or 19th centuries. Today,Phragmites is found across the continent and dominates alongthe Atlantic Coast where few native populations remain.2

Phragmites is thought to be one of the most widespreadplants on earth. Phragmites is found on every continentexcept Antartica and is common throughout North America,Europe, and Asia. Over the last 150 years, the distributionof this plant has increased across North America and thisinvasion has been attributed to factors such as disturbance,shoreline development, pollution, and eutrophication ofwaterways.2,3

Due to its rapid spread and dominance in the marshesin which it invades, Phragmites has been actively managedin North American Atlantic Coast marshes for severaldecades. Such actions have typically included restoringtidal flows, or widespread application of herbicide, fire, andmowing, all of which can have unintended impacts on otherplants and animals of the marsh community. Until now,management strategies have been implemented withoutregard to the native status of different Phragmitespopulations. It has been assumed that all Phragmites posea threat to native biodiversity and will cause negativeimpacts on the ecosystem as a whole.4

Global distribution of all varieties ofPhragmites australis.

Control methods utilized by managers to eradicatePhragmites (left) and restore diverse marsh communitieswith native assemblages of plants (right).

Typical introduced Phragmites stand

The historical record indicates that Phragmites shouldbe considered a native plant. The oldest evidence comesfrom the Southwest where Phragmites remains have beenfound in preserved Shasta ground sloth dung which datesback 40,000 years. Archeological sites throughout thesouthwest dating from 600-1400 AD have also found anumber of artifacts made of Phragmites indicating thatduring this time period it was also quite common and usedby indigenous peoples for a number of purposes. In coastalareas, Phragmites rhizomes preserved in peat have beenfound in many sites, ranging from southern New Englandto Delaware and also in California. These remains

Although we know that Phragmites is native to NorthAmerica, changes in its ecology and growth patterns suggestthat an exotic strain(s) has been introduced. To examinethis further, molecular analyses were conducted to determineif an exotic strain of Phragmites has been introduced to NorthAmerica. Genetic material (DNA: DeoxyriboNucleic Acid)

was extracted from green leaf tissues of Phragmites plantsthat were collected worldwide. Genes were amplified usingmolecular techniques and sequenced. Different Phragmitesstrains were inferred from the different DNA sequences. Byanalyzing the different sequences a map of geneticrelatedness could be created (haplotype network).

Bottom images: f) Shasta ground sloth, g) Shasta ground slothdung containing Phragmites, h) Herbarium sheet, i) NativePhragmites stand. Photos courtesy of Kristin Saltonstall.

indicate that Phragmites has been present in both coastaland inland marshes for thousands of years and certainlybefore the arrival of Europeans to North America.However, historical populations grew in mixed communitieswith sedges and forbs and not in monocultures as wecommonly see today.5 Herbarium records from the 1700sand 1800s indicate that Phragmites was found across thecontinent but was rare or not common. However, duringthe 1900s Phragmites became more common across thecountry, particularly in coastal areas. By the mid-1970sPhragmites had been recorded in all of the lower 48 statesand across southern Canada.1

a b c d e

f g h i

Collectplants

ExtractDNA

Amplificationof DNA sequence

DNA sequencing Haplotypenetwork

Sequencealignment

CGTAGATACCCTGGATACCCTGGCTACCCTGGACACCATCGATAG

CGTAGATACCCTGGATACCCTGGCTACCCTGGACACCATCGATAG

Top images: The Anasazi peoples had several different uses for Phragmites: a) cigarettes from Phragmites stems, b) mat wovenfrom Phragmites leaves, c) arrow shafts, d) prayer stick, e) flutes.

Figure 1: Haplotype network of Phragmites chloroplasthaplotype diversity obtained from sampling 345 populationsworldwide. Each link between haplotypes represents onemutational difference, following coding of indels as singlecharacters. Unlabelled nodes indicate inferred steps not foundin the sampled populations. (From Saltonstall 2002).

Figure 2: Distribution of Phragmites haplotypes in North America.Green circles represent the 11 native haplotypes, blue circlesare Haplotype I, and red circles represent the invasive HaplotypeM. a) distribution of haplotypes in the 62 herbarium samplescollected before 1910. b) distribution of haplotypes in 195samples collected after 1960 (From Saltonstall 2002).

After 1960

Native Phragmites

Introduced Phragmites

South American strain

Before 1910a

b

What is a haplotype?Haplotype = a unique genetic profile for an

organism that contains information from variationat several genes. In the case of chloroplast DNA,

this information is inherited maternally andshows a strong geographical signal.

Following the collection of 345 different populations ofPhragmites worldwide, genetic analysis of thesepopulations shows the distribution of particular haplotypes,or variants of Phragmites throughout the world.

A total of twenty seven haplotypes were identified, with11 of them unique to North America (Fig. 1). These 11haplotypes share five mutations that were not found inindividuals collected throughout the rest of the world andare considered to be native North American Phragmiteshaplotypes. Two other haplotypes were also found in NorthAmerica – haplotypes I and M.

Through genetic analysis of samples of Phragmitescollected and preserved in herbarium records prior to 1910,it was found that the 11 native haplotypes were historicallydistributed across North America, except for the southeast

D

North American Haplotypes

North AmericaEuropeAsia/AustraliaAfricaSouth AmericaNorth & South America, AsiaNorth & South America, Asia, Europe, Africa, New Zealand

A B

C H

AA F G

ES

ZY

V

PQ

RT

J

O

N

M

LU

KX

W

I

An exotic strain of Phragmites was probably introducedto North America from Europe, sometime during the earlypart of the 19th century, most likely at one or more coastalports along the Atlantic coast. Following several decadesof persisting in low densities, the distribution of thishaplotype rapidly expanded. This expansion was probablyfacilitated by human dispersal via the widespreadconstruction of railroads and major roadways across NorthAmerica in the late 19th and early 20th centuries.

Given the aggressive patterns of spread seen over thepast century, it is likely that the expansion of the introducedPhragmites (haplotype M) will continue to occur intowestern and northern parts of the continent. The presenceof native Phragmites lineages throughout these areas willonly complicate efforts to control this spread using currentmanagement techniques.1where Phragmites was not found. Haplotype I occurred

across the southern states and haplotype M was only foundat four sites on the north Atlantic coast (Fig. 2a).

Today, the 11 native haplotypes are still found acrossmuch of the continent, but their distribution on the northAtlantic Coast has become very rare. Haplotype I hasmaintained its historical distribution across the southernstates. In contrast, the introduced Phragmites (haplotypeM) has dramatically increased in distribution, dominatingpopulations across the continent (Fig. 2b).

IAN: www.ian.umces.eduDr. Kristin Saltonstall: ksalton@hpl.umces.edu

Prepared by Dr. Kristin Saltonstall & the IAN groupGraphics, design & layout by Tracey Saxby

FURTHER INFORMATION

SCIENCE COMMUNICATIONhttp://www.umces.edu

PRIMARY OBJECTIVES FOR IAN• Foster problem-solving using integration of scientific data and

information• Support the application of scientific understanding to forecast

consequences of environmental policy options• Provide a rich training ground in complex problem solving

and science application• Facilitate a productive interaction between scientists and the

broader community

The Integration and Application Network (IAN) is a collection ofscientists interested in solving, not just studying environmentalproblems. The intent of IAN is to inspire, manage and producetimely syntheses and assessments on key environmental issues,with a special emphasis on Chesapeake Bay and its watershed.IAN is an initiative of the faculty of the University of MarylandCenter for Environmental Science, but will link with otheracademic institutions, various resource management agenciesand non-governmental organizations.

Printed on 100% Recycled Paper

REFERENCES1. Saltonstall K. (2002) Cryptic invasion by a non-native genotype of Phragmites australis into North America. Proceedings of the National Academy of Sciences, USA 99:2445-24492. Chambers, R.M., L.A. Meyerson and K. Saltonstall (1999) Expansion of Phragmites australis into tidal wetlands of North America. Aquatic Botany 64:261-2733. Marks, M., B. Lapin and J. Randall (1994) Phragmites australis (P. communis): Threats, management and monitoring. Natural Areas Journal 14:285-2944. Meyerson, L.A., K. Saltonstall, L.M. Windham, E. Kiviat and S. Findlay (2000) A comparison of Phragmites australis in freshwater and brackish marsh environments in North America. Wetlands Ecology and Management 8:89-1035. Orson, R. (1999) A paleoecological assessment of Phragmites australis in New England tidal marshes: Changes in plant community structure during the last millenium. Biological Invasions 1:149-158

ACKNOWLEDGEMENTS

StemsIntroduced stems are typically green(but may have a little purple coloralong basal nodes.) Native stemshave some purple color where tissueis exposed and are often shiny.Black spots often appear late in thegrowing season on native stems.

Leaf collarsLeaf collars on the introduced varietyare always green, while leaf collarson native stems may be purple.

Leaf SheathsOn dead stems, the leaf sheaths onintroduced Phragmites remainattached. In comparison, leafsheaths on native stems are lost orvery loosely attached. This is thebest indicator based on morphologythat distinguishes native orintroduced Phragmites.

NativeIntroduced

The mid-Atlantic coast is unique in thatnative Phragmites persists today in manytidal marshes in the Chesapeake Bayregion, particularly along undisturbedcreeks and rivers. It typically grows inoligohaline marshes in mixed plantcommunities, where it may or may notbe the dominant plant species in thecommunity. However, at many sites,monocultures of introduced haplotype MPhragmites are present nearby. Thisposes a challenge for managers wishingto preserve native Phragmites and othernative species while controlling thespread of introduced Phragmites.

Differences between the two varietiesof Phragmites australis are visible, withthe introduced variety on the left and thenative variety on the right.

NativeIntroduced

SeaGrant Connecticut

Yale UniversityEPA Star Fellowship

Connecticut DEPLicence Plate Fund

Differences between introduced and native Phragmites are often very subtle,so morphology may not be the best way to distinguish between the two differentvarieties. However, there are some characteristics to look for in distinguishingthe different types, including:

CT Chapter